ORIGINAL ARTICLE Open Access

Identification and characterization of thefirst cytokinin glycosyltransferase from ricePan Li1,2†, Kang Lei1†, Yanjie Li2, Xingrui He1, Shuo Wang1, Renmin Liu1, Lusha Ji1* and Bingkai Hou2*

Abstract

Background: Cytokinins are one of the five major hormones families in plants and are important for their normalgrowth and environmental adaptability. In plants, cytokinins are mostly present as glycosides in plants, and theirglycosylation modifications are catalyzed by family 1 glycosyltransferases. Current research on cytokininglycosylation has focused on the biochemical identification of enzymes and the analysis of metabolites inArabidopsis. There are few studies that examine how cytokinin glycosylation affects its synthesis and accumulationin plants. It is particularly important to understand these processes in food crops such as rice (Oryza sativa);however, to date, cytokinin glycosyltransferase genes in rice have not been reported.

Results: In this study, we identified eight rice genes that were functionally homologous to an Arabidopsis cytokininglycosyltransferase gene. These genes were cloned and expressed in a prokaryotic system to obtain their purifiedproteins. Through enzymatic analysis and liquid chromatography-mass spectrometry, a single riceglycosyltransferase, Os6, was identified that glycosylated cytokinin in vitro. Os6 was overexpressed in Arabidopsis,and the extraction of cytokinin glycosides showed that Os6 is functionally active in planta.

Conclusions: The identification and characterization of the first cytokinin glycosyltransferase from rice is importantfor future studies on the cytokinin metabolic pathway in rice. An improved understanding of rice cytokininglycosyltransferases may facilitate genetic improvements in rice quality.

Keywords: Glycosyltransferase, Cytokinins, Gene cloning, Prokaryotic expression

BackgroundRice (Oryza sativa) is grown widely around the worldand is the main food for more than 50% of the globalpopulation (Ramegowda et al. 2014). In recent years,with an increasing populations and environmental deg-radation, the land suitable for rice cultivation has dimin-ished. To address these problems, the use ofbiotechnology to improve the stress resistance, yield andnutritional quality of rice is urgently required (Bansal etal. 2016). Cytokinins are important small molecule com-pounds, which are derivatives of adenine that occur nat-urally in plants (Plihalova et al. 2016). Cytokinins areone of the five major hormones found in plants, and areclosely related to other plant hormones. Cytokinins

affect plant growth and development (Zubo et al. 2017);including seed germination, chloroplast specialization,apical dominance, stress responses, cell differentiationand cell death. Therefore, the identification of the keyenzymes of the cytokinin synthesis pathway in rice couldbe valuable for biotechnological applications. By func-tionally identifying these genes, their roles in the synthe-sis and metabolism of rice cytokinins, as well as ingrowth and environmental adaptation, could be furtherinvestigated. Better understanding these processes couldlead to significant advances in the genetic improvementof rice yield and nutritional quality.The first naturally occurring cytokinin identified in

plants was zeatin, which was obtained from unripe cornendosperm (Frebortova et al. 2017). Later, as cytokininresearch progressed, more and more types of cytokininswere identified. The naturally occurring cytokinins inplants can be divided into isoprenoid and aromaticforms on the basis of the type of cytokinin side chain.

© The Author(s). 2019 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, andreproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link tothe Creative Commons license, and indicate if changes were made.

* Correspondence: jilu2060@163.com; bkhou@sdu.edu.cn†Pan Li and Kang Lei contributed equally to this work1College of Pharmacy, Liaocheng University, Liaocheng 252000, Shandong,China2College of Life Science, Shandong University, Qingdao 250000, Shandong,China

Li et al. Rice (2019) 12:19 https://doi.org/10.1186/s12284-019-0279-9

The molecular structures of the common active cytoki-nins were shown in Fig. 1 (Xu et al. 2017).There are many cytokinin synthesis pathways in plants

(Yamburenko et al. 2017). The pathways that have beenidentified to date can be divided into the transport RNA(Morrison et al. 2015) and de novo synthesis (Ciaglia etal. 2017). The transport RNA pathway produces too fewcytokinins to meet the growth needs of plants. There-fore, the de novo synthesis pathway is the generally ac-cepted main pathway for cytokinin synthesis. The denovo synthesis pathway also includes the adenosinemonophosphate (AMP) pathway, the ATP/ADP path-way, and the alternative pathway. In the AMP pathway,dimethyl propylene diphosphate (DMAPP):AMP isopre-nyltransferase catalyzes the transfer of an isopentylgroup from dimethyl propylene diphosphate to the N6position of AMP to produce a cytokinin with active pen-tyl adenosine-5-phosphate (iPMP) and isoamyladenosine

groups (Ashihara et al. 2018). In the ATP/ADP pathway,the IPT4 enzyme obtained from Arabidopsis thalianacan preferentially utilize ATP and ADP as substrates inthe presence of ATP, ADP and AMP. Isoprenoidadenosine-5-triphosphate andisoamyladenosine-5-diphosphate are possible reactionproducts of cytokinins, and can form zeatin through afurther one-step hydroxylation reaction (Yu et al. 2015).The alternative pathway is an iPMP-independent path-way that transfers the hydroxylated side chain to the N6site of adenine. This pathway was identified after it wasdiscovered that the precursor of trans-zeatin nucleosidephosphate was not primarily derived from iPMP (Kalte-negger et al. 2018).To date, studies of the cytokinin metabolic pathway

have focused on Arabidopsis. The cytokinin receptorsare three histidine kinases, AHK2, AHK3 and CYTOKI-NIN RESPONSE 1 (also known as AHK4) (Lomin et al.

Fig. 1 The molecular structure of common active cytokinins. a The molecular structure of Isoprenoid CKs. There are four forms of Isoprenoid CKs,N6-(Δ2-isopentenyl) adenine (iP), trans-zeatin (tZ), cis-zeatin (cZ), dihydrozeatin (DZ). b The molecular structure of Aromatic CKs. There are fiveforms of Aromatic CKs, ortho-topolin(oT),meta-topolin(mT),benzyladenine(BA),ortho-methoxytopolin(MeoT), meta-methoxytopolin(MemT)

Li et al. Rice (2019) 12:19 Page 2 of 11

2015). There are also more than 20 response regulatorsthat are associated with cytokinins. These Arabidopsis re-sponse regulators can be broadly classified into four types:A-type, B-type, and C-type as well as Arabidopsis pseu-doresponse regulators (Kurepa et al. 2014). In addition,the degradation of cytokinin mainly depends on the activ-ity of cytokinin oxidative dehydrogenase, which irrevers-ibly inhibits cytokinin degradation (Yeh et al. 2015; Xiaoet al. 2016). Morris et al. (1999) found that cytokinins areextensively degraded in the anthers and pollen of cytoki-nin oxidative dehydrogenase transgenic corn, which even-tually leads to male sterility during spore formation.In nature, cytokinin compounds are found mostly as

glycosides. Various cytokinin glycosides can be formedowing to differences in sugar types, attachment positionsand aglycones. Further modification of these groups pro-duces a wide variety of cytokinin compounds in natureand glycosylation is particularly important for this diver-sity (HIuska et al. 2016). Cytokinin glycosylation ismainly catalyzed by family 1 glycosyltransferases (GT1s)(Lao et al. 2014), which are conserved across differentplant species. GT1s transfers the active sugar donor,usually a UDP-glycosyl group, to the hydroxyl group ofthe substrate to form a cytokinin glycoside product.The cytokinin glycosides are still poorly understood.

However, cytokinin glycosyltransferase genes have beenstudied in Arabidopsis. For example, Hou et al. (2004)used molecular and biochemical methods to demonstratethat the Arabidopsis glycosyltransferase UGT76C2 cata-lyzes cytokinin glycosylation in vitro. There are many sub-strates that can be catalyzed by glycosyltransferases,including free-form trans-zeatin, cis-zeatin, dihydrozeatin,isopentenyl adenine, 6-benzyl adenine and kinetin. Afterglycosylation, these mitogens form their correspondingN-glycosides. In 2011, Wang et al. (2011) conducted ex-periments in vivo using Arabidopsis thaliana as themodel. They showed that UGT76C2 catalyzes cytokininglycosylation in plants and participates in the regulation ofcytokinins. The modifications made to cytokinins by gly-cosyltransferases may be considered as “fine tuning” thesynthesis, metabolism and function of these compounds.Glycosylation may affect the transport of cytokinins inplants, the normal growth and development of plants, thespecific distribution of cytokinins in tissues and cells, sig-nal transduction processes associated with these mole-cules, and upstream regulatory factors. Therefore,studying cytokinin glycosylation is of great significance forunderstanding the metabolic regulation of cytokinin com-pounds and for clarifying their physiological effects.Studies of cytokinin glycosyltransferase genes in rice

have not previously been reported. Here, we selectedeight candidate rice glycosyltransferase genes and foundthat one of these, Os6, encodes a protein that can glyco-sylate cytokinin in an in vitro enzymatic reaction, as

determined by liquid chromatography-mass spectrom-etry (LC-MS). We transformed Arabidopsis with Os6 toobtain homozygous transgenic lines overexpressing Os6.We examined these plants for growth and developmen-tal phenotypes, as well as analyzing their cytokinin syn-thesis, metabolic and signal transduction pathways. Thecandidate gene selected in this project, Os6, is the firstrice gene reported to glycosylate cytokinin. This worklays a good theoretical and practical foundation that,with the ongoing study of Os6, will improve our under-standing of cytokinin glycosyltransferase functions inrice. This should be beneficial for future genetic breed-ing approaches to improve rice quality.

ResultsScreening and identification of rice cytokininglycosyltransferase candidate genesThe complete rice genome of rice in now available throughthe rice genome database (http://rice.plantbiology.msu.edu).In 2008, Cao et al. constructed a phylogenetic tree of glyco-syltransferases in rice using bioinformatics methods andidentified 609 potential glycosyltransferase genes. Amongthem was GT1, which encodes the enzyme that transfersUDP-glucose. According to Cao’s prediction, the familyGT1 contains the largest number of genes (Cao et al. 2008).There are 8 and 41 genes with glycosyltransferase activityat the N- and O- positions, respectively, which may repre-sent glycosylated cell classifiers, and the phylogenetic treewas constructed using MEGA software based on the simi-larity information of these sequences (Fig. 2). In our study,we selected eight candidate genes capable of glycosylatingcytokinins, LOC_Os01g59100 (Os6), LOC_Os02g11130,LOC_Os07g30330, LOC_Os02g11700, LOC_Os07g30610,LOC_Os07g13800, LOC_Os11g25454 and LOC_Os07g13810. LOC_Os01g59100 corresponded to the gene referredto as Os6 in this study.

Spatiotemporal expression pattern of Os6 in WT rice andOs6 cloningTo investigate Os6 expression in rice, we isolated varioustissues and organs from WT rice plants at different de-velopmental stages. RNA was extracted and Os6 expres-sion was confirmed in various tissues and organs usingqRT-PCR. Os6 was widely expressed to different degreesin various tissues and organs (Fig. 3), with a relativelyhigh expression level in seedlings and a relatively low ex-pression level in mature leaves. Then, the rice glycosyl-transferase gene Os6 was successfully cloned from ricecDNA (Additional file 1: Figure S1a).

Construction of the prokaryotic expression vector and theOs6 protein’s activityAfter sequencing, the Os6 gene was cloned into a prokary-otic expression vector, PGEX (Additional file 1: Figure S1b).

Li et al. Rice (2019) 12:19 Page 3 of 11

To investigate the Os6 protein’s activity, we cloned the tar-get gene into the PGEX vector, and then transformed it intothe E. coli protein-expression strain XL1-Blue. Protein ex-pression was induced and confirmed by sodium dodecylsulfate-polyacrylamide gel electrophoresis (Fig. 4).

Rice glycosyltransferase Os6’s enzymatic reaction andsubstrate identificationTo investigate whether Os6 could glycosylate the planthormone cytokinin, we tested this enzymatic reaction invitro by mixing Os6 protein, cytokinin, buffer and

Fig. 2 Rice cytokinin glycosyltransferase phylogenetic tree. The phylogenetic tree was constructed using MEGA software based on the similarityinformation of these sequences

Li et al. Rice (2019) 12:19 Page 4 of 11

Fig. 3 Time and space expression pattern of Os6. In order to further understand the expression pattern of Os6, RNA was extracted from differenttissues and organs of the wild-type rice plants, then Reverse transcription into cDNA, detection of Os6 expression pattern by Real-Time PCR. 1:Seedling Root; 2: Seedling Stem; 3: Seedling Leaves; 4: Seedling Sheath; 5: Mature Root; 6: Mature Stem; 7: Mature Leaves; 8: Mature Flower; 9:Mature Endosperm; 10: dried seeds; 11: wet seeds

Fig. 4 The activity of the OS6 protein was obtained. In order to obtain the Os6 protein, the protein was extracted from protein expression strainand seperated by protein SDS-PAGE gel

Li et al. Rice (2019) 12:19 Page 5 of 11

UDP-glucose. The products of the reaction mixture wereexamined using HPLC, and Os6 can transfer glucose totwo cytokinins, trans-zeatin and 6-benzylaminopurine(Fig. 5a, b). The Arabidopsis glycosyltransferase geneUGT76C1 was used as a positive control. LC-MS wasused to confirm the presence of glycosylated cytokininsproduced by Os6 activity (Fig. 5c, d).

Evaluation of the Km values of Os6Having found that Os6 could glycosylate cytokinins,we qualitatively analyzed the Km values of these cyto-kinin reactions using HPLC (Table 1). The Km valuesfor Os6-mediated glycosylation of trans-zeatin and6-benzylaminopurine were similar to those ofUGT76C1.

Fig. 5 Rice glycosyltransferase OS6 enzymatic reaction and substrate identification. OS6 can transfer glucose to two cytokinins, trans-zeatin and 6-Benzylaminopurine, which were detected by HPLC and LC/MS mass spectrometry. a. Rice glycosyltransferase Os6 can glycosyl 6-BA by HPLC. b.Rice glycosyltransferase Os6 can glycosyl tZ by HPLC. c. Rice glycosyltransferase Os6 can glycosyl 6-BA by LC/MS. d. Rice glycosyltransferase Os6can glycosyl tZ by LC/MS

Li et al. Rice (2019) 12:19 Page 6 of 11

Os6 overexpression in ArabidopsisTo determine whether Os6 is functionally active inplants, we overexpressed Os6 in the model plant Arabi-dopsis. After three generations of screening, we obtained25 transgenic homozygous lines. RNA was extracted andreverse transcribed into cDNA, and the expression ofOs6 in each line was confirmed by qRT-PCR. Two highlyoverexpressing strains, OE4 and OE18, were selected forsubsequent experiments (Fig. 6a).

Cytokinin glycoside measurements in transgenicArabidopsisThe WT and transgenic Arabidopsis plants were grownunder normal conditions for 2 weeks, after which the cyto-kinins and their glycosides were extracted using an organicsolvent. Esculetin was used as an internal standard to quan-titatively analyze each line by HPLC. The cytokinin glyco-side content in the OE4 and OE18 overexpressing lines wasgreater than in the WT plants (Fig. 6b). Thus, the rice gly-cosyltransferase Os6 appears to glycosylate cytokinins inplanta, and Os6 may act in the cytokinin pathway.

DiscussionIn our research, first, we compared database informationbased on known conditions, and constructed a phylo-genetic tree based on sequence similarity using MEGAsoftware. The results are shown in Fig. 1. Owing to thelengths of the sequenced genes, the differences are large.The data analysis results showed obvious branches, butmost rice glycosyltransferase genes were not associatedwith the already published cytokinin glycosyltransferasegene UGT76C1 and UGT76C2 in Arabidopsis (Smehi-lova et al. 2016) (Additional file 1: Figure S2). In ourstudy, the eight studied rice cytokinin glycosyltransferasegenes were randomly selected.Because the other seven candidate genes are not glyco-

sylated cytokinins, only Os6 can glycosylate cytokinins.

Then, we compared the gene sequence of Os6 with thegenes of the Arabidopsis glycosyltransferase gene familymembers. However, there is no sequence homologous toOs6 in Arabidopsis. We also compared the sequence ofOs6 with the sequences of UGT76C1 and UGT76C2,and found that the similarity was ~ 40%. After the ana-lysis, we found that, in addition to the conserved 44amino acids at the C-terminus of glycosyltransferase,there are other highly similar gene sequences, and wespeculate that these sequences enable these genes to gly-cosylate cytokinins.Here, we cloned a glycosyltransferase gene from rice

and constructed a prokaryotic expression vector to pur-ify the active enzyme protein. After adequate incubation,an in vitro enzymatic reaction was detected by HPLC.The rice glycosyltransferase Os6 was able to glycosylatecytokinins. Glycosyltransferase proteins that can glycosy-late cytokinins have been described previously. In 2004,Hou et al. found that Arabidopsis UGT76C1 andUGT76C2 can glycosylate cytokinins (Hou et al. 2014);however, since then no new proteins have been reported.In this research, we identified a new protein, Os6, thatcan glycosylate cytokinins. The Km value of Os6 is simi-lar to that of UGT76C1. Therefore, we propose that Os6in rice has the same function as UGT76C1 in Arabidop-sis. In the future we will try to generate transgenic riceoverexpressing Os6 to study its function in rice.The glycosyltransferase Os6 is the first protein to be

identified from rice that can glycosylate cytokinins. Withthe completion of the rice genome, the functions ofmany rice genes have been determined. However, mostof the genes in the rice GT1 family have not yet beenidentified. There have been limited studies on cytokininsynthesis in rice and, in particular, the downstream path-way of cytokinin glycosylation. Moreover, there havebeen no new discoveries regarding cytokinin glycosyl-transferases in rice. In this project, we identified eightcandidate cytokinin glycosyltransferases genes and usedLC-MS to determine whether they were functionally ac-tive in glycosylating cytokinins. Our results will allow fu-ture researchers to investigate the role of the Os6cytokinin glycosyltransferase in rice.Os6 was overexpressed in Arabidopsis, and transgenic

lines were obtained through three generations of screen-ing. Measurements of the cytokinin glycosides producedby these transgenic lines showed that Os6 is functionallyactive as a glycosylase in plants. Thus, Os6 is part of thecytokinin metabolic pathway in plants. However, becausethis study was carried out in the model plant Arabidop-sis and involves heterologous expression, our resultsmay not be transferable to rice. Therefore, in future, weplan to examine the function of Os6 in transgenic rice.A spatiotemporal expression analysis of rice plants

showed that Os6 is highly expressed in young organs

Table 1 The Km values of OS6, which glycosylate trans-zeatinand 6-Benzylaminopurine

Substrates Specific activity (nkat/mg protein)

76C1 Os6

7-N 9-N 7-N 9-N

Trans-Zeatin 1.58 0.61 1.79 0.85

6-Benzylaminopurine 0.95 1.53 0.68 1.22

Li et al. Rice (2019) 12:19 Page 7 of 11

and in leaf sheaths. This suggests that Os6 may play aspecific role in these tissues. Transgenic rice overex-pressing Os6 will be useful for examining the growthand development of these parts and the distributions ofcytokinins.Cytokinins are one of the five main plant hormones and

play very important roles in plants (Larrieu et al. 2015).Here, we examined cytokinin glycosylation and the cytoki-nin contents in plants. However, cytokinins have import-ant relationships with other plant hormones, includingauxin and abscisic acid, that also affect growth and devel-opment (Li et al.2016). Therefore, research on these hor-mones may also prove to be important in the future.

ConclusionIn this study, we cloned the rice glycosyltransferase geneOs6, constructed a prokaryotic expression vector, andexpressed and purified the active enzyme protein in bac-teria. Using in vitro enzymatic reactions and LC-MS, wefound that Os6 can glycosylate cytokinins in vitro. Wethen overexpressed Os6 in Arabidopsis and extractedcytokinin glycosides from transgenic and WT plants.The transgenic Arabidopsis plants had increased cytoki-nin glycosides in comparison with the WT-plants, indi-cating that Os6 can also glycosylate cytokinins in plantaand may be involved in the cytokinin pathway of rice.

MethodsPlant materials and growth conditionsThe rice Nipponbare ecotype was used in this study. In-tact and uniformly sized rice grains were surface sterilizedwith 75% ethanol for 2 min, 0.1% mercuric chloride solu-tion for 3min, and then washed 3–4 times with sterilewater. The seeds were placed in sterile culture bottles con-taining a small amount of water for 3 d until germination.

The seedlings were then transferred to plastic pots andgrown in a greenhouse at 30 °C with natural light (12 hlight and 12 h dark).Arabidopsis ecotype Columbia was used as a plant

model in this study. Mature intact wild-type (WT) seedswere sterilized with 0.1% Hg for 2 min, 75% alcohol for3 min, and then rinsed 3–5 times with sterile water. Theseeds were placed in Murashige and Skoog medium, ver-nalized at 4 °C in the dark for 3 d, and then germinatedin a culture chamber at 22 °C with 16 h light (100 μmolm− 2 s− 1) and 8 h dark for 2 weeks. The seedlings werethen transplanted to small pots containing soil andgrown under culture chamber conditions as described.

RNA extraction and reverse transcriptionFor the RNA extraction, young WT rice plants at thetwo-leaf and one-heart stage were ground to a powderin liquid nitrogen and 1mL of TRIzol reagent was addedper 0.2 mg of powder. The sample was then mixed by in-version and, after standing for 5 min, 200 μL phenolchloroform was added. The sample was vortexed to de-nature the plant proteins and, after standing for 5 min,was centrifuged at 13,400×g for 5 min at 4 °C. The super-natant was transferred to a new centrifuge tube, an equalvolume of isopropanol was added, and the sample wasmixed by inversion. After standing for 10 min, the sam-ple was again centrifuged for 5 min at 4 °C, the super-natant discarded, and 1mL of 75% ethanol was added.The flocculated precipitate was washed, and then centri-fuged at 13,400×g for 1 min at 4 °C. The ethanol was dis-carded, the sample was centrifuged at 13,400×g for 1min at 4 °C and the liquid carefully removed using a20-μL pipette. The sample was air dried at roomtemperature for 5 min and 20–50 μL DEPC water wasadded to dissolve the nucleic acids. Samples were stored

Fig. 6 Overexpression Os6 into Arabidopsis and determination their cytokinin glycosides. Overexpression of rice glycosyltransferase gene Os6 intoArabidopsis and determination of cytokinin glycosides in transgenic Arabidopsis. a. The relative expression of Os6 in Arabidopsis. b. The contentof cytokinin glycosides in transgenic Arabidopsis

Li et al. Rice (2019) 12:19 Page 8 of 11

at − 20 °C until required. For the reverse transcription, areverse transcription kit (TaKaRa, Japan) was used ac-cording to the manufacturer’s protocol.

Quantitative RT-PCRFor the first step of the quantitative real-time PCR(qRT-PCR), total RNA was extracted from 2-week-oldrice plants using TRIzol reagent. For the second step, re-verse transcription from RNA to cDNA, a PrimescriptRT reagent kit (TransGen, TaKaRa) was used. A 20 μLreaction volume was used for the qRT-PCR, which wasperformed using a Bio-Rad real-time thermal cyclingsystem. SYBR-Green (TaKaRa) was used to detect quan-titative gene expression, with ubiquitin used as an in-ternal control. The data were analyzed using Bio-RadCFX Manager software. The primer information is in-cluded in Additional file 2: Table S1.

Plasmid construction and plant transformation

(1) Candidate gene cloning. RNA was extracted from WTrice and reverse-transcribed into cDNA. Candidategene sequences were amplified using the primersF:CGCGGATCCATGACAGCACCGATGAC andR:CGGGGTACCCTAGTGTTCTTCCACTC, whichwere designed using the sequences available on therice genome website. After amplification, the candidategene fragment was ligated into an intermediate carrierand its sequence was confirmed by sequencing.

(2) Construction of prokaryotic expression vectorscontaining candidate genes. To facilitate cloning wemodified a common prokaryotic expression vector,PGEX-2 T (Zhang et al. 2008), by inserting a multiple-cloning site between the BamHI and EcoRI restrictionsites (BamHI-NdeI-NotI-SphI-NcoI-SalI-SacI-XhoI-HindIII-EcoRI) and renamed the vector pGEX-3H.Each rice gene was individually cloned into pGEX-3Hand the plasmid isolated. After verification by sequen-cing, the plasmid was transformed into the Escherichiacoli expression strain XL1-Blue, to express the fusionprotein OS6-glutathione S-transferase.

Purification of cytokinin glycosyltransferase protein andin vitro cytokinin glycosyltransferase enzymatic reactions

(i) Protein expression was induced in XL1-Blue by in-cubating the bacteria overnight at 37 °C and thenculturing them to an OD600 = 0.8–1.0 at 20 °C withshaking at 180 rpm. Isopropyl β-D-thiogalactosidewas added to induce the expression of the proteinencoded by the rice gene. (ii) To isolate the targetprotein, the bacterial cells were collected by centri-fugation at 5000×g for 10 min at 4 °C. The cellswere resuspended in phosphate buffer saline and

disrupted by sonification. The solution was appliedto a column to isolate the target protein using itsglutathione S-transferase tag. A protease was usedto elute the protein and obtain a high purity levelfor the enzyme activity analysis. (iii) For the in vitroenzymatic reactions, 2 μg UGT-purified protein wasadded to a 100-μL reaction mixture containing 1mM cytokinin, 5 mM UDP-glucose, 50 mMN′-α-hydroxythylpiperazine-N′- ethanesulfanic acid buf-fer (pH 7.0) and 14.4 mM 2-mercaptopethanol andincubated at various temperatures for different reac-tion times.

High-performance liquid chromatography (HPLC)detection of substrates and (Km) value determinationsAfter the enzymatic reaction, the mixture was filter-sterilizedand added to a 5-μm C18 HPLC column (150 × 4.6mm Zor-bax; Agilent, USA) and gradient-eluted at room temperature.Phase A was a filter-sterilized organic solvent in methanoland Phase B was a filter-sterilized 0.1% phosphoric acidaqueous solution. These were applied to the column as fol-lows: 90% Phase A and 10% Phase B for 22min, 35% PhaseA and 65% Phase B for 25min, and 90% Phase A and 10%Phase B for 35min. An HPLC spectrophotometer (Shi-madzu, Japan) was used with a D2 and set to a 270-nm de-tection wavelength. For the MS, we used a ShimadzuLC-MS system. The column used was the same as that usedfor the LC. The Phase A solution was still methanol, whilethe Phase B solution was 0.1% formic acid. The heater wasset to 180 °C and the mass spectrometer was operated with apositive electrospray ionization mode of 50 eV and a 5.0-kVprobe voltage. Data acquisition and analysis was performedusing Xcalibur software (version 2.0.6).To calculate the Km of the glycosyltransferase and its sub-

strate, a Michaelis-Menten kinetic analysis was performed.We used the same reaction system as described above. Thereaction was performed in a 30 °C water bath for 1, 5, 10,15, 20, 30, 40, 60, 90, 120 and 180min. Reactions weresnap-frozen in liquid nitrogen and either used immediatelyfor HPLC or were stored at 20 °C until required.To determine the kinetic constants, nine concentration

gradients were prepared using substrate concentrations of0–1mM, 0.025mM, 0.05mM, 0.075M, 0.1mM, 0.15mM,0.2mM, 0.4mM, 0.6mM, 1.0mM or 2 μg/mL. The pro-teins being tested were incubated with the substrate and 5mM UDP-glucose in the optimum buffer at the optimumpH, temperature and time. The final HPLC results were an-alyzed and the most suitable Km and maximum rate (Vmax)values were calculated from the kinetic equations.

Generation of transgenic Arabidopsis and cytokininextractionTo generate the Os6 overexpression lines, we cloned thefull-length Os6 cDNA from rice into the pBI121 binary

Li et al. Rice (2019) 12:19 Page 9 of 11

vector, which is driven by the CaMV35S promoter. Thiswas then transformed into to the Agrobacterium tumefa-ciens GV3103 strain. Strain GV3103 containing the riceglycosyltransferase gene Os6 was activated and grown toa concentration of approximately OD600 = 0.8. The cellswere collected by high-speed centrifugation at 13,400×gfor 10 min at 4 °C and diluted in 1% sucrose to OD600 =0.1. Then, the Silwet L-77(GE, Beijing) activator wasadded, and the bacterial solution was used for in planttransformations at room temperature. WT Arabidopsisplants at 4–5 weeks of age were selected for transform-ation because of their vigorous growth and stage (flower-ing) in which the stem is 1 cm in length but the antherhas not yet grown. The flower buds were dipped into theAgrobacterium GV3103 solution for 15 s three times. Theplants were then covered with black cloth for 24 h to allowinfection to occur. After flower maturation and seed for-mation, the seeds were collected, and transformants wereselected on medium containing kanamycin. Homozygoustransgenic Arabidopsis plants overexpressing Os6 wereobtained after three generations of antibiotic selection.To extract cytokinins from the plant tissues,

2-week-old WT and transgenic Arabidopsis plants wereindependently ground in liquid nitrogen. Then, 80%methanol solution was added, and the samples weremixed by inversion at 4 °C for 24 h. The mixtures werecentrifuged at 13,400×g for 10 min and the supernatantwere collected. The mitogen glycoside solutions wereisolated using the described cytokinin HPLC protocol,with UGT76C1 as a positive control.

Additional files

Additional file 1: Figure S1. Cloning and Construction of theProkaryotic Expression Vector. The cloning of Rice Glycosyltransferasegene OS6 and the constructing of its prokaryotic expression vetor. A.Cloning Rice Glycosyltransferase gene Os6 from rice gene data bank. B.Constructing of prokaryotic expression vetor of rice glycosyltransferasegene Os6. Figure S2. Phylogenetic tree comparison of UGT76C1 andUGT76C2 with rice cytokinin glycosyltransferase. To further understandthe distant relationship of the rice glycosyltransferase phylogenetic tree,we compared the glycosyltransferase UGT76C1 and UGT76C2, which hasbeen shown to be a glycosyl cytokinin in Arabidopsis, to the predictedcytokinin glycosyltransferase phylogenetic tree in rice. (DOCX 9898 kb)

Additional file 2: Table S1. Primers used in this study. (DOC 31 kb)

AbbreviationsAPRRs: Arabidopsis pseudoresponse regulators; ARRs: Arabidopsis responseregulators; CKX: Cytokinin oxidative dehydrogenase; CRE1: Cytokininresponse 1; DMAPP: Dimethyl propylene diphosphate; GST: Goods andServices Tax; GT1: Family 1 glycosyltransferases; HEPES: N′-ɑ-hydroxythylpiperazine-N′-ethanesulfanic acid; iPA: Isoamyladenosine;iPDP: Isoamyladenosine-5-diphosphate; iPMP: Adenosine-5-phosphate;IPTG: Isopropyl β-D-Thiogalactoside; iPTP: Isoprenoid adenosine-5-triphosphate; LC-MS: Liquid chromatography-mass spectrometry;MS: Murashige and skoog; PBS: Phosphate buffer saline; qRT-PCR: Quantitative real-time PCR; RT: Room temperature; SDS-PAGE: Sodiumdodecyl sulfate polyacrylamide gel electrophoresis; tRNA: Transport RNA;WT: Wild-type; ZMP: Trans-zeatin nucleoside phosphate

AcknowledgmentsThis project was supported by grants from the National Natural ScienceFoundation of China (Grant No. 21675071 and 31701827), the NaturalScience Foundation of Shandong Province Mayor (China, ZR2017CM009),and the Shandong Province Science and Technology Development Plan(J12LE07). We thank Dr. Jennifer Smith, and Dr. Shelley Robison from LiwenBianji, Edanz Group China (www.liwenbianji.cn/ac), for editing the Englishtext of a draft of this manuscript.

FundingThis project was supported by grants from the National Natural ScienceFoundation of China (Grant No. 21675071 and 31701827), the Natural ScienceFoundation of Shandong Province Mayor (China, ZR2017CM009), and theShandong Province Science and Technology Development Plan (J12LE07).

Availability of data and materialsThe detail data of the primers used for plasmid construction were list inAdditional file 2: Table S1. The rice genome sequences were downloadedfrom the rice website http://rice.plantbiology.msu.edu.

Authors’ contributionsPL, KL and YJL conceived and designed the experiment. PL, KL and RMLconducted the experiments, performed data analysis and wrote themanuscript. XRH and SW participated in material development, samplepreparation and data analysis. SLJ and BKH drafted proposals and correctedthe manuscript. All authors read and approved the final manuscript.

Authors’ informationBK H, Professor in Plant Molecular Genetics, College of Life Science,Shandong University, China.RM L, Professor and Head of the Instrument Analysis Lab, College ofPharmacy, Liaocheng University, China.LS J, Professor in Plant Molecular Biology, College of Pharmacy, LiaochengUniversity, China.P L, Ph D in Plant Molecular Genetics, College of Pharmacy, LiaochengUniversity, China; College of Life Science, Shandong University, China.K L, Ph D in Agronomy, College of Pharmacy, Liaocheng University, China.YJ L, Ph D in Plant Molecular Genetics, College of Life Science, ShandongUniversity, China.XR H, Ph D in Chemistry, College of Pharmacy, Liaocheng University, China.S W, Ph D in Toxicology, College of Pharmacy, Liaocheng University, China.

Ethics approval and consent to participateNot applicable.

Consent for publicationNot applicable.

Competing interestsThe authors declare that they have no competing interests.

Publisher’s NoteSpringer Nature remains neutral with regard to jurisdictional claims inpublished maps and institutional affiliations.

Received: 6 December 2018 Accepted: 21 March 2019

ReferencesAshihara H, Stasolla C, Fujimura T, Crozier A (2018) Purine salvage in plants.

Phytochemistry 147:89–124Bansal M, Sharma M, Kanwar P, Goyal A (2016) Recent advances in proteomics of

cereals. Biotechnol Genet Eng Rev 32(1–2):1–17Cao PJ, Bartley LE, Jung KH, Ronald PC (2008) Construction of a rice

glycosyltransferase phylogenomic database and identification of rice-diverged glycosyltransferases. Mol Plant 1(5):858–877

Ciaglia E, Abate M, Laezza C, Pisanti S, Vitale M, Seneca V, Torelli G, FranceschelliS, Catapano G, Gazzerro P, Bifulco M (2017) Antiglioma effects of N6-isopentenyladenosine, an endogenous isoprenoid end product, through thedownregulation of epidermal growth factor receptor. Int J Cancer 140(4):959–972

Li et al. Rice (2019) 12:19 Page 10 of 11

Frebortova J, Plihal O, Florova V, Kokas F, Kubiasova K, Greplova M, Simura J,Novak O, Frebort I (2017) Light influences cytokinin biosynthesis and sensingin Nostoc(cyanibacteria). J Phycol 53(3):703–714

HIuska T, Dobrew PI, Tarkowska D, Frebortova J, Zalabak D, Kopecny D, Plihal O,Kokas F, Briozzo P, Zatloukal M, Motyka V, Galuszka P (2016) Cytokininmetabolism in maize: novel evidence of cytokinin abundanceinterconversions and formation of a new trans-zeatin metabolic product witha weak anticytokinin activity. Plant Sci 247:127–137

Hou BK, Lim EK, Higgins GS, Bowles DJ (2004) N-glucosylation of cytokinins byglycosyltransferases of Arabidopsis thaliana. J Biol Chem 279(12):47822–47832

Kaltenegger E, Leng S, Heyl A (2018) The effects of repeated whole genomeduplication events on the evolution of cytokinin signaling pathway. BMCEvol Biol 18(1):76

Kurepa J, Li Y, Smalle JA (2014) Cytokinin signaling stabilizes the responseactivator ARR1. Plant J 78(1):157–168

Lao J, Qikawa A, Bromley JR, Mclnerney P, Suttangkakul A, Smith-Moritz AM,Plahar H et al (2014) The plant glycosyltransferase clone collection forfunctionalgenomics. Plant J 79(3):519–527

Larrieu A, Vernoux T (2015) Comparison of plant hormone signalling systems.Essays Biochem 58:165–181

Li G, Ma J, Tan M, Mao J, An N, Sha G, Zhang D, Zhao C, Han M (2016)Transcriptome analysis reveals the effects of sugar metabolism and auxinand cytokinin signaling pathways on root growth and development ofgrafted apple. BMC Genomics 17:150

Lomin SN, Krivosheev DW, Steklow MY, Arkhipov DV, Osolodkin DI, Schmulling T,Romanov GA (2015) Plant membrane assays with cytokinin receptorsunderpin the unique role of free cytokinin bases as biologically activeligands. J Exp Bot 66(7):1851–1863

Morris RO, Bilyeu KD, Laskey JG, Cheikh NN (1999) Isolation of a gene encoding aglycosylated cytokinin oxidase from maize. Biochem Bioph Res Co 255(2):328–333

Morrison EN, Knowles S, Hayward A, Thorn RG, Saville BJ, Emery RJ (2015)Detection of phytohormones in temperate forest fungi predicts consistentabscisic acid production and a common pathway for cytokinin biosynthesis.Mycologia 107(2):245–257

Plihalova L, Vylicilova H, Dolezal K, Zahajska L, Zatloukal M, Strnad M (2016)Synthesis of aromatic cytokinins for plant biotechnology. New Biotechnol33(5):614–624

Ramegowda V, Basu S, Krishnan A, Pereira A (2014) Rice GROWTH UNDERDROUGHT KINASE is required for drought tolerance and grain yield undernormal and drought stress conditions. Plant Physiol 166(3):1634–1645

Smehilova M, Dobruskova J, Novak O, Takac T, Galuszka P (2016) Cytokinin-specific glycosyltransferases possess different roles in cytokinin homeostasismaintenance. Front Plant Sci 7:1264

Wang J, Ma XM, Kojima M, Sakakibara H, Hou BK (2011) N-glucosyltransferaseUGT76C2 is involved in cytokinin homeostasis and cytokinin response inArabidopsis thaliana. Plant Cell Physiol 52(12):2200–2213

Xiao GQ, Qin H, Zhou JH, Quan RD, Lu XY, Huang RF, Zhang HW (2016) OsERF2controls rice root growth and hormone responses through tuningexpression of key genes involved in hormone signaling and sucrosemetabolism. Plant Mol Biol 90(3):293–302

Xu Y, Burgess P, Huang B (2017) Transcriptional regulation of hormone-synthesis andsignaling pathways by overexpressing cytokinin-synthesis contributes to improveddrought tolerance in creeping bentgrass. Physiol Plantarum 161(2):235–256

Yamburenko MV, Kieber JJ, Schaller GE (2017) Dynamic patterns of expression forgenes regulating cytokinin metabolism and signaling during riceinflorescence development. PLoS One 12(4):e0176060

Yeh SY, Chen HW, Ng CY, Lin CY, Tseng TH, Li WH, Ku MS (2015) Down-regulation of cytokinin oxidase 2 expression increases tiller number andimproves rice yield. Rice 8(1):36

Yu D, Yu F, Du C, Li X, Zhao X, Liu X (2015) RPN1a, a subunit of the 26Sproteasome, controls trichome development in Arabidopsis. Plant PhysiolBiochem 88:82–88

Zhang H, Ohyama K, Boudet J, Chen Z, Yang J, Zhang M, Muranaka T, Maurel C, ZhuJK, Gong Z (2008) Dolichol biosynthesis and its effects on the unfolded proteinresponse and abiotic stress resistance in Arabidopsis. Plant Cell 20(7):1879–1898

Zubo YO, Blakley IC, Yamburenko MV, Worthen JM, Street IH, Franco-Zorrilla JM,Zhang W, Hill K, Raines T, Solano R, Kieber JJ, Loraine AE, Schaller GE (2017)Cytokinin induces genome-wide binding of the type-B response regulatorARR10 to regulate growth and development in Arabidopsis. Proc Natl AcadSci U S A 114(29):E5995–E6004

Li et al. Rice (2019) 12:19 Page 11 of 11