identification and characterization of the alc gene product of

Copyright 0 1984 by the Genetics Society of America

IDENTIFICATION AND CHARACTERIZATION OF T H E ALC

GENE PRODUCT O F BACTERIOPHAGE T 4

ELIZABETH KUTTER,* ROLF DRIVDAHL* AND KEITH RAND‘

*The Evergreen State College, Olympia, Washington 98505, and +MRC Laboratory of Molecular Biology, Cambridge CB2 ZQH, England

Manuscript received February 13, 1984 Revised copy accepted June 14, 1984

ABSTRACT

Bacteriophage T4 infection rapidly and almost completely inhibits transcription of host and other phage DNAs. Two processes have been implicated to date in this inhibition: (1) ADP ribosylation of the a subunits of the RNA polymerase, involving gpalt (which is injected with the phage DNA) and, later, gpmod; and (2) the action of the T 4 alclunf gene product, synthesized immediately after infection. The latter unfolds the host genome and also blocks transcription of cytosine-containing DNA. Here, we describe the identification on two-dimensional polyacrylamide gels of gpalclunf, the more precise mapping of the gene and the identification and analysis of the appropriate DNA sequence from an Unf+ alc mutant.

HE DNA of bacteriophage T 4 normally contains glucosylated 5-hydroxy- T methylcytosine rather than cytosine (WYATT and COHEN 1953; LEHMAN and PRATT 1960). This modification renders the T 4 DNA insensitive to most known restriction enzymes and also allows T 4 to distinguish between its own DNA and that of the host for purposes of transcription and host DNA degrada- tion.

The processes involved in host inactivation have been studied in some detail by developing T 4 strains (termed T4dC) that contain cytosine in their DNA, as summarized by KUTTER and SNYDER (1983). Such strains, which lack the T4- directed dCTPase and endonuclease IV, normally make no progeny phage, due to a total block in synthesis of their late proteins (KUTTER et al. 1975). Pseudo- revertants with normal patterns of late-protein synthesis define a new gene, alc (allows late proteins from C-DNA) (SYNDER, GOLD and KUTTER 1976). The product of this gene also can affect transcription of T 4 early genes from T4dC infecting phage (KUTTER et al. 1981) and of lambda late genes (PEARSON and SNYDER 1980) and probably plays a role in the shutoff of host transcription ($ SNUSTAD, SNYDER and KUTTER 1983). The same gene product is required for the unfolding of the host nucleoid (“unf”) after T 4 infection (TIGGES, BURSCH and SNUSTAD 1977; SIROTKIN, WEI and SNYDER 1977). However some alc mutants still unfold the nucleoid; it is not yet clear whether the alclunf gene product (gpalclunf) has two different active sites or whether the function of a single site is only partially impaired.

Genetics 108: 291-304 October, 1984.

292 E. KUTTER, R. DRIVDAHL AND K. RAND

We describe here the identification of the alclunf gene product on two- dimensional polyacrylamide gels, the nature of some of the mutant proteins and the identification of the DNA sequence coding for the gpalclO mutant, which is Unf'. The protein sequence deduced from the open reading frame has some interesting features which may suggest aspects of gpalc's function. Future analysis of various mutants should help answer questions about the mechanism of action of this interesting protein and the relationship between the unfolding and transcription-inhibiting functions.

MATERIALS AND METHODS

Bacterial and bacteriophage strains: Escherichia coli K803 (supE rK-mK-) (WOOD 1966) was used for growing most phage stocks and for plating. E. coli B834 (sup0, met- rb-mb-) was used for producing C-containing phage and for protein labeling. For sequencing, DNA was prepared from phage grown in E. coli B834galU- (RUNNELS and SNYDER 1978). The phage vector used was M13mp8, described by MESSING and VIEIRA (1982).

Table 1 indicates the genotypes and sources of the various T 4 alclunf mutant phage strains used. Multiple mutants are routinely designated in this paper by listing the affected proteins within square brackets. Phage deletion strain (39-56)12 is described by HOMYK and WEIL (1974) and farP13 by CHASE and HALL (1975). The wild-type phage used, T4D, was originally obtained from JOHN WIBERG.

Media: All media used were described by MORTON, KUTTER and GUTTMAN (1978). Bacteria were grown and infected at 37" in M-9 medium, supplemented with 0.1% casamino acids except in those experiments involving incorporation of radioactive amino acids.

Enzymes and chemicals: All restriction enzymes were from New England Biolabs. DNA polymerase (Klenow) and calf intestinal alkaline phosphatase were purchased from Boehringer; T 4 DNA polymerase was purchased from P-L Biochemicals, Inc. T4 DNA ligase came from New England Biolabs or was a gift of DAVID BENTLEY.

Protein labeling and gel electrophoresis: E. coli B834 was grown in M-9 medium to about 5 X 10' cells/ml. Tryptophan was added to 0.02 mg/ml, followed by phage at a multiplicity of about 12 particles/cell. Phage were labeled with 2.5 pCi/ml of I4C-mixed amino acids (1.88 mCi/mg, from Schwarz/Mann) at 3 and again at 5.5 min after infection at 37". At 8 min after infection cold casamino acids were added to 1% final concentration. Two minutes later, cells were chilled and collected by centrifugation for 15 min at 3000 X g .

The method of sample preparation and running of the first-dimension nonequilibrium pH gradient electrophoresis (NEPHGE) gels was virtually identical with method 3 of BURKE et al. (1983), an adaptation of that described by O'FARRELL, GOODMAN and O'FARRELL (1977), with the gel run for 1600-V hr. For the second dimension, the cylindrical first-dimension gels were loaded in 1 ml of 1% agarose (dissolved in SDS sample buffer) onto the top of a 10-17% SDS-polyacrylamide gradient gel. They were run and processed in the standard fashion, including fixing in 50% TCA, drying and autoradiographing (see LAEMMLI 1970). Size estimation was on the basis of comparison with identified, well-characterized T4 proteins (4 MOSIG 1983), some of which have been sequenced.

Heteroduplex mapping: The method used was an adaptation of that described by DAVIS, SIMON and DAVIDSON (1971). The denatured DNA was prepared directly from a mixture of the two phage stocks, each at a concentration of 2 X 10"/ml (in 0.1 M NaCI, 0.01 M MgS04, 0.01 M Tris, pH 8.5); we simultaneously lysed the phage particles and denatured the DNA by adding NaOH to 0.1 M and EDTA to 0.01 M. After 10 min at room temperature, Tris-HCI was added to 0.2 M and Tris base to 0.02 M, and formamide was added to 10% final concentration. The mixture was then dialyzed for 1 hr against 0.9 M NaCI, 0.1 M Tris, pH 8.5, 0.01 M EDTA, in 60% formamide. The DNA was then diluted 1 : l O into a mixture of cytochrome c (50 pglml), 0.1 M Tris, pH 8.5, 0.01 M EDTA and 40% formamide, spread on freshly prepared Parlodion-coated grids, stained 30 sec in 5 X M uranyl acetate, rinsed 10 sec in isopentane and shadowed and examined the same day. DNA molecules were measured using an electronic planimeter, courtesy of CHOU and BROKER, directly from a projected image of the negative. 6x174 phage DNA that had been included in the spread was used as the size standard for the calculations.

BACTERIOPHAGE T4 ALC GENE PRODUCT

TABLE 1

Phage strains

293

Mutations

gene 56 gene 42 den B den A Alc strain dCTPase HMase endo IV endo I1 pseT/cd Reference

alclO amE5 I + ArIIH23 nd28 + (1) JW800(aIc10) amE5l amN55 a 0 2 a 2 3 nd28 + (2) alcGT7 amE51 amC87 ArIINE3034 + + (3) unf39 + + + + +” (4) alcD22 amE5I + ac saA9 nd28 + (5)

(5) alcD32 amE51 + ac saA9 nd28 - (1) pseTAI amE5 I + ArIIDD2 + (1) pseTA3 amE5 I + ArIIDD2 +

- -

a gppseT mobility altered on gel (see Figure 2). References: (1) SNYDER, COLD and KUTTER (1976); “rIIDD2” is a pair of deletions, rEM 6 6 (r lIA-) and rPB296 (rlIE-, denE-). (2) CLARK, WEVER and WIBERC (1980); (3) WILSON, TANYASHIN and MURRAY (1977); (4) SNUSTAD et al. (1976); (5) E. KUTTER and B. GUTTMAN (unpublished data). These are constructed using only T4D strains, whereas the other alc strains are T4D-T4B hybrids.

Preparation of cytosine-containing T 4 DNA fragments: T4dC strain JW800 was grown in E. coli B834GalU-. Phage were precipitated with 6% polyethylene glycol (YAMAMOTO et al. 1970) and further purified by CsCl density-gradient centrifugation. After three phenol extractions, the DNA was ethanol precipitated, washed in 70% ethanol and redissolved in 10 mM Tris-Cl, pH 7.4, 0.1 mM EDTA. The DNA was fragmented either with BglIl or with a combination of Hind111 and PstI, since well-resolved 8.2-kb EglII and 9-kb HindIII-PstI fragments cover the desired region (O’FARRELL, KUTTER and NAKANISHI 1980; MILEHAM, REVEL and MURRAY 1980). The fragments were separated on 0.8% agarose gels, and one of two methods was used for isolating the desired fragment from the gel. In the first, LGT agarose (Sea Plaque) was used for the electrophoresis. Gel slices were melted at 65”. Two volumes of 10 mM Tris-HCI (pH 7.4), 0.1 mM NaZEDTA were added and the agarose was removed by three phenol extractions. Sodium acetate was added to 0.3 M, and DNA was ethanol precipitated (sometimes after addition of carrier tRNA). The precipitate was washed in 70% ethanol before redissolving in 10 mM Tris-HCI (pH 7.4), 0.1 mM EDTA. In the second method, HGT agarose (Seakem) was used, and DNA was electroeluted (MCDONELL, SIMON and STUDIER 1977; CHOUIKH, VOLOVITCH and YOT 1979).

DNA sequencing: The sonication, end repair and size fractionation of DNA fragments were carried out by the methods of DEININCER (1 983) except that the sonicator was from Heat Systems-Ultrasonics, Inc. (model W-375). The resulting fragments [200-600 base pairs (bp) long] were ligated to M13mp8 replicative form DNA that had been cut with SmaI and treated with calf intestine alkaline phosphatase. Transfection initially was performed by the method of DACERT and EHRLICH (1979), but later work used the improved protocol of HANAHAN (1983). Growth of clones was as described by SANCER et al. (1980) except that E. coli JM103 (MESSING, CREA and SEEBURC 1981) was used in place ofJM101 as the host strain. Sequencing with chain-terminating inhibitors (SANCER, NICKLEN and COULSEN 1977) and preparation of buffer gradient gels were carried out as described (for y-”P-dATP) by BIGCIN, GIBSON and HONC (1 983). DNA sequences were compiled and analyzed using the computer programs of STADEN (1 980, 1982). The most likely translational initiation sites were deduced using a computer program based on the data of STORMO et al. (1 982).

RESULTS

Gel Identajication ofgpalc/unf: We have now identified gpalc as a neutral protein with a molecular weight of about 18,000-20,000 daltons, as indicated in Figure 1 . This protein spot is missing in all aZc/unf mutants examined to date, whereas

294 E. KUTTER, R. DRIVDAHI. AND K. RAND

-G- -

-46

52 - e1 -0- - -

FIGURE 1 .-Two-dimensional gel electrophoresis of T4D* proteins labeled 3-8 min after infection of E. coli BR34 at 37'. laheled spots include both those identified in this laboratory and tl~ose identified by BURKE et al. (1983). The spots laheled "P" we find to be missing in deletion mutants psrTA1 and A3 and alcD32. as are the proteins PSET and ALC and one additional very sniall acidic protein lost from the bottom of this particular gel. Those labeled 'D" and 'F" are aniong the proteins missing in deletion mutants (39-56)1* (HOMYK and WEIL 1974) and f a r P l 3 (CHASE and HAtL 1975). respectively (K. D'ACCI. E. KUTTER and R. DRIVDAHL. unpublished results). "H" is RNase H and "X" and 'Y" are uus X and Y, respectively (BURKE cl al. 1983).

it is present in their parents. Figure 2 shows the pattern of proteins produced by an extensively backcrossed unf39X5 strain, which was not known to carry any mutations in addition to that in alclunf. T h e protein we have identified as gpulcl unf is missing, whereas a somewhat smaller, more basic protein appears, which we believe is the altered gene product made by the unf39X5 mutant. In a number of other alclunfstrains, similar new spots appear to replace the putative pic/ u n . it is the Same size as the wild-type gpalc but slightly more basic in alcGT7 and in alclO (inset), for example, and significantly smaller and more basic in alcD22. N o nonsense mutants have been isolated in the alclunf gene; HERMAN, HAAS and SNUSTAD ( 1 984) discuss the fact that such mutants a re likely to be rare because no codons a re used that a re related to amber codons by transitions, and only a few are related by transversions. Size-altering mutations such as unf39X5 and alcD22 could involve small deletions, which might shift the reading frame so that a termination signal was then encountered, but mapping data do not

BACTERIOPHAGE T4 A I L GENE PRODUCT 295

- - a

0 --

60 GI'

0

*- e

P

e -. 60

c

FIGURE 2.--Gel of proteins from alclunf mutant unf3YX5: conditions are identical with those in Figure I . Symbols used are: thin arrow. the nornral position of gpalc; open arrowhead. the new spot that is apparently the altered gpalc; closed arrowheads, the only two other differences ob- wrvrd Iwtwren unf3Y and T4W. The PstT protein is somewhat more acidic than in wild type. and an unidentified protein of atmut 22.000 daltons is slightly more basic. Inset: the gpalc region from alr mutant (alrIO, d<:TPase, endo 11, endo IV).

indicate long deletions; folding differences might also conceivably alter the migration sufficiently to give the apparent size difference.

,Vo other proteins a re consistently altered in alc mutants. Several (indicated as "P" in Figure I ) are, however, missing in those mutants (pseTA1, pseTA3, alcD32) which carry deletions extending through the pseT region, coding for the 5'- polynucleotide kinase-3'-phosphatase (SIROTKIN et al., 1978). T h e remaining portion of gpalc appears most likely to become part of larger fusion proteins i n these deletions, but the gels are too complex to draw firm conclusions.

In the accompanying paper, HERMAN, HAAS and SNUSTAD ( 1 984) independently identify the same protein as gpalclunf and show that this protein reappears in alclunf + revertants of unf3Y. Their more detailed kinetic analysis agrees with our findings that this protein is synthesized mainly in the first few minutes after infection.

Precise localization of the alclunf gene on the restriction map: SNUDSTAD et al. ( 1 976) originally mapped the unf gene to the region between genes 63 and 31. SIROTKIN, WEI and SNYDER ( 1 977) mapped the alc gene to the same region, and

296 E. KUTTER. R. DRIVDAHL AND K. RAND

FIGURE 3.-Heteroduplex mapping of- D S A from the mutarit strain (psrTAI, ArllI)l)2-drn, 5 6 ) against DNA from strain (acsaAY. eiido I I . .56). T h e mutation "rllDD2" actualls is it pair of r lI deletions (SNYDER, COLD and KUITER 1976). One of them, rE.W 66, affects only r l l A, producing the small deletion loop in the figure. T h e other, rPR 296. overlaps the suAY deletion in the region of dcnR and contributes to the production of the bubble observed in the figure, one arm of which is that region that is present in saAY but not DD2; the other a rm is the inverse. This pair of mutations thus serves not only to indicate the location of the r l l region on the heteroduplex DNA molecule but also to indicate the orientation of the circle, thus allowing precise locali7ation of additional deletion loops, such as the one observed here for pscTAI. (The single-stranded tail reflects the region of terminal redundancy in one of the two molecules). &X I74 DNA has been included in the spread as a size standard, one that is fully accurate only for the single-stranded regions. Five molecules were measured (three times each) for psrTAl. giving values of 3.4-3.7 kb, but only one molecule was measured for pseTA3. giving a value of 3.4 kb.

both they and TICGE., BURSCH and SNUSTAD (1 977) went on to present strong evidence that the two functions defined the same gene even though some alc mutants a re still phenotypically Unf+.

More precise locali7ation of the alclunf gene has depended on the analysis of deletions psetA1 and pseTA3. These were first isolated as alc mutants alcl and alc3 (SNYDER, GOLD and KUTTER 1976) but later were renamed by SYNDER after they were shown to also be missing pseT (SIROTKIN, WEI and SNYDER 1977). T h e gene cd, which codes for dCMP deaminase, also is deleted as determined by marker rescue experiments and functional studies (D. HALL, personal communication).

Heteroduplex mapping (Figure 3) showed that both of these strains contain deletions about 3.5 kb in length, located about 30 kb from the known rlIDD2 deletions in the two strains. This would remove virtually the entire region

BACTERIOPHAGE T4 ALC GENE PRODUCT 297

Hindlll Kpnl mol sml Hocll PSt I 1.

F 'early" promoters: - pscfAl

. psoTA3.

gems: 63 4R-un't pseT cd 3 ORF

FIGURE 4.-Map of the gene 63-alc/unf-pseT region of the T 4 genome. The data to construct this map come from KUTTER and RUEGER ( 1 983), MILEHAM, REVEL and MURRAY (1 980), RAND and GAIL ( 1 984), H. GRAM and W. RUECER (personal communication. N. E. MURRAY (personal communication) and the data presented here. "Early" promoters are those observed in vitro by Gram et al. (1 984), which appear to correspond to appropriate recognition sequences for immediate early promoters (RAND and GAIT 1984; W. RUEGER, personal communication). It may be noted that the coordinates differ somewhat from those given by RAND and GAIT (1984); they used the original values of O'FARRELL, RUTTER and NAKANISHI ( 1 980), which have since been refined (KWITER and RUEGER 1983), but both papers are alluding to the identical place with regard to the restriction map.

between essential genes 32 and 63 (WOOD and REVEL, 1976; MOSIG 1983; KUTTER and RUEGER 1983). As summarized in Figure 4, these two deletions have now been mapped more precisely by analyzing the changes they cause in the pattern of EcoRI restriction fragments produced from this region. The pseTAl deletion removes most or all of EcoRl fragments 33 and 21, whereas it leaves fragment 3 1 virtually intact (MILEHAM, REVEL and MURRAY 1980). pseTA3 also removes fragments 33 and 21 and extends about 200 bp into fragment 31 (H. GRAM and W. RUEGER, personal communication). C. PAYZANT, G. LORING and E. KUTTER (unpublished results) found that the alc mutations in both of these deletion strains map at the distal end of the alc gene (toward pseT), recombining with most other mapped alc mutations although not with each other or with alcD32, which also has a deletion extending through pseT. Thus, much, at least, of the alc gene is not deleted in these strains.

Taken together, this evidence implies that the alc gene is largely or totally contained within EcoRl fragment 3 1. It is most probably at about 134.0 kb, just downstream from the one early promoter identified on this fragment (GRAM et al. 1984; KUTTER and RUEGER 1983; RAND and GAIT 1984), in order to be transcribed and translated as rapidly after infection as we have observed.

Determination of the DNA sequence of gpalclunf from an alcl0 mutant: RAND and GAIT (1 984) have recently sequenced the region including and surrounding the T4 RNA ligase gene, using the small-random fragment method of DEININGER (1983), as described in MATERIALS AND METHODS, to get around the cloning difficulties described by MILEHAM, REVEL and MURRAY (1980) for this region. The region has been found to include several additional open reading frames. We have identified the stretch at 133.9-134.4 kb, whose sequence is given in Figure 5, as the alclunf gene from this strain (which carries an alclO mutation) on the basis of a number of criteria:


1. Its size (1 9,102 daltons) corresponds well with the 18,000-20,000 daltons predicted on the basis of the protein gel data.

2. Its location (1 33.9-1 34.4kb) is exactly that predicted by the mapping data given earlier, and it is the only open reading frame of the right size on EcoRI fragment 3 1. Gene 63 extends through most of the fragment (RAND and GAIT 1984) and ends just 67 bp before the open reading frame that we identify as gpalc; gpalc, in turn, is followed by an open reading frame, indicated on Figure 4 as ORF, corresponding to a 13,135-dalton protein, which extends over onto EcoRI fragment 2 1.

3. The approximate pK estimated on the basis of its amino acid composition agrees well with the gel data, which indicate a pK somewhat above 7 for the alclO variant of gpalc. (As seen in the inset to Figure 2, the latter is somewhat more basic than the wild-type alc gene product, although it is the same size.)

4. The fact that some mutants, such as alcD22 and unf3YX5 (see Figure 2), make a protein that is significantly more basic and somewhat smaller than the wild-type gene product suggests that the C-terminal portion of the protein might well be rather acidic; such is indeed the case (Figure 5).

The actual stretches sequenced are indicated in Figure 6; no discrepancies were encountered between clones. It should be noted that use of a program (STADEN 1982) that uses the weight matrix of STORMO et al. (1982) suggests that the second of the pair of ATGs is by far the most likely initiation codon. There is a probable ribosome-binding site eight to 12 nucleotides upstream of this ATG (SHINE and DALGARNO 1974).

DISCUSSION

We have here used two-dimensional gel electrophoresis to identify gpalc as an 18 to 20-kb neutral protein made very soon after infection, an identification reached independently in the accompanying paper by HERMAN, HAAS and SNUSTAD (1 984). We have used a variety of genetic data, heteroduplex-mapping and restriction-mapping information on deletion mutants to precisely locate the alclunfgene on the genomic map of T4. Using all of this data, we have identified the sequence of gpalc/unf(from mutant alclO) in the region adjacent to the RNA ligase gene and have examined the properties of the resultant protein.

The combination of NEPHGE gels in the first dimension and appropriate gradient gels in the second allows routine comparison of more than 100 T 4 proteins made early in infection, many of which have now been characterized by us and others (Figure 1; BURKE et al. 1983). This number comes close to saturating the coding capacity of the early regions of the T 4 map, even given the small size of many of the proteins. The protein that we identify as gpalclunf is the only protein consistently missing or altered in all of the alc mutant strains that we have examined, and the reappearance of this spot in unf+ revertants (HERMAN, HAAS and SNUSTAD 1984) strongly supports the identification. The appearance of altered proteins with some mutants rules out the possibility that gpalclunf merely controls the expression of the gene for this protein. It is not clear whether the two other differences from T4D+ in unf3YX5 (see Figure 2) have functional consequences or are simply strain differences not eliminated

BACTERIOPHAGE T4 ALC GENE PRODUCT

- 35 - 10 GTTGTTTAC4AGTCCCTCGTGTTGTGT~ATAG~AGTCTTACTGACATAACATGAGGACTTTATG

299

MrthCpL~uGlnLou IlrThrThr~Mrt ValValmAlrTyr G l y m T h r T h r a ATGGATTTACAACTT ATTACTACTGAAATG GTCGTTGAAGCATAC GGTGATACTACAGAT OOOOOOOOoOOOOOOOOOOOooowooooooooowooowooo

xxxxxxxxxxxxxxxxxxxxxx xxxxxxxxxxxxxxx

YL - ...... GlyIlrSorVslPhr LyaGlyAmnArgArg VolGlyTyrIlrThr GlyLeuLyaLyahlp GGGATTTCTGTATTC AAAGGAAATCGTCGA GTTGGATATATCACT GGTCTTAAGAAAGAT

oooooooO0ooooowoooooo xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx

YL - YL Y J - LruAlaLyaGlnVd LyaArgLyaThrThr IlrLyaGLyfyrArg AmnArgArgLouGLy TTAGCTAAGCAAGTC AAGCGGAAAACGACC ATTAAAGAATATCGA AATCGTCGTCTTGAG OOOOOOOOOoOOooOOOoOOooowoooooooooooooooo 000000000000

xxxxxxxxxxxxxxxx

GlnAlaArghCpMot LruProhCpAlaVal m M r t L y a V a 1 PhrLoumAanGln CAAGCCCGTGATATG CTTCCTGATGCGGTT GAAGAGATGAAAGTC TTTTTAGAAAATCAA oOOwOOOOowOOOOoO0Oooooooooooooooo~ooooooo~OOooo~wooo

xxxxxxxxxxxxxxxx

zy LouAleLyrTyr&~ CyrGLyValPhrIlr AanGlnThrGlnPro AanValHimIl~Aan CTTGCTAAGTATGAT TGTGAAGTGTTCATT AATCAGACTCAACCC AATGTTCATATCAAT 00 0000000

xYxxxxxxxxxxxxxxxxxxxxxxxxxx

LLL -LLL SerCymLyaTyrTyr IlrIleValAmnPro LmuThrGlyLymHir ArgLruGlyIlcSrr AGCTGCAAATACTAT ATCATCGTTAATCCT TTGACGGGAAAACAT CGCCTTGGTATTAGT

xxxxxxxxxxYxxxxxxxxxxxxxx

Ly

AanProAmnArgSor AlsSrr~MatAla W V a l W A l a CyaPhoLyaIlrSrr AATCCAAATCGTAGT GCATCGGATATGGCA GAAGATGTTGAGGCA TGCTTTAAAATTTCT

0000000000000000000000000000000000000000000000000000~

xxxxxxxxxxxxxxxx

... GSerProA lam GI leLeuI le AanGl yLeuSrrGln AaDAaDI ~ r v a l ~ AAATCTCCAGCTGAA CATCATATTTTAATT AACGGTCTTTCTCAA GACGATATTGTAGAG 0000000000000000000000000000000 OOOOOQOOOOOOOOOOOOO

xxxxxxxxxxxxxxxxxxx xxxxxxxxx

... ValIlcLyeThrLeu CyaMet GTTATTAAAACTTTA TGCATGTAAGTAATT TTACAGCTGGATTGC TATTACTTGTAATAG

xxxxxxxxxxxxxxxxxxxxxx

FIGURE 5.--Sequence of the putative alclunf gene from the mutant ah10 and the corresponding protein sequence. Lines above the amino acids indicate acidic residues; lines below indicate basic residues. oooooooooo, potential alpha helix regions; xxxxxxxxxxxxxx, potential beta sheet regions, as determined by the algorithm of CHOU and FASMAN ( 1 978).

during the backcrossing. In general, we observe that the pseT gene product shows some variation in apparent charge (relative to surrounding proteins), which may reflect strain and/or phosphorylation differences (6 figures in BURKE et al. 1983; E. KUTTER and R. DRIVDAHL, unpublished data).

The observations that bacteria carrying plasmid pR386 restrict unf mutants (HERMAN and SNUSTAD 1982), which permitted isolation of the aforementioned unf+ revertants, also facilitated fine structure mapping of the alclunf gene (C.


134.4 134.3 134.2 13p.I 13?0 1339 137.8 I I I

I alc I I I

..... 175 I70 179 *

m 203 I3 7 +

+ 108 ..... J. 80

I - 213 . - ........ I06

tot -..... 209 c I4 0

4

FIGURE 6.-Indication of the extents of the actual sequenced regions of various clones.

PAYZANT, G. LORINC and E. KUTTER, unpublished data). They found that deletions pseTA1 and pseTA3 extend at most a short distance into the alclunf gene, since the alc mutations in these strains recombine with most other alc mutations and are at the pseT end. We have no indication that the alc mutation is separable from the pseT deletion in either strain; analysis of this question has, however, been complicated by the possibility of picking up new mutations rather than crossed-out ones. For example, we were sent one putative ale+ “pseTAl” which, however, was not missing the proteins that are absent in the deletion (indicated as “P” in Figure 1) and produced a pseT protein that was simply altered in charge. Our gel patterns are most consistent with the possibility (mentioned earlier) that these deletions do extend into alclunf and result in part of gpalc being incorporated into fusion proteins.

The DNA used for sequencing was from an alc mutant, alclO; alc mutants are commonly used for restriction work with T4, since normal T 4 DNA is not attacked by most restriction nucleases (see KUTTER and SNYDER 1983; KUTTER and RUECER 1983). Since this mutant makes an alc protein of the same size as the wild-type protein but shifted somewhat in charge (Figure 2), it presumably differs only by a single-base change from the normal protein. Several features are of interest in the observed sequence:

The protein is quite polar, with no extensive hydrophobic regions. Computer analysis using the technique of CHOU and FASMAN (1978) predicts that the protein contains a number of potential regions of alpha helix and beta sheet configuration; these have been indicated in Figure 5.

The charge distribution is quite asymmetric. As mentioned before, the C- terminal end is relatively acidic. On the other hand, one stretch of 33 amino acids (residues 26-58) contains 15 basic residues (and two acidic ones); it is tempting to speculate that this latter region might be involved in interaction with the DNA.

It will now be of interest to sequence additional alc mutants, to determine the wild-type sequence and to differentiate between the properties of those alc mutants, such as alcA3 and unf39, which block the unfolding of the host genome and those, such as alclO, which are Unf+; such experiments are in progress.

The alclunf gene is located immediately adjacent to the one apparent T 4 early


promoter in the extensive region sequenced (as determined by an analysis program based on the data of HAWLEY and MCCLURE 1983), which appears to be identical with the single in vitro promoter observed there by GRAM et al. (1984). This promoter-proximal location is consistent with gpalc's kinetics of appearance as determined on two-dimensional polyacrylamide gels (HERMAN, HAAS and SNUSTAD 1984) and with the timing appropriate to its probable function in shutting off host transcription. RAND and GAIT (1984) suggest that the region in the immediate vicinity of this promoter interferes seriously with cloning, even though the alc gene adjacent to the promoter is mutated and only the N-terminal portion may be present. Despite extensive efforts, no one has yet succeeded in cloning EcoRI fragment 31 or any of the other known restriction fragments covering this site intact (see MILEHAM, REVEL and MURRAY 1980). As discussed in more detail by RAND and GAIT (1984), clones covering all other portions of the region depicted in Figure 4 were readily isolated in M 13mp8 in both orientations. However, only one clone was isolated covering the promoter region, despite subsequent efforts to use that clone to find additional clones. The first nine bases of the alc gene, therefore, could be sequenced in only one direction, whereas other regions were all sequenced in both directions and from several different clones. RAND and GAIT suggested that in this one clone a strong promoter may have been mutationally weakened. However, the putative promoter sequence still very closely resembles the -10 and -35 E. coli consensus sequences and other known early T 4 promoter sequences (see BRODY, RABUSSAY and HALL 1983; HAWLEY and MCCLURE 1983). It is the only stretch in the extensive sequenced region that does so, as mentioned earlier.

The data given here clearly cannot yet resolve the question of whether the primary interaction of gpalc is with the RNA polymerase or with the DNA, as alc/unfblocks transcription of cytosine-containing DNA and causes unfolding of the host genome. However, the identification and sequence determination of the alc gene product greatly facilitate a variety of experimental approaches in determining its mode(s) of action.

We express our appreciation to our colleagues and students whose unpublished observations we have cited. Special thanks go to BURT GWMAN, for extensive support, discussion and critical reading of the manuscript; to MICHAEL GAIT, for his support of the DNA sequencing work; to SCOTT BROWN, for many useful discussions of the physical map of the gene 63-alc region; to MIKE PARKER for computer analysis of the properties of the protein; to TOM BROKER and to STAN FALKOW and his colleagues at the University of Washington during the summer of 1977 who aided one of us (E. K.) with the heteroduplex mapping; to HERMANN GRAM and WOLFGANG RUEGER for the information on early promoters and the restriction patterns for pseTA1, as well as for much profitable collaboration; and to PETER SNUSTAD for many useful discussions about alclunf, as well as the sharing of unpublished data. This work was supported by National Science Foundation grant PCM 7905626 to E. KUTTER and by a Medical Research Council grant to K. RAND.

LITERATURE CITED

BIGGIN, M. D., T. J. GIBSON and G. F. HONG, 1983

BRODY, E., D. RABUSSAY and D. H. HALL, 1983

Buffer gradient gels and "S label as an aid to rapid DNA sequence determination. Proc. Natl. Acad. Sci. USA SO: 3963-3965.

Regulation of transcription of prereplicative genes. pp. 321-326. In: Bacteriophage T 4 , Edited by C. K. MATHEWS, E. KUTTER, G. MOSIG and P. BERGET. American Society for Microbiology, Washington, D.C.

302 E. KUTTER, R . DRIVDAHL AND K. R A N D

BURKE, R. L., T. FORMOSA, K. S. COOK, A. SEASHOLTZ, J. HOSODA and H. MOISE, 1983 Use of two- dimensional polyacrylamide gels to identify T4 prereplicative proteins. pp. 32 1-326. In: Bacte- riophage T4, Edited by C. K. MATHEWS, E. KUTTER, G. MOSIG and P. BERGET. American Society for Microbiology, Washington, D.C.

Characterization of new regulatory mutants of bacteriophage T4 . 11. New class of mutants. J. Virol. 15: 929-945.

Prediction of the secondary structure of proteins from their

A simple and fast electrophoretic method for elution of nucleic acids from gels. Mol. Biol. Rep. 5: 237-239.

High-molecular-weight DNA and the sedimentation coefficient: a new perspective based on DNA from T7 bacteriophage and two novel forms of T 4 bacteriophage. J. Virol. 33: 443-448.

Prolonged incubation in calcium chloride improves the competence of E. coli cells. Gene 6: 23-28.

Electron microscope heteroduplex methods for mapping regions of base sequence homology in nucleic acids. Methods Enzymol. 21: 413-428.

Random subcloning of sonicated DNA: application to shotgun DNA sequence analysis. Anal. Biochem. 129: 216-223.

DRIVDAHL, R. and E. KUTTER, 1983 Effect of the bacteriophage T4 alc gene on RNA polymerase activity. Fed. Proc. 42: 188 1.

GRAM, H., H. LIEBIG, A. HACK, E. NIGGEMAN and W. RUEGER, 1984 A physical map of bacteriophage T4 including the positions of strong promoters and terminators recognized in vitro. Mol. Gen. Genet. 194: 232-240.

HANAHAN, D., 1983 Studies on transformation ofE. coli with plasmids. J. Mol. Biol. 166 557-580.

CHASE, K. V. and D. H. HALL, 1975

CHOU, P. Y. and G. D. FASMAN, 1978 amino acid sequence. Adv. Enzymol. 47: 45-148.

CHOUIKH, Y., M. VOLOVITCH and P. YOT, 1979

CLARK, R. W., G. H. WEVER and J. S. WIBERG, 1980

DAGERT, M. and S. D. EHRLICH, 1979

DAVIS, R., M. SIMON and N. DAVIDSON, 1971

DEININGER, P. L., 1983

HAWLEY, D. K. and W. R. MCCLURE, 1983

HERMAN, R. E., N. HAAS and D. P. SNUSTAD, 1984

Compilation and analysis of Escherichia coli promoter DNA sequences. Nucleic Acids Res. 11: 2237-2255.

Identification of the bacteriophage T 4 unf (=ale) gene product, a protein involved in the shutoff of host transcript. Genetics 108 305- 317.

Deletion analysis of two nonessential regions of the T4 genome. HOMYK, T. and J. WEIL, 1974 Virology 61: 505-523.

KUTTER, E., A. BEUG, R. SLUS, L. JENSEN and D. BRADLEY, 1975 T h e production of undegraded cytosine-containing DNA by bacteriophage T4 in the absence of dCTPase and endonucleases I1 and IV, and its effects on T4-directed protein synthesis. J. Mol. Biol. 9 9 591-607.

Map of the T 4 genome and its transcription control sites. pp. 277-290. In: Bacteriophage T4, Edited by C. K. MATTHEWS, E. KUTTER, G. MOSIG and P. BERGET, American Society for Microbiology, Washington, D.C.

Production of cytosine-containing T4 phage. pp. 56-57. In: Bacteriophage T4, Edited by C. K. MATHEWS, E. KUTTER, G. MOSIG and P. Berget. American Society for Microbiology, Washington, D.C.

Bacteriophage T4 alc gene product: general inhibitor of transcription from cytosine-containing DNA. J. Virol. 4 0

Cleavage of structural proteins during the assembly of the head of bacteri-

On the structure of the glucosylated hydroxymethylcytosine

KUTTER, E. and W. RUEGER, 1983

KUTTER, E. and L. SNYDER, 1983

KUTTER, E. M., D. BRADLEY, R. SCHENCK, B. S. GUTTMAN and R. LAIKEN, 1981

822-829. LAEMMLI, U. K., 1970

ophage T4. Nature 227: 680-685.

nucleotides of coliphages T2, T4 and T6. J. Biol. Chem. 235: 3254-3258. LEHMAN, I. R., and E. A. PRATT, 1960


MCDONELL, M. W., M. N. SIMON and F. W. STUDIER, 1977 Analysis of restriction fragments of T7 DNA and determination of molecular weights by electrophoresis in neutral and alkaline gels. J. Mol. Biol. 1 1 0 119-146.

A system for shotgun DNA sequencing. Nucleic

A new pair of MI3 vectors for selecting either DNA strand of double-digest restriction fragments. Gene 1 9 269-276.

Molecular cloning of the T4 genome: organization and expression of the frd-DNA ligase region. Mol. Gen. Genet. 1 7 9 227-239.

MORTON, D., E. M. KUTTER and B. S. GUTTMAN, 1978 Synthesis of T4 DNA and bacteriophage in the absence of dCMP hydroxymethylase. J. Virol. 28: 262-269.

MOSIG, G., 1983 T4 genes and gene products. pp. 321-326. In: Bacteriophage T4, Edited by C. K. MATHEWS, E. KUTTER, G. MOSIG and P. BERGET, American Society for Microbiology, Washing- ton, D.C.

O’FARRELL, P. H., E. KUTTER and M. NAKANISHI, 1980 A restriction map of the bacteriophage T4

High resolution two-dimensional

Shutoff of lambda gene expression by bacteriophage T4:

Sequence and cloning of bacteriophage T4 gene 63 encoding

MESSING, J., R. CREA and P. H. SEEBURG, 1981 Acids Res. 9 309-321.

MESSING, J. and J. VIEIRA, 1982

MILEHAM, A. J., H. R. REVEL and N. E. MURRAY, 1980

genome. Mol. Gen. Genet. 179: 421-435.

electrophoresis of basic as well as acidic proteins. Cell 12: 1133-1 142.

role of the T4 alc gene. J. Virol. 35: 194-202.

RNA ligase and tail fibre attachment activities. EMBO J. 3: 397-402.

cytosine in its DNA. J. Virol. 27: 8 15-8 18.

stranded bacteriophage as an aid to rapid DNA sequencing. J. Mol. Biol. 143: 161-178.

O’FARRELL, P. Z., H. M. GOODMAN and P. H. O’Farrell, 1977

PEARSON, R. E., and L. SNYDER, 1980

RAND, K. N. and M. J. GAIT, 1984

RUNNELS, J. and L. SNYDER, 1978 Isolation ofa bacterial host selective for bacteriophage containing

Cloning in single-

DNA sequencing with chain-terminating

The 3’-terminal sequence of Escherichia coli 16s ribosomal RNA: complementary to nonsense triplets and ribosome binding sites. Proc. Natl. Acad. Sci. USA 71:

SANGER, F., A. R. COULSON, B. G. BARRELL, A. J. H. SMITH and B. A. ROE, 1980

SANGER, F., S. NICKLEN and A. R. COULSON, 1977 inhibitors. Proc. Natl. Acad. Sci. USA 7 4 5463-5467.

SHINE, J. and L. DALGARNO, 1974

1342-1 346.

SIROTKIN, K., W. COOLEY, J. RUNNELS and L. SNYDER, 1978 A role in true-late gene expression for the T4 bacteriophage 5’ polynucleotide kinase 3’ phosphatase. J. Mol. Biol. 123: 221-233.

SIROTKIN, K., J. WEI and L. SNYDER, 1977

SNUSTAD, D. P., L. SNYDER and E. M. KUTTER, 1983

T4 bacteriophage-coded RNA polymerase subunit

Effects on host genome structure and expression. pp. 40-55. In: Bacteriophage T4, Edited by C. K. MATHEWS, E. M. KUTTER, G. MOSIG and P. B. BERGET. American Society for Microbiology, Washington, D.C.

SNUSTAD, D. P., M. A. TIGGES, K. A. PARSON, C. J. H. BURSCH, F. M. CARON, J. F. KOERNER and D. J. TUTAS, 1976 Identification and preliminary characterization of a mutant defective in the bacteriophage T4-induced unfolding of the Escherichia coli nucleoid. J. Virol. 17: 622-641.

blocks host transcription and unfolds the host genome. Nature 265: 28-32.

SNYDER, L., L. GOLD and E. KUTTER, 1976 A gene of bacteriophage T4 whose product prevents true late transcription on cytosine-containing T4 DNA. Proc. Natl. Acad. Sci. USA 73: 3098- 3102.

A new computer method for the storage and manipulation of DNA gel reading STADEN, R., 1980 data. Nucleic Acids Res. 8: 3673-3694.

304

STADEN, R., 1982

STORMO, G. D., T . D. SCHNEIDER, L. GOLD and A. EHRENFEUCHT, 1982

E. KUTTER, R. DRIVDAHL AND K. RAND

Automation of the computer handling of gel reading data produced by the

Use of the “Perceptron” algorithm to distinguish translational initiation sites in E. coli. Nucleic Acids Res. 10: 2997- 301 1.

Slow switchover from host RNA synthesis to bacteriophage RNA synthesis after infection of Escherichia coli with a T 4 mutant defective in the bacteriophage T4-induced unfolding of the host nucleoid. J. Virol. 4 4 775-785.

Molecular cloning of fragments of bacteriophage T4 DNA. Mol. Gen. Genet. 156: 203-214.

Host specificity of DNA produced by Escherichia coli: bacterial mutations

The genome of bacteriophage T4. Bacteriol. Rev. 40: 847-

T h e bases of the nucleic acids of some bacterial and animal

shotgun method of DNA sequencing. Nucleic Acids Res. 10: 4731-4751.

TIGGES, M. A., C. J. H. BURSCH and D. P. SNUSTAD, 1977

WILSON, G., V. IANYASHIN and N . MURRAY, 1977

WOOD, W. B., 1966 affecting the restriction and modification of DNA. J. Mol. Biol. 16: 118-133.

868. WOOD, W. B. and H. R. REVEL, 1976

WYATT, G. R. and S. S. COHEN, 1953 viruses: the occurrence of 5-hydroxymethylcytosine. Biochem. J. 5 5 774-782.

Rapid bacteriophage sedimentation in the presence of polyethylene glycol and its application to large- scale virus purification. Virology 40: 734-744.

YAMAMOTO, K. R., B. M. ALBERTS, R. BENZINGER, L. LAWHORNE and G. TREIBER, 1970

Corresponding editor: G. Mosrc

identification and characterization of the alc gene product of

Documents