www.fems-microbiology.org

FEMS Microbiology Letters 253 (2005) 83–88

Hydrogenase genes are uncommon and highly conservedin Rhizobium leguminosarum bv. viciae

Domingo Fernandez a, Annita Toffanin a, Jose Manuel Palacios a,Tomas Ruiz-Argueso a, Juan Imperial a,b,*

a Laboratorio de Microbiologıa, Escuela Tecnica Superior de Ingenieros Agronomos, Universidad Politecnica de Madrid, Ciudad Universitaria,

s/n, 28040 Madrid, Spainb CSIC, Escuela Tecnica Superior de Ingenieros Agronomos, Universidad Politecnica de Madrid, Ciudad Universitaria, s/n, 28040 Madrid, Spain

Received 24 August 2005; received in revised form 14 September 2005; accepted 14 September 2005

First published online 28 September 2005

Edited by Y. Okon

Abstract

A screening for hydrogen uptake (hup) genes in Rhizobium leguminosarum bv. viciae isolates from different locations within Spainidentified no Hup+ strains, confirming the scarcity of the Hup trait in R. leguminosarum. However, five new Hup+ strains were iso-lated from Ni-rich soils from Italy and Germany. The hup gene variability was studied in these strains and in six available strainsisolated from North America. Sequence analysis of three regions within the hup cluster showed an unusually high conservationamong strains, with only 0.5–0.6% polymorphic sites, suggesting that R. leguminosarum acquired hup genes de novo in a very recentevent.� 2005 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved.

Keywords: Hydrogenase; Rhizobium leguminosarum; Symbiotic plasmid; hup Genes

1. Introduction

Symbiotic nitrogen fixation is the key metabolic pro-cess in the root nodule symbiosis between legumes andthe soil bacteria collectively known as rhizobia (mem-bers of the Rhizobium, Bradyrhizobium, Sinorhizobium,

and Mesorhizobium genera, among others). Nitrogen fix-ation is an energy intensive process, requiring no lessthan 16 molecules of ATP and 8 e� per molecule of dini-trogen reduced to ammonia [1]. An inherent source ofenergy inefficiency in this process is the nitrogenase-cat-alyzed generation of H2 from protons and reducingequivalents. Even under optimum in vitro conditions,

0378-1097/$22.00 � 2005 Federation of European Microbiological Societies

doi:10.1016/j.femsle.2005.09.022

* Corresponding author. Tel.: +34 913365759; fax: +34 913365757.E-mail address: juan.imperial@upm.es (J. Imperial).

as much as 25% of the electrons allocated to nitrogenaseare lost as H2 [2]. In vivo, these losses are usually muchhigher [3]. Some rhizobia possess an uptake hydrogenasethat allows them to recycle the hydrogen generated bynitrogenase. The potential of such a hydrogen uptakesystem to increase the energy efficiency of the symbiosishas been repeatedly emphasized [4–6] and clearly shownfor the B. japonicum–soybean symbiosis [3,7].

Our laboratory has been studying the hydrogenasesystem from R. leguminosarum bv. viciae UPM791[6,8]. This system is unique in its adaptation to its rolein recycling the hydrogen generated as a by-product bythe symbiotic nitrogen fixation process. It is present onthe symbiotic plasmid (pSym), together with nodulationand nitrogen fixation genes [9], and it is exclusively ex-pressed in symbiosis, together with the nitrogen fixation

. Published by Elsevier B.V. All rights reserved.

84 D. Fernandez et al. / FEMS Microbiology Letters 253 (2005) 83–88

system, through NifA, the general regulator of nitrogenfixation, which activates the main hup promoter by a no-vel mechanism [10,11]. This adaptation contrasts shar-ply with the fact that few Hup+ strains have beenisolated from fast-growing strains of the Rhizobium

and Sinorhizobium genera [4,12]. Furthermore, ourgroup had previously obtained evidence that majorhup cluster restriction enzyme cut sites are conservedwithin the standard Hup+ collection strains of R. legu-minosarum bv. viciae [13], and that hup genes fromstrains R. leguminosarum bv. viciae UPM791 and B10are very strongly conserved [10]. In an effort to betterunderstand the distribution and variability of thesegenes, we set out to, first screen new R. leguminosarumbv. viciae isolates for hup genes, and then systematicallystudy their conservation among Hup+ isolates.

2. Materials and methods

2.1. Chemicals

All enzymes and nucleotide triphosphates werepurchased from Roche Biochemicals (Mannheim, Ger-many). Specific oligonucleotides were custom synthe-sized by Sigma-Genosys (Pampisford, UK). Mediumconstituents were from Oxoid Ltd. (Basingstoke, UK).Antibiotics used in growth media were from Rocheand Serva Feinbiochemica (Heidelberg, Germany). Allother chemicals were of reagent or electrophoresisgrade.

2.2. Bacterial strains, growth conditions and plant tests

R. leguminosarum bv. viciae Hup+ strains used in thiswork were the following: UPM791 (128C53), UPM987(128C23), UPM988 (128C13), UPM989 (128C30), andUPM990 (128C56), obtained from J.C. Burton (Nitra-gin Co. Milwaukee, WI); strain UPM1072 (B10, ob-tained from W. Lotz [14]; strains UPM1131 throughUPM1135 were isolated from Ni-rich soils in Italy andGermany and are described in this work. Strains weregrown in media and conditions previously described[15,16]. Pea (Pisum sativum L. cv. Frisson) was used asplant host. Conditions for isolation of pea-effective rhi-zobia from soils, and for plant inoculation and growthhave been described previously [9,17].

2.3. DNA manipulation and analysis

DNA manipulations were all performed by standardprocedures [18]. Eckhardt gels [19] were used for rhizo-bial plasmid resolution. Non-radioactive bands labelledwith digoxigenin (Roche Biochemicals) were visualizedeither by luminography or by the use of a GS-250Molecular Imager System (Bio-Rad, Hercules, CA,

USA). Nucleotide sequences were determined from dou-ble stranded templates with the Applied Biosystems(Foster City, CA) PRISM dye terminator cycle sequenc-ing system and the PRISM 377 automated sequencer.

Screening for hup DNA-containing rhizobia was car-ried out by Southern hybridization of total DNA fromnodule isolates with a R. leguminosarum bv. viciaeUPM791 hup DNA probe [9].

2.4. Characterization of hup DNA

Three regions were amplified by PCR with specificprimers: (i) a 330 bp sequence from the hupS promoterregion (bases 3205 through 3534 in Accession No.AF246703) was amplified with primers pro1 (5 0

GTTCGGCCTGGTCGTTCTTG 3 0) and pro2 (5 0

CTCCTCCAGCAATCCCATCC 3 0); (ii) a 562 bp se-quence from the hupEF region (bases 7909 through8470 in Accession No. AF246703 and 4526 through5087 in Accession No. X52974) was amplified withprimers hupE1 (5 0 GGGGGATCCATTCTGGGC-GGGAAACAC 3 0) and hupE2 (5 0 CCCCCATGGCG-GAGCATCTGTATCTGC 3 0); and (iii) a 436 bpsequence from the whoxA region (bases 16,591 through17,026 in Accession No. X52974) was amplified withprimers pc1 (5 0 CGGCATCTACCAATATATCACC3 0) and pc2 (5 0 CGGTATAGGCGCCCTTCT 3 0). Theresulting PCR products were sequenced directly, and se-quences deposited in the GenBank/EMBL databases asfollows (strain/Accession No.): hupS promoter region,UPM791/AY036913, UPM987/AY036914, UPM988/AY036915, UPM989/AY036916, UPM990/AY036917,UPM1072/AY036918, UPM1131/AY036920, UPM1132/AY036921, UPM1133/AY036919, UPM1134/AY036922,UPM1135/AY036955; hupEF region, UPM791/AY-036923, UPM987/AY036924, UPM988/AY036925,UPM-989/AY036926, UPM990/AY036932, UPM1072/AY036927, UPM1131/AY036929, UPM1132/AY036928,UPM1133/AY036931, UPM1134/AY036930, UPM1135/AY036956; whoxA region, UPM791/AY036933, UPM-987/AY036934, UPM988/AY036939, UPM989/AY-036935, UPM990/AY036936, UPM1072/AY036937,UPM1133/AY036938, UPM1135/AY036957.

3. Results and discussion

3.1. Screening for hup-containing R. leguminosarum bv.

viciae strains

Although the potential benefits that Hup+ rhizobiacan derive from recycling the H2 generated duringnitrogen fixation are widely recognized [4–6], the actualbenefits that the symbiosis derives from this have beena matter of controversy. One of the objections raisedhas to do with the paucity of Hup+ strains among

D. Fernandez et al. / FEMS Microbiology Letters 253 (2005) 83–88 85

fast-growing rhizobia [4]. Previous surveys from theliterature suggest that the Hup trait is rare withinR. leguminosarum bv. viciae [4], and few of the re-ported Hup+ strains have been substantiated by geneticanalysis [13].

We screened a collection of 410 new isolates from 20different locations throughout Spain for the presence ofDNA homologous to strain UPM791 hup genes. Thestrains were isolated both from soil, using pea plantsas trap host, and from nodules of R. leguminosarum le-gume hosts other than peas (Vicia, Lens, or Lathyrus).In addition, and considering that nickel availability isa limiting factor for hydrogenase activity within theplant [20,21], we isolated and screened strains fromNi-rich soils of separate geographical locations (Ger-many, Italy, and Spain). Table 1 summarizes the resultsfrom this screening. No isolate from Spain, from anyplant host, showed positive hybridization with hup

genes, even when they were obtained from Ni-rich soilsfrom an ultramafic region (Estepona, Malaga). This re-sult confirms that Hup+ strains are rare among isolatesof R. leguminosarum bv. viciae. Positive hybridizationwith strain UPM791 hup DNA was obtained with iso-lates from Ni-rich mafic and ultramafic soils from theParma and Piacenza Apennines in Italy (strainsUPM1131 through UPM1134), as well as with an isolate(UPM1135) from a German soil rich in Ni due to indus-trial waste contamination. All five strains were alsoshown to express an uptake hydrogenase in symbiosiswith peas (data not shown). These newly isolatedHup+ strains, together with strains UPM791 andUPM987 through UPM990 (isolated by John Burton,

Table 1Frequency of Hup+ strains within isolates of R. leguminosarum bvviciae

Location No.sitesa

Legumehost

No.isolates

No. Hup+

strains

Spain 3 Vicia ervilia 37 05 V. faba 38 01 V. monantos 5 06 Pisum sativum 261 01b P. sativum 37 01 Lens sp. 20 01 Lathyrus sp. 5 01b Lathyrus sp. 4 01b V. sativa 3 0

Italy 9b P. sativum 23 4d

Germany 2c P. sativum 6 1e

4 P. sativum 4 1f

a Normal soils unless otherwise stated. All sites within Spain correspond to different provinces.b Ultramafic (Ni-rich) soils.c Industrial waste, Ni-enriched, contaminated soils.d Hup+ isolates designated UPM1131 through UPM1134.e UPM1135.f UPM1072 (isolated and characterized by Tichy and Lotz [14]).

Fig. 1. Plasmid location of hup genes in new Hup+ strains. Plasmidswere separated and visualized in Eckhardt gels (lanes a), andhybridized with a cosmid pAL618 probe (lanes b). Lanes 1,UPM791; 2, UPM1072; 3, UPM1132; 4, UPM1133; 5, UPM1134; 6,UPM1135. Sizes of strain UPM791 plasmids (in MDa [13]) areindicated on the left.

.

-

Nitragin Co., from North American soils), and strainUPM1072 (B10, isolated from garden soil in Germany[14]) constitute our available Hup+ strains.

3.2. The hup cluster is located in the symbiotic plasmid

It has been previously shown that the hup clusterfrom strain UPM791 and the other North Americanstrains reside in the symbiotic plasmid, together withsymbiotically important genes [13]. This was alsofound for the newly isolated Hup+ strains. In-welllysis and subsequent electrophoresis (Eckhardt gels)allowed separation of plasmids in all these strainsexcept for UPM1131, where only a smear could beobserved (Fig. 1 and data not shown). Southernhybridization with a hup gene cluster DNA probeshowed that hup genes reside in a single plasmid(Fig. 1) of size similar to that of the strain UPM791pSym (145–232 MDa). In all cases this was the symbi-otic plasmid, since it also contained nif and nod genes(data not shown).

3.3. High conservation of hup genes in R. leguminosarum

bv. viciae Hup+ strains

The genetic organization of the hup region in strainUPM791 is shown in Fig. 2(a). It contains 18 genesand 1 pseudogene (whoxA) tightly clustered in an 18kb DNA segment. All the genetic determinants neces-sary for hydrogen uptake activity have been cloned incosmid pAL618 ([9], Fig. 2(a)), which also containsthree upstream genes of unrelated function. It was previ-ously shown that the EcoRI restriction enzyme cut pat-tern of pAL618 is conserved within the North AmericanHup+ strains [13]. As Fig. 2(b) shows, this was alsofound for the new Hup+ isolates from Italy andGermany.

Fig. 2. Genetic organization and conservation of the hup cluster in R.

leguminosarum bv. viciae Hup+ isolates. (a) Physical and genetic mapof the hup region from strain UPM791. Cosmid pAL618 contains allthe genes required to confer the Hup character to Hup� rhizobia [9].Cosmid pAL704 contains the hoxA region [11]. The three DNAregions analyzed in detail for their variability are indicated by thicksolid lines. E = EcoRI. (b) Southern hybridization analysis of hup

DNA in EcoRI-digested total DNA from R. leguminosarum Hup+

strains. Cosmid pAL618 was used as probe. Lanes: 1, pAL618; 2,UPM791, 3, UPM987; 4, UPM988; 5, UPM989; 6, UPM990; 7,UPM1072; 8, UPM1131; 9, UPM1132; 10, UPM1133; 11, UPM1134;12, UPM1135. Sizes of the hybridizing fragments (in kb) are indicatedon the left.

Table 2Sequence analysis of three hup DNA regions from R. leguminosarum

bv. viciae Hup+ strains

Strain Base changesa

hupS promoter hupEF whoxA

UPM987 0 0 0UPM988 0 0 2 (G320A,

G368A)UPM989 0 0 0UPM990 0 1 (D455–461) 0UPM1072 0 0 0UPM1131 2 (C290A, D303–304) 2 (G342A, G378T) –b

UPM1132 2 (C290A, D303–304) 0 –b

UPM1133 0 1 (C386G) 1 (G368A)UPM1134 2 (C290A, D303–304) 1 (C378T) –b

UPM1135 0 0 0

a With respect to the strain UPM791 hup DNA sequence.b No DNA product could be amplified by PCR.

86 D. Fernandez et al. / FEMS Microbiology Letters 253 (2005) 83–88

The conservation of hup genes among R. leguminosa-

rum strains was further investigated taking advantage ofthe availability of the complete DNA sequence of thestrain UPM791 hup region. For this purpose, three re-gions characteristic or unique to the R. leguminosarum

hup cluster were chosen (Fig. 2(a)): (i) the hydrogenasestructural genes promoter region, including sequencesnot required for normal transcription or regulation[11]; (ii) the hupE–hupF region, including part of hupE,a gene rarely found in other hup clusters [6,22], andthe intergenic region between hupE and hupF, a 96nucleotide stretch representing the second largest con-tinuous non-coding sequence within the hup cluster fromstrain UPM791; and (iii) the whoxA pseudogene region,containing the remnants of a former hoxA regulatorygene, including the first inactivating frameshift withinthe whoxA sequence [11]. These three regions were alsochosen because they included non-functional sequences,for which no selective pressure should exist. Specific oli-gonucleotides were designed and used to amplify byPCR each of the three regions. For strain UPM791 thiswould result in PCR products of 330, 562, and 436 bp,

respectively. PCR products of the expected size weregenerated by amplification of both the hupS promoterand hupEF regions for all the Hup+ strains tested (Table2). This was also true for the whoxA region, except forstrains UPM1131, UPM1132, and UPM1134, whereno DNA could be amplified. All PCR products were di-rectly sequenced and the sequences compared to thosefrom strain UPM791 (Table 2). For the hupS promoterregion, all nucleotides were conserved in the NorthAmerican strains (UPM987 through 990), the Germanstrains (UPM1072 and 1135) and the Italian strainUPM1133. The three remaining Italian strains sharedtwo changes, a C290A transversion, and a two-base pairdeletion at positions 303–304. Both changes were lo-cated in the transcribed DNA region preceding hupS.For the hupEF region, all nucleotides were conservedin North American strains UPM987 through 989, inthe German strains (UPM1072 and 1135), and in theItalian strain UPM1132. Strains UPM1133 andUPM1134 had one single nucleotide change each withinthe hupE coding region, which resulted in conservative(Ala ! Gly) and silent replacements, respectively.Strain UPM1131 presented two silent replacementswithin the hupE coding region, one of them also foundin strain UPM1134. Finally, North American strainUPM990 presented a 7 bp deletion that eliminated thehupE stop codon. As a result, UPM990 is expected tosynthesize a longer (28 extra amino acid residues) HupEproduct. With respect to the whoxA region, the sevenstrains where PCR amplification was successful pre-sented the inactivating frameshift observed in strainUPM791. Strains UPM987, 989, 990, 1072, and 1135showed no changes with respect to UPM791. StrainUPM1133 presented one single change, a G368A transi-tion, whereas strain UPM988 presented both the G368Aplus a G320A transition. Southern hybridization analy-sis of genomic DNA from strains UPM1131, 1132, and1134 using the strain UPM791 whoxA PCR product as

D. Fernandez et al. / FEMS Microbiology Letters 253 (2005) 83–88 87

probe, showed that the DNA hybridizing with this re-gion was present in all three genomes but in a differentlocation (data not shown). This suggests that genomicrearrangements have separated this non-functional re-gion from the hup cluster.

With the exception of the genomic rearrangementsaffecting the non-functional whoxA region in three ofthe Italian strains, the number of polymorphic siteswas very small: 0.6%, 0.5%, and 0.5% for the hupS pro-moter, hupEF, and whoxA regions, respectively. This re-sult is more surprising given that plasmid-borne genesmay be subject to higher mutation rates than chromo-somal genes [23], and contrasts sharply with data avail-able in the literature for other loci. For the housekeepingisocitrate dehydrogenase (icd) locus and 17 strains in theEscherichia coli ECOR collection, 6% of the nucleotidesites analyzed (1212) were polymorphic, and the averagestrain to strain variation was 5.6%, a value just abovethe average for other housekeeping genes [24]. For theE. coli lactose permease locus (lacY), described as oneof the most conserved sites in this bacterium, 2.2% ofthe sites were polymorphic within an experimental setof seven strains [25]. It is difficult to understand the rea-sons for the low variability observed within R. legumin-

osarum hup loci. For the highly conserved E. coli lacY

and gapA loci, a strong positive selection pressure in fa-vor of a specific allele has been invoked [25,26], but thisis unlikely for the hup cluster for the following reasons.First, the three regions analyzed were chosen so thatthere should be little functional pressure for conserva-tion. Second, hup genes are only expressed in the symbi-otic part of their life cycle [10,16], when rhizobiadifferentiate into bacteroids, a state that, at least in sym-bioses with indeterminate nodules, many authors thinkis terminal [27]. And third, the scarcity of Hup+ strainssuggests that these genes are dispensable. A plausibleexplanation for the above results is that hup genes havebeen acquired by R. leguminosarum bv. viciae in a veryrecent event. This would explain both their scarcityand their conservation. The fact that hup genes are lo-cated in the pSym should facilitate their quick dissemi-nation and establishment within R. leguminosarum bv.viciae populations by lateral transfer [28–31], and mayprovide an explanation for their isolation from strainsof a geographically diverse origin (North America, Ger-many, Italy). The hup cluster would have probably beenacquired from an unknown Hup+ soil bacterium. Thiscould be an organism similar to Bradyrhizobium japoni-

cum, although not necessarily a plant symbiont: the B.

japonicum hup gene organization and sequence is verysimilar to that of R. leguminosarum bv. viciae [6] butthe genes are expressed in free-living conditions wherethey can support chemolithotrophic growth [32]. Thenewly acquired hup genes would be maintained in R.leguminosarum bv. viciae because they allow recyclingof the H2 generated during symbiotic nitrogen fixation.

Consistent with this new function, the genes were incor-porated into a symbiotic plasmid, where rapid evolutionof the hup cluster regulatory regions ensured coordinateexpression of hup and nif genes under symbiotic condi-tions. Given the potential (see above) and demonstrated(our unpublished results) advantages of the hup systemfor the symbiosis, it is expected that Hup+ strains shouldbecome, in time, prevalent in agricultural soils. In thisrespect, it is noteworthy that most of the availableNorth American Hup+ strains are within the group ofmost effective isolates selected by the Nitragin Companypreviously to the analysis of their Hup phenotype.

Acknowledgements

This work was supported by the Consejeria deEducacion y Cultura de la Comunidad de Madrid(Programa Grupos Estrategicos) and by grantsBIO2004-5385 (to J.I.) and BIO2004-251 (to J.M.P.).

References

[1] Winter, H.C. and Burris, R.H. (1968) Stoichiometry of theadenosine triphosphate requirement for N2 fixation and H2

evolution by a partially purified preparation of Clostridium

pasteurianum. J. Biol. Chem. 243, 940–944.[2] Simpson, F.B. and Burris, R.H. (1985) A nitrogen pressure of 50

atmospheres does not prevent evolution of hydrogen by nitroge-nase. Science 224, 1095–1097.

[3] Schubert, K.R. and Evans, H.J. (1976) Hydrogen evolution: amajor factor affecting the efficiency of nitrogen fixation innodulated symbionts. Proc. Natl. Acad. Sci. USA 73, 1207–1211.

[4] Arp, D.J. (1992) Hydrogen cycling in symbiotic bacteria In:Biological Nitrogen Fixation (Stacey, G., Burris, R.H. and Evans,H.J., Eds.), pp. 432–460. Chapman and Hall, New York.

[5] Maier, R.J. and Triplett, E.W. (1996) Toward more productive,efficient, and competitive nitrogen-fixing symbiotic bacteria. CRCCrit. Rev. Plant Sci. 15, 191–234.

[6] Ruiz-Argueso, T., Imperial, J. and Palacios, J.M. (2000) Uptakehydrogenase in root nodule bacteria In: Prokaryotic NitrogenFixation: A Model System for Analysis of a Biological Process(Triplett, E.W., Ed.), pp. 489–507. Horizon Science Press,Wymondham, UK.

[7] Albrecht, S.L., Maier, R.J., Hanus, F.J., Russell, S.A., Emerich,D.W. and Evans, H.J. (1979) Hydrogenase in Rhizobium japon-

icum increases nitrogen fixation by nodulated soybeans. Science203, 1255–1257.

[8] Ruiz-Argueso, T., Palacios, J.M. and Imperial, J. (2001) Regu-lation of the hydrogenase system in Rhizobium leguminosarum.Plant Soil 230, 49–57.

[9] Leyva, A., Palacios, J.M., Mozo, T. and Ruiz-Argueso, T. (1987)Cloning and characterization of hydrogen uptake genes fromRhizobium leguminosarum. J. Bacteriol. 169, 4929–4934.

[10] Brito, B., Palacios, J.M. and Imperial, J., et al. (1995)Temporal and spatial co-expression of hydrogenase andnitrogenase genes from Rhizobium leguminosarum bv. viciaein pea (Pisum sativum L.) root nodules. Mol. Plant-MicrobeInteract. 8, 235–240.

[11] Brito, B., Martinez, M. and Fernandez, D., et al. (1997)Hydrogenase genes from Rhizobium leguminosarum bv. viciae

88 D. Fernandez et al. / FEMS Microbiology Letters 253 (2005) 83–88

are controlled by the nitrogen fixation regulatory protein NifA.Proc. Natl. Acad. Sci. USA 94, 6019–6024.

[12] Evans, H.J., Russell, S.A., Hanus, F.J. and Ruiz-Argueso, T.(1988) The importance of hydrogen recycling in nitrogen fixationby legumes In: World Crops: Cool Season Food Legumes(Summerfield, R.J., Ed.), pp. 777–791. Kluwer Academic Pub-lishers, Boston.

[13] Leyva, A., Palacios, J.M. and Ruiz-Argueso, T. (1987) Conservedplasmid hydrogen-uptake (hup)-specific sequences within Hup+

Rhizobium leguminosarum strains. Appl. Environ. Microbiol. 53,2539–2543.

[14] Tichy, H.V. and Lotz, W. (1981) Identification and characteriza-tion of large plasmids in newly isolated strains of Rhizobium

leguminosarum. FEMS Microbiol. Lett. 10, 203–207.[15] Leyva, A., Palacios, J.M., Murillo, J. and Ruiz-Argueso, T. (1990)

Genetic organization of the hydrogen uptake (hup) cluster fromRhizobium leguminosarum. J. Bacteriol. 172, 1647–1655.

[16] Palacios, J.M., Murillo, J., Leyva, A. and Ruiz-Argueso, T. (1990)Differential expression of hydrogen uptake (hup) genes in vege-tative and symbiotic cells of Rhizobium leguminosarum. Mol. Gen.Genet. 221, 363–370.

[17] Vincent, J.M. (1970) A Manual for the Practical Study of Root-Nodule Bacteria. Blackwell Scientific Publications, Oxford.

[18] Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) MolecularCloning: A Laboratory Manual. Cold Spring Harbor Laboratory,Cold Spring Harbor, NY.

[19] Eckhardt, T. (1978) A rapid method for the identification ofplasmid deoxyribonucleic acid in bacteria. Plasmid 1, 584–588.

[20] Brito, B., Palacios, J.M., Hidalgo, E., Imperial, J. and Ruiz-Argueso, T. (1994) Nickel availability to pea (Pisum sativum L.)plants limits hydrogenase activity of Rhizobium leguminosarum

bv. viciae bacteroids by affecting the processing of the hydrog-enase structural subunits. J. Bacteriol. 176, 5297–5303.

[21] Brito, B., Monza, J., Imperial, J., Ruiz-Argueso, T. and Palacios,J.M. (2000) Nickel availability and hupSL activation by heterol-ogous regulators limit symbiotic expression of the Rhizobium

leguminosarum bv. viciae hydrogenase system in Hup� rhizobia.Appl. Environ. Microbiol. 66, 937–942.

[22] Baginsky, C., Brito, B., Imperial, J., Palacios, J.M. and Ruiz-Argueso, T. (2002) Diversity and evolution of hydrogenasesystems in rhizobia. Appl. Environ. Microbiol. 68, 4915–4924.

[23] Eberhard, W.G. (1990) Evolution in bacterial plasmids and levelsof selection. Quart. Rev. Biol. 65, 3–22.

[24] Wang, F.-S., Whittam, T.S. and Selander, R.K. (1997) Evolution-ary genetics of the isocitrate dehydrogenase gene (icd) inEscherichiacoli and Salmonella enterica. J. Bacteriol. 179, 6551–6559.

[25] Wagner, R.R. and Riley, M.A. (1996) Low synonymous sitevariation at the lacY locus in Escherichia coli suggests the actionof positive selection. J. Mol. Evol. 42, 79–84.

[26] Guttman, D.S. and Dykhuizen, D.E. (1994) Detecting selectivesweeps in naturally occurring Escherichia coli. Genetics 138, 993–1003.

[27] Denison, R.F. (2000) Legume sanctions and the evolution ofsymbiotic cooperation by rhizobia. Am. Nat. 156, 567–576.

[28] Geniaux, E. and Amarger, N. (1993) Diversity and stability ofplasmid transfer in isolates from a single field population ofRhizobium leguminosarum bv. viciae. FEMS Microbiol. Ecol. 102,251–260.

[29] Laguerre, G., Mavingui, P. and Allard, M.R., et al. (1996)Typing of rhizobia by PCR DNA fingerprinting and PCR-restriction fragment length polymorphism analysis of chromo-somal and symbiotic gene regions: application to Rhizobium

leguminosarum and its different biovars. Appl. Environ. Micro-biol. 62, 2029–2036.

[30] Louvrier, P., Laguerre, G. and Amarger, N. (1996) Distributionof symbiotic genotypes in Rhizobium leguminosarum biovar viciaepopulations isolated directly from soils. Appl. Environ. Micro-biol. 62, 4202–4205.

[31] Rigottier-Gois, L., Turner, S.L., Young, J.P.W. and Amarger, N.(1998) Distribution of repC plasmid-replication sequences amongplasmids and isolates of Rhizobium leguminosarum bv. viciae fromfield populations. Microbiology 144, 771–780.

[32] Hanus, F.J., Maier, R.J. and Evans, H.J. (1979) Autotrophicgrowth of H2 uptake positive strains of Rhizobium japonicum in anatmosphere supplied with H2 gas. Proc. Natl. Acad. Sci. USA 76,1788–1792.