JOURNAL OF VIROLOGY, June 2008, p. 5672–5682 Vol. 82, No. 120022-538X/08/$08.00�0 doi:10.1128/JVI.01330-07Copyright © 2008, American Society for Microbiology. All Rights Reserved.

Human Immunodeficiency Virus Type 1 Vpr Binds to the N Lobe ofthe Wee1 Kinase Domain and Enhances Kinase Activity for Cdc2�

Masakazu Kamata,1 Nobumoto Watanabe,3 Yoshiko Nagaoka,2 and Irvin S. Y. Chen1*Department of Microbiology, Immunology and Molecular Genetics, University of California at Los Angeles, David Geffen School of

Medicine, 615 Charles E. Young Dr. South, BSRB 173, Los Angeles, California 900951; Department of Molecular andMedical Pharmacology, University of California at Los Angeles, David Geffen School of Medicine, 710 Westwood Plaza,

Los Angeles, California 900952; and Antibiotics Laboratory, Discovery Research Institute,Riken 2-1, Hirosawa, Wako, Saitama 351-0198, Japan3

Received 18 June 2007/Accepted 26 March 2008

Human immunodeficiency virus type 1 Vpr is a virion-associated accessory protein that has multipleactivities within an infected cell. One of the most dramatic effects of Vpr is the induction of cell cycle arrest atthe G2/M boundary, followed by apoptosis. This effect has implications for CD4� cell loss in AIDS. In normalcell cycle regulation, Wee1, a key regulator for G2-M progression, phosphorylates Tyr15 on Cdc2 and therebyblocks the progression of cells into M phase. We demonstrate that Vpr physically interacts with Wee1 at theN lobe of the kinase domain analogous to that present in other kinases. This interaction with Vpr enhancesWee1 kinase activity for Cdc2. Overexpression of Wee1 kinase-deficient mutants competes for Vpr-mediatedcell cycle arrest, and deletion of the region of Wee1 that binds Vpr abrogates that competition. However, theVpr mutants I74P and I81P, which fail to induce G2 arrest, can bind to and increase the kinase activity of Wee1to the same extent as wild-type Vpr. Therefore, we conclude that the binding of Vpr to Wee1 is not sufficientfor Vpr to activate the G2 checkpoint, and it may reflect an independent function of Vpr.

Human immunodeficiency virus type 1 (HIV-1) is a memberof the lentivirus family. In addition to the gag, pol, and envgenes, which are found in all simple retroviruses, the lentivi-ruses also contain a number of accessory genes. Some of thesegenes are required for HIV-1 replication, whereas others havebeen implicated in pathogenesis. One such gene, vpr, encodesa 14-kDa, 96-amino-acid (aa) nuclear protein that is highlyconserved between HIV-1, HIV-2, and simian immunodefi-ciency virus (SIV) isolates (15, 57). In addition to vpr, HIV-2and SIV also contain vpx, which is closely related to vpr andprobably arose through a gene duplication event (46). Thedeletion of both vpr and vpx from SIV resulted in an acuteinfection, but no disease was observed in rhesus monkeys,indicating that both genes are required for pathogenesis(11). HIV-1 carries vpr alone, which is thought to encompassthe functions of both vpr and vpx genes found within HIV-2and SIV.

A number of functions have been defined in vitro for HIV-1Vpr that are necessary for viral replication and may be impor-tant for pathogenesis (reviewed in reference 25). Vpr wasshown to possess a weak transcriptional transactivation activity(6, 37) and was required for productive infection of nondivid-ing cells such as macrophages (3, 8, 9, 12, 52). Analysis of themature virions has shown that, through an interaction with Gagp6, Vpr is incorporated into virions (15, 26, 29). Vpr has anuclear subcellular localization (19, 27, 28). After infection,virion-associated Vpr may contribute, in conjunction with the

matrix protein (5), integrase (10), and CPPT (60), to localizethe preintegration complex to the nucleus (14, 40).

A particularly noteworthy effect of Vpr is the arrest of thedivision of infected T cells at the G2-to-M phase transition ofthe cell cycle. The cells subsequently undergo death via apop-tosis (1, 44, 45, 51, 55). We hypothesize that this phenotypiceffect of the vpr gene could have a profound effect on the T-cellimmune function and contribute to the progression of HIV-1disease. We propose that one role of the arrest induced by Vprmay be to prevent the efficient activation and subsequentclonal expansion of CD4� T cells that would be engaged in animmune response. Rapid death of infected cells would alsolimit the recognition of virus-infected cells by immune cells.The death of the cells will contribute to the characteristicCD4� cell decline in AIDS. In support of this model, Vprtransgenic mice showed effects on T-cell depletion and sup-pression of cellular immune function (56).

The normal cell cycle transition of cells from G2 to M isregulated by the Cdc2-cyclin B complex. The two primaryregulators of Cdc2 activity are Wee1 families and Cdc25 fam-ilies. Wee1 phosphorylates Tyr15 of Cdc2 to inhibit its activityand prevent the transition from G2 to M, whereas, Cdc25dephosphorylates Cdc2 to activate Cdc2 kinase activity andpromote the G2/M transition. Wee1 is necessary for Vpr-in-duced G2 arrest, as shown in genetic studies of Schizosaccha-romyces pombe (30). Our preliminary results with synchronizedHeLa cells indicate that Wee1 is initially stabilized duringVpr-mediated G2 cell cycle arrest, a finding consistent with theinactive state of Cdc2 during G2 cell cycle arrest (13, 18, 41). Incontrast, Wee1 levels are diminished after prolonged cell cyclearrest, Cdc2 is activated, and apoptosis occurs. Overexpressionof Wee1 inhibits Vpr-mediated apoptosis (59). Therefore, wehypothesize that modulation of Wee1 levels and/or activity

* Corresponding author. Mailing address: Department of Microbi-ology, Immunology and Molecular Genetics, University of Californiaat Los Angeles, David Geffen School of Medicine, 615 Charles E.Young Dr. South, BSRB 173, Los Angeles, CA 90095. Phone: (310)825-4793. Fax: (310) 267-1875. E-mail: syuchen@mednet.ucla.edu.

� Published ahead of print on 2 April 2008.

5672

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

vi o

n 16

Nov

embe

r 20

21 b

y 22

1.14

1.18

.231

.

may be a critical means by which Vpr induces cell cycle arrestand subsequent apoptosis.

Wee1 is a nuclear protein that is subject to multiple levels ofregulation, including reversible phosphorylation, proteolysis,and protein-protein interactions (2, 24, 31, 47, 50). Wee1 ki-nase activity appears to be controlled by three mechanisms.First, as demonstrated in S. pombe, Wee1 kinase activity isdownregulated during the M phase as a result of phosphory-lation in its catalytic domain by nim1/cdr1 (7, 39, 54). In addi-tion, phosphorylation at its N-terminal noncatalytic domain isalso responsible for its downregulation at the M phase (22, 38).Second, Wee1 levels decrease in M phase as a result of bothdecreased synthesis and increased degradation (50), the latterof which is mediated by SCF�-TrCP (48, 49). Finally, Wee1 canbe activated and stabilized through association with 14-3-3proteins (24, 42), although another group reports that thebinding of 14-3-3 inactivates Wee1A (21).

We previously demonstrated that Vpr-induced cell cycle ar-rest results in increased levels of Wee1 kinase in synchronizedHeLa cells (58). We observed that Vpr-induced G2 arrest cor-related with delayed degradation of Wee1 and that Cdc2 ac-tivity is reduced at G2/M in the presence of Vpr. Here, weexamine the effects of Vpr upon the kinase activity of Wee1.

MATERIALS AND METHODS

Antibodies and reagents. Anti-Flag antibody (M2; F1804), anti-Flag antibody-conjugated agarose beads (A1205), anti-�-tubulin antibody (T5201), normalmouse immunoglobulin G (IgG; I5381), normal rabbit IgG (I5006), doxycycline(Dox; D9891), a cocktail of protease inhibitors (P8465), aprotinin (A1153),proteasome inhibitor (C2211), Flag peptide (F3290), nocodazole (M1404), andhuman transthyretin (P1742) were purchased from Sigma-Aldrich (St. Louis,MO). Anti-hemagglutinin (HA) antibody (HA.11, MMS-101P) and anti-HAantibody-conjugated Sepharose beads (AFC-101P) were obtained from Covance(Princeton, NJ). Anti-actin (SC-1616), anti-Cdc2 (SC-747), anti-Wee1 (SC-325[polyclonal antibody] and SC-5285 [monoclonal antibody]) were purchased fromSanta Cruz Biotechnology (Santa Cruz, CA). Antibody specific for phosphory-lated Tyr15 on Cdc2 was purchased from Cell Signaling Technology (Danvers,MA). [�-32P]ATP (PB10218), glutathione-Sepharose 4FF, and protein A andprotein G-Sepharose 4FF, glutathione S-transferase (GST)-PreScission proteasewere obtained from GE Healthcare (Piscataway, NJ).

Construction of plasmids. Flag-tagged wild-type Vpr and Vpr stop mutantwere PCR amplified as described previously (23, 32) and cloned into the BSvector (18). Vpr S94/96A mutant was constructed by PCR based mutagenesisaccording to the protocol of Zhou and Ratner (61). Vpr I74A, Vpr I74P, and VprI81P mutants were constructed by PCR-based mutagenesis as described previ-ously (34).

Full-length and deletion mutants of Wee1 (human somatic type Wee1,Wee1A) were PCR amplified by using HA-tagged Wee1 (59) as a template withthe following primer sets and cloned into the pVAX1 vector (Invitrogen, Carls-bad, CA): 1-646, CGATATCGCCATGACCAGCTACCCATACGATGTTCCAGATTACGCCAGCTTCCTGAGCCGACAGC (HA Wee1 sense) and GACTAGTTCACAGATCCTCTTCAGAGATGAGTTTCTGTTCGTATATAGTAAGGCTGAC; 1-422, HA Wee1 sense and GACTAGTTCACAGATCCTCTTCAGAGATGAGTTTCTGTTCCAAAGACATTGAATGAAT; 1-392, HA Wee1sense and GACTAGTTCACAGATCCTCTTCAGAGATGAGTTTCTGTTCGTAGTTTTCACTTATAGC; 1-369; HA Wee1 sense and CACTAGTTCACAGATCCTCTTCAGAGATGAGTTTCTGTTCATCTTCTGCCCACGCAGAG; and1-322, HA Wee1 sense and CACTAGTTCACAGATCCTCTTCAGAGATGAGTTTCTGTTCGCATCCATCCAGCCTCTTC.

For GST fusion constructs of Wee1, full-length and deletion mutants of Wee1containing a GST tag at the N terminus and an HA tag at the C terminus werePCR amplified by using HA-tagged Wee1 (59) as a template with the followingprimer sets and cloned into pGEX-6P vector (GE Healthcare): 1-646, GTGCGGATCCATGAGCTTCCTGAGCCGACA and GCTATGCGGCCGCTAAGCATAGTGTGGGAC (HA reverse); 291-646, GCGCCGGATCCATGAAGTCCCGGTATACAAC (291 sense) and HA reverse; 291-422, 291 sense and CGCGACTAGTCTAAGCGTAGTCTGGGACGTCGTATGGGTAAGCCAAAGACAT

TGAATGAATATAC; 291-392, 291 sense and CGCGACTAGTCTAAGCGTAGTCTGGGACGTCGTATGGGTAAGCGTAGTTTTCACTTATAGC; 291-380, 291sense and CGCGACTAGTCTAAGCGTAGTCTGGGACGTCGTATGGGTAAGCATTACAATATTCATTCTG; 291-369, 291 sense and AGCTAGCTAAGCGTAGTCTGGGACGTCGTATGGGTAAGCATCTTCTGCCCACGCAGA (369reverse); 291-323, 291 sense and GCGCGACTAGTCTAAGCGTAGTCTGGGACGTCGTATGGGTAAGCGCATCCATCCAGCCTC; and 324-369, CCGAGATCTATTTATGCCATTAAGCG and 369 reverse.

GST-tagged Wee1 �291-369 was constructed by PCR-based mutagenesis withGST-tagged 1-422 as a template and the following primer set: CAATGATCATATGCTTATACAGAATGAATATTG and CTTTCAGTAATTGTAATTCTCTTAGCAGG.

Lentiviral vector pLV-TH encoding HA-tagged Wee1 was constructed bysubcloning of HA-tagged Wee1 from HR�Wee1 (59). All plasmid constructswere confirmed by DNA sequencing.

Cell culture and viruses. Maintenance of HeLa and 293T cells, synchroniza-tion at G1/S phase by double thymidine block, gamma irradiation, and cell cycleanalysis were performed as described previously (58). HR�EGFP and HR� wild-type Vpr or Vpr mutants viruses were produced in 293T cells by cotransfectionand titrated as described previously (58). The Dox-inducible HeLa cell line stablyexpressing HA-tagged Wee1 was established by coinfection of HeLa cells withlentiviral vectors pLV-TH encoding HA-tagged Wee1 and pLV-tTR-KRAB(53).

Preparation of recombinant proteins. All GST fusion proteins were expressedin Rosetta-gami2 (Novagen, Madison, WI) and purified with glutathione-Sepha-rose 4FF as described previously (20). Plasmids encoding Flag-tagged wild andmutant forms of Vpr or Flag-tagged hrGFP (Stratagene, La Jolla, CA) weretransfected into 293T cells by calcium phosphate transfection. At 48 h, the cellswere lysed in cold CHAPS buffer (0.5 M NaCl, 0.05 M Tris-HCl [pH 8.5], 0.15M KCl, 5 mM CHAPS [USB, Cleveland, OH]) containing a cocktail of proteaseinhibitors, aprotinin, and proteasome inhibitor. Lysates were centrifuged at 4°Cfor 30 min at 100,000 � g, and supernatants were subjected to immunoprecipi-tation with anti-Flag antibody-conjugated agarose beads. After five washes withCHAPS buffer, Flag-tagged proteins were eluted with Flag peptide diluted inWee1 kinase buffer (see below). The purity of each protein was confirmed bysodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) andsilver staining (PlusOne silver staining kit; GE Healthcare). The levels of con-tamination of endogenous Wee1 protein in the purified Flag-tagged proteinfractions were checked by Western blotting with anti-Wee1 polyclonal antibody.

Protein-protein interaction. Interaction between Vpr and Wee1 was analyzedby two methods: immunoprecipitation and GST-pull down assay. For immuno-precipitation of endogenous Wee1, HeLa cells were transfected with plasmidencoding either Flag-tagged Vpr or Vpr stop mutant. For immunoprecipitationof exogenously expressed Wee1, HeLa cells were cotransfected with plasmidsencoding HA-tagged Wee1 and either Flag-tagged Vpr or Vpr stop mutant byelectroporation (33). At 48 h, cell lysates were prepared in CHAPS buffercontaining a cocktail of protease inhibitors, aprotinin, and proteasome inhibitorand then centrifuged at 4°C for 30 min at 100,000 � g. Supernatants weresubjected to immunoprecipitation with anti-Flag antibody for Vpr or anti-HAantibody for HA-Wee1. The immunoprecipitates were analyzed by Westernblotting with anti-Wee1 monoclonal antibody or anti-Flag antibody, respectively.

For analysis of direct binding between Wee1 and Vpr, GST-tagged Vpr (GST-Vpr) and full-length Wee1 containing a GST tag at the N terminus and an HAtag at the C terminus were expressed and purified as described above. The GSTtag on Wee1 was released by on-column cleavage with GST-PreScission pro-tease. The purity and concentration of released Wee1 was confirmed by SDS-PAGE and silver staining. Various amounts of Wee1 were incubated with eitherGST or GST-Vpr preadsorbed on glutathione-Sepharose 4FF beads in CHAPSbuffer for 2 h at 4°C. The beads were washed, and the amount of Wee1 boundto GST-Vpr was analyzed by SDS-PAGE and silver staining.

For analysis of the Vpr-binding region in Wee1, full-length and deletionmutants of Wee1 containing a GST tag at the N terminus and an HA tag at theC terminus were expressed and purified as described above. A total of 50 pmoleach of GST-tagged Wee1 was preadsorbed on a glutathione-Sepharose 4FFcolumn and incubated in CHAPS buffer for 2 h at 4°C with 0.5 mg of HeLa celllysate transfected with Flag-tagged Vpr encoding expression vector. The beadswere washed, and the amount of Flag-tagged Vpr bound to Wee1 was analyzedby Western blotting with anti-Flag antibody.

In vitro Wee1 kinase assay. In vitro Wee1 kinase assay was performed usingtwo different sources of Wee1: (i) affinity-purified HA-tagged Wee1 from HeLacells coexpressing HA-tagged Wee1 and either Flag-tagged Vpr or Vpr stopmutant using anti-HA antibody-conjugated Sepharose beads and (ii) affinity-purified GST-tagged Wee1 (GST-Wee1) from SF9 cells (Novagen) using gluta-

VOL. 82, 2008 UPREGULATION OF Wee1 THROUGH BINDING WITH Vpr 5673

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

vi o

n 16

Nov

embe

r 20

21 b

y 22

1.14

1.18

.231

.

thione-Sepharose 4FF beads. Affinity-purified HA-tagged Wee1 were incubatedwith 4 U of Cdc2-cyclinB complex (P6020S; NEB, Ipswich, MA) in 60 �l of Wee1kinase buffer (50 mM Tris-HCl [pH 7.5], 10 mM MgCl2, 10 mM MnC12, 1 mMdithiothreitol, 0.4 mM ATP) for 15 min at 30°C. Reactions were stopped byadding 5� SDS-PAGE sample buffer, followed by heating to 100°C for 5 min,and then analyzed by SDS-PAGE, followed by Western blotting with antibodyspecific for phosphorylated Tyr15 on Cdc2. In vitro kinase assay with GST-Wee1and GST-cyclin B/Cdc2 KR complex as a substrate was performed as describedpreviously (50) in the presence or absence of Flag-tagged Vpr, Vpr mutants, orhrGFP.

Competition for G2 arrest induced by Vpr. The expression plasmids for Wee1deletion mutants containing an HA tag at the N terminus and a Myc tag at the

C terminus were introduced into HeLa cells by nucleofection (Amaxa, Inc.,Gaithersburg, MD) using program I-13. We routinely obtained �95% transfec-tion efficiency as monitored by EGFP expression. The cells were then synchro-nized at G1/S phase by a double thymidine block as described above and infectedwith HR�EGFP or HR� wild-type Vpr or gamma irradiated at 4,000 rads. Cellcycle profiles were analyzed at 14 h postinfection.

RESULTS

Vpr enhances the specific kinase activity of Wee1. We pre-viously demonstrated that the half-life of Wee1 is enhanced in

FIG. 1. Vpr enhances the specific kinase activity of Wee1. (A) Expression of HA-tagged Wee1 (HA-Wee1) was induced by 10 �g of Dox/mland analyzed by Western blotting with anti-HA antibody after 72 h of culture. (B) HA-Wee1-expressing HeLa cells were synchronized at the G1/Sphase by a double-thymidine block and infected without (mock) or with lentiviral vector encoding either Flag-tagged Vpr (Vpr) or I81P mutant(I81P). Cell cycle profiles with (“�”) or without (“”) Dox induction were analyzed by flow cytometry at 14 h postinfection. The number in eachpanel indicates the percentage of cells in each peak. (C) HA-Wee1-expressing HeLa cells were synchronized at the G1/S phase by a double-thymidine block and infected without (mock) or with lentiviral vector encoding Flag-tagged Vpr or Vpr I81P mutant (I81P). Cell lysates wereprepared at 8 h after release from the block for cells synchronized in G2/M phase by culture in the presence of 20 �M nocodazole for 4 h beforeharvesting or at 14 h for mock, Vpr, and I81P mutant. The levels of Wee1, including endogenous and HA-Wee1 (Wee1 whole), HA-Wee1(HA-Wee1), phosphorylated Cdc2 at Tyr 15 (p-Cdc2), whole Cdc2 (Cdc2 whole), Vpr, and actin (as a loading control), were analyzed by Westernblotting. (D) HA-Wee1-expressing HeLa cells were infected with either Flag-tagged wild-type Vpr or Vpr stop mutant encoding lentiviral vector.HA-Wee1 was affinity purified at 24 h postinfection from 0.05 mg of lysate with anti-HA antibody-conjugated Sepharose beads and incubated with4 U of cyclin B/Cdc2 complex in the presence of 0.4 mM ATP. The levels of phosphate incorporation at Tyr15 of Cdc2 kinase were analyzed byWestern blotting with antibody specific for phosphorylated Tyr15 of Cdc2, and the relative amounts were calculated by densitometry.

5674 KAMATA ET AL. J. VIROL.

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

vi o

n 16

Nov

embe

r 20

21 b

y 22

1.14

1.18

.231

.

the presence of Vpr. In the present study we determinedwhether there were qualitative changes in the kinase activity ofWee1 in the presence of Vpr. In order to control for thevarious levels of Wee1 in cells, we created an inducible cell linefor Wee1 expression (Fig. 1A). Because these cells overexpressan HA-tagged Wee1 in the presence of Dox, the absolutelevels of Wee1 are unaffected by the presence of Vpr. Thesecells are arrested in G2 in the presence of Vpr independent ofthe induction of Wee1 (Fig. 1B). Despite similar levels ofinduced and overexpressed Wee1, we observed significant en-hancement in phosphorylated Cdc2 in the presence of Vpr butnot in the presence of a loss-of-function mutant of Vpr for G2

arrest, the I81P mutant (see Fig. 6C) (34, 35), a finding com-parable to levels observed in cells synchronized at the G2/Mphase of the cell cycle. The levels of Cdc2 were comparableunder all conditions (Fig. 1C).

Since Wee1 is the primary kinase responsible for negativelyregulating the activity of Cdc2, we examined whether the ki-nase activity of Wee1 in the cells was altered in the presence ofVpr (Fig. 1D). HA-Wee1 was affinity-purified from cells ex-pressing or not expressing Vpr. The purified HA-Wee1 wasassayed for kinase activity on purified Cdc2 complexed withcyclin B. Phosphorylation at Tyr15 of Cdc2 kinase was alsoanalyzed by Western blotting with an antibody specific forphosphorylated Tyr15 of Cdc2. Our results demonstrate that inthe presence of Vpr the activity of HA-Wee1 to phosphorylateCdc2 is enhanced by 3.2-fold. The enhanced level of phosphor-ylated Cdc2 was similar to that seen in the cells expressing Vpr(compare Fig. 1D, upper left and upper right lanes).

Functional interaction between Vpr and Wee1. We furtheranalyzed by genetic means whether Vpr interacts in the samepathway leading to G2 arrest as does Wee1. We tested whethermutants of Wee1 lacking the core kinase domain, located be-tween aa 291 and 575 (43) could compete for Vpr-mediatedcell cycle arrest (Fig. 2). Two Wee1 mutants, 1-422 and 1-392,alleviated the cell cycle arrest when transfected into cells priorto the introduction of virion-associated Vpr. In the absence ofWee1 mutants, the percentage of cells in G2/M was 82%. Thiswas reduced to 64 and 73%, respectively, for 1-422 and 1-392.Larger truncations of Wee1 did not alleviate cell cycle arrest(1-369 and 1-322). The alleviation of G2 arrest was specific toG2 arrest induced by Vpr; no alleviation was observed whencells were arrested in G2 by gamma irradiation. Furthermore,the alleviation of cell cycle arrest could be partially abrogatedby increasing the dosage of Vpr through increasing the multi-plicity of infection (MOI) of virion-containing Vpr. At a virioninput of 500 ng of virion p24 antigen, the level of G2 arrest inthe presence of the competing Wee1 1-422 increased from 64to 76%. Therefore, these results suggest that Vpr interacts withWee1 at a common point in the pathway leading to cell cyclearrest, which is consistent with the enhanced kinase activity ofWee1 in the presence of Vpr.

Vpr directly interacts with Wee1. Given the results heredemonstrating enhancements in Wee1 kinase activity and al-leviation of cell cycle arrest by kinase-defective mutants ofWee1, as well as our previous studies demonstrating an in-crease in the half-life of Wee1 by Vpr, we tested whether thealterations in Wee1 kinase activity in the presence of Vprmight be the result of direct physical interactions betweenWee1 and Vpr. HeLa cells were transfected with Flag-tagged

Vpr. Coimmunoprecipitation of Vpr with antibody for endog-enous Wee1 was analyzed by Western blotting (Fig. 3A). Theresults demonstrate that Vpr is coimmunoprecipitated withantibodies to endogenous Wee1. HA-tagged Wee1, which isoverexpressed in HeLa cells, is also coimmunoprecipitatedwith Flag antibodies to Flag-tagged Vpr (Fig. 3B). We furthertested the direct interaction between Vpr and Wee1 usingGST-tagged Vpr and bacterially expressed and affinity-purifiedWee1 visualized by silver staining (Fig. 3C). Thus, Vpr candirectly physically interact with Wee1.

Vpr interacts with Wee1 aa 291 to 369. The region respon-sible for the interaction between Wee1 and Vpr was confirmedby expressing full-length Wee1 and deletion mutants of Wee1in Escherichia coli as GST fusion proteins (Fig. 3D and E).Purified GST fusion proteins were tested for interaction withFlag-tagged Vpr expressed in HeLa cells. Interaction was as-sayed by pulldown of GST fusion proteins and analysis byWestern blotting for coprecipitating Vpr. Successive trunca-tions of Wee1 from the amino and carboxy termini of Wee1delineated a region of Wee1 from aa 291 to 369 that retainedbinding activity to Vpr. Further deletion abolished the bindingactivity to Vpr.

While these studies were in progress, a crystal structure wasattained for the catalytic domain of human Wee1A complexedwith an active-site inhibitor (PD0407824) (43). The catalyticdomain of Wee1 is comprised of two parts, N and C lobes. TheN lobe is composed of two helical domains (B and C) andfive � strands (�1 to �5). The C helix is adjacent to a keyfunctional structure found in many kinases, known as the “ac-tivation segment.” In several kinases this activation segmentforms a loop that regulates kinase activity through the bindingof proteins to C (16). In the case of cyclin-dependent kinase(CDK), the binding of cyclin to CDK through C helix (alsocalled the PSTAIRE) reorients C helix and subsequentlycauses the conformational change of the “activation segment,”resulting in the activation of CDK (17). Interestingly, the Vpr-binding domain of Wee1 contains the C helix located be-tween aa 338 and 352; thus, it is possible that interaction of Vprwith the domain of Wee1 located between aa 291 and 369enhances the kinase activity of Wee1, thereby increasing phos-phorylation at the inhibitory Tyr15 and contributing to cellcycle arrest.

The Vpr-binding domain located between aa 291 and 369 inWee1 is required for the dominant-negative effect. In Fig. 2, weshowed that two Wee1 deletion mutants, 1-422 and 1-396,partially abrogated G2 arrest induced by Vpr. We then testedwhether a mutant of Wee1 lacking the Vpr-binding domainlocated between aa 291 and 369 competes for Vpr-mediatedG2 arrest (Fig. 4). In the absence of Wee1 mutants, the per-centage of cells in G2/M was ca. 55%. This was reduced to 40%for 1-422, which is similar to the results shown in Fig. 2. Im-portantly, the alleviation of G2 arrest could be abrogated bydeletion of the Vpr-binding domain (�291-369) in 1-422; thepercentage of cells in G2/M was increased to 63%. Theseresults provide further support for the model that Wee1 inter-acts with Vpr through the region located between aa 291 and369, and this interaction may be involved in G2 arrest inducedby Vpr.

Vpr stimulates Wee1 kinase activity. We determinedwhether Vpr would stimulate Wee1 activity in an in vitro assay

VOL. 82, 2008 UPREGULATION OF Wee1 THROUGH BINDING WITH Vpr 5675

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

vi o

n 16

Nov

embe

r 20

21 b

y 22

1.14

1.18

.231

.

FIG. 2. Alleviation of Vpr-induced G2 arrest by overexpression of Wee1 deletion mutants. (A) Constructs of Wee1 deletion mutants (leftpanel). Dark boxes represent the Wee1 kinase domain (43). All mutants contain an HA tag at the N terminus and a Myc tag at the C terminus.Wee1 deletion mutants and EGFP-encoding plasmids were introduced into HeLa cells by nucleofection according to the manufacturer’sinstructions (program I-13; Amaxa). The expression of Wee1 deletion mutants was analyzed by Western blotting with anti-HA antibody.�-Tubulin was the loading control (right panel). (B) Cells were synchronized at the G1/S phase by a double-thymidine block and then infectedwith lentiviral vector encoding either Flag-tagged Vpr (Vpr) or EGFP (as a control) at two different MOIs (350 and 500 ng of viral p24antigen per 105 cells), or gamma irradiated at 4,000 rads. Cells were stained with propidium iodide at 12 h postinfection, and cell cycleprofiles were analyzed by flow cytometry. A total of 10,000 events were collected and analyzed per sample. The number in each panelindicates the percentage of cells in each peak.

5676 KAMATA ET AL. J. VIROL.

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

vi o

n 16

Nov

embe

r 20

21 b

y 22

1.14

1.18

.231

.

FIG. 3. Vpr directly interacts with Wee1. (A) Flag-tagged Vpr (Vpr) or Vpr stop mutant (Stop) encoding plasmid was transfected into HeLacells. Cells were lysed in CHAPS buffer and used for immunoprecipitation. The lysates (2 mg) were incubated with either control normal rabbitIgG (NR IgG) or anti-Wee1 rabbit polyclonal antibody. The immunocomplexes were collected with protein A-Sepharose 4FF beads and analyzedby Western blotting with anti-Flag antibody for Vpr. Endogenous Wee1 in immunocomplexes was detected with anti-Wee1 mouse monoclonalantibody. (B) HA-tagged Wee1 (HA-Wee1) and either Flag-tagged Vpr (Vpr) or Vpr stop mutant (Stop) encoding plasmids were cotransfectedinto HeLa cells. Cells were lysed in CHAPS buffer and Flag-tagged Vpr was immunoprecipitated with either control normal mouse IgG (NMIgG)or anti-Flag antibody. The immunocomplexes were collected with protein G-Sepharose 4FF and analyzed by Western blotting with anti-HAantibody for HA-Wee1. Flag-tagged Vpr in immunocomplexes was detected with anti-Flag antibody. IgG, light chain of antibody used forimmunoprecipitation. Input, 1% of each lysate was loaded as controls for the expression of Vpr, Wee1, and HA-Wee1. (C) GST or GST-taggedVpr was incubated with various amounts of recombinant Wee1 (0, 12.5, 25, or 50 pmol) and pulled down by using glutathione-Sepharose 4FFbeads. The interaction was monitored by SDS-PAGE, followed by silver staining. (D, E, and F) Identification of the Vpr-binding domain in Wee1using GST pulldown assays. (D) Constructs of GST-tagged full-length and deletion mutants of Wee1. (E) A total of 50 pmol each of GST-taggedfull-length or deletion mutants of Wee1 preadsorbed on glutathione-Sepharose 4FF beads was incubated with 0.5 mg of HeLa cell lysatetransfected with Flag-tagged Vpr (Vpr) encoding expression vector. The amounts of Vpr bound to Wee1 were analyzed by Western blotting withanti-Flag antibody. Input, 0.5% of cell lysate was loaded as a control for Vpr expression. (F) Primary and secondary structures for Wee1 betweenaa 291 and 369 (left panel) and the three-dimensional structures for Wee1 between aa 291 and 575 (PDB 1x8B, right panel) (43). The Vpr-bindingdomain located from aa 291 to 369 is indicated by dark gray area on the three-dimensional structure. , -helix structure; �, �-sheet structure.

VOL. 82, 2008 UPREGULATION OF Wee1 THROUGH BINDING WITH Vpr 5677

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

vi o

n 16

Nov

embe

r 20

21 b

y 22

1.14

1.18

.231

.

FIG. 4. Vpr-binding domain located between aa 291 and 369 in Wee1 is required for the dominant-negative effect. (A) Constructs of Wee1deletion mutants (left panel). Dark boxes represent a part of the Wee1-kinase domain located from aa 291 to 575. The light gray box representsthe Vpr-binding domain located from aa 291 to 369. All mutants contain an HA tag at the N terminus and a Myc tag at the C terminus. Wee1deletion mutants and EGFP-encoding plasmids were introduced into HeLa cells by nucleofection according to the manufacturer’s instructions. Theexpression of Wee1 deletion mutants was analyzed by Western blotting with anti-HA specific antibody. �-Tubulin was the loading control (rightpanel). (B) Cells were synchronized at G1/S by a double-thymidine block and then infected with lentiviral vector encoding either Flag-tagged Vpr(Vpr) or EGFP (as a control) at two different MOIs (400 and 600 ng of viral p24 antigen per 105 cells), or gamma irradiated at 4,000 rads. Cellswere then stained with propidium iodide at 12 h postinfection and analyzed by flow cytometry. A total of 10,000 events were collected and analyzedper sample. The number in each panel indicates the percentage of cells in each peak.

5678 KAMATA ET AL. J. VIROL.

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

vi o

n 16

Nov

embe

r 20

21 b

y 22

1.14

1.18

.231

.

using purified proteins (Fig. 5). Full-length Vpr has been no-toriously difficult to purify as a recombinant protein in non-mammalian expression systems. Therefore, we chose to ex-press Vpr in the 293T cells and purify the expressed Vpr byaffinity purification using a Flag tag specific antibody. GST-tagged Wee1 was incubated with purified complexes ofCdc2KR, a kinase-defective form of Cdc2, and GST-taggedcyclin B (50). Under appropriate reaction conditions, Wee1will catalyze the incorporation of [�-32P]ATP into Tyr15 ofCdc2KR. The degree of Tyr15 phosphorylation was analyzedin the presence or absence of Vpr affinity purified from thetransfected 293T cells by using anti-Flag antibody-conjugatedagarose beads. In the presence of Vpr, we observed an approx-imately threefold enhancement in 32P incorporation intoCdc2KR relative to a reaction without (no protein) or reactionwith an irrelevant protein, Flag-tagged hrGFP (hrGFP), puri-fied in the same manner as Flag-tagged Vpr. The increasedlevels of 32P incorporation into Cdc2KR by Vpr were notobserved in the absence of GST-tagged Wee1 (data notshown), indicating that it was Wee1-dependent phosphoryla-tion. Thus, these results demonstrate that Vpr can stimulatethe kinase activity of Wee1 in an in vitro cell-free assay. Themajor species detected by silver staining after purification isFlag-tagged Vpr (see Fig. 7A), and there is no detectable levelof Wee1 derived from 293T cells on Western blotting analysis(see Fig. 7B); however, we cannot completely exclude the pres-ence of other proteins that may contribute to the activities weobserved.

Domains of Vpr that interact with Wee1. We expressedthree domains of Vpr—-helical region 1 (H1), -helicalregion 2 (H2), and the C terminus (C-term) of Vpr—asEGFP fusion proteins (19) and tested them in a GST pulldownassay for interaction with GST-Wee1 (Fig. 6). Since the en-hanced green fluorescent protein (EGFP) fusion proteins witheach Vpr domain predominantly localize in the nucleus (19),we used simian virus 40 large T nuclear localization signal-

conjugated EGFP as a control. Both H2 and the C-terminalregion of Vpr independently reacted with Wee1 (Fig. 6B). H1 did not interact with Wee1. The expression of wild-typeVpr-EGFP fusion protein could not be assayed since it was notstable in cells (Fig. 6A, right panel).

Point mutations in each of the above-determined domainshave been shown to abrogate Vpr-mediated cell cycle arrest.Figure 6C shows a typical result with mutation I74P in H2and mutation I81P in the C-terminal region of Vpr. Thesemutations strongly impair the G2 arrest activity of Vpr (34, 35).Wild-type Vpr and other mutants (I74A and S94/96A) thatinduce cell cycle arrest increase the levels of Wee1 and thelevels of phosphorylated Cdc2 (Fig. 6D). These mutants showdiminished levels of Wee1 and decreased phosphorylation ofCdc2. However, GST pulldown studies utilizing full-length ortruncated mutants of Wee1 still demonstrate interaction ofthese functionally defective Vpr mutants with Wee1 (Fig. 6E).Similar to wild-type Vpr, the I81P mutant interacts with full-length Wee1 and truncation variants of Wee1 that include thekinase and Vpr-binding domain of Wee1, but not further trun-cations; Wee1 291-380 binds Vpr and I81P mutant, whereasWee1 291-323 does not. Similar binding was observed whenthe I74P mutant was used instead of the I81P mutant (data notshown). These mutants of Vpr defective for cell cycle arreststill bind to Wee1. Therefore, solely the interaction betweenVpr and Wee1 appears to be insufficient for the cell cycle-arresting properties of Vpr and suggests that additional prop-erties or activities of the complex that includes Vpr and Wee1is necessary for cell cycle arrest by Vpr.

Since the mutants of Vpr still bind Wee1, we testedwhether the mutations had an effect upon the kinase activityof Wee1 in an in vitro kinase assay (Fig. 7). Flag-taggedhrGFP, wild-type Vpr, and I74P and I81P mutants wereaffinity purified from 293T cells (Fig. 7A and B). Additionsof the Vpr protein to the in vitro Wee1 kinase assay dem-onstrated increased phosphorylation of Cdc2KR by bothmutants at levels comparable to those seen with wild-typeVpr. The increased levels of 32P incorporation into Cdc2KRby wild-type Vpr or Vpr mutants were not observed in theabsence of GST-tagged Wee1 (data not shown). These re-sults are consistent with the interaction studies describedabove wherein mutants that abrogate cell cycle arrest arestill able to bind Wee1. Therefore, interaction between Vprand Wee1 correlates with increased kinase activity of Wee1;however, this increased activity is not sufficient for the in-duction of cell cycle arrest by Vpr, implicating other factorsin the Vpr-mediated cell cycle arrest.

DISCUSSION

These results provide biochemical and genetic evidence forthe interaction between Vpr and Wee1. Ectopic expression ofa C-terminal truncated Wee1 partially alleviates Vpr-mediatedcell cycle arrest. Physical interaction between Wee1 and Vpr isevidenced in GST pulldown assays and in coimmunoprecipita-tion assays. Importantly, we defined the domain of Wee1 withwhich Vpr interacts as a region that corresponds to the con-served C helix regulatory domain found in many kinases (16).Finally, we demonstrate that the interaction of Vpr with Wee1leads to an enhancement of Wee1 kinase activity on its primary

FIG. 5. Vpr stimulates Wee1 kinase activity. Flag-tagged Vpr(Vpr) and Flag-tagged hrGFP (hrGFP) were expressed in 293T cellsand affinity purified using anti-Flag antibody-conjugated agarosebeads. GST-tagged cyclin B and kinase-inactive form of Cdc2 complex(cyclin B/Cdc2KR) and GST-tagged Wee1 (GST-Wee1) were ex-pressed and purified from SF9 by using glutathione-Sepharose 4FFbeads. Cyclin B/Cdc2KR, GST-Wee1, and either Vpr or hrGFP (1pmol each) or buffer only (No protein) was mixed and incubated for 15min at 30°C in the presence of [�-32P]ATP (10 �Ci). The levels of 32Pincorporation into Cdc2KR were analyzed by SDS-PAGE and auto-radiography (arrowheads, left panel). The data shown are the resultsobtained in three independent reactions (lanes 1 to 3). The fold acti-vation is calculated relative to the value for “no protein” by densitom-etry (right panel). The bars represent the standard deviations of threeindependent reactions.

VOL. 82, 2008 UPREGULATION OF Wee1 THROUGH BINDING WITH Vpr 5679

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

vi o

n 16

Nov

embe

r 20

21 b

y 22

1.14

1.18

.231

.

physiologic substrate, Cdc2. Despite these interactions be-tween Vpr and Wee1, our results also show that these inter-actions are not solely responsible for the induction of cell cyclearrest by Vpr. Mutants of Vpr that do not induce cell cyclearrest can still bind to Wee1 and enhance in vitro kinaseactivity.

Our structural mapping studies of the Vpr-binding domaindelineate a key domain, the C helix domain of Wee1. Thisdomain is found in the �-sheet-rich N lobe of other kinases andis the only conserved helix structure; it is generically termedthe C helix domain. The C helix domain induces conforma-tional change within the catalytic domain of kinases throughthe interaction with N-terminal region of the activation loop(see the reviews in references 16 and 36). As a typical example,the regulation of CDK by cyclin has been well studied. CDKsare in a catalytically inactive state in the absence of cyclin.Cyclin binds the C helix domain of CDKs and induces con-formational changes in the C helix domain and activation

loop, resulting in the activation of CDKs (17). The crystalstructure of the Wee1 kinase domain suggested that the Chelix domain of Wee1 is present in an active conformation;however, our results indicate that it may still serve a regulatoryfunction. It should be noted that the crystal structure of Wee1was resolved only for its catalytic domain that lacks N-terminalregulatory domain located between aa 1 and 290 (43). Thus, itis possible that the conformation of the C helix of Wee1 maybe inactive for mature protein, or other cellular proteins mayalso recognize this domain and participate in the regulation ofWee1 kinase activity. Like other kinases, Wee1 activity mayalso be modulated via this C helix domain, and Vpr might actas an activator of Wee1.

We previously reported that the presence of Vpr leads toenhanced levels of Wee1 through protein stability. Here weshow that Vpr also enhances the specific kinase activity ofWee1. The dual effect of Vpr of increasing the Wee1 activitythrough the previously reported protein stabilization and in-

FIG. 6. Vpr binds Wee1 through two independent domains, H2 and C terminus domains. (A) Constructs of Flag-tagged Vpr (Vpr), H1 (aa17 to 34), H2 (aa 46 to 74), C terminus (aa 77 to 96), or the NLS of the large T antigen of SV40 fused to the N terminus of EGFP. Each Vprdomain is represented in black (left panel). Above EGFP fusion proteins (EGFP) and Flag-tagged Vpr (Vpr) were expressed in HeLa cells andanalyzed by Western blotting with anti-Flag antibody (right panel). (B) A total of 50 pmol each of GST (lanes 1, 3, 5, 7, 9, 11, and 13) orGST-tagged Wee1 (lanes 2, 4, 6, 8, 10, 12, and 14) preadsorbed on glutathione-Sepharose 4FF beads was incubated with 0.5 mg of HeLa cell lysateseither mock transfected (mock) or transfected with expression vectors shown in panel A. The amounts of EGFP fusion proteins (EGFP) andFlag-tagged Vpr (Vpr) bound to Wee1 were analyzed by Western blotting with anti-Flag antibody. (C and D) HeLa cells were synchronized at theG1/S phase by a double-thymidine block and then infected with equivalent amounts of lentiviral vector encoding Flag-tagged wild-type Vpr or Vprmutants as indicated. Cells were stained with propidium iodide and analyzed for cell cycle by flow cytometry. A total of 10,000 events were collectedand analyzed in each sample. The number in each panel indicates the percentage of cells in each peak (C). Whole-cell lysates were separated bySDS-PAGE and probed with antibodies to Wee1, phosphorylated Cdc2 (p-Cdc2), and actin (as a loading control). There were equivalent levelsof Vpr expressed from each sample (data not shown) (D). (E) A total of 50 pmol each of GST or GST-tagged full-length and deletion mutantsof Wee1 preadsorbed on glutathione-Sepharose 4FF beads was incubated with 0.5 mg of HeLa cell lysate transfected with either Flag-taggedVpr or Vpr I81P mutant (I81P) encoding expression vector. The amounts of Vpr or I81P mutant bound to Wee1 were analyzed by Western blottingwith anti-Flag antibody. Input, 0.5% of cell lysates were loaded as a control for Vpr expression.

5680 KAMATA ET AL. J. VIROL.

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

vi o

n 16

Nov

embe

r 20

21 b

y 22

1.14

1.18

.231

.

creasing the specific kinase activity are likely to play a role inthe mechanism by which Vpr induces cell cycle arrest. Al-though Wee1 is a key regulator of Cdc2 kinase, the activationof Wee1 activity by Vpr appears to be insufficient for cell cyclearrest by Vpr. This conclusion is evidenced by our observationswith loss-of-function mutants of Vpr. Although overexpressionof a C-terminal truncated version of Wee1 partially alleviatescell cycle arrest, supporting a common pathway for Vpr andWee1 in the induction of cell cycle arrest, mutants of Vpr thatdo not lead to cell cycle arrest and do not affect the phosphor-ylation levels of Cdc2 kinase in cells are still capable of bindingto Wee1 and enhance the phosphorylation of Cdc2 in vitro.Therefore, Vpr-mediated cell cycle arrest is unlikely to solelyinvolve enhancements in Wee1 levels or activity. A number ofother factors also play a role in the regulation of Cdc2 kinase,including the related Myt1 kinase related to Wee1 and Cdc25phosphatases, positive regulators of Cdc2, which in turn areregulated by 14-3-3 proteins. Vpr-mediated cell cycle arrest hasalso been shown to act through the ataxia-telangiectasia mu-tated and Rad3-related (ATR) kinase pathway. ATR kinaseresponses to double-stranded DNA breaks with ataxia-telan-giectasia mutated kinase and phosphorylates checkpoint ki-nase 1 (Chk1), an effector ATR kinase. By this phosphoryla-tion, Chk1 kinase is activated and then phosphorylates Wee1,as well as Cdc25, resulting in the activation of Wee1 kinaseactivity and the degradation of Cdc25, respectively (4, 24).There are likely to be as-yet-undefined interactions betweenthese factors, Vpr and Wee1, that in combination lead to cellcycle arrest by Vpr. Further work will be required to elucidatethe interactions among the multiple pathways potentially act-ing in concert to ultimately induce cell cycle arrest.

ACKNOWLEDGMENTS

We thank Didier Trono for lentiviral vectors, pLV-TH, and pLV-tTR-KRAB. We are grateful to Betty Poon for proofreading of themanuscript.

This study was supported by the NIH grants CA070018-13 (I.S.Y.C)and AI1028697-18 (UCLA CFAR).

REFERENCES

1. Andersen, J. L., J. L. Dehart, E. S. Zimmerman, O. Ardon, B. Kim, G.Jacquot, S. Benichou, and V. Planelles. 2006. HIV-1 Vpr-induced apoptosisis cell cycle dependent and requires Bax but not ANT. PLoS Pathog. 2:e127.

2. Azad, A. A. 2000. Could Nef and Vpr proteins contribute to disease progres-sion by promoting depletion of bystander cells and prolonged survival ofHIV-infected cells? Biochem. Biophys. Res. Commun. 267:677–685.

3. Balliet, J. W., D. L. Kolson, G. Eiger, F. M. Kim, K. A. McGann, A. Srini-vasan, and R. Collman. 1994. Distinct effects in primary macrophages andlymphocytes of the human immunodeficiency virus type 1 accessory genesvpr, vpu, and nef: mutational analysis of a primary HIV-1 isolate. Virology200:623–631.

4. Bartek, J., C. Lukas, and J. Lukas. 2004. Checking on DNA damage in Sphase. Nat. Rev. Mol. Cell. Biol. 5:792–804.

5. Bukrinsky, M. I., S. Haggerty, M. P. Dempsey, N. Sharova, A. Adzhubel, L.Spitz, P. Lewis, D. Goldfarb, M. Emerman, and M. Stevenson. 1993. Anuclear localization signal within HIV-1 matrix protein that governs infec-tion of non-dividing cells. Nature 365:666–669.

6. Cohen, E. A., E. F. Terwilliger, Y. Jalinoos, J. Proulx, J. G. Sodroski, andW. A. Haseltine. 1990. Identification of HIV-1 vpr product and function. J.Acquir. Immune Defic. Syndr. 3:11–18.

7. Coleman, T. R., Z. Tang, and W. G. Dunphy. 1993. Negative regulation of thewee1 protein kinase by direct action of the nim1/cdr1 mitotic inducer. Cell72:919–929.

8. Connor, R. I., B. K. Chen, S. Choe, and N. R. Landau. 1995. Vpr is requiredfor efficient replication of human immunodeficiency virus type-1 in mono-nuclear phagocytes. Virology 206:935–944.

9. Eckstein, D. A., M. P. Sherman, M. L. Penn, P. S. Chin, C. M. De Noronha,W. C. Greene, and M. A. Goldsmith. 2001. HIV-1 Vpr enhances viral burdenby facilitating infection of tissue macrophages but not nondividing CD4� Tcells. J. Exp. Med. 194:1407–1419.

10. Gallay, P., T. Hope, D. Chin, and D. Trono. 1997. HIV-1 infection ofnondividing cells through the recognition of integrase by the importin/karyo-pherin pathway. Proc. Natl. Acad. Sci. USA 94:9825–9830.

FIG. 7. A single point mutation in Vpr does not affect on activation for Wee1 kinase activity. (A) Silver staining for affinity-purified Flag-taggedhrGFP (hrGFP), wild-type Vpr (Vpr), Vpr I74P (I74P) and Vpr I81P (I81P) mutants. Various amounts of human transthyretin were used asstandards. (B) Affinity-purified Flag-tagged proteins, as well as total cell lysates (5 �g), were analyzed by Western blotting with anti-Wee1polyclonal and anti-Flag antibodies. (C) Cyclin B/Cdc2KR, GST-Wee1, and either Flag-tagged hrGFP, Vpr, or Vpr mutants (1.3 pmol each) weremixed and incubated for 15 min at 30°C in the presence of [�-32P]ATP (10 �Ci). The levels of 32P incorporation into Cdc2KR were analyzed bySDS-PAGE and autoradiography (arrowhead, left panel). The fold activation was calculated relative to the value for “no protein” by densitometry(right panel).

VOL. 82, 2008 UPREGULATION OF Wee1 THROUGH BINDING WITH Vpr 5681

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

vi o

n 16

Nov

embe

r 20

21 b

y 22

1.14

1.18

.231

.

11. Gibbs, J. S., A. A. Lackner, S. M. Lang, M. A. Simon, P. K. Sehgal, M. D.Daniel, and R. C. Desrosiers. 1995. Progression to AIDS in the absence ofa gene for vpr or vpx. J. Virol. 69:2378–2383.

12. Hattori, N., F. Michaels, K. Fargnoli, L. Marcon, R. C. Gallo, and G.Franchini. 1990. The human immunodeficiency virus type 2 vpr gene isessential for productive infection of human macrophages. Proc. Natl. Acad.Sci. USA 87:8080–8084.

13. He, J., S. Choe, R. Walker, P. Di Marzio, D. O. Morgan, and N. R. Landau.1995. Human immunodeficiency virus type 1 viral protein R (Vpr) arrestscells in the G2 phase of the cell cycle by inhibiting p34cdc2 activity. J. Virol.69:6705–6711.

14. Heinzinger, N. K., M. I. Bukinsky, S. A. Haggerty, A. M. Ragland, V. Kewal-ramani, M. A. Lee, H. E. Gendelman, L. Ratner, M. Stevenson, and M.Emerman. 1994. The Vpr protein of human immunodeficiency virus type 1influences nuclear localization of viral nucleic acids in nondividing host cells.Proc. Natl. Acad. Sci. USA 91:7311–7315.

15. Huang, L.-M., and K. T. Jeang. 1995. HIV Vpr: roles in viral replication andcellular metabolism, p. III-3–III-9. In G. Myers, B. Hahn, J. Mellors, and L.Henderson (ed.), Human retroviruses and AIDS. Los Alamos National Lab-oratory, Los Alamos, NM.

16. Huse, M., and J. Kuriyan. 2002. The conformational plasticity of proteinkinases. Cell 109:275–282.

17. Jeffrey, P. D., A. A. Russo, K. Polyak, E. Gibbs, J. Hurwitz, J. Massague, andN. P. Pavletich. 1995. Mechanism of CDK activation revealed by the struc-ture of a cyclin A-CDK2 complex. Nature 376:313–320.

18. Jowett, J. B., V. Planelles, B. Poon, N. P. Shah, M. L. Chen, and I. S. Chen.1995. The human immunodeficiency virus type 1 vpr gene arrests infected Tcells in the G2 � M phase of the cell cycle. J. Virol. 69:6304–6313.

19. Kamata, M., and Y. Aida. 2000. Two putative alpha-helical domains ofhuman immunodeficiency virus type 1 Vpr mediate nuclear localization by atleast two mechanisms. J. Virol. 74:7179–7186.

20. Kamata, M., Y. Nitahara-Kasahara, Y. Miyamoto, Y. Yoneda, and Y. Aida.2005. Importin-alpha promotes passage through the nuclear pore complex ofhuman immunodeficiency virus type 1 Vpr. J. Virol. 79:3557–3564.

21. Katayama, K., N. Fujita, and T. Tsuruo. 2005. Akt/protein kinase B-depen-dent phosphorylation and inactivation of WEE1Hu promote cell cycle pro-gression at G2/M transition. Mol. Cell. Biol. 25:5725–5737.

22. Kim, S. Y., E. J. Song, K. J. Lee, and J. E. Ferrell, Jr. 2005. MultisiteM-phase phosphorylation of Xenopus Wee1A. Mol. Cell. Biol. 25:10580–10590.

23. Kuramitsu, M., C. Hashizume, N. Yamamoto, A. Azuma, M. Kamata, N.Yamamoto, Y. Tanaka, and Y. Aida. 2005. A novel role for Vpr of humanimmunodeficiency virus type 1 as a regulator of the splicing of cellularpre-mRNA. Microbes Infect. 7:1150–1160.

24. Lee, J., A. Kumagai, and W. G. Dunphy. 2001. Positive regulation of Wee1by Chk1 and 14-3-3 proteins. Mol. Biol. Cell 12:551–563.

25. Le Rouzic, E., and S. Benichou. 2005. The Vpr protein from HIV-1: distinctroles along the viral life cycle. Retrovirology 2:11.

26. Lu, Y. L., R. P. Bennett, J. W. Wills, R. Gorelick, and L. Ratner. 1995. Aleucine triplet repeat sequence (LXX)4 in p6gag is important for Vpr incor-poration into human immunodeficiency virus type 1 particles. J. Virol. 69:6873–6879.

27. Lu, Y. L., P. Spearman, and L. Ratner. 1993. Human immunodeficiency virustype 1 viral protein R localization in infected cells and virions. J. Virol.67:6542–6550.

28. Mahalingam, S., R. G. Collman, M. Patel, C. E. Monken, and A. Srinivasan.1995. Functional analysis of HIV-1 Vpr: identification of determinants es-sential for subcellular localization. Virology 212:331–339.

29. Mahalingam, S., B. MacDonald, K. E. Ugen, V. Ayyavoo, M. G. Agadjanyan,W. V. Williams, and D. B. Weiner. 1997. In vitro and in vivo tumor growthsuppression by HIV-1 Vpr. DNA Cell Biol. 16:137–143.

30. Masuda, M., Y. Nagai, N. Oshima, K. Tanaka, H. Murakami, H. Igarashi,and H. Okayama. 2000. Genetic studies with the fission yeast Schizosaccha-romyces pombe suggest involvement of wee1, ppa2, and rad24 in induction ofcell cycle arrest by human immunodeficiency virus type 1 Vpr. J. Virol.74:2636–2646.

31. McGowan, C. H., and P. Russell. 1995. Cell cycle regulation of humanWEE1. EMBO J. 14:2166–2175.

32. Nishino, Y., T. Myojin, M. Kamata, and Y. Aida. 1997. Human immunode-ficiency virus type 1 Vpr gene product prevents cell proliferation on mouseNIH 3T3 cells without the G2 arrest of the cell cycle. Biochem. Biophys. Res.Commun. 232:550–554.

33. Nishizawa, M., M. Kamata, R. Katsumata, and Y. Aida. 2000. A carboxy-terminally truncated form of the human immunodeficiency virus type 1 Vprprotein induces apoptosis via G1 cell cycle arrest. J. Virol. 74:6058–6067.

34. Nishizawa, M., M. Kamata, T. Mojin, Y. Nakai, and Y. Aida. 2000. Inductionof apoptosis by the Vpr protein of human immunodeficiency virus type 1occurs independently of G2 arrest of the cell cycle. Virology 276:16–26.

35. Nishizawa, M., T. Myojin, Y. Nishino, Y. Nakai, M. Kamata, and Y. Aida.1999. A carboxy-terminally truncated form of the Vpr protein of humanimmunodeficiency virus type 1 retards cell proliferation independently of G2arrest of the cell cycle. Virology 263:313–322.

36. Nolen, B., S. Taylor, and G. Ghosh. 2004. Regulation of protein kinases;controlling activity through activation segment conformation. Mol. Cell 15:661–675.

37. Ogawa, K., R. Shibata, T. Kiyomasu, I. Higuchi, Y. Kishida, A. Ishimoto,and A. Adachi. 1989. Mutational analysis of the human immunodeficiencyvirus vpr open reading frame. J. Virol. 63:4110–4114.

38. Okamoto, K., and N. Sagata. 2007. Mechanism for inactivation of the mitoticinhibitory kinase Wee1 at M phase. Proc. Natl. Acad. Sci. USA 104:3753–3758.

39. Parker, L. L., S. A. Walter, P. G. Young, and H. Piwnica-Worms. 1993.Phosphorylation and inactivation of the mitotic inhibitor Wee1 by the nim1/cdr1 kinase. Nature 363:736–738.

40. Popov, S., M. Rexach, G. Zybarth, N. Reiling, M. A. Lee, L. Ratner, C. M.Lane, M. S. Moore, G. Blobel, and M. Bukrinsky. 1998. Viral protein Rregulates nuclear import of the HIV-1 pre-integration complex. EMBO J.17:909–917.

41. Re, F., D. Braaten, E. K. Franke, and J. Luban. 1995. Human immunode-ficiency virus type 1 Vpr arrests the cell cycle in G2 by inhibiting the activa-tion of p34cdc2-cyclin B. J. Virol. 69:6859–6864.

42. Rothblum-Oviatt, C. J., C. E. Ryan, and H. Piwnica-Worms. 2001. 14-3-3binding regulates catalytic activity of human Wee1 kinase. Cell GrowthDiffer. 12:581–589.

43. Squire, C. J., J. M. Dickson, I. Ivanovic, and E. N. Baker. 2005. Structure andinhibition of the human cell cycle checkpoint kinase, Wee1A kinase: anatypical tyrosine kinase with a key role in CDK1 regulation. Structure 13:541–550.

44. Stewart, S. A., B. Poon, J. B. Jowett, and I. S. Chen. 1997. Human immu-nodeficiency virus type 1 Vpr induces apoptosis following cell cycle arrest.J. Virol. 71:5579–5592.

45. Stewart, S. A., B. Poon, J. Y. Song, and I. S. Chen. 2000. Human immuno-deficiency virus type 1 vpr induces apoptosis through caspase activation.J. Virol. 74:3105–3111.

46. Tristem, M., C. Marshall, A. Karpas, and F. Hill. 1992. Evolution of theprimate lentiviruses: evidence from vpx and vpr. EMBO J. 11:3405–3412.

47. Wang, Y., C. Jacobs, K. E. Hook, H. Duan, R. N. Booher, and Y. Sun. 2000.Binding of 14-3-3beta to the carboxyl terminus of Wee1 increases Wee1stability, kinase activity, and G2-M cell population. Cell Growth Differ.11:211–219.

48. Watanabe, N., H. Arai, J. Iwasaki, M. Shiina, K. Ogata, T. Hunter, and H.Osada. 2005. Cyclin-dependent kinase (CDK) phosphorylation destabilizessomatic Wee1 via multiple pathways. Proc. Natl. Acad. Sci. USA 102:11663–11668.

49. Watanabe, N., H. Arai, Y. Nishihara, M. Taniguchi, N. Watanabe, T. Hunter,and H. Osada. 2004. M-phase kinases induce phospho-dependent ubiquiti-nation of somatic Wee1 by SCF�-TrCP. Proc. Natl. Acad. Sci. USA 101:4419–4424.

50. Watanabe, N., M. Broome, and T. Hunter. 1995. Regulation of the humanWEE1Hu CDK tyrosine 15-kinase during the cell cycle. EMBO J. 14:1878–1891.

51. Watanabe, N., T. Yamaguchi, Y. Akimoto, J. B. Rattner, H. Hirano, and H.Nakauchi. 2000. Induction of M-phase arrest and apoptosis after HIV-1 Vprexpression through uncoupling of nuclear and centrosomal cycle in HeLacells. Exp. Cell Res. 258:261–269.

52. Westervelt, P., T. Henkel, D. B. Trowbridge, J. Orenstein, J. Heuser, H. E.Gendelman, and L. Ratner. 1992. Dual regulation of silent and productiveinfection in monocytes by distinct human immunodeficiency virus type 1determinants. J. Virol. 66:3925–3931.

53. Wiznerowicz, M., and D. Trono. 2003. Conditional suppression of cellulargenes: lentivirus vector-mediated drug-inducible RNA interference. J. Virol.77:8957–8961.

54. Wu, L., and P. Russell. 1993. Nim1 kinase promotes mitosis by inactivatingWee1 tyrosine kinase. Nature 363:738–741.

55. Yao, X. J., N. Rougeau, G. Duisit, J. Lemay, and E. A. Cohen. 2004. Analysisof HIV-1 Vpr determinants responsible for cell growth arrest in Saccharo-myces cerevisiae. Retrovirology 1:21.

56. Yasuda, J., T. Miyao, M. Kamata, Y. Aida, and Y. Iwakura. 2001. T-cellapoptosis causes peripheral T-cell depletion in mice transgenic for theHIV-1 vpr gene. Virology 285:181–192.

57. Yu, X. F., M. Matsuda, M. Essex, and T. H. Lee. 1990. Open reading framevpr of simian immunodeficiency virus encodes a virion-associated protein.J. Virol. 64:5688–5693.

58. Yuan, H., M. Kamata, Y. M. Xie, and I. S. Chen. 2004. Increased levels ofWee-1 kinase in G2 are necessary for Vpr- and gamma irradiation-inducedG2 arrest. J. Virol. 78:8183–8190.

59. Yuan, H., Y. M. Xie, and I. S. Chen. 2003. Depletion of Wee-1 kinase isnecessary for both human immunodeficiency virus type 1 Vpr- and gammairradiation-induced apoptosis. J. Virol. 77:2063–2070.

60. Zennou, V., C. Petit, D. Guetard, U. Nerhbass, L. Montagnier, and P.Charneau. 2000. HIV-1 genome nuclear import is mediated by a centralDNA flap. Cell 101:173–185.

61. Zhou, Y., and L. Ratner. 2000. Phosphorylation of human immunodeficiencyvirus type 1 Vpr regulates cell cycle arrest. J. Virol. 74:6520–6527.

5682 KAMATA ET AL. J. VIROL.

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

vi o

n 16

Nov

embe

r 20

21 b

y 22

1.14

1.18

.231

.