JOANA MARQUES DA CUNHA

Host-parasite interactions in leishmaniasis

In vitro and in vivo study of Leishmania infantum strains isolated from

different human patients

Interações hospedeiro-parasita na leishmaniose

Estudo in vitro e in vivo de estirpes de Leishmania infantum isoladas

de diferentes doentes humanos

Tese de Candidatura ao grau de Doutor em

Patologia e Genética Molecular submetida ao

Instituto de Ciências Biomédicas Abel Salazar e

Faculdade de Medicina da Universidade do Porto

Orientador: Doutora Anabela Cordeiro da Silva

Categoria: Professor Associado com Agregação

Afiliação: Faculdade de Farmácia e Instituto de

Biologia Molecular e Celular, Universidade do

Porto, Portugal

Co-orientador: Doutor Javier Moreno

Categoria: Investigador titular

Afiliação: Centro Colaborador da OMS para a

Leishmaniose, Centro Nacional de Microbiologia,

Instituto de Salud Carlos III, Espanha

iii

Author’s declaration

The author of this thesis declares that she afforded a major contribution to the conceptual

design and technical execution of the work, interpretation of the results and manuscript

preparation of the accepted and submitted articles included in this dissertation.

Additionally, she hereby declares that the following original articles/communications were

prepared in the scope of this dissertation.

The candidate was supported by a doctoral fellowship (SFRH/BD/48626/2008) given by

the “Fundação para a Ciência e a Tecnologia” (FCT; Portugal). The Parasite Disease

Group at IBMC - Instituto de Biologia Molecular e Celular (Portugal) and the  WHO

Collaborating Center for Leishmaniasis at Centro Nacional de Microbiologia, Instituto de

Salud Carlos III (Spain) provided the facilities, reagents and logistical supports.

              

 

v

Scientific publications

ARTICLES IN INTERNATIONAL PEER-REVIEWED JOURNALS

In the scope of this dissertation

1. Cunha J, Carrillo E, Sánchez C, Cruz I, Moreno J and Cordeiro-da-Silva A:

Characterization of the biology and infectivity of Leishmania infantum

viscerotropic and dermotropic strains isolated from HIV+ and HIV- patients in

the murine model of visceral leishmaniasis. Parasites and Vectors 2013, 6:122

2. Santarém N and Cunha J, Silvestre R, Silva C, Moreira D, Ouellette M and Cordeiro-

da-Silva A: The impact of distinct culture media in Leishmania infantum biology

and infectivity. In press in Parasitology 2013

Participation in other publications in related fields

3. Lima SC, Silvestre R, Cunha J, Barros D, Baltazar MT, Dinis R, Cordeiro-da-Silva A:

Crucial CD8+ T lymphocyte cytotoxic role in amphotericin B nanospheres

efficacy against experimental visceral leishmaniasis. Submitted to Small 2013

4. Carrillo E, Jimenez MA, Sánchez C, Cunha J, Seva AP, Moreno J: Protein energy

malnutrition weakens the immune response and favors the progression of

visceral leishmaniasis in hamsters. Submitted to PLOS Negl Trop Dis 2013

5. Santos AC, Cunha J, Veiga F, Cordeiro-da-Silva A, Ribeiro AJ: Ultrasonication of

insulin microgel particles: impact on particle's size and insulin bioactivity.

Accepted in Carbohydrate Polymers 2013

6. Resende M, Moreira M, Cunha J, Augusto J, Neves B, Cruz MT, Estaquier J,

Cordeiro-da-Silva and Silvestre R: Leishmania-infected MHC-IIhigh dendritic cells

polarize CD4+ T cells towards a non-protective T-bet+INFγ+IL10+ phenotype.

Journal of immunology 2013, 191(1):262-73

7. Neves BM, Silvestre R, Resende M, Ouaissi A, Cunha J, Tavares J, Loureiro I,

Santarem N, Silva AM, Lopes MC et al: Activation of phosphatidylinositol 3-

kinase/Akt and impairment of nuclear factor-kappaB: molecular mechanisms

behind the arrested maturation/activation state of Leishmania infantum-infected

dendritic cells. The American journal of pathology 2010, 177(6):2898-2911.

vi

PUBLICATIONS OF SCIENTIFIC MEETINGS

In the scope of this dissertation

1. Cunha J (presenting author), Carrillo E, Sánchez C, Tavares J, Moreno J and

Cordeiro-da-Silva A: Characterization of the virulence of Leishmania infantum

isolates from human patients. Immunology 2012, 137, Issue Supplement s1

(Special Issue: Abstracts of the European Congress of Immunology, 5-8 September

2012, Glasgow, Scotland):555.

2. Cunha J (presenting author), Moreno J and Cordeiro-da-Silva A: Comparative study

between naturally attenuated and virulent strains of Leishmania infantum:

culture conditions and infectiveness. Acta Parasitológica Portuguesa 2010, 17(2;

Congresso Português de Parasitologia, 8-10 September 2010, Porto, Portugal):97.

Participation in other publications in related fields

3. Hanniffy S (presenting author), Sánchez C, Cunha J, Carrillo, Cañavate C, Moreno J:

Mucosal vaccination using non-pathogenic lactic acid bacteria as a strategy to

prevent morbidity and mortality caused by visceral Leishmaniasis European

Journal TM&IH Tropical Medicine & International Health 2011, 16 (Supplement 1 -

Special Issue: Abstracts of the 7th European Congress on Tropical Medicine and

International Health 3-6 October 2011 Barcelona, Spain.):198.

4. Neves B, Silvestre R, Cunha J, Tavares J, Resende M, Ouaissi A, Lopes MC, Cruz MT

& Cordeiro-da-Silva A: Immunomodulation of dendritic cells by virulent and

attenuated Leishmania infantum strains. European journal of immunology 2009,

39(Supplement 1/09 - Abstracts of the 2nd European Congress of Immunology,

September 13-16 2009, Berlim, Germany):365.

 

vii

POSTER COMMUNICATIONS

In the scope of this dissertation

1. Cunha J (presenting author), Carrillo E, Sánchez C, Tavares, J, Moreno J and

Cordeiro-da-Silva A: Characterization of the virulence of Leishmania infantum

isolates from human patients. 3rd European Congress of Immunology, September

5-8, 2012, Glasgow, Scotland, Poster 1168

2. Santarém N and Cunha J (presenting authors), Silva C, Moreira D, Silvestre R and

Cordeiro-da Silva A: The development of a semi-defined medium for growth of

Leishmania infantum. 3rd I3S Scientific Retreat, May 10-11, 2012, Póvoa de Varzim,

Portugal, Poster 14

3. Cunha J (presenting author), Moreno J, Cordeiro-da-Silva A: In vitro comparative

study between naturally attenuated and virulent strains of Leishmania

infantum. 2nd I3S Scientific Retreat, May 5-6, 2011, Póvoa de Varzim, Portugal,

Poster 12

4. Cunha J (presenting author), Moreno J, Cordeiro-da-Silva A: Comparative study

between naturally attenuated and virulent strains of Leishmania infantum:

culture conditions and infectiveness. XIV Congresso Português de Parasitologia

2010, Porto, Portugal, Poster P-31

Participation in other communications in related fields

5. Resende M (presenting author), Moreira D, Cunha J, Neves B, Lima SC, Cruz MT,

Cordeiro-da-Silva A & Silvestre R: Infected but not Bystander Dendritic Cells

polarize CD4+ T cells towards a non-protective T-bet+ INFγ+ IL10+ phenotype.

XXXVII Annual Meeting of the Portuguese Society for Immunology, November 29-

30, 2011, Oeiras, Portugal

6. Robalo AL (presenting author), Pereira JA, Resende M, Moreira D, Cunha J, Costa-

Lima S, Cordeiro-da-Silva A & Silvestre R: Activation of IL-27 p28 gene

transcription on antigen presenting cells infected with Leishmania infantum.

XXXVII Annual Meeting of the Portuguese Society for Immunology, November 29-

30, 2011, Oeiras, Portugal

viii

7. Hanniffy S (presenting author), Sánchez C, Cunha J, Carrillo, Cañavate C, Moreno

J: Mucosal vaccination using non-pathogenic lactic acid bacteria as a strategy

to prevent morbidity and mortality caused by visceral Leishmaniasis. 7th

European Congress on Tropical Medicine and International Health, October 3-6,

2011, Barcelona, Spain, Poster 1.3-106

8. Resende M, Cunha J, Costa-Lima S, Moreira D, Cordeiro-da-Silva A and Silvestre R

(presenting author): Early stages of visceral Leishmania infection. 2nd I3S

Scientific Retreat, May 5-6, 2011, Póvoa de Varzim, Portugal, Poster 23

9. Resende M (presenting author), Silvestre R, Neves B, Cunha J, Cruz MT &

Cordeiro-da-Silva A: Differential effect of Leishmania infantum on infected and

bystander dendritic cells. XXXVI Annual Meeting of the Portuguese Society for

Immunology, September 20-11, 2010, Braga, Portugal

10. Neves B, Silvestre R, Cunha J (presenting author), Tavares J, Resende M, Ouaissi

A, Lopes MC, Cruz MT & Cordeiro-da-Silva A: Immunomodulation of dendritic

cells by virulent and attenuated Leishmania infantum strains. 2nd European

Congress of Immunology 2009, Berlin, Germany, Poster PA11/60

ix

Acknowledgments

I am very grateful to everyone who directly or indirectly made this thesis possible to be

developed and concluded. During these more than five years I have worked with amazing

people that taught me everything I know in Science, helped me to be more critical about

what is known and more curious about the unknown. With all of you I grew up and

became the Scientist which I expect to have accurately transposed in this thesis.

To Professor Anabela I thank the opportunity for accepting me in her lab many years ago

where I gave my first steps in Science. Thank you for guiding me in the road that led me

to the accomplishment of this work.

To Javier I thank for his kindness when I first arrived to his lab, receiving me as part of

his family. It was just a first demonstration of the good heart he has. Thank you for

showing me that sometimes I just have to look at things in a more relaxed way.

Eugenia, what a friend and an inspiration you became to me! Thank you for listen to me,

think with me and work along me. Your support and open mind were essential. And if we

join Carmen “San”, no one can stop us! Carmen, tu alegría es contagiosa! Soy una persona

diferente después de haberte conocido.

To Isra, the “master of the Molecular Biology”, thank you for sharing your knowledge (but

never your primers or pipettes… ). To Sean, our Scottish “Clark Kent”, for making me

feel so well organized . Thanks for your company in some of the working weekends. To

Javier Nieto for first introduce me to Madrid. To Carmen Cañavate, Emi, Carmen

Chicharro, Maria Flores y las chicas del laboratório. To all of you in the Parasitology

Department for the several farewell parties you organized for me. Thank you all for your

kindness, especially Espe, Carolina, José and Chus.

To Ramona, “mi abuelita gallega”, thank you for making me feel at home in your home.

You truly represented my family in Madrid. Te echaré de menos.

I thank Mariana for the company in the late hours. When it was needed we did it. Thanks

for the chocolates and for our nice lunches outside IBMC. Sofia and Diana, thanks for

giving me a hand taking care of the cell cultures when I was in vacations. Ricardo, thanks

for your expertise in almost every subject. You rock! And Nuno, I still remember that it

was you who taught me how to do ELISAS. No one understands your music taste as I do… I

thank Joana Tavares for her dedication. Back in the old days you were an example to me.

x

To Lúcia, Inês, Vasco, Ana Luísa, Daniela and Patrícia, thanks for being part of this

journey at some point.

To my very best friends, Pi e Sarocas, I thank you both for always being there. We grew

up, we don’t have the time to be together as before, but I love when me manage to have

lunch just us 3 or to do a 6-pack program. I LUV U, girls!

I also thank Joaninha and Bárbara. We are such different 3 Pharmacists… Thanks for

presenting me your reality and helping me doing my choices.

I am very grateful to my family that gave me unconditional love and support. You taught

me to never give up and to fight for my goals. Mum, thanks for being my mumi. You try

your best, and I don’t know if you know, but you are the best! Dad, thank you for always

being there for me. I am so proud of being your daughter. I thank you both for raising me

and letting me fulfilled whatever dreams I had.

To Sérgio, my beautiful husband, I cannot express how grateful I am for your love,

support and patience. I am sorry for making you feel alone when I was gone, or tired of

waiting for me in “big experiment days”. Thank you so much for having me. We are now

ready to move one step forward in our lives. I love you very much. You’re everything…

I also thank to João Leandro for treating me as a daughter. Thanks to your lovely family

for being part of my family too. I appreciate your support. You’re great! Thanks to

Cristina and João for being part of my life too.

And to all the other members of my family, I thank for your love, support and wise

advices.

Finally, I would like to officially thank to FCT for believing in me and financing me with a

personal scientific grant and to IBMC and ISCIII for making available all the facilities that

made my work possible.

xi

Summary

Leishmania spp. are protozoan parasites responsible for a group of clinical manifestations

collectively known as leishmaniasis. The parasite is transmitted to the mammalian host by

the bite of an infected female phlebotomine sand fly where it exists as promastigote forms.

The metacyclic promastigote is the infective stage for the mammalian host but it must

rapidly convert into the intracellular amastigote form to survive inside the host’s

macrophages.

Leishmaniasis are zoonotic or anthroponotic diseases spread over the Mediterranean,

tropic and subtropic regions worldwide. They are considered neglected infectious

diseases and the emergence of HIV/Leishmania co-infections in developed countries

brought new interest on the disease. Anti-Leishmania drugs are efficient but treatment is

highly toxic and associated with elevated cost, not only because of the price of the

treatment itself but also due to mandatory hospitalization in most of the cases.

The search for the human vaccine against visceral leishmaniasis, the most severe form of

the disease, for long has been attempted but without positive results. However, there are

three licensed vaccines for canine leishmaniasis, an important factor in the epidemiology

of leishmaniasis in Brazil and Southern Europe, where dogs are the main domestic

reservoir for the parasite.

Few years ago our group described the efficacy of the live attenuated sir2 single knockout

Leishmania infantum in the protection from the wild type virulent challenge in the murine

model of visceral leishmaniasis. With the knowledge that advent from that work and

maintaining the interest on the research for a vaccine for visceral leishmaniasis, we

wanted to experimentally explore the possibility of the naturally attenuated strains in the

protection from a secondary virulent infection.

In some cases, HIV+ patients have been revealing to be infected by Leishmania parasites

with rare zymodemes that have never been described in immunocompetent persons or

dogs. This fact supports the hypothesis that those strains are only pathogenic in

conditions of immunosuppression and, therefore, are less virulent than those found in

immunocompetent hosts. Nevertheless, very little is known about the infective,

pathogenic, immunogenic and protective capabilities of these naturally attenuated strains

in an immunocompetent host. Therefore, experimental confirmation of the non-

pathogenicity of these Leishmania attenuated strains would promote its interest as live

attenuated vaccines.

To study Leishmania biology a reliable source of parasites is needed. Many are the

options available of semi-define and complete define culture media for the in vitro culture

of Leishmania promastigotes. However, the choice of the culture medium to use should be

xii

a rational decision since it influences the growth, the development and, ultimately, the

infectivity of the parasites.

This thesis starts with a systematic analysis of the morphology, viability, cell cycle

progression, metacyclic profile, capacity to differentiate into axenic amastigotes and

infectivity of L. infantum promastigotes when cultivated in different well-established culture

media. Indeed, the different media revealed to leave an imprint in the infectivity of the

parasite. Furthermore, using a rational approach from the evaluated media, it was

developed a simple serum free culture medium that showed to be useful for long-term

low-cost maintenance of L. infantum or studies requiring the production of promastigotes

in the absence of proteins.

Four L. infantum strains responsible for cutaneous or visceral leishmaniasis in

immunocompetent or immunosuppressed patients were studied in the scope of

understanding their infective, pathogenic, immunogenic and protective capabilities in an

immunocompetent host. To avoid any biased results, the establishment of the culture

settings for the four studied strains that allow the generation of similar promastigotes was

successfully done. The murine model of visceral leishmaniasis used in this thesis put on

evidence the inherent infectivity of each one of the four L. infantum strains and their

potential and differential immunomodulatory capacities.

Finally, for the first time it was evaluated the impact of infection-induced immunity on a

secondary homologous or heterologous infection with L. infantum strains in the murine

model of visceral leishmaniasis. The two most infective strains were used to assess the

cellular innate and adaptive immune responses generated 6 weeks after infection and

their efficacy in protecting against subsequent challenge. The high infective strain showed

partial protection against re-infection due to the expansion of central and effector memory

T cell populations and also by the production of IFNγ by both CD4+ and CD8+ T cells and

double producers CD4+IFNγ+IL-10+ and CD8+IFNγ+TNFα+. No protection upon virulent

challenge was observed when a strain with lower infectivity was used as imprinting,

revealing the need of a virulent infection to generate and maintain appropriate immunity.

With the work performed within this thesis it was concluded that inherent characteristics of

each infective L. infantum strain are responsible for the tropism and memory generation

mechanisms, two processes that remarkably influence the outcome and progression of

leishmaniasis. These findings contribute to the general acceptance that leishmaniasis is a

multifactorial disease with the clinical outcome being highly dependent on the infectivity of

the strain and the susceptibility of the host.

xiii

Keywords

Leishmania infantum, visceral leishmaniasis, clinical isolates, culture media, infectivity,

tropism, infection-induced immunity, memory, protection.

 

xiv

Resumo

Leishmania spp. são parasitas protozoários responsáveis por um grupo de manifestações

clínicas designadas de leishmaniose. O parasita é transmitido ao mamífero hospedeiro

pela picada de uma mosca da areia infetada com forma promastigota. O promastigota

metacíclico é a forma infeciosa para o mamífero, mas para sobreviver no interior dos

macrófagos do hospedeiro o promastigota tem rapidamente de converter-se na forma

amastigota intracelular.

A leishmaniose é uma doença zoonótica e antroponótica dispersa mundialmente pelas

regiões mediterrânica, tropicais e subtropicais. Desde sempre tem sido considerada uma

doença infeciosa negligenciada, mas a emergência de co-infeções HIV/Leishmania em

países desenvolvidos trouxe um novo interesse à doença. Os fármacos anti-Leishmania

apesar de eficazes constituem um tratamento altamente tóxico e que está associado a

custos elevados, não só pelo preço do tratamento em si mas também devido à

hospitalização requerida na maioria dos casos.

A procura da vacina humana para a leishmaniose visceral, a forma mais grave da

doença, remonta há várias décadas mas sem nunca alcançar resultados positivos. No

entanto, há três vacinas licenciadas para a leishmaniose canina, um fator importante na

epidemiologia da leishmaniose no Brasil e sul da Europa onde os cães são o principal

reservatório doméstico.

Há alguns anos atrás o nosso grupo descreveu a eficácia de uma estirpe viva de

Leishmania infantum geneticamente atenuada pela remoção de um dos alelos do gene

sir2 na proteção contra uma infecção com a estirpe selvagem no modelo de leishmaniose

visceral murina. Com o conhecimento adquirido nesse trabalho e mantendo o interesse

na investigação da vacina para a leishmaniose visceral, quisemos explorar a

possibilidade de estirpes naturalmente atenuadas induzirem proteção contra uma infeção

virulenta.

Nalguns casos, os doentes HIV+ co-infetados têm demonstrado ser infetados por estirpes

de Leishmania com zimodemos pouco frequentes que nunca foram descritos em pessoas

imunocompetentes ou em cães. Este facto suporta a hipótese de estas estirpes serem

patogénicas apenas em condições de imunossupressão e, por isso, serem menos

virulentas do que aquelas encontradas em hospedeiros imunocompetentes. No entanto,

pouco se sabe sobre a infetividade, patogenicidade, imunogenicidade e capacidade

protetora destas estirpes naturalmente atenuadas num hospedeiro imunocompetente. Por

isso, a confirmação experimental da não-patogenicidade destas estirpes atenuadas de

Leishmania iria levar ao seu interesse como vacinas vivas atenuadas.

xv

Para estudar a biologia da Leishmania é necessária uma fonte confiável de parasitas.

Muitas são as opções disponíveis de meios de cultura semi-definidos e totalmente

definidos para a cultura in vitro de promastigotas de Leishmania. No entanto, a escolha

do meio de cultura a usar deve ser uma decisão racional uma vez que influencia o

crescimento, o desenvolvimento e, consequentemente, a infetividade dos parasitas.

Esta tese inicia-se com a análise sistemática da morfologia, viabilidade, progressão

durante o ciclo celular, perfil de metaciclogénese, capacidade de diferenciação em

amastigotas axénicos e infetividade de promastigotas de L. infantum em diferentes meios

de cultura bem caracterizados na área. Efetivamente, a escolha do meio de cultura

revelou-se determinante na infetividade do parasita. Além disto, usando uma abordagem

racional a partir dos meios avaliados, desenvolveu-se um meio de cultura simples sem

soro que mostrou ser interessante para a manutenção de L. infantum por longos períodos

de tempo de forma económica ou para aplicação em estudos que exijam a produção de

promastigotas na ausência de proteínas.

Quatro estirpes de L. infantum agentes de leishmaniose cutânea ou visceral em doentes

imunocompetentes ou imunodeprimidos foram estudadas no sentido de compreender as

suas capacidades de infeção, patogénicas, imunogénicas e protetoras num hospedeiro

imunocompetente. Para evitar resultados tendenciosos, o estabelecimento das condições

de cultivo para as quatro estirpes em estudo que permitem a geração de promastigotas

semelhantes foi conseguido com sucesso. O modelo murino de leishmaniose visceral

usado nesta tese evidenciou a infetividade intrínseca de cada uma das quatro estirpes de

L. infantum e as suas diferentes capacidades potencialmente imunomodulatórias.

Finalmente, pela primeira vez foi avaliado o impacto da imunidade induzida pela infeção

na infeção secundária homóloga ou heteróloga com estirpes de L. infantum no modelo

murino de leishmaniose visceral. As duas estirpes com maior infetividade foram usadas

para determinar as respostas celulares inata e adaptativa geradas 6 semanas após

infeção bem como a sua eficácia na proteção contra uma infeção subsequente. A estirpe

com maior infectividade mostrou proteção parcial contra re-infeção devido à expansão

das células T de memória central e efetora e também pela produção de IFNγ pelas

células T CD4+ e CD8+ e duplas produtoras CD4+IFNγ+IL-10+ e CD8+IFNγ+TNFα+. No

entanto, não foi observada proteção quando se usou a estirpe com menor infetividade na

primo-infeção, revelando a necessidade de uma infeção virulenta para a geração e

manutenção de imunidade adquirida eficaz contra uma re-infeção virulenta.

Com o trabalho realizado nesta tese foi concluído que as características intrínsecas de

cada estirpe de L. infantum são responsáveis pelo tropismo e mecanismos de

desenvolvimento de memória imunológica, dois processos que influenciam

marcadamente a manifestação e a progressão da leishmaniose. Estes dados reforçam a

xvi

corrente da leishmaniose ser uma doença multifatorial cuja manifestação clínica é

altamente dependente da capacidade de infeção da estirpe e da suscetibilidade do

hospedeiro.

Palavras-chave

Leishmania infantum, leishmaniose visceral, isolados clínicos, meio de cultura,

infetividade, tropismo, imunidade induzida pela infeção, memória, proteção.

 

xvii

Resumen

Leishmania spp. son parásitos protozoarios responsables de un grupo de enfermedades

que se conocen de forma conjunta como leishmaniasis. El parásito es trasmitido al

hospedador mamífero por la picadura de un flebótomo infectado donde existe en la

forma promastigote. El promastigote metacíclico es la forma infecciosa para el mamífero,

pero para sobrevivir dentro de los macrófagos hospedadores el promastigote tiene que

convertirse rápidamente en la forma amastigote intracelular.

Las leishmaniasis son enfermedades zoonóticas o antroponóticas que se distribuyen por

las regiones mediterráneas, tropicales y subtropicales. Se considera una enfermedad

infecciosa desatendida, aunque la emergencia de co-infecciones HIV/Leishmania en

países desarollados ha generado un nuevo interés por esta enfermedad. Los fármacos

anti-Leishmania son eficaces pero el tratamiento es altamente tóxico y está asociado a

costes elevados, no sólo por el precio del tratamiento en sí pero también debido a la

hospitalización requerida en la mayoría de los casos.

La búsqueda de la vacuna humana para la leishmaniasis visceral, la forma más grave de

la enfermedad, se remonta a varias décadas pero sin alcanzar nunca resultados positivos

completos. En este momento, hay tres vacunas licenciadas para la leishmaniasis canina,

lo que constituye una herramienta importante en el control epidemiológico de la

leishmaniasis en Brasil y sur de Europa, donde el perro constituye el principal reservorio

doméstico del parásito.

Hace algunos años nuestro grupo describió la eficacia de una cepa viva de Leishmania

infantum atenuada genéticamente por la deleción de uno de los alelos del gen sir2 en la

protección contra un desafío con la cepa salvaje en el modelo murino de leishmaniasis

visceral. Con el conocimiento adquirido de ese trabajo y manteniendo el interés en la

investigación  de una vacuna para la leishmaniasis visceral, hemos querido explorar la

posibilidad de utilizar cepas naturalmente atenuadas en la protección contra una segunda

infección virulenta.

Se ha confirmado que parte de los enfermos VIH+ coinfectados estaban infectados por

cepas de Leishmania con zimodemas poco frecuentes que no habían descritos en

personas inmunocompetentes o en perros. Este hecho apoya la hipótesis de estas cepas

sean patógenas sólo en condiciones de inmunossupressión y, por eso, sean menos

virulentas que aquellas encontradas en hospedadores inmunocompetentes. Sin embargo,

se sabe poco sobre la infectividad, patogenicidad, inmunogenicidad y capacidad

protectora de estas cepas naturalmente atenuadas en un hospedador

inmunocompetente. Por eso, la confirmación experimental de la no-patogenicidad de

xviii

estas cepas atenuadas de Leishmania llevaría a platear su interés como vacunas vivas

atenuadas.

Para estudiar la biología de Leishmania es necesaria una fuente de parásitos de

confianza. Muchas son las opciones disponibles de medios de cultivo semi-definidos y

totalmente definidos para el cultivo in vitro de promastigotas de Leishmania. Sin embargo,

la elección del medio de cultivo a usar debe ser una decisión racional ya que afecta el

crecimiento, el desarrollo y, consecuentemente, la infectividade de los parásitos.

Esta tesis se inicia con el análisis sistemático de la morfología, viabilidad, progresión

durante el ciclo celular, perfil de metaciclogenesis, capacidad de diferenciación en

amastigotes axénicos y infectividad de promastigotes de L. infantum en diferentes medios

de cultivo bien caracterizados en este campo. Efectivamente, la elección del medio de

cultivo se reveló determinante en la infectividad del parásito. Además, usando un

abordaje racional a partir de los medios evaluados, se desarrolló un medio de cultivo

simple sin suero que demostró ser particularmente útil para el mantenimiento de L.

infantum por periodos largos de tiempo de forma económica o para su aplicación en

estudios que exijan la producción de promastigotes en ausencia de proteínas.

Se estudiaron cuatro cepas de L. infantum causantes de leishmaniosis cutánea o visceral

en enfermos inmunocompetentes o inmunodeprimidos, con el fin de comprender sus

capacidades de infección, patogénicas, inmunogénicas y protectoras en un hospedador

inmunocompetente. Para evitar resultados sesgados, se establecieron con éxito

condiciones de cultivo para las cuatro cepas en estudio que permitieron la generación de

promastigotes similares. El modelo murino de leishmaniasis visceral usado en esta tesis

evidenció la infectividad intrínseca de cada una de las cuatro cepas de L. infantum y sus

diferentes capacidades potencialmente inmunomoduladoras.

Finalmente, se evaluó por primera vez el impacto de la inmunidad inducida por la

infección en la infección secundaria homóloga o heteróloga con cepas de L. infantum en

el modelo murino de leishmaniasis visceral. Las dos cepas con mayor infectividade fueron

usadas para determinar las respuestas celulares innatas y adaptativas generadas 6

semanas después de infección así como su eficacia  en la protección contra un nuevo

desafío. La cepa con mayor infectividad mostró protección parcial contra reinfección

debido a la expansión de las células T de memoria central y efectora y también por la

producción de IFNγ por las células T CD4+ y CD8+ y dobles productoras CD4+IFNγ+IL-10+

y CD8+IFNγ+TNFα+. No se observó protección contra un desafío virulento cuando se usó

la cepa con menor infectividad en la primo-infección, revelando la necesidad de una

infección virulenta para la generación y mantenimiento de inmunidad adecuada.

Con el trabajo realizado y los resultados obtenidos en esta tesis se puede concluir que las

características intrínsecas de cada cepa de L. infantum son responsables del tropismo y

xix

los mecanismos de desarrollo de memoria inmunológica, dos procesos que influyen de

forma decisiva en la aparición y la progresión de la leishmaniasis clínica. Estos datos

refuerzan la idea de que la leishmaniasis es una enfermedad multifactorial  cuya

manifestación clínica es altamente dependiente de la capacidad de infección de la cepa y

de la susceptibilidad del hospedador.

Palabras clave

Leishmania infantum, leishmaniasis visceral, aislados clínicos, médio de cultivo,

infectividad, tropismo, inmunidad inducida por la infección, memoria, protección.

xxi

Table of Contents

AUTHOR’S DECLARATION iii 

SCIENTIFIC PUBLICATIONS v 

Articles in international peer-reviewed journals v 

Publications of scientific meetings vi 

Poster communications vii 

ACKNOWLEDGMENTS ix 

SUMMARY xi 

RESUMO xiv 

RESUMEN xvii 

ABBREVIATIONS LIST xxvii 

INTRODUCTION 1 

THE DISEASE 3 

HIV/AIDS and leishmaniasis 5 

Canine leishmaniasis 6 

LEISHMANIA BIOLOGY AND TRANSMISSION 7 

IMMUNOBIOLOGY OF LEISHMANIASIS 8 

Parasite’s strategies 8 

Host defense 9 

MEMORY DEVELOPMENT 10 

Memory in leishmaniasis 12 

PROPHYLAXIS AND TREATMENT 14 

Vaccines 14 

Drugs 16 

TRANSFERRING LEISHMANIA SP. LIFE CYCLE TO THE LABORATORY 19 

Promastigotes cultivation 19 

Amastigotes cultivation 21 

WHAT’S LEFT TO BE DONE? 23 

OBJECTIVES 25 

AIMS OF THE THESIS 27 

xxii

RESULTS 29 

THE IMPACT OF DISTINCT CULTURE MEDIA IN LEISHMANIA INFANTUM BIOLOGY AND

INFECTIVITY 31 

Abstract 34 

Background 35 

Materials and methods 37 

Results 41 

Discussion 49 

Supplemental data 55 

References 59 

CHARACTERIZATION OF THE BIOLOGY AND INFECTIVITY OF LEISHMANIA INFANTUM

VISCEROTROPIC AND DERMOTROPIC STRAINS ISOLATED FROM HIV+ AND HIV- PATIENTS

IN THE MURINE MODEL OF VISCERAL LEISHMANIASIS 63 

Abstract 66 

Background 67 

Materials and methods 69 

Results and Discussion 75 

Conclusions 86 

Supplemental data 88 

References 93 

Related unpublished data 98 

HIGH INFECTIVE LEISHMANIA INFANTUM STRAIN INDUCES STRONG CENTRAL AND EFFECTOR

MEMORY CD4+ AND CD8+ IMMUNITY REQUIRED FOR PARTIAL PROTECTION AGAINST RE-

INFECTION 99 

Abstract 102 

Background 103 

Materials and methods 106 

Results and discussion 109 

Conclusions 117 

References 118 

 

xxiii

DISCUSSION & CONCLUSIONS 123 

ON THE IMPORTANCE OF ESTABLISHING THE CULTURE CONDITIONS FOR THE IN VITRO

GROWTH OF LEISHMANIA SP. PARASITES 125 

ON THE STRAIN-SPECIFIC CHARACTERISTICS THAT LEAD TO DIFFERENTIAL INFECTIVITY

AND TROPISM 127 

ON THE PROTECTIVE ROLE THAT A HIGH INFECTIVE L. INFANTUM STRAIN DISPLAY AGAINST

RE-INFECTION 130 

FINAL REMARKS 132 

BIBLIOGRAPHY 135 

xxiv

Index of Figures

INTRODUCTION

Figure I. Worldwide distribution of VL and CL 4

Figure II. Worldwide distribution of HIV/Leishmania co-infections 6

Figure III. Zoonotic and anthroponotic Leishmania spp. transmission cycles 7

Figure IV. Differentiation progress of CD4+ and CD8+ effector and memory cells 11

Figure V. Leishmania spp. development in the insect vector and in the mammalian host 20

RESULTS

THE IMPACT OF DISTINCT CULTURE MEDIA IN LEISHMANIA INFANTUM BIOLOGY AND INFECTIVITY

Figure 1. Parameters of in vitro development of L. infantum in the different culture media 41

Figure 2. Dominant morphology of logarithmic and stationary-phase L. infantum 42

Figure 3. In vitro and in vivo virulence of promastigotes grown in different culture media 43

Figure 4. Relative expression of metacyclogenesis-related genes in L. infantum

promastigotes grown in the different media

44

Figure 5. Development of a protein-free medium for the growth of L. infantum

promastigotes

45

Figure 6. Biology of L. infantum promastigotes in cRPMI 47

Figure 7. Overtime virulence loss 48

Figure S1. Adjustment of initial inoculum for SDM and Schneider media 55

Figure S2. Histogram of cell cycle analysis of parasites in different media 55

Figure S3. Cell cycle analysis of parasites in different media 56

Figure S4. Dot plot of bone marrow-derived macrophages infected with CFSE-labeled

parasites

56

Figure S5. Relative gene expression of metacyclogenesis-related genes of promastigotes

cultivated in the different media

57

Figure S6. Dominant promastigote morphology during the process of development of the

protein-free media

57

Figure S7. Growth curves of L. infantum in cRPMI after 4 or 20 in vitro passages 58

Figure S8. Influence of different FCS lots on the growth of L. infantum cultivated in RPMI 58

xxv

CHARACTERIZATION OF THE BIOLOGY AND INFECTIVITY OF LEISHMANIA INFANTUM

VISCEROTROPIC AND DERMOTROPIC STRAINS ISOLATED FROM HIV+ AND HIV- PATIENTS

IN THE MURINE MODEL OF VISCERAL LEISHMANIASIS

Figure 1. Molecular characterization of L. infantum isolates 75

Figure 2. Growth of L. infantum in different culture medium 77

Figure 3. Indirect measurement of metacyclogenesis 78

Figure 4. In vitro differential infectivity of L. infantum strains 79

Figure 5. Quantitative distribution of L. infantum in BALB/c mice 2 and 6 weeks after

infection

81

Figure 6. Cell populations in spleens of naive and Leishmania-infected mice in the acute

and chronic phases

84

Figure 7. Leishmania-specific humoral response 85

Additional figure 1. Validation of the qPCR methodology for quantification of the parasite

loads in murine tissues

89

Additional figure 2. K26 gene alignment 90

Additional figure 3. Cell cycle analysis 91

Additional figure 4. Variation of the transcription of metacyclogenesis-dependent genes 92

Additional figure 5. Organ weight 2 and 6 weeks post-infection 92

Figure VI. RFLP patterns of mixed infections 98

HIGH INFECTIVE LEISHMANIA INFANTUM STRAIN INDUCES STRONG CENTRAL AND EFFECTOR

MEMORY CD4+ AND CD8+ IMMUNITY REQUIRED FOR PARTIAL PROTECTION AGAINST

RE-INFECTION

Figure 1. Parasite load after infection and challenge with L. infantum strains

with different infectivity

109

Figure 2. Splenic cellular populations after infection and challenge with highly and low

infective L. infantum strain

111

Figure 3. Expression of CCR2 on splenic macrophages, neutrophils and dendritic cells 112

Figure 4. T cell memory repertoire 114

Figure 5. Intracellular cytokines of CD4+ and CD8+ lymphocytes 115

xxvi

Index of Tables

INTRODUCTION

Table I. Main disease manifestations of leishmaniasis and the Leishmania species

frequently associated with the disease

4

RESULTS

THE IMPACT OF DISTINCT CULTURE MEDIA IN LEISHMANIA INFANTUM BIOLOGY AND INFECTIVITY

Table S1. Comparative cost of the culture media used in the study 58

CHARACTERIZATION OF THE BIOLOGY AND INFECTIVITY OF LEISHMANIA INFANTUM

VISCEROTROPIC AND DERMOTROPIC STRAINS ISOLATED FROM HIV+ AND HIV- PATIENTS

IN THE MURINE MODEL OF VISCERAL LEISHMANIASIS

Table 1. Estimated overall parasite load of L. infantum-infected BALB/c mice 2 and 6

weeks post-infection

82

xxvii

Abbreviations list

 

AIDS Acquired Immunodeficiency Syndrome

BMMo Bone marrow-derived macrophages

CCR CC chemokine receptor

CD Cluster of differentiation

Challg Challenge

CL Cutaneous leishmaniasis

DCs Dendritic cells

FBS Fetal bovine serum

FCS Fetal calf serum

HIV Human immunodeficiency virus

IL Interleukin

IFNγ Interferon-γ

ITS Ribosomal internal transcribed spacer

IVDUs Intravenous drug users

MCL Mucocutaneous leishmaniasis

MLEE Multilocus enzyme electrophoresis

MLMT Multilocus microsatellite typing

NK Natural killer

NNN Novy-McNeal-Nicolle medium

PCR Polymerase chain reaction

PKDL Post kala-azar dermal leishmaniasis

qPCR Quantitative real time polymerase chain reaction

Re-Inf Re-infection

RFLP Restriction fragment length polymorphism

RT-PCR Reverse transcriptase - polymerase chain reaction

SHERP Small Hydrophilic Endoplasmic Reticulum-associated Protein

TCM Central memory T cells

TEM Effector memory T cells

TGFβ Transforming growth factor-β

Th Helper T lymphocyte

TNFα Tumor necrosis factor-α

VL Visceral leishmaniasis

WHO World Health Organization

Introduction

 

INTRODUCTION

3

The disease

Leishmaniasis designate a group of parasitic diseases caused by the infection of the

Leishmania spp. protozoa in humans and several domestic and sylvatic animals. In

humans, four main clinical forms of the disease can be identified according to the clinical

manifestations:

Cutaneous leishmaniasis (CL) comprises cutaneous lesions that are more or

less difficult to heal (depending on the species involved) and leave visible scars

when cured, many times in exposed areas like the face or the arms which can

be socially stigmatizing [1].

Mucocutaneous leishmaniasis (MCL) affects the mucous layers of the nose,

mouth, throat and surrounding tissues, many times leading to mutilating

lesions, which can lead to social exclusion. In contrast to CL, treatment is

always required because the disease can be life-threatening [1].

Visceral leishmaniasis (VL), also known as kala-azar, is the most severe form

of the disease, since it affects the spleen, liver and bone marrow, producing

hepatosplenomegalia, weight loss, pancytopenia, hypergammaglobulinemia

and intermittent low-grade fever. Is fatal if untreated due to severe cachexia

and bleeding (owing to thrombocytopenia that installs with time) [2].

Post kala-azar dermal leishmaniasis (PKDL) is a manifestation that can appear

weeks to years after cure of VL by L. donovani infection [1]. It consists of skin

papules and hypopigmented macules dispersed through the skin. It is frequent

in African and Indian patients but its emergence is not well understood [2].

Up to date, 30 species of Leishmania were described, 20 of them are pathogenic for the

humans [3]. In Table I are depicted the main species that affect humans and the related

disease manifestation.

INTRODUCTION

4

Table I. Main disease manifestations of leishmaniasis and the Leishmania species frequently

associated with the disease

Main type of the disease  Species

Old World, subgenus Leishmania

Visceral leishmaniasis  Leishmania donovani and Leishmania infantum 

Cutaneous leishmaniasis  Leishmania major, Leishmania tropica and Leishmania aethiopica 

Post kala‐azar dermal leishmaniasis Leishmania donovani

New World, subgenus Leishmania

Visceral leishmaniasis  Leishmania infantum

Cutaneous leishmaniasis  Leishmania infantum, Leishmania mexicana, Leishmania pifanoi and Leishmania amazonensis 

New World, subgenus Viannia 

Cutaneous leishmaniasis  Leishmania braziliensis, Leishmania guyanensis, Leishmania panamensis and Leishmania peruviana  

Mucocutaneous leishmaniasis  Leishmania braziliensis and Leishmania panamensis 

Adapted from [4]

Leishmaniasis is endemic in 98 countries and 3 territories ranging the Mediterranean

Basin, the Middle East, the Indian sub-continent, and the tropical regions from America

and Africa [5] (Figure I). The last WHO report on the epidemiology of leishmaniasis

estimates that every year 0.7 to 1.2 million new cases of CL are mounted and 0.2 to 0.4

million people develop VL which, in turn, is responsible for 20 000 to 40 000 deaths [5].

Nevertheless, in endemic countries most of the L. infantum- or L. donovani- infected

people are asymptomatic carriers or self-healers [6, 7].

Figure I - Worldwide distribution of VL and CL

Adapted from [8].

INTRODUCTION

5

The relation of leishmaniasis with poverty catalogues it as a neglected tropical disease. In

fact, 72 of the endemic countries are developing nations with a burden of 90% of the VL,

CL and MCL [9]. In these regions, the majority of the population lives in rural areas, where

higher densities of sand flies are found, and are malnourished, a condition that leads to

immunosuppression. In addition, HIV concomitant infection is frequent, contributing to a

severe state of immunodeficiency [10].

However, leishmaniasis is nowadays an important issue in developed countries due to

coinfection cases with HIV where Leishmania arises as an opportunistic infectious agent,

the third of the parasitic infections, after Toxoplasma gondii and Cryptosporidium spp.

[10]. Indeed, 90% of the reported HIV/Leishmania cases are from Southern European

countries, namely Spain, Portugal, Italy and France [11].

HIV/AIDS AND LEISHMANIASIS

HIV/Leishmania co-infections correspond to 2-9% of all the VL cases in endemic countries

(Figure II) [12]. The close geographical overlap of Leishmania and HIV infections promote

the concomitant infection of both pathogens. In fact, HIV infection increases in 100-2320

times the risk of developing VL in the endemic regions. Intravenous drug users (IVDUs)

are an important group in the epidemiology of HIV/Leishmania co-infections. Indeed,

IVDUs have contributed for 76% (between 1990 and 1998) to 67% (between 2000 and

2006) of the HIV/Leishmania co-infected cases [12]. Also, 10% of the overall HIV

infections are transmitted by the use of intravenous drugs; in some regions of Eastern

Europe and Central Asia this number rises to 80% [13]. However, data mainly from the

Southern Europe revealed that since the introduction of the HAART regimes routinely the

number of co-infection cases has dropped [12].

Both diseases present synergistic detrimental effects on the cellular immune response

because they infect similar target cells (macrophages and dendritic cells). Leishmania

induces the secretion of tumor necrosis factor-α (TNFα) and IL-1α which upregulate HIV

gene expression by NF-κB, while HIV-dependent immunosuppression promotes

Leishmania multiplication [14]. VL promotes the progression of HIV infection leading to the

clinical manifestation of AIDS, whereas HIV+ patients present repetitive relapses of

leishmaniasis and, frequently, amastigotes are found in unusual locations, such as the

lungs, tonsils or intestinal tract [12].

INTRODUCTION

6

Figure II. Worldwide distribution of HIV/Leishmania co-infections

Adapted from [14].

CANINE LEISHMANIASIS

In the veterinary field, dogs are a main concern, not only because of the disease itself, but

also because of their importance as reservoir for human transmission. Canine

leishmaniasis (CanL) is endemic in 70 countries of the same affected regions as human

leishmaniasis, including also the United States of America. In non-endemic countries,

however, imported sick dogs constitute an important veterinary and public health problem

[15]. CanL is associated to L. infantum infection and, being a systemic disease, clinical

manifestations are unspecific. Nonetheless, the existence of skin ulcers, onychogryphosis

and marked cachexia are common visible signs in sick dogs. Renal disease is frequently

the only symptom in dogs with CanL and chronic renal failure is often the cause of death

[15].

INTRODUCTION

7

Leishmania biology and transmission

Leishmania spp. are trypanosomatid parasites with a digenetic life cycle that is required

for the perpetuation of the species. The promastigote is a flagellated motile form that

develops in the sand fly vector (Phlebotomus spp. in the Old World or Lutzomyia spp. in

the New World). In the digestive tract of the insect, promastigotes multiply and evolve

through sequential stages until they differentiate in the final infective form, the metacyclic

promastigote [16, 17]. Upon a blood meal on a susceptible mammalian host, metacyclic

promastigotes are deposited in the skin and rapidly captured by neutrophils [18], dendritic

cells (DCs) [19] and macrophages [20]. To survive inside these cells, a dramatic

differentiation step occurs and promastigotes develop into amastigotes, non-motile

intracellular forms which are able to resist and multiply inside the aggressive milieu of the

phagocytes phagolysosomes [21]. Intracellular amastigotes are spread throughout the

organism reaching distant locations from bitten sites, whether residing in the skin or being

capable to enter the viscera and bone marrow.

Leishmania spp. can be transmitted by zoonotic or anthroponotic cycles. L. major [22,23]

and L. infantum are usually of zoonotic transmission, with dogs as the main reservoir,

while L. donovani and L. tropica are generally of anthroponotic origin [24]. A segregation

of the different clinical manifestations related with its reservoir host can, then, be made as

follows: zoonotic VL (by L. infantum), zoonotic CL (by L. major), anthroponotic VL (by L.

donovani) and anthroponotic CL (by L. tropica). In addition to these natural cycles, an

important alternative artificial anthroponotic cycle has been revealed more than one

decade ago with the analysis of blood remnants in syringes discarded by IVDUs [25]

(Figure III).

Figure III. Zoonotic and anthroponotic Leishmania spp. transmission cycles [26]

INTRODUCTION

8

Immunobiology of leishmaniasis

PARASITE’S STRATEGIES

The diversity of clinical manifestations expressed in leishmaniasis derives from a complex

interaction between the parasite and the host’s immune system. In fact, the outcome of

the disease is strongly influenced not only by inherent characteristics of the infective strain

but also by the fitness of the immune system in generating a protective response.

Leishmania spp. are masters at disguising their entry into the host as they downregulate

the activation signals that otherwise would prompt an effective immune response.

Promastigote antigens from the surface glycocalix like gp63 protease (leishmanolysin) or

the lipophosphoglycans (LPG) are known to provide specific resistance to complement-

mediated lysis, the first attack to pathogens that reach the blood, and to participate in the

silent entry of the parasite into the phagocytes [27]. On their hand, amastigotes released

from disrupted macrophages use opsonization with IgG’s Fcγ moiety to enter in new

macrophages without triggering their activation through ligation to Fcγ receptor [27]. A

more elegant approach relies on the “Trojan horse” strategy, where Leishmania takes

advantage of the rapid arrival of neutrophils to the inoculation site and uses them to

blindly enter the macrophages as they phagocyte apoptotic infected neutrophils [28].

However, this mechanism has not yet been demonstrated to occur in vivo and in situ

studies failed to prove it, though the involvement of neutrophils in the early steps of

infection is undoubtable [4].

Once inside the phagocyte, Leishmania is able to downregulate the co-stimulatory

molecules CD40 and CD86 on DCs [29] and CD40 and MHC class II on macrophages

[30] that are needed for the proper activation of T cells. Also, it induces the establishment

of a more favorable anti-inflammatory milieu by increasing IL-10 and diminishing IL-12, IL-

6 and TNFα secretion by those cells [29, 30]. This immunomodulation arrests the

maturation process that is usually driven by the interaction of a pathogen-associated

molecular pattern (PAMP) with Toll-like receptors (TLRs) and interferes with the cross-

talking between innate and acquired immune responses, allowing the parasite to favorably

infect the spleen, liver, lymph nodes and bone marrow in VL [27].

One of the hallmarks in leishmaniasis immunobiology is the hypergammaglobulinemia due

to polyclonal expansion of B cells. In CL a clear segregation of IgG2/IgG1 antibodies in

the dichotomy of Th1/ Th2 responses is related to protection/progression of the disease

[31, 32]. In VL this is not the case and, in general terms, a strong humoral response is

detrimental and increases the severity of the disease [33, 34]. However, the appearance

of IgG2 after vaccination is usually considered a good marker of protection [35].

INTRODUCTION

9

HOST DEFENSE

 

The primary strategy that the host presents to fight against Leishmania is non-specific and

relies on innate mechanisms of the immune response. As mentioned above, complement-

mediated lysis is the first trap that promastigotes must circumvent to succeed in infection

and, in fact, “the messers become the messies” since Leishmania cleave the C3b factor

transforming it in a C3b1-like molecule that is used by the parasite to enter unnoticeably in

macrophages [27]. Also, Leishmania takes advantage of the C5a cleaved fragment since

it has a negative impact on the TLR4-induced synthesis of IL-12 family of cytokines [27].

Even so, activation of DCs upon contact with Leishmania still occurs in those cells that did

not engulf parasites - the so called bystander cells - leading to the secretion of IL-12

[33,37].

IL-12 is considered a key cytokine in the early development of the effective immune

response due to its requirement for the activation of NK cells and T lymphocytes [38].

Activation of these cells leads to the secretion of interferon-γ (IFNγ), another commander

cytokine.

Both in mice as in humans, macrophages are classically activated by IFNγ. This leads to

the transcription of inducible nitric oxide synthase (iNOS) and phagocyte NADPH oxidase

(phox) that produce nitric oxide (NO) and reactive oxygen species (ROS), respectively,

specimens generally considered indispensable for macrophage-direct killing of

Leishmania [27]. Macrophages activated by IL-12-driven IFNγ secretion by Th1

lymphocytes - M1 macrophages - also produce TNFα, IL-1β and IL-6, pro-inflammatory

cytokines that favor the protective response against Leishmania infection. These

macrophages are, then, both effectors and inducers of the Th1 polarized immune

response [39]. Nevertheless, the strong Th1 pro-inflammatory response must be balanced

with the secretion of IL-10 and transforming growth factor-β (TGFβ) to avoid

immunopathology through excessive tissue damage [40].

However, depending on the Leishmania species involved and the fitness of the host’s

immune system, an alternative activation of the macrophages, through IL-4 and IL-13

secretion by Th2 lymphocytes, can command an immune response favoring the

progression of the infection. These so-called M2 macrophages upregulate arginase 1

which promotes the biosynthesis of polyamines that Leishmania can take up and use for

proliferation [40].

INTRODUCTION

10

Memory development

Effector CD4+ and CD8+ T cells that were activated by the recognition of Leishmania

antigens on the cognate T cell receptor (TCR) and expanded to respond to infection will

face a massive contraction on their numbers of about 90% after the elimination of the

parasite, leaving a subset of experienced cells that constitute the memory pool. Memory

cells are long-lived cells that rapidly expand in response to a secondary challenge with the

priming antigen [41]. They form a heterogeneous pool with distinct abilities in proliferation,

migration and cytokine production that can be easily identified by the differential

expression of some surface molecules, usually CD44 and CD62L in mice [42] or

CD45RA/RO and CD62L or CCR7 in humans [43].

CD44 is the most widely marker for selecting antigen-exposed T cells as, after it has been

upregulated on activated lymphocytes, its expression is sustained on effector and memory

murine cells. Through the interaction with its major ligand, the hyaluronic acid, CD44

regulates cell adhesion and migration, critical phenomena for the recruitment and function

of effector and memory cells. Besides increasing T cell activation and promoting T cell

survival, CD44 also contributes to the regulation of the contraction phase that takes place

after the elimination of the pathogen and the maintenance of tolerance [44]. In humans,

CD45RA is expressed in naïve cells, whereas memory cells upregulate CD45RO in

response to antigen priming [45].

CD62L (L-selectin) is a transmembrane protein with cell adhesion properties and receptor

signaling functions. Both in mice and in humans, it is expressed in the surface of the

majority of circulating leukocytes contributing to their regulated recruitment to the lymph

nodes and inflamed tissues [46, 47]. In the lymph nodes, CD62L+ T cells become

activated by the interaction with antigen presenting cells, which leads to its cleavage.

CD62L shedding from the surface of activated T cells allows them to re-enter circulation

and be directed to target sites where they are needed to employ their effector functions

[48]. The surface expression of CD62L allows, then, and in coordination with CD44

expression to differentiate the two main memory populations, both in CD4+ and in CD8+ T

cells: central memory T cells (TCM) are CD44hiCD62L+ while effector memory T cells

(TEM) are CD44hiCD62L- [42].

The CCR7 surface expression is another segregation marker for effector and central

memory cells. Although it is usually synchronized with CD62L, some heterogeneity on its

expression has been found in murine memory cells, making CD62L a more reliable

indicator of memory populations in mice [48].

The divergent expression of CD62L translates into different trafficking and tissue

predominance of TCM and TEM cells, as well as cytokine production and proliferative

INTRODUCTION

11

capacities. TCM cells are found principally in the lymph nodes and spleen where they

secrete high amounts of IL-2 and exhibit high proliferation. TEM cells, on the contrary, are

found mainly in the blood, peripheral organs and also in the spleen, show low proliferative

capacity and strong effector function due to immediate ability of IFNγ secretion and

accumulation of granzyme B and perforine in granules characteristic of CD8+ T cells [42,

48].

Antigen-specific TCM cells develop in the presence of the pathogen, though after its

elimination they endure and are the ones that support the rapid response mounted upon

challenge [47, 49]. On the contrary, TEM cells are strong effectors but are eliminated in

the absence of the antigen [47, 49]; when needed to face a challenge they are provided

by the TCM experienced pool [50]. This is in accordance with the linear model of

differentiation observed in mice, humans and non-human primates in which cells

progressively gain function from TCM to TEM to terminal effectors [48], as shown in

Figure IV. In this figure the relation of the memory phenotype and the cytokines these

cells produce is well discriminated.

Figure IV. Differentiation progress of CD4+ and CD8+ effector and memory cells [51].

INTRODUCTION

12

In CD4+ T cells TNFα is the most common cytokine to be detected when a Th1 milieu is

developed [51]. Also IL-2 is found very often in conjunction with TNFα and, although it has

no major effector function, IL-2 promotes lifelong memory cells (even in the absence of

TNFα). These highly sustainable cells can further secrete IFNγ upon another activation

signal, eventually becoming short-lived terminal effector IFNγ single producers cells if the

antigen persists (Figure IV-a) [51]. CD8+ T cells follow a linear progression similar to the

CD4+ T cells trajectory, though TEM cells are able to regain IL-2 expression and revert to

TCM state that concomitantly produce IFNγ, TNFα and IL-2. The fixed lineage model is

also depicted in Figure IV-b showing that TEM cells can be directly originated from

effector cytotoxic CD8+ T cells [51]. The desirable memory phenotype is, then, to have

multifunctional effector cells that concomitantly produce IFNγ and TNFα along with IL-2

that enhances the expansion of the memory pools, contributing to a better effector

response [51].

MEMORY IN LEISHMANIASIS

Memory cells were demonstrated to have great importance in the control of leishmaniasis,

with distinct roles described for TCM and TEM cells. Zaph et al. have shown that in mice

both TCM and TEM CD4+ cells require parasite presence to be developed, though

maintenance of TCM is independent of antigen persistence [49]. This achievement,

however, seems highly dependent on the initial overall T cell response, since in some

immunization experiments that used low dose of parasites protection was lost after the

elimination of the parasites, possibly due to insufficient expansion of the TCM pool [52].

Adoptive transfer of TCM from L. major-infected mice to naïve animals conferred

protection upon a challenge. When facing the antigen, TCM expanded in the lymph

nodes, acquired effector functions, including CD62L downregulation which allowed their

migration to the infection site and effective protection [49].

Nevertheless, concomitant immunity, i.e. efficient protection upon a challenge due to the

long-term and simultaneous persistence of the pathogen, seems to be a hallmark in

leishmaniasis [53]. Studies using mice models have shown that a small numbers of

parasites restricted to the inoculation site, without causing clinical manifestations, are

essential for protection from a virulent challenge [52]. In fact, this is the concept behind

the leishmanization strategy applied in humans, discussed below, where a small amount

of Leishmania virulent parasites are inoculated in a hidden location of the skin with the

objective of protection from a real challenge [54].

INTRODUCTION

13

The regulation of the effector responses prone to Leishmania elimination to avoid the

development of the disease but still leaving a restricted parasite population that maintains

the lifelong memory is done by the CD4+CD25+FoxP3+ regulatory T cells [53]. However,

these cells are also responsible for the reactivation of the persistent parasites in mice [55],

so a tight balance between effector and regulatory T cells must be achieved in order to

retrieve efficient recall responses.

INTRODUCTION

14

Prophylaxis and treatment

VACCINES

Until date, the only successful, long-lasting strategy for human immunization against

leishmaniasis was the leishmanization process. It consists on the inoculation of live

virulent parasites in a hidden area of the skin of healthy people with the purpose of

development of immunity when challenged by a natural infection. Leishmanization showed

100% protection when used as prophylaxis for cutaneous leishmaniasis (CL) throughout

the ex-Soviet Union, Asia, and the Middle East [56]. Due to risk of complications in healthy

people and difficult standardization of the live L. major inoculum, this procedure was

mostly abandoned. However, this is still a current practice in Uzbekistan [56] and a few

years ago it was reported to be applied in the evaluation of the efficacy of new vaccines

[57].

A “natural” form of leishmanization may be the reason why in Sri Lanka so many cases of

CL by L. donovani are reported while VL is rare [8]. McCall et al. have recently reproduced

this scenario in the BALB/c model, immunizing the mice subcutaneously with a

dermotropic L. donovani strain from Sri Lanka followed by intravenous challenge with a

viscerotropic autochthonous strain, and indeed, partial protection was obtained in the liver

of the infected mice [58]. The authors attributed the ability of the cutaneous strain to

protect against the challenge with the visceral strain to a probable great similarity between

the two L. donovani strains, to justify the opposing phenotype observed by others [59].

Also, an epidemiological study in Sudan indicated that only individuals previously negative

for leishmanin (Montenegro skin test) developed VL, thus, though without scientific

evidences, the leishmanin-positive individuals that were possibly formerly infected with L.

major were protected against the visceral disease [60].

First generation vaccines comprise killed parasites and live attenuated parasites. They

were primarily developed to overcome one of the major concerns related to

leishmanization: the risk of disease development in immunocompetent persons and the

total improperness for immunosuppressed patients for this same reason.

With more or less success, some examples of killed vaccines include L. braziliensis crude

antigens tested in dogs [61] and trivalent (L. braziliensis + L. guayanensis + L.

amazonensis) phenol-killed whole Leishmania promastigotes with bacille Calmette-Guérin

(BCG) as adjuvant in Ecuadorian children [62]. According to a meta-analysis conducted in

2009 by Noazin et.al. to evaluate the efficacy of the clinical trials performed with whole

killed parasites in endemic areas since 1970s, with the exception of this latter in Ecuador,

INTRODUCTION

15

none of the other eight clinical trials (based on autoclaved L. major with BCG tested

against CL in the Old World and L. amazonensis or multivalent preparations inactivated

with merthiolate used against CL in the New World) showed significant protection against

natural infection [63]. A new option was tested recently: a killed but metabolically active

(KBMA) L. infantum. This vaccine showed partial protection in spleen and liver of BALB/c

mice 2 and 8 weeks after challenge triggering a mixed Th1/Th2 response but the authors

claim that improving results could be obtained by adding TLR agonists and Th1 adjuvants

[64].

For the live attenuated parasites many are the works reported whether using physical,

chemical or genetic manipulation for reducing the virulence of the strains or even naturally

attenuated strains, like the non-pathogenic L. tarentolae [65]. Some of the most

successful vaccine candidates for VL based on genetically altered live parasites were L

donovani biopterin transporter gene knockout (KO) (BT1−/−) [66], L donovani replication

deficient centrin gene KO (Cen−/−) [67], L donovani cytochrome c oxidase complex

component p27 gene KO (Ldp27−/−) [68], L. infantum silent information regulatory 2 single

KO (SIR2+/−) [69] and L. tarentolae expressing L. donovani A2 antigen [70]. Despite

showing hopeful efficiency in murine models, the promising candidates that were tested in

human and canine diseases failed to protect (reviewed in [71]).

A different approach relies on recombinant proteins, polyproteins, DNA vaccines,

liposomal formulations and dendritic cell vaccine delivery systems [56]; these constitute

the second generation vaccines. A variety of antigens have been tested, though only few

in the scope of VL. These include rgp63, rHASPB1, rA2 and the polyprotein rLeish-111f in

the group of the recombinant proteins; LiESA, FML and amastigote P8 as purified

antigens; LACK and KMP-11 in DNA vaccines (all reviewed in detail in [72]).

For VL, the best vaccine candidate so far tested is the Leish-111f Leishmania

recombinant antigen combined with MPL-SE adjuvant. After having proved to protect in

murine CL [73] and VL [74] it has also demonstrated to be safe and well tolerated in

humans [75]. Clinical trials in dogs have resulted in disparate conclusions about the

efficacy of the vaccine in the prophylaxis of CanL [76, 77], though survival of infected dogs

was increased after vaccination and treatment with glucantime [78].

In canine vaccinology, however, authorized vaccine options are available. Leishmune®

was the first vaccine licensed for the prevention of CanL but is authorized only in Brazil. It

consists of L. donovani purified fuccose-mannose ligand (FML antigen) in combination

with a saponin adjuvant. Clinical trials have showed that Leishmune® reduces the risk of

infection but also prevents disease progression in already infected dogs, though the

INTRODUCTION

16

manufacturer does not recommend the vaccine as immunotherapy. A transmission-

blocking activity was also attributed to this vaccine, making it highly appealing for the

control of the zoonosis [79].

Some years later, Leish-Tec® was released, also only in Brazil. The recombinant A2

protein is the antigen that constitutes the vaccine along with saponin adjuvant. Protection

was found to be related to high levels of IgG and IgG2 anti-A2 antibodies, without the

presence of IgG1, and high amounts of IFNγ with low levels of IL-10 [80].

Recently, a new vaccine, CaniLeish®, the only authorized in Europe, has entered the

market for the prophylaxis of CanL. The manufacturer claims that vaccinated dogs reduce

the risk of developing the disease in 4 fold compared to non-vaccinated animals [81]. The

use of L. infantum excreted/secreted proteins associated to QA-21 adjuvant (LiESP/QA-

21) leads to the increase of IgG2 specific antibodies, stronger Leishmania-specific

lymphoproliferation with increased IFNγ-producing T cell population that is able to activate

a significant leishmanicidal macrophage ability in vitro due to NO production [35].

DRUGS

According to WHO guidelines, treatment should be given only after confirmation of the

disease and following national and regional recommendations. In some cases supportive

treatment, like rehydration, nutritional supplementation or blood transfusions might be

needed before starting the therapy to improve prognosis [24].

Currently six drugs are available for the treatment of VL: pentavalent antimonials (sodium

stibogluconate and meglumine antimoniate), the antifungal amphotericin B (AmpB in the

deoxycholate form and the lipid formulation), the anticancer drug miltefosine and the

antibiotics paramomycin and pentamidine. Pentavalent antimonials are the first line

treatment, followed by AmpB and miltefosine [24]. The treatment is usually prolonged and

requires parenteral (intravenous or intramuscular) administration, with the exception of

miltefosine that is available in oral formulation. All six drugs present high toxicity which

increases the treatment cost due to the necessary monitoring to control the adverse

reactions.

Adverse reactions of pentavalent antimonials include nausea and vomiting, headache,

myalgia and arthralgia, pancreatitis, cardiotoxicity, pancytopenia and peripheral

neuropathy. Following AmpB administration it is frequent to observe thrombophlebitis of

the injected vein, high fever, rigor and chills; hypokalemia and myocarditis are less

common but serious, making hospitalization mandatory during AmpB treatment. Lipid

formulations of AmpB allow the reduction of some side-effects though maintaining the

INTRODUCTION

17

high efficacy of the free compound; nevertheless, back pain and transient nephrotoxicity

or thrombocytopenia are occasionally seen. Miltefosine is potentially teratogenic, thus

should be avoided in pregnant women. Besides this, most frequent side effects related to

miltefosine administration are gastrointestinal manifestations, which are usually resolved

with continuous treatment, and, occasionally, skin allergy and hepatotoxicity; rarely, renal

insufficiency can be observed. Paramomycin is probably the less toxic drug with mild pain

in the injection site being the most frequent adverse reaction; renal and hepatic toxicity

are rarely described. On its turn, however, the severe toxic effects associated to

pentamidine (diabetes mellitus, severe hypoglycemia, shock, myocarditis and renal

toxicity) limit its use [24].

Treatment of CL is usually based on intralesional injection of pentavalent antimonials or

AmpB. Because it is painful and associated with side effects in the surrounding areas of

the wound, topical formulations are also available and can be useful for patients that

cannot tolerate the pain associated to the parenteral administration. However, this

approach raises some controversies due to unclear results concerning its efficacy.

Ointments, solutions or gels are available formulations to vehiculate the antifungal

imidazoles, paramomycin, AmpB or sitamaquine (analogue of the anti-malaric primaquine)

[82].

Non-chemical alternatives have also been tested like thermotherapy using radiofrequency

waves with 50°C temperature for 30 seconds, cryosurgery in combination with drug

therapy, photodynamic therapy with photosensitizers that mediate cytolysis of Leishmania

and CO2 laser. And, finally, honey was shown to ameliorate scaring due to its

antimicrobial properties and increased wound healing [82].

Treatment should cure the patient, reduce the risk of relapse and development of PKDL

and avoid the transmission of resistant parasites [24]. Especially concerning this latter

objective, combination therapies are now highly recommended, the exception being for

lipid formulations of AmpB that could be taken in monotherapy. Combination therapy

shows the same or increased efficacy compared with the drugs alone but using lower

doses of each drug, which decreases the therapy cost and the related adverse reactions.

This, in turn, increases the patients’ compliance in completing the treatment, which

reduces the possibility of generation of resistant parasites, therefore prolonging the

effective life of the available drugs [24].

In the case HIV/Leishmania co-infections, the first line treatment is AmpB (deoxycholate

form or lipid formulations), since pentavalent antimonials present increased toxicity in

INTRODUCTION

18

immunosuppressed patients. In the case of cutaneous manifestations, only parenteral

therapy should be provided (topic administrations are discouraged). If the patient is not

already being treated in a highly active antiretroviral therapy (HAART) regime, VL is an

inclusion criteria even if the CD4+ counts are >200. Despite few information is available

about anti-Leishmania combination therapies, they are recommended to be tested in

HIV/Leishmania co-infected patients, though implemented sequentially instead of

simultaneously, to improve efficacy and reduce toxicity [12].

Treatment for CanL is based on three molecules: meglumine antimoniate, miltefosine and

allopurinol, usually in monotherapy. The responsiveness of the dogs to the treatment is

highly dependent on the initial clinicopathological status. Therapy often leads to clinical

cure, but sterile cure is not achieved, thus treated animals still harbor parasites in their

skin and blood that can be transmitted to the sand flies. Preventive measures are, then,

extremely important in endemic areas and they comprise the use of collars with repellent

compounds to sand flies and topic application of insecticides [15].

INTRODUCTION

19

Transferring Leishmania sp. life cycle to the laboratory

As it has been stated, the completion of Leishmania sp. life cycle requires the passage of

the parasite in two hosts: the insect vector and the mammalian host. In nature,

Leishmania prospers mainly by the maintenance of the sylvatic life cycle. For

xenodiagnosis or to study the parasite-host interaction or the biology of Leishmania it is

mandatory to develop colonies of both the sand flies and the mammalian host (usually

mice, hamsters, dogs or monkeys) and also to provide the means for the development of

both the promastigotes and the amastigotes forms.

PROMASTIGOTES CULTIVATION

Sand fly colonies are difficult to rear. From the 700 species known, less than 60 were ever

colonized in the laboratory, but only few can be maintained and produce large numbers of

individuals to allow their experimental use. Phlebotomus papatasi and Lutzomyia

longipalpis are considered “easy” species to colonize and breed [83]. Entomologists are

encouraged to start new colonies from endemic areas, though this is far more difficult than

to routinely maintain well adapted colonies that are reared for many generations in the

laboratory [83].

The use of infected sand flies as a breeding source of promastigotes is, then,

unreasonable especially because the in vitro culture is very easy and returns large

numbers of parasites. Novy-McNeal-Nicolle (NNN) medium [84] was the first culture

medium described for the in vitro isolation, maintenance and expansion of promastigotes

of several Leishmania species. Diphasic media like NNN are recommended for the

isolation of the parasites from lesions or biopsies, to establish cultures and to routinely

maintain them with yields in the order of 107-108 parasites/mL [85].

An essential component of these media is blood, preferably rabbit blood, that must be

heat inactivated and collected with anticoagulant [85]. However, many other culture media

that do not use blood have been developed over the years. In liquid media, much easier to

prepare and less susceptible to unwanted contaminations, a source of proteins, like fetal

calf/bovine serum (FCS/FBS) or bovine serum albumin (BSA), and a source of heme [86],

usually hemin, fulfill some of the nutritional requisites that blood provides for Leishmania.

Other essential components, like folic acids, vitamins and amino acids must be added to

the media. FCS is also a source of growth factors that enhance the yield of the cultures

[85]. Other growth-stimulatory agents comprise human urine in concentrations from 2 to

INTRODUCTION

20

5%, granulocyte-macrophage colony-stimulating factor (GM-CSF) and insulin-like growth

factors [85].

Thus, in general terms, in vitro culture of Leishmania promastigotes consists in choosing

an adequate culture medium from the many available, transfer a pure inoculum, incubate

over approximately a week at 26-28ºC and recover great numbers of viable

promastigotes. The objective is that inside the flask the developmental steps that naturally

occur in the gut of the sand fly be reproduced [87]. The proliferative procyclic forms will

predominate in the first days of culture and will progressively develop into the stationary

steady-state forms. The continued nutrient consumption will lead to the acidification of the

medium promoting the differentiation of the infective metacyclic forms (Figure V). Before

the culture shows signs of aging, a subpassage of few parasites (~105-106/mL) to new

culture medium should be done in order to maintain the culture with good viability.

Figure V. Leishmania spp. development in the insect vector and in the mammalian host

The shaded area is mimicked by in vitro cultivation of promastigotes and the light area

by axenic cultivation of amastigotes. Adapted from [87]. 

INTRODUCTION

21

Many are the options available of semi-defined and complete defined culture media for the

in vitro culture of promastigotes. The choice of the culture medium to use should be a

rational decision since it influences the final infectivity of the parasites [88]. Moreover, the

continuous in vitro subpassage of promastigotes leads to loss of virulence overtime.

However, transformation into amastigotes by macrophage or mice/hamster infection was

shown to revert promastigotes’ infectivity [30].

AMASTIGOTES CULTIVATION

Concerning the mammalian branch of Leishmania life cycle, amastigotes can be obtained

by the purification of promastigotes-infected cells, whether from in vitro macrophage

infection or from in vivo infections in mice or hamster [89]. However, besides expensive

(especially because of the maintenance of the animal colonies), this process implies 1)

the production of large volumes of promastigote culture, 2) the incubation time needed for

the development of the intracellular amastigotes and subsequent multiplication and 3)

many purification steps to extract the amastigotes from the phagolysosomes and to clean

host cell debris, yielding acceptable numbers of live pure amastigotes. Achieving the

axenic cultivation of amastigotes was, then, a great advance in the in vitro culture of

Leishmania spp.

The first step is to induce the transformation of the promastigotes into amastigotes. This is

done in vitro by mimicking the phagolysosome physical milieu and must be adjusted

depending on Leishmania species. For a better success in the development of

amastigotes from promastigotes, metacyclic-enriched cultures should be used as

metacyclic promastigotes are considered a pre-adaptive form to the mammalian host [85,

90].

Once amastigotes are differentiated they can be subpassaged in vitro similarly to the

promastigotes. However, amastigotes are quite more exquisite in the nutritional

requirements for growth. Higher percentages of FCS are normally needed [85] and

different lots may have obvious impact in the growth (personal observations). Also, the

culture media with all its supplements should be freshly prepared [91], which may

complicate the management of the laboratory settings.

Despite more comfortable to handle and to be maintained, some questions about the

equivalence of axenic amastigotes to bona fide intracellular amastigotes have been raised

[92, 93]. However, it is of general scientific consensus, based on morphological,

biochemical, molecular and antigenic criteria [89], that axenic amastigotes can be used for

INTRODUCTION

22

the understanding of amastigote-specific biological processes [94], infection studies [95]

and in vitro drug screening assays [96], among other applications, similarly to the “real”

amastigotes.

INTRODUCTION

23

What’s left to be done?

Despite Leishmania and leishmaniasis are very active fields in terms of generation of

new knowledge (1449 original papers in the last year and 10 582 in the past decade

indexed in PubMed to both terms), many questions remain unsolved. These are some

of the questions related with the biology of the disease raised by some authors [97, 98]

that remain without a definitive answer:

1) What is the relative importance of each of the numerous evasion strategies that

have been identified in vitro for long-term parasite persistence in vivo?

2) What are the key immunological events that switch the spleen of an infected

animal into a state of chronic inflammation?

3) How does the mechanism of visceralization occur?

4) Do free parasites or infected cells migrate via blood or lymph? 

 

5) Is the mechanism of visceralization similar for spleen, liver and bone marrow?

6) What is the role of Leishmania species-specific genes in determining the

tropism?

7) What are the factors that allow L. donovani to switch from a visceral parasite

(in VL) to a cutaneous parasite (in PKDL)?

In addition to these, other concerns justify future funding for research on leishmaniasis.

New therapeutic alternatives are needed with less toxic effects, dispensing parenteral

administration and presenting high efficacy against resistant parasites. Moreover, the

reality of the vaccine against CL and principally VL is an urgent necessity to control this

disease that globally is the third cause of death among the neglected tropical diseases

[99]. To achieve these important goals, further knowledge in the interaction of the parasite

with its host, in the development of more representative models of human VL and in the

dependence of Leishmania inoculum (number of parasites, developmental stage, route of

administration) in the generated experimental data are required.

 

Objectives

OBJECTIVES

27

Aims of the thesis

Few years ago our group described the efficacy of the live attenuated sir2 single knockout

Leishmania infantum in the protection to the wild type virulent challenge in the murine

model of visceral leishmaniasis (VL) [69]. With the knowledge that advent from that work

and maintaining the interest on the search for a vaccine for VL, we wanted to explore the

possibility of the naturally attenuated strains in protecting from a secondary virulent

infection.

With the emergence of HIV/Leishmania co-infections, new Leishmania zymodemes are

being identified that have never been described in immunocompetent humans and dogs

[100,101]. This fact supports the hypothesis that those strains are only pathogenic in

conditions of immunosuppression and, therefore, are less virulent than those found in

immunocompetent hosts. Nevertheless, very little is known about the infective,

pathogenic, immunogenic and protective capabilities of these naturally attenuated strains

in an immunocompetent host. Therefore, experimental confirmation of the non-

pathogenicity of these L. infantum attenuated strains would promote its interest as live

attenuated vaccine candidates and constitutes the general objective of this thesis.

This was the starting point that led to the elaboration of this thesis. However, because

Leishmania virulence is modulated by the in vitro culture conditions, a special concern

about this matter lead us to develop some work exploring the differences in the infectivity

of several strains according to the culture media used for their growth before starting to

evaluate the inherent infectivity, pathogenicity, immunogenicity and protective ability of

each strain in the context of murine VL.

With this, we planned to follow three lines of work as specific objectives:

1. To study the impact of distinct culture media in L. infantum biology and infectivity.

The morphology, viability, cell cycle progression, metacyclic profile, capacity to

differentiate into axenic amastigotes and infectivity will be analyzed using several

established culture media.

2. To characterize the biology and infectivity of L. infantum viscerotropic and dermotropic

strains isolated from HIV+ and HIV- patients in the murine model of visceral leishmaniasis.

Four strains of L. infantum will be evaluated in terms of molecular typing, in vitro

cultivation and differentiation and in vitro and in vivo infectivity in a murine model of

visceral leishmaniasis. Two strains were isolated from HIV+ patients with visceral

leishmaniasis, one strain was isolated from a cutaneous lesion in an immunocompetent

OBJECTIVES

28

patient and other strain causative of visceral leishmaniasis, also from an

immunocompetent patient, was used for comparison.

3. To understand the influence of two virulent L. infantum strains on the modulation of the

outcome of a de novo infection.

In order to establish the mechanism underlying protection, two of the previously

characterized L. infantum strains will be used to analyze the ability of a very infective and

an intermediate infective strain in the generation of infection-induced immunity and its

efficacy on protection to a subsequent homologous or heterologous challenge in the

murine model of VL.

Results 

 

RESULTS - SECTION 1

31

SECTION 1

The impact of distinct culture media in Leishmania infantum biology and infectivity

In press in Parasitology, 2013

Main findings

Cultivation of Leishmania infantum promastigotes in several media led to the production of

parasites with distinct growing kinetics that present different biological characteristics and

in vitro and in vivo infectivities. Our data prove that media-specific phenomena are

sufficient to induce biological bias with consequences in infectivity and general parasite

biology. Also, we developed a FCS-free medium, named cRPMI. This medium is a cost

effective alternative for promastigote in vitro cultivation in conditions that require the

absence of proteins or for long-term maintenance of infective L. infantum.

RESULTS - SECTION 1

33

The impact of distinct culture media in Leishmania infantum biology and infectivity

Nuno Santarém1,2*, Joana Cunha1,3*, Ricardo Silvestre1, Cátia Silva1, Diana Moreira1, Marc

Ouellette2 and Anabela Cordeiro-da-Silva1,4#

1 Parasite Disease Group, Unit of Infection and Immunity, IBMC - Instituto de Biologia

Molecular e Celular, Universidade do Porto, Portugal 2 Centre de Recherche en Infectiologie du Centre de Recherche du CHUL, Québec,

Canada 3 Instituto de Ciências Biomédicas Abel Salazar e Faculdade de Medicina, Universidade

do Porto 4 Departamento de Ciências Biológicas, Faculdade de Farmácia, Universidade do Porto,

Portugal

* These authors contributed equally for this work.

# Corresponding author

Anabela Cordeiro da Silva, Parasite Disease Group, Unit of Infection and Immunity,

IBMC - Instituto de Biologia Molecular e Celular, Universidade do Porto, Rua do Campo

Alegre, 823, 4150-180 Porto, Portugal

Tel.: +351 226 074 949; Fax: +351 226 099 15; e-mail: cordeiro@ibmc.up.pt

Short title

Experimental bias induced by Leishmania culture

Keywords

Infectivity, Leishmania infantum, culture media, promastigote cultivation.

RESULTS - SECTION 1

34

ABSTRACT

 

An ideal culture medium for Leishmania promastigotes should allow the display of the

basic characteristics of promastigotes found in sandflies (morphology and infectivity).

Furthermore, the media should not be a bias in experimental settings enabling the proper

extrapolation of results. To assess the influence of the culture media on Leishmania

biology we studied several established media for promastigote growth. We analyzed

morphology, viability, cell cycle progression, metacyclic profile, capacity to differentiate

into axenic amastigotes and infectivity. Furthermore, using a rational approach from the

evaluated media we developed a simple serum free medium (cRPMI). We report that

parasites growing in different media present different biological characteristics and distinct

in vitro and in vivo infectivities. The developed medium cRPMI, proved to be a less

expensive substitute of traditional serum-supplemented media for the in vitro maintenance

of promastigotes. In fact, cRPMI is ideal for the maintenance of parasites in the laboratory,

diminishing the expected overtime loss of virulence typical of the parasite cultivation.

Ultimately this report is a clear warning that the normalization of culture media should be a

real concern in the field as media specific phenomena are sufficient to induce biological

bias with consequences in infectivity and general parasite biology.

RESULTS - SECTION 1

35

BACKGROUND

The biology of clinically important flagellated protozoan parasites from the genus

Leishmania has been a subject of increasing academic interest. These parasites have a

life cycle with two distinct forms: extracellular promastigotes that proliferate within the

digestive tract of hematophagous female sandflies and intracellular amastigotes that thrive

in the phagolysosomes of macrophages [1, 2]. Within susceptible mammalian hosts, the

parasite proliferation and associated immune response originate a group of diseases

known as leishmaniasis. Human leishmaniasis is characterized by different clinical

presentations ranging from self-healing cutaneous manifestations to fatal visceralizing

ailments [3]. Yearly, among a risk population of 350 million people, two million new cases

are reported. As there is no vaccine, the disease control relies on effective medical care.

Although several therapeutic options are available, problems related to toxicity and

resistance prevent adequate control and disease eradication [3]. In consequence, a better

understanding of these protozoa is urgent to enable the development of safer and

affordable therapeutic approaches.

A stable and reproducible source of microorganisms is essential to study Leishmania. In

the wild a steady population of Leishmania is maintained by the sylvatic life cycle. In

laboratorial settings, promastigotes can be obtained from infected sandflies or from axenic

cultivation. Biosecurity related problems and the lack of adequate facilities negate the

generalized use of sand flies to study promastigotes [4, 5]. Notwithstanding, the axenic

promastigotes are considered similar to those found in sandflies [6]. On the other hand,

axenic amastigotes are not considered biological surrogates for the intracellular

amastigotes [7, 8]. As consequence, the bulk of the available information about

Leishmania has been obtained from axenic promastigotes.

Novy-MacNeal-Nicolle (NNN) was the first medium used for the in vitro growth of

Leishmania promastigotes [9]. Afterwards, several media were developed in a continuous

effort to create more affordable and defined options for the growth of Leishmania [10-21].

The most common options used for cultivation are semi-defined media supplemented with

fetal calf serum (FCS) in concentrations varying between 5-20% [14]. The FCS is

expensive and highly variable in composition. Its replacement has for long been

considered an advance towards the standardization of in vitro cultivation. Some FCS

substitutes such as milk [21] or urine [10, 22] have been proposed but their used is

limited. Years of axenic culture refinement enabled the definition of generalized nutritional

requirements permitting the creation of completely defined media [16, 20]. The main

nutritional requirements of Leishmania include: heme [23]; 6-hydroxymethylpterine and

related pteridines [24]; high levels of folic acid [25]; the vitamins thiamine, nicotinic acid,

RESULTS - SECTION 1

36

pantothenate, riboflavin, and biotin [14] and also several essential amino acids [14]. As

consequence, the production of completely defined media is normally cumbersome

requiring more than thirty individual components [16, 20].

The traditional requisites for the development of new media for Leishmania spp. culture

are sustained growth and infectivity of the parasites. Nonetheless, promastigote

development in the insect vector involves several stages regulated by genetic and

environmental factors [2]. The assumption that all developed media enable biologically

identical promastigotes is therefore a dangerous oversimplification. In consequence, it is

of crucial importance to evaluate if media can influence and modify promastigote biology.

It is already known that the in vitro maintenance of Leishmania parasites rapidly leads to a

decrease of virulence [26-28]. This phenotype has been related to a mounting incapacity

to differentiate in the amastigote stage [27] or the loss of virulence factors through

hypothetical medium adaptations [8, 26]. Overall, an ideal culture media should not induce

any bias capable of influencing experimental data leading to experimental conclusions

only valid for a specific combination of parasite and media. Human urine is a clear

example of a media component with a specific biological imprint. When used as a medium

supplement it increases parasite proliferation [29] and infectivity [30].

Here, we evaluated the morphologic, biologic and immunological characteristics of L.

infantum promastigotes maintained in four conventional culture media, RPMI [31], SDM

79 [32], Schneider and NNN. Our approach enabled us to clearly assess significant

alterations of relevant promastigotes’ biological parameters in each medium. Furthermore,

we used the biological information obtained to develop a simple serum free media named

cRPMI. The cRPMI retains the biological characteristics required for becoming a medium

of choice in the maintenance of parasites.

RESULTS - SECTION 1

37

MATERIALS AND METHODS

Parasites and cell culture

A cloned line of virulent L. infantum (MHOM/MA/67/ITMAP-263) was maintained at 27°C

in different culture media. SDM-79 [32] (bSDM) was supplemented with 10% fetal calf

serum (Lonza), 5 μg/mL hemin (Sigma), and 5 μM biopterin (Sigma) - SDM. RPMI 1640

medium (Lonza) (bRPMI) was supplemented with 10% FCS, 2 mM L-glutamine (Lonza),

100 U/mL penicillin (Lonza), 100 mg/mL streptomycin (Lonza) and 20 mM HEPES buffer

(Lonza) - RPMI. Schneider’s Insect Medium (Sigma) was supplemented with 10% FCS,

200 units/mL penicillin, 200 units/mL streptomycin, 5mM HEPES buffer, 2.5 g/mL Phenol

Red (Sigma) - Schneider. Novy-MacNeal-Nicolle medium consists of 1.4% agar (Sigma),

0.6% NaCl (Merck), 31% defibrinated rabbit blood, 625 units/mL penicillin, 625 units/mL

streptomycin and RPMI as liquid phase - NNN. Parasites were subcultured every 4 days

with an initial inoculum of 106 parasites/mL, except for SDM and Schneider in which the

initial inoculum was 2.5x105 parasites/mL. Promastigote to amastigote differentiation was

achieved by culturing 107 stationary phase promastigotes/mL in a cell free culture medium

at an acidic pH and 37ºC (MAA20) [33]. To minimize the possibility of clonal bias, we have

performed three independent experiments each one started with a distinct promastigote

clone recovered from experimentally infected BALB/c mice.

Development of protein-free medium

FCS was passed through a centriprep Ultracel YM-3 filtering unit (Millipore) to remove the

bulk of the protein content from the filtrate. The filtrate was then passed through the

filtering device once again and then sterilized through a 0.2 µm filter (Millipore) and stored

at 4ºC until use (this fraction will be herein referred as <3 kDa). The retentate was

dialyzed twice against phosphate buffer saline (PBS) to completely remove the low

molecular weight components and stored at 4ºC until use (this fraction will be herein

referred as >3 kDa). For the complementation experiments, L. infantum promastigotes

growing in RPMI or SDM were washed twice in PBS and transferred for two days at a

density of 106/mL in the respective base medium (bRPMI or bSDM) complemented with

one or combinations of the following supplements: 10% FCS; 10% >3kDa; 10% <3kDa or

2.5 µg/mL hemin. After two days, parasites were transferred again at a density of 106/mL

and evaluated for growth after 4 days counting on a Neubauer chamber. To boost the

growth obtain on bRPMI we added bSDM in defined percentages. For this, L. infantum

promastigotes grown in RPMI were washed twice in PBS and used at a density of 106/mL

in bRPMI supplemented with 2.5 µg/mL of hemin and one or none of the following bSDM

supplements: 10% bSDM, 20% bSDM, 50% bSDM or 100% bSDM. After 4 days of

RESULTS - SECTION 1

38

culture, the growth was determined using a Neubauer chamber. Morphology of the

parasites were imaged using a Spinning Disk Confocal System Andor Revolution XD

(ANDOR Technology, UK) using the 67X oil objective and treated using open source

ImageJ software.

Growth curves

Promastigotes in bRPMI supplemented with 10% bSDM (cRPMI), RPMI, SDM, NNN or

Schneider were grown for 24 hours in a startup culture with the above defined initial

inocula. These cultures were used as starter for the growth curves and followed for 7

days. At defined time points the parasites were counted using a Neubauer chamber.

Cell cycle analysis

Promastigotes were recovered from cultures in specific media at defined time points.

Subsequently, parasites were washed twice and resuspended at a density of 2x106 in 1

mL of PBS 2% FCS. This was followed by the addition of 3 mL of cold absolute ethanol

(Panreac) with continuous vortexing. Cells were then fixed for at least 1 hour at 4ºC and

washed twice in PBS. Before analysis, cells were resuspended in 50 μg/mL propidium

iodide staining solution (Sigma) with 0.5 ng/mL RNase A (Sigma) and incubated 30 min at

4ºC. Data was collected in a BD FACSCalibur cytometer (20000 gated events) and

analyzed by FlowJo software (Tree Star).

Viability analysis

Promastigotes were washed and resuspended at a density of 106/mL in Annexin V binding

buffer (BD Pharmingen). Parasites were then incubated at room temperature for 15

minutes with AnnexinV-Cy5 (BD Pharmingen) and 7-AAD (Sigma). Parasites subjected to

ultra violet light during 30 minutes and kept in culture for 4 hours were used as a positive

control. Data were collected in a BD FACSCalibur cytometer (20000 gated events) and

analyzed by FlowJo software.

Real time RT-PCR

Total RNA from 1x107 promastigotes was purified with TRIzol® reagent (Invitrogen),

according to the manufacturer's instructions and resuspended in 10 μL RNase free water.

RNA concentration was determined by using a Nanodrop spectrophotometer (Wilmington)

and quality was inspected for absence of degradation or genomic DNA contamination,

using the Experion RNA StdSens Chips in the ExperionTM automated microfluidic

electrophoresis system (BioRad Hercules, CA, USA). RNA was stored at -80ºC until use.

RT was performed with equal amounts of total extracted RNA (1 μg) obtained from

RESULTS - SECTION 1

39

parasites recovered from different experimental conditions by using Superscript II RT

(Gibco BRL) and random primers (Stratagene). Real-Time quantitative PCR (qPCR)

reactions were run in duplicate for each sample on a BioRad My iCycler iQ5 in a 20 µL

volume containing 4 µL of cDNA (diluted 25 x), iQ SYBR Green Supermix (BioRad) and

500 nM (histone H4 and Meta1) or 250 nM (rRNA45 and SHERP) of primers. Specific

primers for histone H4 (forward: 5’-ACACCGAGTATGCG-3’; reverse: 5’-

TAGCCGTAGAGGATG-3’) [27], meta1 (forward: 5’-GGGCAGCGACGACCTGAT-3’;

reverse: 5’-CGTCAACTTGCCGCCGTC-3’) [34], Small Hydrophilic Endoplasmic

Reticulum-associated Protein (SHERP) (forward: 5’-CAATGCGCACAACAAGATCCAG-3’;

reverse: 5’-TACGAGCCGCCGCTTATCTTGTC-3’) [27] and rRNA45 (forward: 5’-

CCTACCATGCCGTGTCCTTCTA -3’; reverse: 5’-AACGACCCCTGCAGCAATAC-3’) [35]

were obtained from Stabvida (Portugal), thoroughly tested and used for amplification.

After amplification, a threshold was set for each gene and cycle threshold-values (Ct-

values) were calculated for all samples. Gene expression changes were analyzed using

the built-in iQ5 Optical system software v2.1 (Bio-Rad laboratories, Inc). The results were

normalized using as reference rRNA45 sequence [35].

Staining of parasites with CFSE

Stationary-phase promastigotes (with 4 days of culture) were diluted to a concentration of

1.2x107/mL were used for carboxyfluorescein succinimidyl ester (CFSE, Invitrogen)

labeling. Promastigotes were washed two times with PBS and labeled with 5 µM of CFSE

for 10 minutes at 37ºC shaking every 3 minutes. Then, 9 mL of complete Dulbecco’s

modified Eagle’s medium (DMEM, Lonza) was added and tubes were centrifuged for 10

minutes at 1200g. The supernatant was discarded and the parasites were resuspended in

5 mL of complete DMEM and incubated at 4ºC for 5 minutes. After a final centrifugation

for 10 minutes at 1200g, the promastigotes were resuspended in complete DMEM before

proceeding to macrophage infections.

In vitro macrophage infection

Cell suspensions of bone marrow were obtained by flushing the femurs and tibiae of 10-

12 week-old BALB/c mice. The resulting cell suspension was cultured in DMEM

supplemented with 10 % heat-inactivated FCS, 2 mM L-glutamine, 100 U/mL penicillin,

100 U/mL streptomycin and 1 mM sodium pyruvate (Lonza). After overnight incubation at

37ºC, non-adherent cells were recovered (300g for 10 min at room temperature) and

cultured in 24-well culture dishes at a density of 106 cells/mL. For macrophage

differentiation, 10% L-929 cell conditioned medium was added to complete DMEM at days

0 and 4. At day 7 of culture, CFSE labeled promastigotes were incubated with the

RESULTS - SECTION 1

40

adherent bone-marrow derived macrophages (BMMø) at a 10:1 ratio. After 4 hours,

infection was stopped by washing the cells twice with PBS and further incubated for 24

and 48 hours or immediately scrapped. The infection rates were determined at 4, 24 and

48 hours post-infection by a BD FACSCalibur cytometer and analyzed by FlowJo software

as the percentage of CFSE+ cells.

Animal experiments and parasite quantification

Eight to twelve week-old female BALB/c mice obtained from Instituto de Biologia

Molecular e Celular (IBMC, Porto, Portugal) animal facilities were maintained in sterile

cabinets and allowed sterile food and water ad libitum. Animal care and procedures were

in accordance with institutional guidelines. All experiments were approved by and

conducted in accordance with the IBMC.INEB Animal Ethics Committee and the

Portuguese National Authority for Animal Health (DGAV – Direcção-Geral de Alimentação

e Veterinária) guidelines. RS, JC and ACS have accreditations for animal research given

by DGAV (Ministerial Directive 1005/92). Promastigotes recovered from stationary culture

with 4 in vitro passages were collected, washed and suspended in sterile PBS. A volume

of 200 µl of PBS containing 108 parasites was injected intraperitoneally. Mice of each

group were sacrificed at 56 days post-infection. The parasite burden in the spleen and

liver was determined by limiting dilution as previously described [36].

Statistical analysis and division time calculations

The data was analyzed using the one-way Anova followed by Bonferroni’s post-test for

multiple comparisons when necessary. Minimum doubling time was calculated from

experimental data using the algorithm provided by http://www.doubling-time.com.

RESULTS - SECTION 1

41

RESULTS

 

In vitro characterization of promastigotes grown in distinct media

We started by evaluating the biological characteristics of L. infantum promastigotes grown

in different culture media. We performed daily evaluations of parasite number, viability and

cell cycle analysis (Figure 1A-C). Promastigote culture in SDM, Schneider and NNN

enabled a rapid parasite growth that peaked at day 4 (from 1.0x108-1.3x108 parasites/mL)

followed by a steep decrease (Figure 1A). This decrease in parasite numbers was

concomitant with a significant diminution in viability and multiplicative parasites (Figure 1

A-C).

Figure 1. Parameters of in vitro development of L. infantum in the different culture media

Promastigotes were cultured with an initial concentration of 1x106/mL in RPMI and NNN or 2.5x105

parasites/mL in SDM and Schneider. (A) The growth curve was done by counting the parasites at different

time points in a hemocytometer. (B) Promastigote viability was determined at the defined time points by

quantifying the percentage of Annexin V (Ann V) and 7-aminoactinomycin D (7-AAD) negative promastigotes.

(C) The percentage of S/G2 parasites was determined at different days. (D) Promastigote minimum division

time calculated from the growth curves. *P < 0.05; **P < 0.01; ***P < 0.001 as calculated by One-way ANOVA

followed by Bonferroni’s post-test analyzed in Graph Pad Prism. The cell cycle and viability analysis was done

using FACSCalibur cytometer and analyzed by FlowJo software. The average of at least three experiments is

shown.

RESULTS - SECTION 1

42

In fact, the steep decrease in viability for SDM and Schneider required an adjustment of

the starting inoculum to enable synchronous passages for all media (Figure S1). In

opposition, the promastigotes cultured in RPMI presented a different growth profile with

lower parasite densities (3x107 parasites/mL) that were sustained for more than 10 days

(data not shown). The maintenance of parasite density in RPMI was accompanied by high

viability throughout the growth curve (>90%) and low numbers of multiplicative parasites

(Figure 1B-C).

Concerning the cell cycle analysis, promastigotes in RPMI, SDM and NNN followed a

trend of overtime percentage decrease of S/G2 parasites (Figures 1C, S2 and S3). In all

these media, 40-50% of the parasites presented an S/G2 phenotype up to 2 days of

growth. This was followed by a time dependent decrease until less than 20% of the

parasite population presented this phenotype. The only exception was the in Schneider

medium where more than 50% of the population displayed a S/G2 cell cycle profile for all

the days tested.

The conjugation of growth curve and cell cycle analysis enabled the determination of

minimum division time (Figure 1D). The SDM and Schneider media enabled smaller

division times with an average of 6.56h ± 0.89 and 5.89h ± 0.90, respectively. The

calculated division times for parasites in RPMI (9.74h ± 0.65) and NNN (8.14h ± 0.27)

were significantly higher.

To better integrate the biological information we also registered the dominant

promastigote morphology at specific time points (Figure 2).

Figure 2. Dominant morphology of logarithmic and stationary-phase L. infantum

Promastigotes were cultured with previously established initial inoculum for each medium. After 1 or 4 days of

culture CFSE-labeled parasites were mounted on CyGelTM and live confocal microscopy images were taken.

RESULTS - SECTION 1

43

The first two days of culture were dominated by parasites with rounded bodies and flagella

shorter than the body length. In fact, these represented the only detected form in the first

day of culture. Cultures with four days displayed promastigotes with the traditional needle

shape morphology (Figure 2). The RPMI originated uniform promastigotes with long

flagellum while the other media presented stationary cultures with mixed morphology. The

NNN grown parasites had a different growth phenotype with consistently smaller bodies

than all the other media.

Evaluation of promastigotes infectivity

The evaluation of the in vitro infectivity was done with stationary phase-parasites using

bone marrow derived macrophages as target cells (Figures 3A and S4). Similar

percentages of infected cells were found after 4 hours irrespective of the medium used for

promastigote maintenance (Figure 3A). At 48h post-infection, the SDM grown parasites

consistently presented a significantly higher level of infectivity (Figure 3A). This increased

in vitro infectivity did not translate in higher parasite burden in BALB/c mice (Figure 3B-C).

On the contrary, the visceral parasite load induced by Schneider cultivated parasites were

significantly lower than the other tested media.

Figure 3. In vitro and in vivo virulence of promastigotes grown in different culture media

Parasites with 4 successive in vitro passages in SDM, RPMI, NNN or Schneider were used to perform in vitro

and in vivo infections. (A) Bone marrow-derived macrophages were infected at a 1:10 (cell/parasite) ratio with

CFSE-labeled promastigotes. Data was acquired in FACSCalibur cytometer and analyzed by FlowJo software.

Three independent experiments were performed and mean and standard deviation are shown. (B,C) BALB/c

mice were infected with stationary phase-promastigotes. After 6 weeks of infection, the parasite load was

determined in spleen (B) and liver (C) by limiting dilution. The mean and standard deviation are shown. Two

independent experiments were performed; one representative experiment is shown. *P < 0.05; **P < 0.01;

***P < 0.001 as calculated by One-way ANOVA followed by Bonferroni’s post-test analyzed in Graph Pad

Prism.

Hours post-infection

RESULTS - SECTION 1

44

The presence of metacyclic parasites and the capacity to differentiate into amastigotes

have been described as important elements in virulence [27, 36]. Therefore, to better

understand the differences in infectivity, we evaluated two parameters indicative of

metacyclogenesis and the capacity to differentiate into axenic amastigotes. We analyzed

the expression of two metacyclogenesis-related genes META1 and SHERP and also

Histone H4 (Figures 4 and S5) [35, 37, 38]. A time dependent fold increase in the relative

expression of the above mentioned genes relative to Histone H4 was detected. The

greatest increase was detected for promastigotes in RPMI with a 40-fold increase for

META1. In agreement with the in vivo data, Schneider grown parasites presented no time

dependent variation in these genes. To confirm the possible enrichment of metacyclic

parasites we segregated the promastigotes by Ficoll gradients [39]. These gradients

originated poor yields of metacyclic parasites, less than 6% of the original cultures, with

no specific trend (data not shown). We also evaluated the differentiation into axenic

amastigotes using MAA20 [33]. All media were capable of originating similar numbers of

axenic amastigotes that were able to be sub-cultured (data not shown).

Figure 4. Relative expression of metacyclogenesis-related genes in L. infantum

promastigotes grown in the different media

Promastigotes relative gene expression of (A) META1 and (B) SHERP determined by qPCR at the defined

time points, when compared to Histone H4. Basic normalizations for the three genes were made using the

reference gene rRNA45. Three independent experiments were done, each performed in duplicate; the mean

of the three experiments is shown with SD.

Development of a FCS free medium

After the initial analysis of general biological properties of the parasites grown in different

media we develop a protein free medium with a specific biological phenotype requisite:

the conjugation of infectivity with long lasting stationary cultures. Among the media

evaluated, SDM and RPMI enabled the combination of these characteristics. The former

allowed high yields of more infective but fast dying parasites while the latter enabled long

RESULTS - SECTION 1

45

lasting cultures. Although the media have different composition, the 10% FCS

complementation was a common feature. Therefore, we evaluated the contribution of the

FCS complementation. To achieve this, we used ultracentrifugation devices with 3kDa

membranes to separate the FCS into two distinct fractions: the retentate, composed of

protein associated components with a molecular weight higher than 3 kDa (>3 kDa) and

the filtrate, composed of components with less than 3 kDa (<3 kDa). These two distinct

fractions were then used to complement the defined SDM and RPMI bases (bSDM and

bRPMI). Parasite growth in these complemented media was evaluated after 4 days of

culture (Figure 5 A-B).

Figure 5. Development of a protein-free medium for the growth of L. infantum promastigotes

Relative growth of L. infantum promastigotes (compared to SMD or RPMI) after four days of culture in (A)

bSDM or (B) bRPMI complemented with: no supplement (NS); 10% of the lower fraction of serum (<3 kDa);

10% of high molecular components of serum (>3kDa); 2.5 µg/mL hemin (Hem) and 10% of lower molecular

components of serum with 2.5 µg/mL hemin (Hem; <3 kDa); 10% of high molecular components of serum with

2.5 µg/mL hemin (Hem; > 3 kDa). One representative experiment of five (A) or three (B) is shown. (C) Growth

of L. infantum promastigotes after four days of culture in bRPMI complemented with 2.5 µg/mL of hemin and

different percentages of bSDM. The average of at least three independent experiments is represented.

The parasites were adapted for two days in the tested media to assess the real capacity

for sustaining parasite growth. In all growth capable conditions the parasite viability was

higher than 90% allowing at least two subsequent passages (data not shown). Neither the

bSDM nor bRPMI were able to promote growth even when complemented with <3kDa. In

contrast, the complementation with >3kDa enabled total growth recovery for both media.

In the latter, the parasites were indistinguishable from those in standard media (Figures 1

and S6). The bSDM and bRPMI, alone or upon complementation with <3kDa presented

limited growth, which was partially recovered by the addition of hemin, an essential

component for Leishmania development [23]. The concentration of hemin was adjusted to

2.5µg/mL as lower amounts were growth limiting (data not shown). Hence, hemin

complementation in bSDM enabled 60% of normal growth (Figure 5A), while in bRPMI did

RESULTS - SECTION 1

46

not contribute towards significant growth (Figure 5B). The complementation of both bases

with <3kDa and hemin induced distinct relative growths, 58% for bSDM and 27% for

bRPMI. Significantly, the complementation of bRPMI with hemin and <3kDa or hemin

alone induced morphological features similar to RPMI grown parasites (Figure S6B). The

same complementation for bSDM originated higher parasite yields with morphology that

was different from SDM. To take advantage of the superior yield of bSDM and

morphological characteristics provided by bRPMI, we combined bRPMI and bSDM (Figure

5C). The combination that enabled the highest parasite yield with indistinguishable

morphology from RPMI was obtained complementing bRPMI with 10% bSDM. This

specific ratio of bSDM and bRPMI was called cRPMI. Also, the growth of other strains and

species like L. tarentolae was achieved upon adjustment of the bRPMI/bSDM ratio (data

not shown).

Another important characteristic for media development is the final cost. Thus, we

compared the production cost of cRPMI with other standard media. cRPMI was the least

expensive with half the cost of standard SDM (Table S1) being ideal for parasite

maintenance.

In vitro characterization of promastigotes grown in cRPMI

The cRPMI enabled a continuous and reproducible growth with a maximum density of

≈1.2x107 parasites/mL (Figure 6A). No growth defect was observed in long term parasite

maintenance (Figure S7). The cRPMI enabled up to 12 days of continuous culture with

>90% viability, maintaining the subculture’s multiplicative capacity until the 9th day of

culture (Figure 6A).

Cell cycle analysis demonstrated that promastigotes grown in cRPMI also followed the

general trend of decreasing the percentage of S/G2 parasites with less than 5% at day 5

(Figure 6A). The division time for cRPMI was 12.09h ± 0.41. The morphology in cRPMI

was indistinguishable from RPMI (Figures 2 and 6B). The fold increase of metacyclic

genes was the highest among all tested media with more than 20-fold increase at day 5

for SHERP and 60-fold increase for META1. The cRPMI grown parasites were also able

to differentiate into axenic amastigotes in MAA20.

RESULTS - SECTION 1

47

Figure 6. Biology of L. infantum promastigotes in cRPMI

Promastigotes were cultured in cRPMI with an initial concentration of 1x106/mL. (A) The growth curve (solid

line), percentage of S/G2 parasites (dark dashed line) and viability (light dash line) where determined at

different time points. Parasite number was determined using a hemocytometer. Promastigote viability was

determined by the percentage of Annexin V (Ann V) and 7-aminoactinomycin D (7-AAD) negative

promastigotes. The capacity of the parasites to originate effective inoculates (grey bars) was determined as

follows: in each day of culture, an aliquot of parasites was recovered and used as inoculum to initiate new

subpassages with 1x106/mL. The number of parasites present in culture 2 days after was counted with a

hemocytometer. The cell cycle and viability analysis were done using FACSCalibur cytometer and analyzed

by FlowJo software. The average of three independent experiments is shown. (B) After 1 or 4 days of culture

live confocal microscopy images were taken from the cRPMI grown parasites stained with CFSE and mounted

on CyGelTM. (C) Promastigote relative gene expression of META1 and SHERP compared to histone H4 was

determined by qRT-PCR at the defined time points. Normalizations for the three genes were made using the

reference gene rRNA45. Three independent experiments were done, each performed in duplicate; the mean

of the three experiments is shown with SD. (D) Bone marrow-derived macrophages were infected at a 1:10

(cell/parasite) ratio with CFSE-labeled promastigotes submitted to 4 successive in vitro passages in cRPMI.

Data were acquired by FACSCalibur cytometer and analyzed by FlowJo software. The mean and standard

deviation of duplicates are shown. Three independent experiments were performed; one representative

experiment is shown. (E) BALB/c mice were infected with stationary phase-promastigotes. After 6 weeks post-

infection, the parasite load was determined in spleen and liver by limiting dilution. The mean and standard

deviation are shown. Two independent experiments were performed; one representative experiment is shown.

*P < 0.05; **P < 0.01; ***P < 0.001 as calculated by One-way ANOVA followed by Bonferroni’s post-test

analyzed in Graph Pad Prism.

RESULTS - SECTION 1

48

Promastigotes grown in cRPMI maintained in vitro and in vivo infectivity without

significant loss of virulence

The in vitro infectivity of promastigotes grown in cRPMI was evaluated as above. (Figure

6D). The infection profile was similar to the one obtained with RPMI grown parasites with

the number of infected cells dropping to less than 20% at 48h. The in vivo infectivity was

similar to RPMI, SDM e NNN parasites (Figures 3 and 6E). We also evaluated the short

term loss of infectivity associated with continuous subculture [27]. For this, we have made

infections with promastigotes that were maintained in SDM, RPMI or cRPMI for 20

passages. The predicted number of generations for each passage (using 5 days of

subculture) is higher in SDM (9 generations) when compared to RPMI (5 generations) and

cRPMI (3.5 generations). Promastigotes subcultured in cRPMI medium maintained

infectivity to similar levels as P4 promastigotes (Figure 7). In opposition, all promastigotes

grown in other tested media had a significant loss of infectivity after 20 in vitro successive

passages. This loss was more evident in SDM grown promastigotes that presented the

most significant drop in infectivity (more than 50% - Figure 7). A similar time dependent

loss of infectivity was already reported for RPMI [27].

Figure 7. Overtime virulence loss

Bone marrow-derived macrophages were infected at a 1:10 (cell/parasite) ratio with CFSE-labeled

promastigotes submitted to 4 or 21 successive in vitro passages in SDM, RPMI or cRPMI. Data were

acquired by FACSCalibur cytometer and analyzed by FlowJo software. Bars represent the percentage of

infected cell by promastigotes with 21 passages in relation to the infection by parasites with 4 passages

(dashed line); the mean and standard deviation of duplicates are shown. Three independent experiments were

performed; one representative experiment is shown.

RESULTS - SECTION 1

49

DISCUSSION

 

Ideally the use of distinct media should not be a determining factor in Leishmania biology

enabling comparison of experimental results obtained with promastigotes grown in

different media. To evaluate the potential bias induced by distinct media, we analyzed

several promastigote characteristics in four distinct commonly used media. In a simplistic

perspective, the development of promastigote forms can be divided in logarithmic

(procyclic) and stationary stages. The correct definition of these stages is pivotal because

the characteristics of multiplicative and stationary phase-parasites are distinct. In fact,

several studies are supported by the correct definition of these stages [40, 41]. Therefore,

we started to define these two basic promastigote stages in the context of different media.

All the promastigote growth curves were characterized by a phase of active increase in

parasite number followed by a slower growth or stationary phase (Figure 1A). The

promastigote division time calculated for each individual media during the first two days

was remarkably constant (data not shown). Still, inter-medium variations were detected

ranging from 5.89h ± 0.90 (Schneider) to 9.74h ± 0.65 (RPMI) (Figure 1D). This media

dependency of the average division time was already reported [42] and will have an

immediate impact in any study that evaluate cell cycle progression. As example, full cell

cycle progression in L. mexicana using M199 based medium was shown to take 7.1 hours

[43]. This value is similar to the division times for our strain in SDM (6.56h ± 0.89),

Schneider (5.89h ± 0.90) but significantly different from the values obtained for RPMI

(9.74h ± 0.65) and NNN (8.14h ± 0.27). The use of minimum division time to define the

logarithmic phase suggests that the parasites are dividing with unrestrained speed for the

first two days of culture. This is supported by cell cycle analysis as for the first two days

more than 40% of parasites were in S/G2 phase (Figure 1C). Nonetheless, the use of the

growth curve to define the time frame for recovery of stationary phase-parasites can be

misleading. Considering exclusively the promastigotes growth curve profile, for SDM,

NNN and Schneider the logarithmic phase will be limited to the first two days while the

stationary phase will be between day 3 and 5. Notwithstanding, cell cycle profile of

Schneider grown parasites does not support this assumption. Promastigotes in Schneider

presented an atypical behavior with more than 50% being in a stable S/G2 phase

throughout the culture span. This S/G2 profile suggests continuous division with the

absence of a defined stationary phase as it is traditionally characterized. The overtime

increase in the theoretical division time indicates that cells take a longer time to complete

the cell cycle - considering that cell death is negligible until day 4 (more than 90% viability)

(Figure 1B). The possibility of reduced/absent stationary phase in Schneider parasites

was reinforced by: morphological information that supported the existence of multiplicative

RESULTS - SECTION 1

50

parasites even at later stages of culture, no increase in metacyclic specific genes and

lower in vivo infectivity in BALB/c mice (logarithmic parasites are known to be less

infective [44]). The RPMI grown parasites present a distinct growth behavior from the

other media evaluated with a long stationary phase and high viability lasting until day 10.

The cell cycle profile fully supports this assumption (Figure 1C). Interestingly, the general

characteristics of the parasites are maintained overtime with no significant change in

infectivity (data not shown). In consequence, simple generalizations of the growth phase

of Leishmania cultures must be avoided. The proper definition of the time frame

dominated by logarithmic or stationary phase-parasites must be supported by cell cycle

and growth curve derived information (including minimum division time and viability).

The capacity to infect and originate productive infections is a characteristic of stationary

phase-parasites. The SDM grown parasites presented significantly higher infection levels

after 48 hours than the other tested media (Figure 3). A higher number of

immunomodulatory metacyclic parasites could explain these differences [27]. However,

neither the metacyclic specific gene expression nor the recovery from ficoll gradient

supported this possibility. Indeed, the SDM grown parasites present similar metacyclic

gene expression as RPMI parasites (Figures 4 and S5). Other factors can be accountable

for these differences in infection. Apoptotic parasites have been shown to be relevant for

the infectious process [45]. The level of apoptotic parasites was distinct among the

cultures evaluated (Figure 1B), with a steep increase in apoptotic cells after day 4 (except

for RPMI). This might contribute to the differences found in SDM as it was shown for L.

braziliensis that apoptotic parasites inhibit the inflammatory response [45]. In fact, at day 4

the percentage of apoptotic parasites in SDM culture is higher, although not statistically

significant, than RPMI. Therefore, a significant experimental bias may be induced if

promastigotes with 5 days were used, as parasite viability is significantly decreased in

NNN, Schneider and SDM. Also, the promastigotes from Schneider presented a specific

phenotype related to infection as they are significantly less infective in vivo. The lower

expression of metacyclic specific genes hints at the possibility of having less metacyclic

parasites. Still, we cannot infer that the differences in in vivo infectivity are directly related

with a possible reduced metacyclogenesis. The attempts to recover metacyclic parasites

from each media did not give additional significant information. Moreover, promastigotes

cultivated in SDM, which are more resistant to macrophage-specific killing (Figure 3A), do

not express higher levels of those genes. These facts reinforce the importance of solid

parasite characterization before the intended use. Interestingly, the reported differences

for in vitro infections did not translate into significantly different in vivo infections for SDM,

RESULTS - SECTION 1

51

RPMI and NNN. The high number of parasites used and the infection route might account

for the lack of differences between infections.

A possible explanation for the significant biological differences reported here might be the

existence of different promastigotes forms [46]. In the sandfly, the promastigotes follow a

specific developmental process encompassing the differentiation from amastigotes to

metacyclic promastigotes. This process involves successive promastigote stages:

procyclic, nectomonads, leptomonads and metacyclic [46]. These forms have distinct

predicted biological roles and morphology [47]. The latter allows their distinction by simple

microscopic analysis [46]. Interestingly, it was proposed that starting from amastigotes,

one can find all these proposed developmental stages in vitro [6]. The mechanisms

responsible for these changes are not clear, although some facts related to the metacyclic

development are known. Culture at low pH was associated with increased

metacyclogenesis in L. mexicana [48]. Glucose consumption in Trypanosomatids induces

a decrease of environmental pH due to the production of oxidized intermediates and

organic acids [49]. Therefore, it is clear that the media content can influence not only the

density of parasites but also the population composition. Interestingly, the dominant

parasite morphology in the different media could be fitted in distinct morphological groups

[46]. On the first day all cultures presented procyclic parasites with cell bodies bigger than

flagella and of variable width (Figure 2). After 4 days of culture the panorama was distinct.

RPMI presented very homogeneous cultures of needle shaped parasites longer than 12

µm and possessing long flagella that resemble nectomonads. Interestingly, the

nectomonads are not multiplicative forms. This fact might explain the abnormal time span

of the RPMI cultures (more than 10 days) compared to all other tested media (5 days). It

is possible that RPMI promastigotes are mostly arrested in the nectomonads stage with

very few advancing to the leptomonads stage. This would explain the low numbers of

metacyclic parasites found for this strain in RPMI on previous works [27]. All the other

media promote cultures with mixed morphology at the 4th day of culture. The NNN grown

parasites were visibly smaller than all the other parasites (Figure 2). This was an intriguing

fact that reinforces the importance of media selection. Noteworthy was the continuous

presence of multiplicative promastigotes in Schneider medium. The parasites with 4 days

are also multiplicative but distinct from day one with longer flagella and slower division

times. These might represent the second promastigote multiplicative form, the

leptomonads. It is possible that Schneider grown parasites are not able to pass this last

developmental stage failing to originate metacyclic promastigotes. Cultures with 4 days in

SDM presented a mixture of promastigotes with morphologies similar to nectomonads,

leptomonads and metacyclic parasites. It is still unclear whether these distinct

RESULTS - SECTION 1

52

morphological forms are associated with relevant biological phenomena in vitro, although

further studies must be done to evaluate this. Still, the distinct biological properties of the

cultures point to the pressing necessity for standardization of culture conditions. In fact,

the use of clonal populations, as a result of parasite genetic modifications, might

exacerbate the potential of the media to induce significant biological imprint on the

parasites [50].

Taking in consideration the different growth profiles induced by the media and the

associated costs (Table S1) one can think on specific media applications. For example,

SDM is the most cost efficient media, therefore should be the best option to produce

parasite mass for DNA extraction. Furthermore, if swift and continuous parasite growth is

required, like limiting dilution assays for parasite load quantification, Schneider should be

a solid choice as it enables fast growth, allowing rapid and easy to read results (the media

changes color due to acidification induced by parasite multiplication). However, for

application requiring protein recovery or other biological determinations there is a strong

possibility of media-induced phenotypes, as parasite growth and infectivity can be media

specific.

The evaluation of the biological characteristics of the distinct media enabled the creation

of a simple FCS free media for the routine culture of L. infantum. The convenience of

removing FCS from the media is clearly shown using RPMI. Other groups reported

different parasite densities and smaller division times [17, 20, 42]. These growth variations

described for the RPMI might be due to FCS intrinsic heterogeneity. In fact, our personal

observations support this hypothesis. We detected a density variation of 1x107 resulting

from a change on the FCS lot (Figure S8). Therefore, we pursued the creation of a

medium that enabled the growth of virulent parasites with uniform stationary morphology

and long lasting viability. These attributes are important for long term protein-free studies,

like exoproteome recovery, where reduced cell death is an essential requisite. The RPMI

media was the media that enabled this phenotype. In the absence of FCS the RPMI base

(bRPMI) did not sustained any parasite growth. Therefore, it required a supplement to be

added to the bRPMI. From the other studied media, only SDM conjugated a protein-free

base (bSDM) with highly infective parasites. The SDM medium enabled short lived

cultures with mixed morphology reaching more than twice the culture density of RPMI. As

both media were complemented with 10% FCS, the differences in culture profile must

originate in the composition of the base media. Leishmania spp. are auxotrophic for heme,

therefore they require an exogenous heme source [23]. The removal of the serum leads to

the loss of hemoglobin as the main usable iron/heme source [51, 52]. To overcome this

limitation we used hemin [53, 54]. The complementation experiments using fractionated

RESULTS - SECTION 1

53

FCS confirm that both bases were unable to promote parasite growth or survival in the

absence of hemin (Figure 5A-B). The fractionation of FCS suggests that the protein

fraction (>3kDa) is required for culture density. This is not unexpected because bovine

serum albumin can be added as a media supplement improving parasite doubling times

[14]. The incapacity of the <3kDa fraction to promote growth restoration in bSDM

suggested that bSDM contains all the nutrients (or equivalent) existing in the <3kDa

fraction. The morphology of the parasites was also used also as quality control, as

parasites with abnormal morphology are usually in stress conditions [55]. We used as

criteria of normal morphology the elongated and pointed promastigotes with an anterior

flagellum exceeding the body length. Parasites in bSDM presented abnormal morphology

in the absence of protein supplementation (Figure S6A). On the contrary, parasites in

bRPMI presented the classical morphology of stationary phase-promastigotes irrelevantly

of the complementation (Figure S6B). Remarkably, it seemed to be medium specific

elements that enabled acquisition and maintenance of the traditional stationary forms. As

the essential nutrients in FCS could be substituted by bSDM, we used it to complement

bRPMI boosting the culture density (Figure 5C). Indeed, 10% bSDM complementation of

bRPMI enabled the growth of promastigotes morphologically indistinguishable from

parasites cultivated in RPMI (Figure 2 and 6B). The proportion of both bases was strain

and species specific, since we were able to cultivate the non-pathogenic L. tarentolae,

which presented optimal growth with 20% bSDM in cRPMI (data not shown). The cRPMI

enabled lower parasite densities with longer division times of 12.9h ± 0.41. The viability,

cell cycle and infectivity retained the characteristics of RPMI. This was expected because

the bRPMI fraction accounts for 90% of cRPMI. Significantly, the high viability sustained

over time lead to a longer life span similar to RPMI. This culture longevity is significant,

enabling studies with long term growth of promastigotes. Prolonged viability also

minimizes the number of passages required for parasite maintenance. Indeed, this is

highly relevant for in vitro culture of Leishmania, as virulence loss results from continuous

cultivation [27]. This loss of virulence reported is consistent with the number of

generations passed since the recovery of parasites from the mammalian host [27]. In fact,

in our sub-culture settings, twenty passages enable at least 80, 120 and 200 generations

for parasites cultivated in cRPMI, RPMI and SDM, respectively. It would be expected that

the effects of virulence loss might be diminished in cRPMI when compared to the other

two media. In fact, twenty passages in SDM induced a significant infectivity loss at 48h

after in vitro infection when compared to parasites grown in RPMI and cRPMI. The only

medium without significant virulence loss was cRPMI, confirming the effect of the

passages in infectivity. Moreover, parasites in cRPMI could be successfully passed until

the 9th day of culture (Figure 6A). Therefore, the number of generations should decrease

RESULTS - SECTION 1

54

dramatically if we subculture the parasites at the 9th day (≈ 40 generations). This would

result in an expected significant increase in the usable life span of the parasites between

their recovery from mice and intended elimination due to virulence loss. The low cost

associated to cRPMI also supports its use for culture maintenance. Still, the lower yield

associated transforms it in the least cost effective media. This is not a significant limitation

of cRPMI; nonetheless it is not the best option for producing large numbers of parasites.

Therefore in this work, we clearly demonstrated that axenic cultivation of promastigotes

induces specific biological, morphological and immunological biases in a media-specific

manner. This fact will inherently influence experimental interpretation and warrants further

investigation. We also developed a serum free semi-defined medium, cRPMI, which

sustain the growth of promastigotes biologically indistinguishable from parasites cultivated

in RPMI. This medium enables the affordable maintenance of infective parasites for longer

times, increasing the sub-culturing time.

FINANCIAL SUPPORT

This work was funded by FEDER funds through the Operational Competitiveness

Program – COMPETE and by National Funds through FCT – Fundação para a Ciência e

a Tecnologia under the projects FCOMP-01-0124-FEDER-011054 (PTDC/SAU-

FCF/100749/2008), FCOMP-01-0124-FEDER-011058 (PTDC/SAU-FCF/101017/2008),

FCOMP-01-0124-FEDER-019648 (PTDC/BIA-MIC/118644/2010) and CIHR operating

grants to MO. NS, JC and DM were supported by fellowships from FCT code

SFRH/BD/37352/2007, SFRH/BD/48626/2008 and SFRH/BD/91543/2012, respectively.

RS was supported by Programa Ciência – financed by Programa Operacional Potencial

Humano POPH – QREN– Tipologia 4.2 – Promoção do Emprego Científico, co-funded by

Fundo Social Europeu and National funding from Ministry of Science, Technology and

Higher Education (MCTES). MO holds the Canada Research Chair in Antimicrobial

Resistance.

RESULTS - SECTION 1

55

SUPPLEMENTAL DATA

 

Figure S1. Adjustment of initial inoculum for SDM and Schneider media

Promastigotes with 4 passages were cultured with a variable initial concentration in (A) SDM or (B)

Schneider. The average of two independent experiments is shown.

________________________________________________________________________ 

 

Figure S2. Histogram of cell cycle analysis of parasites in different media

Representative histograms for cell cycle analysis of parasites with 1 to 5 days of culture in RPMI, SDM,

NNN, Schneider and cRPMI. The cell cycle analysis was done with a FACSCalibur cytometer and

FlowJo software’s built-in tool for cell cycle analysis. One out of at least three experiments is shown.

RESULTS - SECTION 1

56

 

Figure S3. Cell cycle analysis of parasites in different media

The percentage of parasites in G1, S or G2 was determined at days 1 to 5 of culture in SDM, RPMI, NNN,

Schneider and cRPMI. The cell cycle analysis was done using FACSCalibur cytometer and analyzed by

FlowJo software. One out of at least three experiments is shown.

 

________________________________________________________________________ 

 

 

Figure S4. Dot plot of bone marrow-derived macrophages infected with CFSE labeled parasites

Promastigotes used were grown for 4 days in RPMI, SDM, NNN, Schneider and cRPMI and labeled with

CFSE. The percentage of infected cells was determined with a FACSCalibur cytometer and FlowJo software.

One out of at least three experiments is shown.

 

RESULTS - SECTION 1

57

 

Figure S5. Relative gene expression of metacyclogenesis-related genes of

promastigotes cultivated in the different media

Promastigote relative gene expression of (A) META1, (B) SHERP and (C) histone H4

determined by qRT-PCR at the defined time points. Normalizations for the three genes were

made using the reference gene rRNA45. Three independent experiments were executed, each

performed in duplicate; one representative experiment is shown.

________________________________________________________________________ 

A

 

B

 

Figure S6. Dominant promastigote morphology during the process of

development of the protein-free media

Live confocal images from dominant morphology of L. infantum promastigotes after four

days of culture in (A) bSDM or (B) bRPMI supplemented with: (a) no supplement; (b) 10%

of <3 kDa; (c) 10% of >3kDa; (d) 2.5 µg/mL hemin; (e) 10% of <3 kDa with 2.5 µg/mL

hemin; (f) 10% of >3kDa with 2.5 µg/mL hemin.

RESULTS - SECTION 1

58

 

Figure S7. Growth curves of L. infantum in cRPMI after 4 or 20 in vitro passages

Promastigotes with 4 or 20 passages were cultured with an initial concentration of 1x106 /mL

parasites in cRPMI. The growth curve was done by counting the parasites at different time points in

a hemocytometer. One out of at least three independent experiments is shown.

________________________________________________________________________ 

Figure S8. Influence of different FCS lots on the growth of L. infantum cultivated in RPMI

Promastigotes were cultured with an initial concentration of 1x106 /mL parasites in RPMI using

FCS from two distinct lots. The growth curve was done by counting the parasites at different time

points in a hemocytometer. One out of at least three independent experiments is shown.

________________________________________________________________________ 

Table S1. Comparative cost of the culture media used in the study

Cost/L (€) Cost (€)/109 promastigotes

SDM 60.2 4.52

RPMI 38.53 12.72

cRPMI 32.87 17.71

Schneider 58.18 5.21

NNN 74.52 6.18

RESULTS - SECTION 1

59

REFERENCES

 

1. Mougneau E, Bihl F, Glaichenhaus N: Cell biology and immunology of Leishmania. Immunological

reviews 2011, 240(1):286-296.

2. Bates PA: Transmission of Leishmania metacyclic promastigotes by phlebotomine sand flies. Int J

Parasitol 2007, 37(10):1097-1106.

3. Kedzierski L: Leishmaniasis Vaccine: Where are We Today? J Glob Infect Dis 2010, 2(2):177-185.

4. Volf P, Volfova V: Establishment and maintenance of sand fly colonies. Journal of vector ecology :

journal of the Society for Vector Ecology 2011, 36 Suppl 1:S1-9.

5. Freitas VC, Parreiras KP, Duarte AP, Secundino NF, Pimenta PF: Development of Leishmania

(Leishmania) infantum chagasi in its natural sandfly vector Lutzomyia longipalpis. Am J Trop Med

Hyg 2012, 86(4):606-612.

6. Gossage SM, Rogers ME, Bates PA: Two separate growth phases during the development of

Leishmania in sand flies: implications for understanding the life cycle. International journal for

parasitology 2003, 33(10):1027-1034.

7. Rochette A, Raymond F, Corbeil J, Ouellette M, Papadopoulou B: Whole-genome comparative RNA

expression profiling of axenic and intracellular amastigote forms of Leishmania infantum.

Molecular and biochemical parasitology 2009, 165(1):32-47.

8. Pescher P, Blisnick T, Bastin P, Spath GF: Quantitative proteome profiling informs on phenotypic

traits that adapt Leishmania donovani for axenic and intracellular proliferation. Cellular

microbiology 2011, 13(7):978-991.

9. Nicolle C: Culture du parasite du bouton d’Orient. C R Acad Sci 1908(146):842–843.

10. Singh S, Mohapatra DP, Sivakumar R: Successful replacement of fetal calf serum with human urine

for in vitro culture of Leishmania donovani. J Commun Dis 2000, 32(4):289-294.

11. Grekov I, Svobodova M, Nohynkova E, Lipoldova M: Preparation of highly infective Leishmania

promastigotes by cultivation on SNB-9 biphasic medium. J Microbiol Methods 2011.

12. Rodrigues Ide A, da Silva BA, dos Santos AL, Vermelho AB, Alviano CS, Dutra PM, Rosa Mdo S: A new

experimental culture medium for cultivation of Leishmania amazonensis: its efficacy for the

continuous in vitro growth and differentiation of infective promastigote forms. Parasitology

research 2010, 106(5):1249-1252.

13. Sharief AH, Khalil EA, Omer SA, Abdalla HS: Innovative serum-free medium for in vitro cultivation

of promastigote forms of Leishmania species. Parasitol Int 2008, 57(2):138-142.

14. Schuster FL, Sullivan JJ: Cultivation of clinically significant hemoflagellates. Clinical microbiology

reviews 2002, 15(3):374-389.

15. Tasew G, Kebede A, Wolday D, Gadisa E, Britton S, Eidsmo L, Akuffo H: Low-cost liquid medium for

in vitro cultivation of Leishmania parasites in low-income countries. Glob Health Action 2009, 2.

16. Steiger RF, Black CD: Simplified defined media for cultivating Leishmania donovani

promastigotes. Acta Trop 1980, 37(2):195-198.

RESULTS - SECTION 1

60

17. Limoncu ME, Balcioglu IC, Yereli K, Ozbel Y, Ozbilgin A: A new experimental in vitro culture medium

for cultivation of Leishmania species. J Clin Microbiol 1997, 35(9):2430-2431.

18. Palomino JC: Peptone-yeast autolysate-fetal bovine serum 10, a simple, inexpensive liquid

medium for cultivation of Leishmania spp. J Clin Microbiol 1982, 15(5):949-950.

19. Hendricks LD, Wood DE, Hajduk ME: Haemoflagellates: commercially available liquid media for

rapid cultivation. Parasitology 1978, 76(3):309-316.

20. Merlen T, Sereno D, Brajon N, Rostand F, Lemesre JL: Leishmania spp: completely defined medium

without serum and macromolecules (CDM/LP) for the continuous in vitro cultivation of infective

promastigote forms. Am J Trop Med Hyg 1999, 60(1):41-50.

21. Muniaraj M, Lal CS, Kumar S, Sinha PK, Das P: Milk of cow (Bos taurus), buffalo (Bubalus bubalis),

and goat (Capra hircus): a better alternative than fetal bovine serum in media for primary

isolation, in vitro cultivation, and maintenance of Leishmania donovani promastigotes. J Clin

Microbiol 2007, 45(4):1353-1356.

22. Armstrong TC, Patterson JL: Cultivation of Leishmania braziliensis in an economical serum-free

medium containing human urine. J Parasitol 1994, 80(6):1030-1032.

23. Chang CS, Chang KP: Heme requirement and acquisition by extracellular and intracellular stages

of Leishmania mexicana amazonensis. Molecular and biochemical parasitology 1985, 16(3):267-276.

24. Bello AR, Nare B, Freedman D, Hardy L, Beverley SM: PTR1: a reductase mediating salvage of

oxidized pteridines and methotrexate resistance in the protozoan parasite Leishmania major.

Proc Natl Acad Sci U S A 1994, 91(24):11442-11446.

25. Kar K: Folic acid the essential supplement to brain heart infusion broth for cultivation and cloning

of Leishmania donovani promastigotes. Parasitology 1997, 115 ( Pt 3):231-235.

26. Mitchell GF, Handman E, Spithill TW: Vaccination against cutaneous leishmaniasis in mice using

nonpathogenic cloned promastigotes of Leishmania major and importance of route of injection.

Aust J Exp Biol Med Sci 1984, 62 ( Pt 2):145-153.

27. Moreira D, Santarem N, Loureiro I, Tavares J, Silva AM, Amorim AM, Ouaissi A, Cordeiro-da-Silva A,

Silvestre R: Impact of continuous axenic cultivation in Leishmania infantum virulence. PLoS

neglected tropical diseases 2012, 6(1):e1469.

28. Nolan TJ, Herman R: Effects of long-term in vitro cultivation on Leishmania donovani

promastigotes. J Protozool 1985, 32(1):70-75.

29. Shamsuzzaman SM, Furuya M, Korenaga M, Imamura K, Hashiguchi Y: Use of urine samples from

healthy humans, nephritis patients or other animals as an alternative to foetal calf serum in the

culture of Leishmania (L.) donovani in vitro. Ann Trop Med Parasitol 1999, 93(6):613-620.

30. Allahverdiyev AM, Bagirova M, Elcicek S, Koc RC, Oztel ON: Effect of human urine on cell cycle and

infectivity of Leismania species promastigotes in vitro. The American journal of tropical medicine

and hygiene 2011, 85(4):639-643.

31. McCarthy-Burke C, Bates PA, Dwyer DM: Leishmania donovani: use of two different, commercially

available, chemically defined media for the continuous in vitro cultivation of promastigotes. Exp

Parasitol 1991, 73(3):385-387.

RESULTS - SECTION 1

61

32. Brun R, Schonenberger: Cultivation and in vitro cloning or procyclic culture forms of Trypanosoma

brucei in a semi-defined medium. Short communication. Acta Trop 1979, 36(3):289-292.

33. Sereno D, Lemesre JL: Axenically cultured amastigote forms as an in vitro model for investigation

of antileishmanial agents. Antimicrob Agents Chemother 1997, 41(5):972-976.

34. Soto M, Quijada L, Alonso C, Requena JM: Molecular cloning and analysis of expression of the

Leishmania infantum histone H4 genes. Molecular and biochemical parasitology 1997, 90(2):439-447.

35. Santos MG, Silva MF, Zampieri RA, Lafraia RM, Floeter-Winter LM: Correlation of meta 1 expression

with culture stage, cell morphology and infectivity in Leishmania (Leishmania) amazonensis

promastigotes. Memorias do Instituto Oswaldo Cruz 2011, 106(2):190-193.

36. Ouakad M, Bahi-Jaber N, Chenik M, Dellagi K, Louzir H: Selection of endogenous reference genes

for gene expression analysis in Leishmania major developmental stages. Parasitology research

2007, 101(2):473-477.

37. Silvestre R, Cordeiro-Da-Silva A, Santarem N, Vergnes B, Sereno D, Ouaissi A: SIR2-deficient

Leishmania infantum induces a defined IFN-gamma/IL-10 pattern that correlates with protection.

Journal of immunology 2007, 179(5):3161-3170.

38. Yao C, Chen Y, Sudan B, Donelson JE, Wilson ME: Leishmania chagasi: homogenous metacyclic

promastigotes isolated by buoyant density are highly virulent in a mouse model. Exp Parasitol

2008, 118(1):129-133.

39. Holzer TR, McMaster WR, Forney JD: Expression profiling by whole-genome interspecies

microarray hybridization reveals differential gene expression in procyclic promastigotes, lesion-

derived amastigotes, and axenic amastigotes in Leishmania mexicana. Mol Biochem Parasitol

2006, 146(2):198-218.

40. McNicoll F, Drummelsmith J, Muller M, Madore E, Boilard N, Ouellette M, Papadopoulou B: A combined

proteomic and transcriptomic approach to the study of stage differentiation in Leishmania

infantum. Proteomics 2006, 6(12):3567-3581.

41. Fritsche C, Sitz M, Weiland N, Breitling R, Pohl HD: Characterization of the growth behavior of

Leishmania tarentolae: a new expression system for recombinant proteins. J Basic Microbiol 2007,

47(5):384-393.

42. Wheeler RJ, Gluenz E, Gull K: The cell cycle of Leishmania: morphogenetic events and their

implications for parasite biology. Mol Microbiol 2011, 79(3):647-662.

43. Alvarez-Rueda N, Biron M, Le Pape P: Infectivity of Leishmania mexicana is associated with

differential expression of protein kinase C-like triggered during a cell-cell contact. PLoS One

2009, 4(10):e7581.

44. Wanderley JL, Pinto da Silva LH, Deolindo P, Soong L, Borges VM, Prates DB, de Souza AP, Barral A,

Balanco JM, do Nascimento MT et al: Cooperation between apoptotic and viable metacyclics

enhances the pathogenesis of Leishmaniasis. PLoS One 2009, 4(5):e5733.

45. Rogers ME, Chance ML, Bates PA: The role of promastigote secretory gel in the origin and

transmission of the infective stage of Leishmania mexicana by the sandfly Lutzomyia longipalpis.

Parasitology 2002, 124(Pt 5):495-507.

RESULTS - SECTION 1

62

46. Bates PA: Leishmania sand fly interaction: progress and challenges. Curr Opin Microbiol 2008,

11(4):340-344.

47. Bates PA, Tetley L: Leishmania mexicana: induction of metacyclogenesis by cultivation of

promastigotes at acidic pH. Exp Parasitol 1993, 76(4):412-423.

48. Van Hellemond JJ, Opperdoes FR, Tielens AG: Trypanosomatidae produce acetate via a

mitochondrial acetate:succinate CoA transferase. Proc Natl Acad Sci U S A 1998, 95(6):3036-3041.

49. Carvalho S, Cruz T, Santarem N, Castro H, Costa V, Tomas AM: Heme as a source of iron to

Leishmania infantum amastigotes. Acta Trop 2009, 109(2):131-135.

50. Krishnamurthy G, Vikram R, Singh SB, Patel N, Agarwal S, Mukhopadhyay G, Basu SK, Mukhopadhyay

A: Hemoglobin receptor in Leishmania is a hexokinase located in the flagellar pocket. J Biol Chem

2005, 280(7):5884-5891.

51. Srivastava P, Sharma GD, Kamboj KK, Rastogi AK, Pandey VC: Heme metabolism in promastigotes

of Leishmania donovani. Mol Cell Biochem 1997, 171(1-2):65-68.

52. Gholamhosseinian A, Vassef A: Superiority of hemoglobin to hemin for cultivation of Leishmania

tropica promastigotes in serum-free media. J Protozool 1988, 35(4):446-449.

53. Zangger H, Mottram JC, Fasel N: Cell death in Leishmania induced by stress and differentiation:

programmed cell death or necrosis? Cell Death Differ 2002, 9(10):1126-1139.

RESULTS - SECTION 2

63

SECTION 2

Characterization of the biology and infectivity of Leishmania infantum viscerotropic

and dermotropic strains isolated from HIV+ and HIV- patients in the murine model

of visceral leishmaniasis

Parasites and Vectors 2013, 6:122

Main findings

Molecular typing unraveled a new k26 sequence attributed to MON-284 zymodeme and

allowed the generation of a molecular signature for the identification of each L. infantum

strain. In vitro cultivation enabled the production of promastigotes with comparable growth

curves and metacyclogenesis development. Differences in in vitro and in vivo infectivity

and immunogenicity between strains were found and attributed to intrinsic characteristics

of each strain. Strains isolated from HIV+ patients demonstrated to be less resistant to

host defense.

RESULTS - SECTION 2

65

Characterization of the biology and infectivity of Leishmania infantum viscerotropic

and dermotropic strains isolated from HIV+ and HIV- patients in the murine model

of visceral leishmaniasis

Joana Cunha1,2, Eugenia Carrillo3, Carmen Sánchez3, Israel Cruz3, Javier Moreno3 and

Anabela Cordeiro-da-Silva1,4,*

1 Parasite Disease Group, IBMC - Instituto de Biologia Molecular e Celular, Universidade

do Porto, Portugal 2 Instituto de Ciências Biomédicas Abel Salazar and Faculdade de Medicina,

Universidade do Porto, Portugal 3 WHO Collaborating Center for Leishmaniasis, Centro Nacional de Microbiologia, Instituto

de Salud Carlos III, Spain 4 Laboratório de Microbiologia, Departamento de Ciências Biológicas, Faculdade de

Farmácia, Universidade do Porto, Portugal

* Corresponding author

Anabela Cordeiro da Silva, Parasite Disease Group, Unit of Infection and Immunity,

IBMC - Instituto de Biologia Molecular e Celular, Universidade do Porto, Rua do Campo

Alegre, 823, 4150-180 Porto, Portugal

Tel.: +351 226 074 949; Fax: +351 226 099 15; e-mail: cordeiro@ibmc.up.pt

Keywords

Leishmania infantum, clinical isolates, visceral leishmaniasis, molecular typing,

metacyclogenesis, infectivity, tropism.

RESULTS - SECTION 2

66

ABSTRACT

Background: Leishmaniasis are a group of diseases with a variety of clinical

manifestations. The form of the disease is highly dependent on the infective Leishmania

species and the immunological status of the host. The infectivity of the parasite strain also

plays an important role in the progression of the infection. The aim of this work is to

understand the influence of the natural infectivity of Leishmania strains in the outcome of

visceral leishmaniasis.

Methods: In this study we have characterized four strains of L. infantum in terms of

molecular typing, in vitro cultivation and differentiation. Two strains were isolated from

HIV+ patients with visceral leishmaniasis (Bibiano and E390M), one strain was isolated

from a cutaneous lesion in an immunocompetent patient (HL) and another internal

reference strain causative of visceral leishmaniasis (ST) also from an immunocompetent

patient was used for comparison. For this objective, we have compared their virulence by

in vitro and in vivo infectivity in a murine model of visceral leishmaniasis.

Results: Molecular typing unraveled a new k26 sequence attributed to MON-284

zymodeme and allowed the generation of a molecular signature for the identification of

each strain. In vitro cultivation enabled the production of promastigotes with comparable

growth curves and metacyclogenesis development. The HL strain was the most infective,

showing the highest parasite loads in vitro that were corroborated with the in vivo assays,

6 weeks post-infection in BALB/c mice. The two strains isolated from HIV+ patients, both

belonging to two different zymodemes, revealed different kinetics of infection.

Conclusion: Differences in in vitro and in vivo infectivity found in the murine model were

then attributed to intrinsic characteristics of each strain. This work is supported by other

studies that present the parasite’s inherent features as factors for the multiplicity of clinical

manifestations and severity of leishmaniasis.

RESULTS - SECTION 2

67

BACKGROUND

 

Parasites from the Leishmania genus are trypanosomatid protozoans responsible for a

group of diseases with a broad range of clinical manifestations collectively known as

leishmaniasis (reviewed in [1-3]). The emergence of leishmaniasis as an opportunistic

infection in HIV+ patients in areas where both pathogens are endemic [4] has generated

new interest in leishmaniasis.

It is well known that species such as L. major and L. mexicana are usually exclusively

dermotropic, while L. infantum and L. donovani are responsible for both cutaneous and

visceral leishmaniasis [5]. Apart from a general species-specific organ tropism of

Leishmania, intraspecies intrinsic characteristics are also a relevant factor to consider.

According to Maia et al. [6], dermotropic and viscerotropic L. infantum strains modulate

the sand fly biting time on the host leading to the delivery, respectively, of a high or low

dose of metacyclic promastigotes into the skin which will impact on the parasite tropism

and manifestation of the disease. Even strains belonging to the same zymodeme have

been associated to differential infectivity [7].

In experimental infections, however, another parasite-related feature is of major

importance. In vitro cultivation of Leishmania is a subject open to wide variation between

laboratories, making the comparison of similar experiments ambiguous. Depending on the

culture medium (Santarém, N. and Cunha, J., submitted results and [8]), the duration of

the culture [9] and the number of axenic passages performed [9], the promastigotes

generated will be differentially enriched in metacyclic forms [9], which will condition the

success of the infection. Nonetheless, the genetics and the immune status of the host play

a similarly important role in the tropism and severity of the disease [10]. In the murine

models, L. major was only found in the infection site of the resistant C57BL/6 mice after

subcutaneous injection, whereas the same experimental protocol followed in the

susceptible BALB/c strain allowed visceralization [11]. Also, high and low infective strains

maintained their profile (visceralizing or regulatory, respectively) in BALB/c and C.B-17

SCID mice, although with higher parasite loads in the T and B cell-dysfunctional SCID

animals [12].

The analysis of HIV/Leishmania-coinfected human patients brought important insights into

the role of the immune system on the severity of the disease. On the one hand the

visceralization of dermotropic strains is frequently observed in HIV/Leishmania-

coinfections [13], as well as the regular presence of amastigotes in uncommon locations

such as the lungs or the intestine [14]. On the other, the appearance of unique

Leishmania zymodemes in HIV+ patients has been reported, which may be indicative of

RESULTS - SECTION 2

68

circulating strains normally associated with asymptomatic disease in immunocompetent

patients [13,15]. Some studies have shown that strains originating from HIV+ patients

have low infectivity, which explains its appearance only in immunocompromised

individuals [7,16]. On the contrary, three distinct infective profiles were attributed to strains

responsible for CL or VL (from immunocompetent or HIV+ patients) and no correlation

was made according to the origin of the isolate [17].

In this study, we have focused on four different L. infantum strains isolated from patients

with CL, VL and HIV/Leishmania coinfections. We characterized these strains according

to molecular, biological and infectivity characteristics. We standardized the in vitro culture

to avoid any biased infectivity that was evaluated with macrophage and mouse models.

We have studied the distribution of the strains in acute and chronic infection by qPCR

assessing the parasite load in spleen, liver, bone marrow, blood and lymph nodes and

correlated differences in infectivity with major findings on the molecular typing.

RESULTS - SECTION 2

69

MATERIALS AND METHODS

Parasites

Four L. infantum strains isolated from patients in the Mediterranean basin and Portugal

were used in this study. MHOM/MA/67/ITMAP-263 (ST) is a cloned line derived from a

patient with visceral leishmaniasis [9,18] that was used as an internal and comparative

control in all the experiments performed. HL strain (MHOM/PT/2009/LLM-1708) was

isolated from an immunocompetent patient with cutaneous leishmaniasis. Briefly, a skin

biopsy was dissociated in a cell strainer to isolate the cells and was then transferred into

culture in RPMI. E390M (MHOM/ES/99/LLM-855) and Bibiano (MHOM/ES/01/LLM-1083)

were isolated from bone marrow aspirates of HIV/Leishmania-coinfected patients, this

second one being responsible for recurrent relapses of leishmaniasis. The bone marrow

samples were cultivated in NNN medium at 26–27°C, until the expansion of the

promastigotes. ST, HL and Bibiano strains have been characterized by multilocus enzyme

electrophoresis (MLEE) as MON-1 zymodeme, while E390M is MON-284 (electrophoretic

mobilities for malate dehydrogenase (MDH) and glucose-phosphate isomerase (GPI)

were determined to be of 104 and 105, respectively, in relation to MON-1 zymodeme

[13]).

Molecular typing

L. infantum isolates were subjected to molecular typing by targeting four different regions

of the Leishmania genome. Leishmania DNA was extracted by phenol/chloroform as

described below in more detail and samples were adjusted to a final concentration of 10

ng/μL after measuring DNA content with a Nanodrop ND-1000 spectrophotometer

(Thermo Scientific). A volume of 5 μL of each sample was used in further PCRs. PCR

products were run on 2% agarose gels stained with ethidium bromide and visualized

under UV light. Then they were excised from agarose gels and purified using the QIAquick

Gel Extraction Kit (QIAGEN). First, the species status of the isolates was confirmed by

DNA sequencing of the heat-shock protein 70 (hsp70) gene [19]. Further subtyping was

performed by sequence analysis of the ribosomal internal transcribed spacer 1 (ITS1) and

2 (ITS2) [20] and the hydrophilic acylated surface protein B (haspB) or k26 gene [21]. The

Big-Dye Terminator Cycle Sequencing Ready Reaction Kit V3.1 and the automated ABI

PRISM 377 DNA sequencer (Applied Biosystems) were used for direct sequencing of the

k26, ITS1 and ITS2 PCR products that was performed with the corresponding forward and

reverse primers; internal primers for sequencing were also used for the hsp70 PCR

product, as described by Fraga et al. [19]. The obtained sequences were analyzed and

edited using the software BioEdit Sequence Alignment Editor, version 7.0.9.0 (Ibis

RESULTS - SECTION 2

70

Biosciences) [22]. ClustalW multiple alignment algorithm tool and manual adjustment were

used for comparison of the resulting sequences with the respective published sequences.

The hsp70 sequences were compared with those of the different Leishmania species

generated by Fraga et al. [19]. ITS types were assigned to each isolate according to the

sequence polymorphism of the 12 microsatellite regions included in ITS1 (four sites) and

ITS2 (eight sites), as described by Kuhls et al. [20]. k26 genotypes were assigned

according to the size and sequence of the PCR product, following the criteria previously

described by Haralambous et al. [21].

For the generation of unique patterns that could be used for strain identification, we

amplified a region of the kinetoplast DNA minicircles and evaluated the restriction profile

after HaeIII (Roche Applied Science) endonuclease digestion [23] using DNA extracted

from axenic promastigotes and from experimentally infected murine tissues.

Culture media

Novy-MacNeal-Nicolle medium (NNN) was prepared with a semi-solid phase made of

1.4% agar (Sigma-Aldrich), 0.6% NaCl (Merck), 31% defibrinated rabbit blood, 625

units/mL penicillin, 625units/mL streptomycin and RPMI 1640 medium supplemented with

10% fetal bovine serum (FBS), 2 mM L-glutamine, 100 U/mL penicillin, 100 U/mL

streptomycin and 20 mM HEPES buffer (all from Lonza) as liquid phase.

Growth curves and viability

Parasites were first passed in mice to control their virulence and frozen in vials for future

use until 10 in vitro passages [9]. Promastigotes were cultivated at 26°C with an initial

inoculum of 106 parasites/mL in NNN from a synchronized culture in the same media and

followed for 6 days. In each day, parasites were counted in a hemocytometer and stained

with Annexin V and 7-amino-actinomycin D (7-AAD) for viability analysis as described in

[9]. 10 000 gated events were analyzed in a FACSCanto II (BD Biosciences) and the

percentage of Annexin-/7AAD- cells determined with FlowJo software (TreeStar).

Cell cycle

In each day of culture, promastigotes were recovered and washed in PBS/FBS 2%. 2x106

parasites were resuspended in 1 mL of PBS/FBS 2% and 3 mL of ice-cold absolute

ethanol (Panreac) was carefully added while vortexing. After fixation for 1 hour at 4°C, the

parasites were washed in PBS and resuspended in 1 mL of propidium iodide (PI) staining

solution consisting of citrate buffer 3.8 mM in PBS, 50 μg/mL PI (Sigma-Aldrich) and 0.5

μg/μL RNAse A (Sigma-Aldrich). Following an incubation of 30 minutes at 4°C, 20 000

RESULTS - SECTION 2

71

single live cells were acquired in a FACSCanto II and analyzed with the FlowJo’s cell

cycle built-in tool.

Quantification of metacyclogenesis-dependent gene transcription

107 promastigotes from day 1 to 6 of culture were resuspended in TRIzol reagent

(Invitrogen) and frozen at −80°C. Total RNA was extracted using chloroform and

isopropanol according to the manufacturer’s instructions and solubilized in 10 μL of

nuclease-free water. RNA of high quality was obtained (RQI between 9.0 and 10.0) as

assessed using RNA StdSens Chips of the Experion automated electrophoresis system

(Bio-Rad). RNA concentration was determined using a Nanodrop ND-1000

spectrophotometer. Samples were stored at −80°C until cDNA was synthesised. Reverse

transcription was performed with iScript cDNA synthesis kit (Bio-Rad) according to the

manufacturer’s instructions over 500 ng of total RNA. Meta-1, Small Hydrophilic

Endoplasmic Reticulum-associated Protein (SHERP) and histone H4 transcription was

quantitatively analyzed after normalization with rRNA45 transcription by qPCR using the

iQ SYBR Green Supermix according to the manufacturer’s instructions in a My iCycler iQ5

(Bio-Rad). 4 μL of cDNA (diluted 25×) was used as template that was run in duplicate with

500 nM (Meta-1 and histone H4) or 250 nM (SHERP and rRNA45) of the following primers

(from Stabvida): Meta-1 [GenBank: NC_009401] forward: 5′-GGGCAGCGACGACCTGAT-

3′ and reverse: 5′-CGTCAACTTGCCGCCGTC-3′ (modified from [24]); histone H4

[LinJ35.1400, GenBank: XM_001468907] forward: 5′-ACACCGAGTATGCG-3′ and

reverse: 5′-TAGCCGTAGAGGATG-3′ [9]; SHERP [GenBank: XM_003392466] forward: 5′-

CAATGCGCACAACAAGATCCAG-3′ and reverse: 5′-TACGAGCCGCCGCTTATCTTGTC-

3′ [9]; rRNA45 [GenBank: CC144545] forward: 5′-CCTACCATGCCGTGTCCTTCTA-3′

and reverse: 5′-AACGACCCCTGCAGCAATAC-3′ [25]. Changes in relative gene

expression were determined with ∆∆CT method and results show fold changes

comparative to day 1 calculated by 2-∆∆CT.

In vitro infections

Bone marrow-derived macrophages (BMMo) were produced as described previously [9].

Stationary promastigotes cultivated in NNN for 4 days were washed and put in contact

with the cells in 1:10 ratio (cell:parasites) for 4 h. Extracellular parasites were washed

away with PBS and the cells incubated for more 24, 48, 72 or 96 hours or fixed

immediately with 2% PFA. The macrophages were mounted on Vectashield with DAPI

(Vector Laboratories) and 100 infected cells or 400 total cells were counted in duplicate by

fluorescence microscopy in a Zeiss Axioskop (Carl Zeiss). The percentage of infected

cells and the geometric mean of the number of parasites per infected cell were evaluated.

RESULTS - SECTION 2

72

The infection index was calculated by multiplication of both parameters to account for the

overall parasite load.

In vivo infections

7–8 week-old BALB/c male mice (4–5 animals per group, except in 2-week infections with

E390M strain where only 3 animals were used) were infected via the intraperitoneal route

with 108 promastigotes of each strain cultivated in NNN for four days. After 2 or 6 weeks of

infection mice were anesthetized with isoflurane and sacrificed by cervical dislocation.

Blood, inguinal lymph nodes, spleen, liver and femoral bone marrow were recovered for

quantification of parasite load. Blood and spleen were also used for the evaluation of

humoral and cellular responses.

Parasite load quantification

Parasite load was quantified in samples that were collected and frozen at the time of

animal sacrifice. We used 200 μL of blood collected with EDTA, 10 mg of spleen and liver

(single cell suspensions), 3 × 106 bone marrow cells and the inguinal draining lymph node

to extract DNA. First, 400 μL of a buffer containing 10 mM NaCl, 10 mM EDTA and 10 mM

Tris–HCl with pH 8.0 were added to the samples, which were incubated overnight with 40

μg of proteinase K (Sigma-Aldrich) at 56°C with shaking. Then, the samples were

vortexed and incubated for 20 minutes at 70°C. DNA was extracted using

phenol/chloroform/isoamyl alcohol (all from Merck Millipore). After precipitation with ice-

cold 70% ethanol solution, DNA was dissolved in 100–200 μL of nuclease-free water. We

quantified the total DNA in a Nanodrop ND-1000 spectrophotometer and prepared

dilutions of concentrations adjusted for each tissue. We quantified Leishmania sp. DNA by

qPCR using 1000nM of R223 and 500nM of R333 primers (Sigma-Aldrich) for the small

subunit rRNA (SSUrRNA) [26]. Depending on the tissue, 100 to 400 ng of total DNA

served as a template in a 20 μL reaction using LightCycler FastStart DNA Master SYBR

Green I kit (Roche Applied Science) according to the manufacturer’s instructions, in a

touchdown qPCR performed in a LightCycler 2.0 carousel-based instrument (Roche

Applied Science) with final annealing temperature of 65°C [27]. CTs were extrapolated in

a standard curve constructed with serial dilutions of L. infantum DNA (strain JPC,

MCAN/ES/98/LLM-722) diluted in host DNA (from spleen of naïve mice) to calculate

Leishmania content in parasites/μg DNA. Whenever the qPCR gave a positive (with the

expected melting curve) but unquantifiable value or a doubtable specific product (aberrant

melting curve), we performed a nested PCR [28] that has a higher sensitivity (0.01

parasites) than the qPCR (0.6 parasites) to confirm the positivity of the quantitative result.

300 nM of R221 and R332 primers [26] were used for the first amplification reaction. For

RESULTS - SECTION 2

73

the second reaction, 10 μL of the first PCR product diluted 1:40 served as template with

the same R223 and R333 primers (300 nM and 150 nM, respectively) used for the qPCR.

This molecular quantification was applied after proper validation by comparison with

limiting dilution assay (Additional Methods and Additional figure 1).

Splenic cell populations

5 × 105 splenocytes were surface-stained for 20 minutes at 4°C with saturating

concentrations of monoclonal antibodies (all from Biolegend). After washing twice with

PBS/FBS 2%, the cells were examined by flow cytometry in a FACSCanto (BD

Bioscences) and analyzed with FlowJo software. After acquisition of 50000 cells identified

by FSC and SSC parameters, major populations were identified as follows: CD4+ T

lymphocytes (PerCp.Cy5.5 anti-CD3, clone 17A2; APC.Cy7 anti-CD4, clone GK 1.5),

CD8+ T lymphocytes (PerCp.Cy5.5 anti-CD3; FITC anti-CD8, clone 53–6.7), B cells (FITC

anti-CD19, clone 6D5), monocytes/macrophages (PE.Cy7 anti-CD11b, clone M1/70;

PerCp.Cy5.5 anti-Ly6C, clone HK1.4).

Leishmania-specific immunoglobulins

The specific humoral response was analyzed by ELISA as described elsewhere [18]. In

short, 96-well microtitration plates (Greiner Bio-One) were coated with 10 μg/mL of soluble

Leishmania antigens (SLA) in carbonates buffer pH 8.5 and then blocked with PBS/gelatin

1%. Sera were diluted 1:100 and incubated for 2 hours at 37°C. After washing with

PBS/tween 20 0.1%, HRP-conjugated anti-IgG1 or anti-IgG2a (Southern Biotech) were

added to the wells at a dilution of 1:5000 and incubated for 30 minutes at 37°C. The plates

were revealed with 0.5 mg/mL of o-phenylenediamine dihydrochloride (Sigma-Aldrich) in

citrate buffer pH 4.0 and the reaction was stopped with HCl 3 N. The absorbance was

read at 492 nm in a Synergy 2 microplate reader (Biotek).

Animals and ethics statement

For the in vitro experiments we used 10–12 week-old female BALB/c mice bred and

maintained at IBMC - Instituto de Biologia Molecular e Celular (Portugal) animal facilities.

For the in vivo experiments 7–8 week-old male BALB/c mice were bred and maintained at

the Instituto de Salud Carlos III (Spain) animal facilities. Mice were housed in IVC cabinets

with sterile food and water ad libitum. All experiments conducted were carried out in

accordance with the IBMC.INEB and ISCIII Animal Ethics Committees and the

Portuguese and Spanish National Authorities for Animal Health guidelines that follow the

statements on the directive 2010/63/EU of the European Parliament and of the Council.

RESULTS - SECTION 2

74

JC and ACS have an accreditation for animal research given from Portuguese Veterinary

Direction (Ministerial Directive 1005/92).

Statistical analysis

GraphPad Prism 5 (GraphPad Software) was used to perform all the statistical analysis.

The results are presented as means ± standard deviations (SD). To compare statistical

differences between means two-sided t test or one-way ANOVA followed by Dunnett’s

multiple comparison test were run when comparing 2 or more groups, respectively, unless

otherwise stated. * p < 0.05, ** p < 0.01 and *** p < 0.001.

 

RESULTS - SECTION 2

75

RESULTS AND DISCUSSION

Molecular characterization of the clinical isolates of L. infantum

To understand the intraspecies polymorphisms and its possible impact on both in vitro and

in vivo infectivity, we characterized certain molecular aspects of these four L. infantum

strains.

A molecular approach was followed by us aiming not only to confirm the identity [19] of

Bibiano, E390M and HL strains, together with the laboratory’s standard L. infantum (ST)

strain, but also to subtype the isolates according to Haralambous et al. [21] and Kuhls et

al. [20]. Molecular genotyping of the strains indicated that all four were 100% consistent

with L. infantum and were clustered in the same ITS type A group (data not shown), which

is the most common in specimens from the Mediterranean area even within different

zymodemes [20]. Moreover, Bibiano, HL and ST were classified in the k26 group 1b, the

most frequent in the Iberian Peninsula [21], while E390M belongs to a new k26 group

reported here for the first time, since it returned an 836 bp amplicon [GenBank:

KC576808] never found before (Figure 1A and Additional figure 2).

Figure 1. Molecular characterization of L. infantum isolates

(A) Amplification of the k26 gene. See additional figure 2 for coding DNA sequences and alignment. (B) RFLP

patterns for L. infantum isolates after HaeIII digestion of an amplified fragment of the minicircles kDNA.

Profiles for DNA extracted from axenic promastigotes are shown, though DNA from experimentally infected

murine tissues delivered comparable restriction patterns. For each strain, left lane corresponds to the digested

DNA and right lane to undigested product. Gels were prepared with 2% (A) or 2.5% (B) agarose and stained

with ethidium bromide. MW - molecular weight marker with bp units assigned in the left of the figure.

RESULTS - SECTION 2

76

PCR-RFLP of kinetoplast DNA minicircles was used as a tool for creating an individual

identity for each strain. Because we were working with L. infantum strains that preferably

could have similar growth and morphology, they would be indistinguishable in in vitro

cultures. In case of cross-contaminations between strains [29,30], we would like to have a

tool for identification of our parasites. All the strains showed very complex profiles (Figure

1B), but each one of the specimens was clearly identifiable by the examination of the most

intense bands.

Characterization of biological features of the promastigotes generated in vitro

In vitro cultivation has a major impact on the virulence of the pathogens due to intrinsic

properties of the culture media that modulate Leishmania infectivity (Santarém, N. and

Cunha, J., submitted results and [8,31]), or to the loss of adaptive capacities to

mammalian host cells resulting from long-term in vitro cultivation of promastigotes. A

relevant experimental bias can be introduced if these factors are not considered. Hence,

the comparison of the infective capacity of distinct strains should take into account the

adaptation to culture conditions and/or the axenic growth behavior [7,32].

We started to characterize the axenic growth of the four L. infantum strains. Aiming to

identify any difference in their infectivity that could justify the dissimilar outcomes of the

disease in the natural infections, we first had to understand what specific nutritional needs

the parasites might have in order to standardize the in vitro culture conditions. Preliminary

experiments with parasites cultivated in RPMI medium exposed remarkable differences

among the growth of each L. infantum strain (data not shown). Attempts to find a culture

medium suitable for the continuous and comparable growth of the four strains included

doubling the FBS content to 20% and adding glucose to RPMI medium, the use of

Schneider’s Insect medium and the preparation of a mixture of RPMI and Schneider

media in equal parts (data not shown; the composition of these culture media is detailed in

Additional file 1: Additional Methods). However, only the use of Novy-MacNeal-Nicolle

medium (NNN) allowed us to guarantee an in vitro homogeneous culture condition where

all four strains could be easily cultivated, maintained and have a similar development that

would allow the direct comparison of strain infectivity. Bibiano, E390M, HL and ST strains

showed perfectly overlapped growth curves in NNN (Figure 2A), with morphologically

indistinguishable promastigotes that maintained high viability (90-95%) at least until the

fourth day of culture (Figure 2B).

RESULTS - SECTION 2

77

Figure 2. In vitro development of L. infantum strains.

(A) Growth curves of Bibiano (light grey), E390M (dark grey), HL (black) and ST (white) L. infantum strains in

NNN. Cultures were started with 106 promastigotes of each strain per mL and growth was followed for a week,

with a daily counting of parasite numbers in a Neubauer chamber. (B) Parasite viability measured by flow

cytometry as percentage of AnnV-/7AAD- cells. The mean of three independent experiments is plotted; bars

represent SD. One-way ANOVA followed by Tukey’s post-test was used to evaluate significant differences

between means of all strains in each time point. * p < 0.05, ** p < 0.01 compared to ST. (C) Cell cycle analysis

of HL during growth period. Data show means of one representative experiment of three independent assays.

(D) Illustrative phenotype of L. infantum promastigotes with 4 days of culture in NNN captured by flow

cytometry.

The culture of all promastigote strains in NNN enabled a rapid exponential parasite growth

that peaked at day 3 (≈108 parasites/mL) after which it stabilized until day 6. These

timings could be confirmed by the analysis of the cell cycle (Figure 2C and Additional

figure 3). On the first day of culture, around 50% of the parasites were in S/G2 phases in a

clear indication of active proliferation. From the third day on, only ≈ 20% of the cells were

found to be in division. Moreover, during the stationary phase promastigotes with small

bodies and large flagella could be clearly identified by optic microscopy (data not shown);

these were confirmed by flow cytometry (Figure 2D) as FSCloPI- cells [33,34]. Based on

this typical morphology of metacyclic promastigotes, we analyzed metacyclogenesis

throughout the 6 days of culture by quantifying the expression of specific genes which are

upregulated (Meta-1 and SHERP) or downregulated (histone H4) during the process

RESULTS - SECTION 2

78

[25,33,35] (Figure 3 and Additional figure 4). Despite the observed interstrain variations on

the fold modifications of each gene, all of the strains showed a dramatic decrease in

histone H4 expression consistent with the cell cycle analysis. For Bibiano, Meta-1 gene

expression significantly increased every day of culture, while for E390M the major fold

changes were detected in the SHERP gene expression. Both Meta-1 and SHERP

increased overtime for HL and ST until day 4 and after that they recovered to levels close

to those of day 1.

Figure 3. Indirect measurement of metacyclogenesis

Quantification of (A) Meta-1, (B) SHERP and (C) histone H4 transcription by RT-PCR over the time of culture

in NNN medium for the four strains. Bars represent the mean fold change relative to day 1 with SD of two

independent experiments. Statistical significant differences between day 1 and the following days were

determined with One-way ANOVA and Dunnett's multiple comparison test.

We cannot directly compare the metacyclogenesis process between the four strains, but

we must take into account the total information available to affirm that these

RESULTS - SECTION 2

79

promastigotes were differentiating into metacyclic forms. The leading factor is that the

overall analysis of the three genes studied pointed towards metacyclogenesis. This trend

could be better understood when calculating the ratio between the up and downregulated

genes (Additional figure 4), as all the strains presented an increase in the ratios over the 6

days of culture.

Evaluation of the infectivity of L. infantum isolates

To evaluate parasite infectivity, we infected macrophages and followed the progression of

the infection for four days (Figure 4).

Figure 4. In vitro differential infectivity of L. infantum strains

BMMo were infected with promastigotes of each strain after 4 days of culture in NNN in a ratio of 10:1

(parasites:macrophage). The kinetic of infection was followed counting (A) the infected cells and (B) the

number of parasites per infected cell on fluorescent microscope. To account to the overall parasite load, an

infection index (C) was calculated multiplying the individual data from (A) by (B). Statistical significant

differences between ST and the other strains were determined with One-way ANOVA followed by Tukey's

multiple comparison test.

RESULTS - SECTION 2

80

At the initial time-point, the four strains infected approximately all the cells without any

differences in the total percentage of infected macrophages (Figure 4A). However, when

evaluating the parasite load in each infected cell, HL promastigotes were more effective in

the invasion of the macrophages with a mean of 12 ± 1.5 parasites in each infected cell

versus 3 to 5 parasites found for the other strains (Figure 4B). After the first 24 hours, an

accentuated reduction in the infection index was detected for the four strains (Figure 4C),

which was maintained, though softened, during the entire period of the assay.

Nevertheless, HL parasites were more resistant to macrophage-specific killing machinery

as displayed by the increased infection index throughout the study. For this reason, this

strain was considered to be more infective than the ST virulent strain [36,37]. Interestingly,

72 and 96 hours post-infection, macrophages could harbor significantly more Bibiano than

ST parasites, though it did not translate into a higher overall parasite load as shown for HL

(Figure 4C) because of the low percentage of infected cells.

As is well known, disease manifestation depends on the virulence of Leishmania strain

[12,17] but also on the genetic background [38] and immune status of the host [14,39].

Hence, the differences in infectivity detected in vitro were explored in the BALB/c model of

visceral leishmaniasis to evaluate the influence of the parasites’ intrinsic characteristics in

the ability to cause the disease. We therefore studied parasitological and immunological

features in the acute and chronic phases of infection. Parasite load was quantified in the

spleen, liver and bone marrow as the main target organs in this model. The presence of

Leishmania in the draining lymph nodes and the blood were also investigated (Figure 5).

In the acute phase, 2 weeks after the infection, no significant differences were calculated

between the four strains in all the five tissues studied. Despite the lack of statistical

significance, important differences could be appreciated between strains. In the visceral

organs (Figures 5A and B), HL and Bibiano showed very similar parasite burden,

representing the most infective strains in these tissues. As compared to ST, they

presented over 1 logarithm higher parasite load in spleen and were ≈ 800 times higher in

the liver. ST was indeed the least efficient strain colonizing these organs, as E390M was

able to infect almost 3 and 15 times more in the spleen and liver of mice. In the inguinal

lymph nodes (Figure 5D) and the blood (Figure 5E), HL was the strain that showed higher

parasitism. Its values surmounted 14, 300 and 1100 times the burden of Bibiano, E390M

and ST, respectively, in the lymph nodes, and 3, 20 and 46 times, respectively, in the

blood. The bone marrow was more infected by ST, though without accentuated

differences between the other strains (Figure 5C). After this analysis one could expect ST

to be the least infective strain in the acute phase of the disease, once HL was the strain

that showed higher infectivity in the majority of the tissues examined, followed close by

RESULTS - SECTION 2

81

Bibiano. Nonetheless, estimating the total number of parasites existing in the whole

animal, we calculated ≈ 5 × 108 ST parasites, approximately double the number estimated

for Bibiano and HL and over a logarithm more than E390M (Table 1).

Figure 5. Quantitative distribution of L. infantum in BALB/c mice 2 and 6 weeks after infection

The parasite burden was quantified on the (A) spleen, (B) liver, (C) bone marrow, (D) lymph node and (E)

blood. Data represent means ± SD of 3-5 animals per group of a representative experiment of two

independent assays. T test was used to determine statistical significant differences between 2 and 6 weeks of

infection with each strain; * p<0.05. With one-way ANOVA followed by Tukey’s multiple comparison test we

calculated statistical significant differences between strains in each time point; # p<0.05. Dashed line indicate

limit of detection for quantification for each tissue.

In the chronic phase, 6 weeks after infection, the four strains showed relative infection

profiles in the spleen (Figure 5A), bone marrow (Figure 5C) and lymph nodes (Figure 5D)

similar to the acute phase. As before, HL was shown to be the most infective strain in

spleen and lymph nodes. In the bone marrow the differences were once more not as

accentuated between strains, although the higher parasite loads were found in HL

infected mice. In the liver (Figure 5B), HL was still the most infective strain, but Bibiano,

which in the other tissues presented comparable parasite loads, was, significantly, the

least infective strain, whereas E390M and ST produced intermediate infections. In the

blood (Figure 5E), the differences observed at 2 weeks post-infection were neutralized, as

the four strains showed similar levels of circulating parasites.

RESULTS - SECTION 2

82

Table 1 - Estimated overall parasite load of L. infantum-infected BALB/c mice 2 and 6 weeks post-

infection

Total

parasite load

2 weeks post-infection 6 weeks post-infection

Bibiano E390M HL ST Bibiano E390M HL ST

Spleen 67.7x104 8.82x104 44.1x104 3.81x104 62.7x104 0.40x104 329x104 18.9x104

Liver 157x106 2.77x106 112x106 0.14x106 0.35x106 2.54x106 86.8x106 2.42x106

Bone marrow 15.0x107 4.49x107 11.9x107 50.9x107 13.9x107 2.29x107 18.1x107 11.7x107

Lymph nodes 4.83x104 0.19x104 67.0x104 0.10x104 1.78x104 0.015x104 10.3x104 0.59x104

Blood 0.97x103 0.42x103 19.4x103 0.32x103 6.54x103 3.12x103 1.95x103 4.53x103

Whole animal 3.08x108 0.48x108 2.32x108 5.09x108 1.40x108 0.25x108 2.71x108 1.19x108

Mean weights of spleen, liver and inguinal lymph nodes of the infected animals (Additional figure 5) were used

in these calculations. Values for total volume of blood (1.8 mL) and total number of bone marrow cells (4.5 ×

108) were estimated as published elsewhere [40,41].

Distribution and compartmentalization throughout the infection

Evaluating the progression of the disease, these four strains depicted very different

trends. In the acute phase of infection, Bibiano and HL were found in very high numbers in

the visceral organs but evolved in the opposite directions with chronicity. Bibiano was

efficiently cleared from the liver, with a 425-fold reduction, though in the spleen the

parasite load did not alter. As to HL, the liver infection was maintained and the splenic

parasite burden increased 5 times from 2 to 6 weeks after infection, which showed not

only high capacity to infect but also to perpetuate in the host. E390M, on the contrary,

showed a low infective phenotype, with the lowest parasite loads in all the tissues

quantified in the acute phase of infection. Through time, this strain was not able to

proliferate in the spleen or in the bone marrow; the parasites resisted in the liver and

showed a 7.4-fold increase in the blood. Despite with disparate initial parasite loads (more

than 6-fold difference), Bibiano and E390M, both isolated from HIV+ patients, followed a

very similar trajectory in the progression of the disease and, eventually, would be

eliminated over time in these immunocompetent BALB/c mice. The high parasitemia

presented by these two strains in the chronic phase may facilitate the anthroponotic

transmission of Leishmania between the intravenous drug users (IVDUs) [42], one of the

populations with highest risk of HIV/Leishmania coinfection [43]. Concerning ST, the

standard virulent strain in our laboratory, showed a clear tropism for the bone marrow in

the acute phase, with the lowest parasite loads in the remaining organs compared to other

strains. However, 6 weeks post-infection, ST dramatically multiplied reaching levels ≈ 6-

and ≈ 17-fold higher in the spleen and liver, respectively.

RESULTS - SECTION 2

83

As a final remark, this study allowed us to verify that bone marrow parasite load is

maintained in a range that does not suffer major alterations either over-time nor is it strain-

dependent. Possibly this is the reason why bone marrow aspirates are the eligible sample

for leishmaniasis diagnosis, either for microscopic analysis, culture or molecular

techniques [4].

Infectivity relates with cell modulation

Along with the differences described in the parasite load, we analyzed the weight of

spleen and liver of the infected animals and compared them with naïve mice (Additional

figure 5A and B). In general, small fluctuations were detected in the weight of the organs,

which followed the trends exposed above for the parasite loads. Indeed, HL infected mice

presented hepatosplenomegaly in the chronic phase of the disease, the pathologic

hallmark of visceral leishmaniasis (reviewed in [44]). We attributed the splenomegaly not

only to the presence of elevated numbers of Leishmania but also to the expansion of the

main cellular populations detected in the spleen (Figure 6). A significant increase in both

CD4+ and CD8+ T cells, B cells and macrophages was quantified in mice infected for 6

weeks with HL, an increment that corresponded to double the numbers found in the naïve

mice. While the expansion of lymphocyte populations are classically linked to cellular and

humoral immune responses, the presence and increase of CD11b+Ly6C+ monocytes were

recently described to play a major role in the architectural remodeling of the spleen during

experimental visceral leishmaniasis, mainly in the vascularization of the red pulp that

accompanies splenomegaly [45].

The enlargement in the B cell population explains the elevated titers of anti-Leishmania

antibodies quantified in the chronic infection by HL (Figure 7). Both IgG2a and IgG1 were

generated in high levels, leading to the exacerbation of the pathology, as described by

others [46-48]. However, in E390M infections we did not detect any B cell expansion, as

measured at 2 weeks post infection and later at 6 weeks, though IgG2a and IgG1 were

significantly increased compared to age-matched naïve mice. We speculate that this

antibody production could be in part related to the k26 gene. Leishmania k26 (also known

as HASPB) protein, as well as SHERP that share the same locus on chromosome 23 [49],

are stage-regulated proteins, expressed only in the mammalian host infective forms

(metacyclic promastigotes and amastigotes) [50]. k26 has a central core composed of a

10–11 amino acid repeats (PKEDGHTQKND/PKEDGRTQKN in Additional figure 2) which

present high inter and intra-specific variability [49,51,52], a feature that makes it an

interesting tool for molecular typing of different Leishmania species and strains [21].

RESULTS - SECTION 2

84

 

Figure 6. Cell populations in spleens of naive and Leishmania-infected mice in

the acute and chronic phases

(A), (F) Total cells were counted and stained for identification of major splenic populations by flow cytometry.

(B), (G) CD4+ T cells. (C), (H) CD8+ T cells. (D), (I) B cells. (E), (J) Monocytes/macrophages. (A)-(E) Absolute

number of cells per spleen. Data represent means ± SD of 3 to 5 animals per group of one experiment

representative of two. (F)-(J) Fold modification of cell numbers in the infected mice in relation to naïve. Boxes

and whiskers with 5-95 percentile and mean (showed by “+”) of 3 to 5 animals. Dashed and solid lines indicate

a 2- or 4-fold modification, respectively, relative to naïve mice. One-way ANOVA followed by Dunnett's

multiple comparison test was performed to calculate statistical significant differences between naive and

infected mice at 2 and 6 weeks after infection.

RESULTS - SECTION 2

85

Other than this, k26 is a highly immunogenic antigen [49] with proven efficacy as a

vaccine in murine models of visceral leishmaniasis by L. donovani [51,53] and partial

efficacy in canine leishmaniasis by L. infantum [54]. Its immunogenic properties make k26

an interesting antigen that has been studied for diagnostic purposes [55-57]. As we

reported in this work, E390M k26 protein has more repeats than MON-1 strains, which

may influence the type and the strength of the humoral response as those amino acid

repeats were determined to be B cell epitopes [52]. We point towards this argument since

Bibiano and ST strains, that proved to be more infective than E390M, were not able to

produce specific antibodies nor increased splenic cellularity in the acute or the chronic

phases of murine VL.

Figure 7. Leishmania-specific humoral response

Leishmania-specific sera reactivity of naive and infected animals 2 and 6 weeks post-infection was

analyzed by ELISA. Specific (A) IgG2a and (B) IgG1 were quantified and are depicted as means ±

SD of one representative experiment of 2 independents. Statistical significant differences are

pointed out as given by one-way ANOVA followed by Dunnett’s multiple comparison test.

RESULTS - SECTION 2

86

CONCLUSIONS

The molecular typing strategy confirmed the previous zymodeme characterization by

MLEE and provided further knowledge that can be applied to diagnostics and population

genetics studies. In this sense, the k26 sequence for E390M strain generated in this work

adds information for a zymodeme (MON-284) not included in the study by Harambolous

[21], thus contributing to k26 gene-based typing methodology, which is being used

increasingly in population genetics and molecular epidemiology studies related to the L.

donovani complex [58,59]. Laboratory conditions for in vitro culture were set to produce

Bibiano, E390M, HL and ST fit promastigotes in the same developmental stage. In vivo

infections with HL confirmed the in vitro phenotype of the most infective strain as more

parasites were estimated to be present in the whole animal. ST was also considered to be

highly infective though with a slower progression over time. Bibiano and E390M, isolated

from HIV+ patients, showed differential infectivity and immunomodulation that could be

influenced by the initial compartmentalization in host tissues. Interestingly, the most (HL)

and the least (E390M) infective strains were the most immunogenic, revealing high levels

of anti-Leishmania IgG2a and IgG1, especially in the chronic phase of infection.

This work is in line with previous studies [6,7,17,60] that show that leishmaniasis is a

multifactorial disease and the broad spectrum of clinical manifestations depends on the

genetics and inherent characteristics of the parasite coordinated with the susceptibility of

the host.

COMPETING INTERESTS

The authors declare no competing interest.

AUTHOR’S CONTRIBUTIONS

JC designed and performed all the experiments, analyzed data and wrote the manuscript.

EC participated in some of the in vivo experiments, gave valuable input concerning qPCR

for evaluation of the parasite load and helped to draft the manuscript. CS participated in

the in vivo experiments, especially in collecting animal organs, and performed DNA

extractions and qPCRs. IC carried out the molecular typing. JM and ACS conceived the

study, participated in its design and coordination and helped to draft the manuscript. All

authors read, discussed and approved the final manuscript.

RESULTS - SECTION 2

87

ACKNOWLEDGMENTS

We thank Doctor Maria da Luz Duarte from São Marcos Hospital, Braga, Portugal, for

kindly provide us with the skin sample infected with HL strain of L. infantum and Joana

Tavares from Parasite Disease Group, IBMC, Porto, Portugal, for its isolation and

preparation of stocks. We thank Carmen Chicharro from WHO Collaborating Center for

Leishmaniasis, National Center of Microbiology, Institute of Health Carlos III, Spain, for

analyzing HL strain’s zymodeme. We thank Ricardo Silvestre and Mariana Resende from

Parasite Disease Group, IBMC, Porto, Portugal, for the help in animal experiments and

flow cytometry analysis.

This work was funded by FEDER funds through the Operational Competitiveness

Programme – COMPETE and by National Funds through FCT – Fundação para a Ciência

e a Tecnologia under the project FCOMP-01- 0124-FEDER-019648 (PTDC/BIA-

MIC/118644/2010) and FCOMP-01-0124- FEDER-011054 (PTDC/SAU-FCF/100749/2008

and MICINN project number PIM2010‐ENI00627. JC was supported by fellowship from

FCT code SFRH/BD/48626/2008 and CS by Contratos de Técnicos de apoyo a la

investigación en el SNS code AES‐FIS‐2011.

RESULTS - SECTION 2

88

SUPPLEMENTAL DATA

Additional methods

Culture media referenced in unpublished data

RPMI 20% FBS + glucose medium was produced by enrichment of supplemented RPMI

with an extra 10% of FBS and 2.5 mg/mL of glucose (Sigma-Aldrich). Schneider is

composed of Schneider’s Insect Medium (Sigma-Aldrich) supplemented with 10% FBS,

200 units/mL penicillin, 200 units/mL streptomycin, 5 mM Hepes Buffer, 2.5 g/mL Phenol

Red (Sigma-Aldrich). A mixture of Schneider and RPMI in equal parts (50% SchRPMI)

was also used. Promastigotes were cultivated at 26 ºC with an initial inoculum of 106

parasites /mL (or 105 parasites/mL in Schneider) from a synchronized culture in the same

media and followed for 6 days.

Parasite load quantification by limiting dilution

Spleen and liver of each animal were collected and homogenized into cell suspensions in

50% SchRPMI medium. A fraction of the total organ was plated in a 96-well plate and

submitted to 2-fold serial dilutions in the same culture medium. After 2 weeks of

incubation at 26 ºC, the quantification of the parasite load was carried out as described in

[18] by the integration of the dilution factor of the last well where at least one parasite was

detected with the initial amount of organ plated on the first well and its total weight.

RESULTS - SECTION 2

89

Additional figure 1. Validation of the qPCR methodology for quantification of the

parasite loads in murine tissues.

BALB/c mice were infected for 2 weeks with 108 L. infantum strains (3 mice for each strain) cultivated in an

equivolumetric mixture of RPMI and Schneider for 5 days. (A) Spleen and (B) liver were collected and cell

suspensions were prepared. Parasite loads were quantified by qPCR and compared with the values obtained

by limiting dilution assay.

RESULTS - SECTION 2

90

 

Additional figure 2. k26 gene alignment

Coding DNA sequences (cds) were translated into aminoacids and aligned with standard sequences

generated by Haralambous et al [22] [GenBank: EF504255 and EF504256]. Complete cds of k26 gene

[GenBank: XM_001465758.2] is aligned in the first row. The four L. infantum isolates are aligned in the bottom

rows. E390M k26 sequence was entered in the GenBank with the access number KC576808.

RESULTS - SECTION 2

91

 

 

 

 

 

Additional figure 3. Cell cycle analysis

(A) Representative histograms of PI content in day 1 and 6 of promastigotes culture. (B) Bibiano.

(C) E390M. (D) ST. The percentage of parasites in G1, S or G2 phases of the cell cycle was

determined at days 1 to 6 of culture in NNN medium by flow cytometry after staining the

promastigotes with a PI solution. Three independent experiments were performed, one

representative experiment is shown.

 

   

RESULTS - SECTION 2

92

 

Additional figure 4. Variation of the transcription of metacyclogenesis-dependent genes

Meta-1, SHERP and histone H4 transcription was quantified by RT-PCR over the time of culture in

NNN medium. To evaluate the progression of metacyclogenesis we related the up-regulation of (A)

Meta-1 and (B) SHERP with the down-regulation of histone H4 applying a mathematical ratio. Bars

represent the mean fold change relative to day 1 with SD of two independent experiments.

Statistical significant differences between day 1 and the following days were determined with One-

way ANOVA and Dunnett's multiple comparison test.

________________________________________________________________________ 

 

Additional figure 5. Organ weight 2 and 6 weeks post-infection

Mice were sacrificed and (A) spleen, (B) liver and (C) inguinal lymph nodes were collected and weighted. Data

represent means ± SD of 3-5 animals of one experiment representative of two. One-way ANOVA followed by

Dunnett’s multiple comparison test were run for statistical analysis between groups in each time point.

 

RESULTS - SECTION 2

93

REFERENCES

1. Chappuis F, Sundar S, Hailu A, Ghalib H, Rijal S, Peeling RW, Alvar J, Boelaert M: Visceral

leishmaniasis: what are the needs for diagnosis, treatment and control? Nature reviews

Microbiology 2007, 5(11):873–882.

2. van Griensven J, Diro E: Visceral leishmaniasis. Infectious disease clinics of North America 2012,

26(2):309–322.

3. Goto H, Lauletta Lindoso JA: Cutaneous and mucocutaneous leishmaniasis. Infectious disease

clinics of North America 2012, 26(2):293–307.

4. Alvar J, Aparicio P, Aseffa A, Den Boer M, Canavate C, Dedet JP, Gradoni L, Ter Horst R, Lopez-Velez

R, Moreno J: The relationship between leishmaniasis and AIDS: the second 10 years. Clinical

microbiology reviews 2008, 21(2):334–359. table of contents.

5. WHO: Control of the leishmaniasis: report of a meeting of the WHO Expert Committee on the

Control of Leishmaniases, Geneva, 22–26 March 2010. WHO technical report series 2010(949):xii–

xiii. 1–186, back cover.

6. Maia C, Seblova V, Sadlova J, Votypka J, Volf P: Experimental transmission of Leishmania infantum

by two major vectors: a comparison between a viscerotropic and a dermotropic strain. PLOS

neglected tropical diseases 2011, 5(6):e1181.

7. Baptista-Fernandes T, Marques C, Roos Rodrigues O, Santos-Gomes GM: Intra-specific variability of

virulence in Leishmania infantum zymodeme MON-1 strains. Comparative immunology, microbiology

and infectious diseases 2007, 30(1):41–53.

8. Dey T, Afrin F, Anam K, Ali N: Infectivity and virulence of Leishmania donovani promastigotes: a

role for media, source, and strain of parasite. The jornal of eukaryotic microbiology 2002, 49(4):270–

274.

9. Moreira D, Santarem N, Loureiro I, Tavares J, Silva AM, Amorim AM, Ouaissi A, Cordeiro-da-Silva A,

Silvestre R: Impact of continuous axenic cultivation in Leishmania infantum virulence. PLOS

neglected tropical diseases 2012, 6(1):e1469.

10. Gradoni L, Gramiccia M: Leishmania infantum tropism: strain genotype or host immune status?

Parasitology today 1994, 10(7):264–267.

11. Laskay T, Diefenbach A, Rollinghoff M, Solbach W: Early parasite containment is decisive for

resistance to Leishmania major infection. European jounal of immunology 1995, 25(8):2220–2227.

12. Gangneux JP, Sulahian A, Honore S, Meneceur P, Derouin F, Garin YJ: Evidence for determining

parasitic factors in addition to host genetics and immune status in the outcome of murine

Leishmania infantum visceral leishmaniasis. Parasite immunology 2000, 22(10):515–519.

13. Chicharro C, Jimenez MI, Alvar J: Iso-enzymatic variability of Leishmania infantum in Spain. Annals

of tropical medicine and parasitology 2003, 97(Suppl 1):57–64.

14. Rivas L, Moreno J, Canavate C, Alvar J: Virulence and disease in leishmaniasis: what is relevant for

the patient? Trends in parasitology 2004, 20(7):297–301.

RESULTS - SECTION 2

94

15. Pratlong F, Dereure J, Deniau M, Marty P, Faraut-Gambarelli F, Dedet JP: Enzymatic polymorphism

during Leishmania/HIV co-infection: a study of 381 Leishmania strains received between 1986

and 2000 at the international cryobank in Montpellier, France. Annals of tropical medicine and

parasitology 2003, 97(Suppl 1):47–56.

16. Gramiccia M, Gradoni L, Troiani M: HIV-Leishmania co-infections in Italy. Isoenzyme

characterization of Leishmania causing visceral leishmaniasis in HIV patients. Transactions of the

Royal Society of Tropical Medicine and Hygiene 1992, 86(2):161–163.

17. Sulahian A, Garin YJ, Pratlong F, Dedet JP, Derouin F: Experimental pathogenicity of viscerotropic

and dermotropic isolates of Leishmania infantum from immunocompromised and

immunocompetent patients in a murine model. FEMS immunology and medical microbiology 1997,

17(3):131–138.

18. Silvestre R, Cordeiro-Da-Silva A, Santarem N, Vergnes B, Sereno D, Ouaissi A: SIR2-deficient

Leishmania infantum induces a defined IFN-gamma/IL-10 pattern that correlates with protection.

Journal of immunology 2007, 179(5):3161–3170.

19. Fraga J, Montalvo AM, De Doncker S, Dujardin JC, Van der Auwera G: Phylogeny of Leishmania

species based on the heat-shock protein 70 gene. Infection, genetics and evolution: journal of

molecular epidemiology and evolutionary genetics in infectious diseases 2010, 10(2):238–245.

20. Kuhls K, Mauricio IL, Pratlong F, Presber W, Schonian G: Analysis of ribosomal DNA internal

transcribed spacer sequences of the Leishmania donovani complex. Microbes and infections /

Institute Pasteurs 2005, 7(11–12):1224–1234.

21. Haralambous C, Antoniou M, Pratlong F, Dedet JP, Soteriadou K: Development of a molecular assay

specific for the Leishmania donovani complex that discriminates L. donovani/Leishmania

infantum zymodemes: a useful tool for typing MON-1. Diagnostic microbiology and infectious disease

2008, 60(1):33–42.

22. Hall TA: BioEdit: a user-friendly biological sequence alignment editor and analysis program for

Windows 95/98/NT. Nucleic Acids Symp Ser 1999, 41:95–98.

23. Inocencio da Luz R, Romero GA, Dorval ME, Cruz I, Canavate C, Dujardin JC, Van Assche T, Cos P,

Maes L: Drug susceptibility of Leishmania infantum (syn. Leishmania chagasi) isolates from

Brazilian HIV-positive and HIV-negative patients. The Journal of antimicrobial chemotherapy 2011,

66(3):677–679.

24. Adaui V, Schnorbusch K, Zimic M, Gutierrez A, Decuypere S, Vanaerschot M, De Doncker S, Maes I,

Llanos-Cuentas A, Chappuis F, et al: Comparison of gene expression patterns among Leishmania

braziliensis clinical isolates showing a different in vitro susceptibility to pentavalent antimony.

Parasitology 2011, 138(2):183–193.

25. Ouakad M, Bahi-Jaber N, Chenik M, Dellagi K, Louzir H: Selection of endogenous reference genes

for gene expression analysis in Leishmania major developmental stages. Parasitology research

2007, 101(2):473–477.

26. van Eys GJ, Schoone GJ, Kroon NC, Ebeling SB: Sequence analysis of small subunit ribosomal

RNA genes and its use for detection and identification of Leishmania parasites. Molecular and

biochemical parasitology 1992, 51(1):133–142.

RESULTS - SECTION 2

95

27. Miro G, Oliva G, Cruz I, Canavate C, Mortarino M, Vischer C, Bianciardi P: Multicentric, controlled

clinical study to evaluate effectiveness and safety of miltefosine and allopurinol for canine

leishmaniosis. Veterinary dermatology 2009, 20(5–6):397–404.

28. Cruz I, Chicharro C, Nieto J, Bailo B, Canavate C, Figueras MC, Alvar J: Comparison of new

diagnostic tools for management of pediatric Mediterranean visceral leishmaniasis. Journal of

clinical microbiology 2006, 44(7):2343–2347.

29. Mahmoudzadeh-Niknam H, Abrishami F, Doroudian M, Moradi M, Alimohammadian M, Parvizi P, Hatam

G, Mohebali M, Khalaj V: The Problem of Mixing up of Leishmania Isolates in the Laboratory:

Suggestion of ITS1 Gene Sequencing for Verification of Species. Iranian journal of parasitology

2011, 6(1):41–48.

30. Simpson L, Holz G Jr: The status of Leishmania tarentolae/Trypanosoma platydactyli. Parasitology

today 1988, 4(4):115–118.

31. Neal RA: Leishmania major: culture media, mouse strains, and promastigote virulence and

infectivity. Experimental parasitology 1984, 57(3):269–273.

32. Kebaier C, Louzir H, Chenik M, Ben Salah A, Dellagi K: Heterogeneity of wild Leishmania major

isolates in experimental murine pathogenicity and specific immune response. Infection and

immunity 2001, 69(8):4906–4915.

33. Santos MG, Silva MF, Zampieri RA, Lafraia RM, Floeter-Winter LM: Correlation of meta 1 expression

with culture stage, cell morphology and infectivity in Leishmania (Leishmania) amazonensis

promastigotes. Memorias do Instituto Oswaldo Cruz 2011, 106(2):190–193.

34. Saraiva EM, Pinto-da-Silva LH, Wanderley JL, Bonomo AC, Barcinski MA, Moreira ME: Flow cytometric

assessment of Leishmania spp metacyclic differentiation: validation by morphological features

and specific markers. Experimental parasitology 2005, 110(1):39–47.

35. Soto M, Quijada L, Alonso C, Requena JM: Molecular cloning and analysis of expression of the

Leishmania infantum histone H4 genes. Molecular and biochemical parasitology 1997, 90(2):439–

447.

36. Cortez M, Huynh C, Fernandes MC, Kennedy KA, Aderem A, Andrews NW: Leishmania promotes its

own virulence by inducing expression of the host immune inhibitory ligand CD200. Cell host &

microbe 2011, 9(6):463–471.

37. Gomes IN, Calabrich AF, Tavares Rda S, Wietzerbin J, de Freitas LA, Veras PS: Differential properties

of CBA/J mononuclear phagocytes recovered from an inflammatory site and probed with two

different species of Leishmania. Microbes and infection / Institut Pasteur 2003, 5(4):251–260.

38. Wilson ME, Jeronimo SM, Pearson RD: Immunopathogenesis of infection with the visceralizing

Leishmania species. Microbial pathogenesis 2005, 38(4):147–160.

39. Sacks D, Noben-Trauth N: The immunology of susceptibility and resistance to Leishmania major in

mice. Nature reviews immunology 2002, 2(11):845–858.

40. Colvin GA, Lambert JF, Abedi M, Hsieh CC, Carlson JE, Stewart FM, Quesenberry PJ: Murine marrow

cellularity and the concept of stem cell competition: geographic and quantitative determinants in

stem cell biology. Leukemia 2004, 18(3):575–583.

RESULTS - SECTION 2

96

41. Diehl KH, Hull R, Morton D, Pfister R, Rabemampianina Y, Smith D, Vidal JM, van de Vorstenbosch C,

European Federation of Pharmaceutical Industries A, European Centre for the Validation of Alternative

M: A good practice guide to the administration of substances and removal of blood, including

routes and volumes. J Appl Toxicol 2001, 21(1):15–23.

42. Cruz I, Morales MA, Noguer I, Rodriguez A, Alvar J: Leishmania in discarded syringes from

intravenous drug users. Lancet 2002, 359(9312):1124–1125.

43. Cruz I, Nieto J, Moreno J, Canavate C, Desjeux P, Alvar J: Leishmania/HIV co-infections in the

second decade. The Indian journal of medical research 2006, 123(3):357–388.

44. Stanley AC, Engwerda CR: Balancing immunity and pathology in visceral leishmaniasis.

Immunology and cell biology 2007, 85(2):138–147.

45. Yurdakul P, Dalton J, Beattie L, Brown N, Erguven S, Maroof A, Kaye PM: Compartment-specific

remodeling of splenic micro-architecture during experimental visceral leishmaniasis. The

American journal of pathology 2011, 179(1):23–29.

46. Oliveira DM, Costa MA, Chavez-Fumagalli MA, Valadares DG, Duarte MC, Costa LE, Martins VT,

Gomes RF, Melo MN, Soto M, et al: Evaluation of parasitological and immunological parameters of

Leishmania chagasi infection in BALB/c mice using different doses and routes of inoculation of

parasites. Parasitology research 2012, 110(3):1277–1285.

47. Deak E, Jayakumar A, Cho KW, Goldsmith-Pestana K, Dondji B, Lambris JD, McMahon-Pratt D: Murine

visceral leishmaniasis: IgM and polyclonal B-cell activation lead to disease exacerbation.

European journal of immunology 2010, 40(5):1355–1368.

48. Kaur S, Kaur T, Garg N, Mukherjee S, Raina P, Athokpam V: Effect of dose and route of inoculation

on the generation of CD4+ Th1/Th2 type of immune response in murine visceral leishmaniasis.

Parasitology research 2008, 103(6):1413–1419.

49. Depledge DP, MacLean LM, Hodgkinson MR, Smith BA, Jackson AP, Ma S, Uliana SR, Smith DF:

Leishmania-specific surface antigens show sub-genus sequence variation and immune

recognition. PLOS neglected tropical diseases 2010, 4(9):e829.

50. Sadlova J, Price HP, Smith BA, Votypka J, Volf P, Smith DF: The stage-regulated HASPB and SHERP

proteins are essential for differentiation of the protozoan parasite Leishmania major in its sand

fly vector, Phlebotomus papatasi. Cellular microbiology 2010, 12(12):1765–1779.

51. Maroof A, Brown N, Smith B, Hodgkinson MR, Maxwell A, Losch FO, Fritz U, Walden P, Lacey CN,

Smith DF, et al: Therapeutic vaccination with recombinant adenovirus reduces splenic parasite

burden in experimental visceral leishmaniasis. The journal of infectious diseases 2012, 205(5):853–

863.

52. Zackay A, Nasereddin A, Takele Y, Tadesse D, Hailu W, Hurissa Z, Yifru S, Weldegebreal T, Diro E,

Kassahun A, et al: Polymorphism in the HASPB Repeat Region of East African Leishmania

donovani Strains. PLOS neglected tropical diseases 2013, 7(1):e2031.

53. Stager S, Smith DF, Kaye PM: Immunization with a recombinant stage-regulated surface protein

from Leishmania donovani induces protection against visceral leishmaniasis. Journal of

immunology 2000, 165(12):7064–7071.

RESULTS - SECTION 2

97

54. Moreno J, Nieto J, Masina S, Canavate C, Cruz I, Chicharro C, Carrillo E, Napp S, Reymond C, Kaye

PM, et al: Immunization with H1, HASPB1 and MML Leishmania proteins in a vaccine trial against

experimental canine leishmaniasis. Vaccine 2007, 25(29):5290–5300.

55. Farajnia S, Darbani B, Babaei H, Alimohammadian MH, Mahboudi F, Gavgani AM: Development and

evaluation of Leishmania infantum rK26 ELISA for serodiagnosis of visceral leishmaniasis in

Iran. Parasitology 2008, 135(9):1035–1041.

56. Sundar S, Singh RK, Bimal SK, Gidwani K, Mishra A, Maurya R, Singh SK, Manandhar KD, Boelaert M,

Rai M: Comparative evaluation of parasitology and serological tests in the diagnosis of visceral

leishmaniasis in India: a phase III diagnostic accuracy study. Tropical medicine & international

health: TM & IH 2007, 12(2):284–289.

57. da Costa RT, Franca JC, Mayrink W, Nascimento E, Genaro O, Campos-Neto A: Standardization of a

rapid immunochromatographic test with the recombinant antigens K39 and K26 for the diagnosis

of canine visceral leishmaniasis. Transactions of the Royal Society of Tropical Medicine and Hygiene

2003, 97(6):678–682.

58. Bhattarai NR, Dujardin JC, Rijal S, De Doncker S, Boelaert M, Van der Auwera G: Development and

evaluation of different PCR-based typing methods for discrimination of Leishmania donovani

isolates from Nepal. Parasitology 2010, 137(6):947–957.

59. Gouzelou E, Haralambous C, Amro A, Mentis A, Pratlong F, Dedet JP, Votypka J, Volf P, Toz SO, Kuhls

K, et al: Multilocus microsatellite typing (MLMT) of strains from Turkey and Cyprus reveals a

novel monophyletic L. donovani sensu lato group. PLOS neglected tropical diseases 2012,

6(2):e1507.

60. Wege AK, Florian C, Ernst W, Zimara N, Schleicher U, Hanses F, Schmid M, Ritter U: Leishmania

major infection in humanized mice induces systemic infection and provokes a nonprotective

human immune response. PLOS neglected tropical diseases 2012, 6(7):e1741.

RESULTS - SECTION 2

98

RELATED UNPUBLISHED DATA

With the RFLP paterns generated within this work, we were able to detected concomitant

presence of two L. infantum strains, wether by artificially mixing their individual DNA or by

infecting mice with live promastigotes (for instance in re-infection studies).

Figure VI. RFLP patterns of mixed infections

RFLP patterns representative of mixed infections with E390M and ST (A) or HL and ST strains (B) created

artificially by the mixture in different ratios (100/0; 87.5/12.5; 75/25; 50/50; 25/75; 12.5/87.5; 0/100) of DNA

isolated from infected spleens. (C) Example of mixed infections in the liver of 3 animals infected with HL and

re-infected with ST. In lanes 1 and 2 both patterns can be identified simultaneously, while in lane 3 only ST

pattern was generated. For details on the materials and methods go to Materials and Methods of the section

two of the Results. MW - Molecular weight.

RESULTS - SECTION 3

99

SECTION 3

Highly infective Leishmania infantum strain induces strong central and effector

memory CD4+ and CD8+ immunity required for partial protection against re-infection

Unpublished results

Main findings

The nature of a primary infection resulted in a major influence on the concomitant

protection following a second challenge, as partial protection was only found when the

imprinting was made with the L. infantum highly infective strain. The protection associated

to this strain relied on its ability to induce an effective cellular response after infection that

is recalled through the expansion of effector memory CD4+ and CD8+ T cells and the

production of CD4+IFNγ+IL-10+ and CD8+IFNγ+TNFα+.

RESULTS - SECTION 3

101

Highly infective Leishmania infantum strain induces strong central and effector

memory CD4+ and CD8+ immunity required for partial protection against re-infection

Joana Cunha1,2, Eugenia Carrillo3, Carmen Sánchez3, Ricardo Silvestre1, Mariana

Resende1, Javier Moreno3 and Anabela Cordeiro-da-Silva1,4,*

1 Parasite Disease Group, IBMC - Instituto de Biologia Molecular e Celular, Universidade

do Porto, Portugal 2 Instituto de Ciências Biomédicas Abel Salazar and Faculdade de Medicina,

Universidade do Porto, Portugal 3 WHO Collaborating Center for Leishmaniasis, Centro Nacional de Microbiologia, Instituto

de Salud Carlos III, Spain 4 Laboratório de Microbiologia, Departamento de Ciências Biológicas, Faculdade de

Farmácia, Universidade do Porto, Portugal

* Corresponding author

Anabela Cordeiro da Silva, Parasite Disease Group, Unit of Infection and Immunity,

IBMC - Instituto de Biologia Molecular e Celular, Universidade do Porto, Rua do Campo

Alegre, 823, 4150-180 Porto, Portugal

Tel.: +351 226 074 949; Fax: +351 226 099 15; e-mail: cordeiro@ibmc.up.pt

Keywords

Leishmania infantum, infection-induced immunity, memory, protection.

RESULTS - SECTION 3

102

ABSTRACT

Background: Visceral leishmaniasis (VL) is a protozoan infectious disease mainly caused

by Leishmania infantum and L. donovani spread over the tropical and subtropical regions

around the world. Progression of L. infantum infection to clinical disease comprises

multifactorial phenomena. The existence of a previous infection in the host could play an

important role in the course of a following infection due to the downregulation of the

activation signals by Leishmania parasites that otherwise would prompt an effective

immune response.

Aim: To understand the influence of two virulent L. infantum strains on the modulation of

the outcome of a de novo infection, we have studied the ability of a very infective (HL) and

an intermediate infective (ST) strains in the generation of infection-induced immunity and

its efficacy on protection from a subsequent homologous or heterologous challenge in the

murine model of VL.

Results: Partial protection was observed in liver when mice were imprinted and

challenged with HL. In addition, re-infection with ST induced significant reduction in

splenic and hepatic parasite load. However, when the imprinting was made by infection

with ST, high parasite load was found in spleen, liver and bone marrow. Evident

differences between strains were found on memory subsets, as only HL infected mice

presented elevated numbers of CD4+ and CD8+ central memory T cells. Effector memory

sub-populations were also elevated after challenge with HL. Additionally, double

producers CD4+IFNγ+IL-10+ and CD8+IFNγ+TNFα+ were detected upon challenge.

Conclusion: The protection associated with the HL high infective strain relies on its ability

to generate an effective cellular response after infection and that is recalled through

expansion of effector memory CD4+ and CD8+ T cells. The nature of a primary infection is

then a major influence on the concomitant protection following a second challenge, since

it can lead to a milder or more severe disease.

RESULTS - SECTION 3

103

BACKGROUND

Leishmaniasis are an ensemble of diseases with cutaneous, mucocutaneous, visceral and

systemic manifestations that affect many orders of mammals, the main concerning of

them being humans and dogs [1]. They are zoonotic and anthroponotic diseases

transmitted by the bite of a Leishmania sp.-infected female sand fly, endemic in the

Mediterranean Basin, Middle East, Indian sub-continent, and tropical regions from

America and Africa [2]. The most severe form, visceral leishmaniasis (VL), is classically

caused by L. infantum and L. donovani. It can manifest by hepatosplenomegaly, long-term

low-grade fever and weight loss [3], but frequently is asymptomatic, especially in endemic

areas where re-infections are recurrent [4]. The parasite species and the fitness of the

host immune system determine the type and severity of the disease [5].

Leishmania modulates the host’s immune system subverting it to silently enter into the

phagocytes, their target cells. However, pro-inflammatory cytokines, mainly IL-12,

secreted by activated non-infected dendritic cells that act on naïve CD4+ T cells can

polarize a Th1 protective response (Resende et al., submitted and [6]). IL-12-driven IFNγ

secretion by Th1 lymphocytes induces the transcription of the inducible nitric oxide

synthase (iNOS) in macrophages producing high levels of NO, a deadly weapon for the

intracellular amastigotes [7]. Another important role played by IFNγ is on the generation of

cytotoxic CD8+ T cells that are able to directly kill Leishmania-infected phagocytes [8] as

well as influencing the assembly of memory responses [9]. Nevertheless, the secretion of

IFNγ and TNFα that is needed for mounting the effective immunity is also responsible for

disease progression in combination with high levels of IL-10 and also TNFα [10].

It is well accepted that the broad clinical manifestations described in leishmaniasis are

associated with the different cytokine milieu developed in response to the infection, which

is highly dependent on the parasite itself. Accordingly, a diversity of immune responses

have been described for L. major substrains [11] and L. infantum strains from the MON-1

zymodeme [12]. These immune responses may have a pivotal importance if the host

faces a secondary de novo Leishmania infection. In fact, data from endemic countries put

on evidence the reality of resistance to reinfection in visceral leishmaniasis (VL). In one

hand, the predominance of L. infantum infections in children [13] may result from acquired

resistance to reinfection in adulthood and, on the other hand, the examples of fully

recovered patients that showed resistance to re-infection by the same parasite [14].

Some studies on re-infection with the same Leishmania species have been performed in

mice. Streit et al. described a partial level of protection against L. chagasi when mice were

first infected with a high-dose inoculum since it was able to stimulate the immune system

towards a Th1 response for counteracting a subsequent infection. On the contrary, a low-

RESULTS - SECTION 3

104

dose infection suppressed IFNγ production and elicited high levels of TGFβ. Also,

protective immunity was not achieved if an attenuated dhfr-ts knockout strain was used

instead for immunization [15]. However, Oliveira et al. published opposing results as when

they infected mice with a low dose of L. chagasi a protective immune response was

generated, while a high dose contributed to the generation of visceral disease [16].

Several Leishmania species overlap in their geographical distribution. Studies of cross-

infection, using different Leishmania species to immunize and to challenge, have also

shown discrepant results, either conferring protection (with varying degrees of success) or

exacerbating the disease [17].

The existence of infection-induced immunity is indicative of the effective generation of

memory repertoires after a Leishmania sp. infection [18]. Based on the homing

characteristics (dependent on CD62L and CCR7 surface expression), cytokine secretion

and proliferative capacity, two subsets of CD4+ and CD8+ memory cells (CD44hi) can be

defined: central memory (TCM) and effector memory (TEM) T cells. TCM (CD44hiCD62L+)

cells are predominant in secondary lymphoid organs (lymph nodes and spleen), secrete

IL-2 and proliferate extensively. Instead, TEM (CD44hiCD62L-) cells are found principally

in blood, spleen and peripheral organs, have low proliferative capacity but strong

immediate effector function by IFNγ secretion and the pre-expression of granzyme B and

perforin in cytotoxic intracellular granules (in CD8+) [19, 20].

Several studies in the vaccination field, mainly using L. major, have highlighted some

differences in the life span and kinetics of protection between TCM and TEM cells.

Though both subsets are protective, Leishmania-specific TEM cells are lost if the parasite

is eliminated, but TCM are maintained even without antigen persistence and can confer

protection against challenge [21]. Nevertheless, TEM cells mediate rapid protection

whereas TCM-derived protection has a delayed onset [21]. However few studies have

focused on the influence of these four subpopulations (CD4+ and CD8+, TCM and TEM

cells) in the scenario of an infection with live parasites and reinfection with the same or

another strain. Kedzierski et al. have described that the observed protection against a

challenge with Friedlin L. major after immunization with a live attenuated non-persistent L.

major strain was associated with increased numbers of CD44hi CD4+ and CD8+ T cells in

the draining lymph nodes after challenge rather than their memory phenotype (CD62L+ or

CD62L-) [22]. To our knowledge, there is no previous literature about the concomitant

immunity developed with live virulent L. infantum infection followed by homologous or

heterologous re-infection.

In a previous work, we have characterized the HL and ST L. infantum strains according to

their infectivity [23]. In our mouse model of VL, both strains were able to infect and prevail

in the spleen, liver, bone marrow and inguinal lymph nodes after 6 weeks of infection.

RESULTS - SECTION 3

105

However, the HL strain demonstrated to be more infective in vitro and in vivo than ST as

evaluated by parasite load quantification. Since the severity of the infection and the

progression of the disease are strongly determined by the elicited immune response, in

this work we analyzed the ability of these two virulent strains in the generation of an

effective adaptive immunity in the context of experimental chronic infection and in the

induction of a recall response after re-infection in BALB/c model.

RESULTS - SECTION 3

106

MATERIALS AND METHODS

Parasite culture

Two Leishmania infantum strains were previously characterized and used in this study. HL

(MHOM/PT/2009/LLM-1708) and ST (MHOM/MA/67/ITMAP-263) strains demonstrated to

have, respectively, high and intermediate infectivity [23]. Promastigotes were cultivated in

Novy-MacNeal-Nicolle medium prepared with a semi-solid phase made of 1.4 % agar

(Sigma-Aldrich), 0.6 % NaCl (Merck), 31 % defibrinated rabbit blood, 625 units/mL

penicillin, 625 units/mL streptomycin and RPMI 1640 medium supplemented with 10%

fetal bovine serum, 2 mM L-glutamine, 100 U/mL penicillin, 100 U/mL streptomycin and 20

mM HEPES buffer (all from Lonza) as liquid phase. Cultures were initiated with 106

promastigotes that had been previously synchronized in procyclic forms and grown for 4

days at 26 ºC. After expansion, promastigotes were recovered, washed in PBS and used

for infection. To maintain parasite virulence, no more than 10 in vitro sub-passages were

performed.

Infection of the animals and ethics statement

7-8 week-old BALB/c male mice (Harlan Laboratories, United Kingdom) were maintained

at the Instituto de Salud Carlos III (Spain) and IBMC - Instituto de Biologia Molecular e

Celular (Portugal) animal facilities. Animals were housed in IVC cabinets and fed with

sterile food and water ad libitum. All conducted experiments were done in agreement with

the ISCIII and IBMC.INEB Animal Ethics Committees and the Spanish and Portuguese

National Authorities for Animal Health guidelines, according to the statements on the

directive 2010/63/EU of the European Parliament and of the Council. JC, RS and ACS

have an accreditation for animal research given from Portuguese Veterinary Direction

(Ministerial Directive 1005/92). Mice were infected by intraperitoneal route with 108 HL or

ST promastigotes suspended in 200 μL of PBS. After 6 weeks of infection mice were

anesthetized with isoflurane and sacrificed by cervical dislocation. In the re-infection

experiments, animals were infected for 6 weeks with HL or ST strains as before and

challenged intraperitoneally with 108 promastigotes of the same or the other strain; 6

weeks after challenge they were sacrificed. Spleen, liver and femoral bone marrow were

recovered for quantification of the parasite load. Splenocytes were also used for the study

of the cellular immune response.

RESULTS - SECTION 3

107

Parasite load quantification

Spleen, liver and femoral bone marrow were collected and dissociated in single-cell

suspensions and parasite loads quantified by qPCR as described in detail elsewhere [23].

Briefly, the equivalent of 10 mg of spleen and liver and 3x106 bone marrow cells were

digested overnight at 56 ºC by 40 μg of Proteinase K (Sigma) in 400 μL of a buffer

containing 10 mM NaCl, 10 mM EDTA and 10 mM Tris-HCl with pH 8.0. DNA was

extracted by classic phenol/chloroform/isoamyl alcohol protocol, precipitated with ethanol

and dissolved in 150 μL of nuclease free water. Samples were incubated for 1h at 56 ºC

to guarantee complete solubilization of DNA prior to quantification in Nanodrop ND-1000

spectrophotometer (Thermo Scientific). Depending on the tissue, 100 - 400 ng of DNA

were used in a qPCR targeting the small subunit rRNA (SSUrRNA) with the primers R223

and R333 [24], using LightCycler FastStart DNA Master SYBR Green I kit (Roche Applied

Science) according to the manufacturer’s instructions in a LightCycler 2.0 instrument

(Roche Applied Science). Positive but unquantifiable samples were examined by melting

temperature analysis and confirmed by nested PCR with the primers R221 and R332 in

the first reaction and the same R223 and R333 in the second one [25].

Splenic cell populations

5x105 splenocytes were incubated for 20 minutes at 4 ºC with saturating concentrations of

anti-mouse monoclonal antibodies (all from Biolegend, except when noted): FITC anti-

CD8, clone 53-6.7; FITC anti-CD19, clone 6D5; PE anti-NK1.1, clone PK136 (from BD

Pharmingen); APC anti-CD11c, clone N418; PE anti-CCR2, clone 475301 (from R&D); PE

anti-CD44, clone IM7; APC anti-CD62L, clone MEL-14-H2.100 (from MACS Miltenyi);

Alexa Fluor 647 anti-Ly6G, clone 1A8; PerCp.Cy5.5 anti-Ly6C, clone HK1.4; PerCp.Cy5.5

anti-CD3, clone 17A2; APC.Cy7 anti-CD4, clone GK 1.5; PE.Cy7 anti-CD11b, clone

M1/70. After washing twice with PBS/FBS 2 %, the cells were examined by flow cytometry

in a FACSCanto (BD Bioscences). Leukocytes were gated by FSC and SSC parameters

and 50 000 cells were analyzed with FlowJo software (Tree Star).

Intracellular cytokines

1x106 splenocytes were plated on a 96-well plate and stimulated for 2 hours with 50

ng/mL phorbol 12‐myristate 13‐acetate (PMA) and 500ng/mL ionomycin. Then 10 μg/mL

Brefeldin A was added for another 2 hours. Cells were recovered and surface-stained as

mentioned before for CD4 (FITC anti-CD4, clone GK 1.5) and CD8 (PE anti-CD8, clone

53-6.7) followed by intracellular staining of IFNγ (PE.Cy 7 anti-IFNγ, clone XMG1.2), IL-10

(APC anti-IL-10, clone JES5-16E3) and TNFα (PerCP.Cy5.5 anti-TNFα, clone MP6-XT22)

(all antibodies from Biolegend). Briefly, surfaced stained cells were fixed with

RESULTS - SECTION 3

108

PBS/paraformaldehyde 2% and incubated in the permeabilization buffer (PBS/saponin

0.5%). Antibodies for intracellular cytokines were added to the cells and incubated for 30

minutes at 4 ºC. The cells were washed, first with the permeabilization buffer and then in

PBS/FBS 2 %, and analyzed in a FACS Canto. Lymphocytes were gated according to

FSC and SSC parameters and 10 000 CD4+ and CD8+ cells were acquired and evaluated

with FlowJo software for single or double production of the selected cytokines.

Statistical analysis

All the statistical analysis was done with GraphPad Prism 5 (GraphPad Software). The

results are presented as means ± standard deviations (SD). To compare statistical

differences two-tailed Mann Whitney test was performed unless otherwise stated. 1, 2 or 3

symbols indicate p<0.05, p<0.01 or p<0.001.

RESULTS - SECTION 3

109

RESULTS AND DISCUSSION

Development of protection needs highly infective Leishmania

Many efforts have been made to understand how Leishmania-specific immunity is

generated and maintained over time. Nowadays, it is of scientific consensus that early

activation of the innate immune system is essential for the production of a reliable

adaptive response that leans on CD4+ and CD8+ specific cellular immunity.

To understand the strain-specific immunomodulation mechanisms that lead to protection

to re-infection we used two strains of L. infantum, one dermotropic (HL) and the other

viscerotropic (ST), which presented differential onset and progression of visceral

leishmaniasis (VL) in mice. As previously shown [23], HL is able to colonize the spleen,

liver and bone marrow in higher extent than ST parasites 6 weeks after infection (Figure 1,

Infection bars). We hypothesized that these differences in infectivity could lead to distinct

levels of protection. Thus, we re-infected the mice with homologous or heterologous

strains.

Figure 1. Parasite load after infection and challenge with L. infantum strains

with different infectivity

Mice were infected for 6 weeks with each strain (Infection) and then re-infected independently with both

strains (Re-inf HL and Re-inf ST) for another 6 weeks. At the end of both experiments parasite load was

measured in (A) spleen, (B) liver and (C) bone marrow. Bars represent means ± SD of 5 to 9 animals of one

experiment representative of two independents. Statistical significant differences between HL and ST

infections were calculated with Mann Whitney test and are signed with +. Kruskall-Wallis test followed by

Dunn’s multiple comparison test were used to calculate differences before and after challenge and are

depicted with *. Dashed line indicates the limit of detection for quantification for each tissue.

In our model, mice that were previously imprinted with HL strain and then challenged with

the same high infective strain (Figure 1, Re-inf HL bars) were able to sustain the splenic

parasite load and to decrease in about 1 logarithm the number of parasites colonizing the

RESULTS - SECTION 3

110

liver and bone marrow. On the contrary, HL re-infection after ST imprinting led to a

significant increase of about 3 logarithmic units in all the target tissues. Concomitant

immunity was more pronounced when the animals were infected with the high infective

strain and then challenged with ST due to its lower infectivity (Figure 1, Re-inf ST bars).

As such, the infections in the spleen and liver of HL imprinted mice suffered a significant

reduction of 3 logarithms in the parasite load to levels close to the quantification limit,

and in the bone marrow parasitic presence was detected but not quantifiable. Accordingly,

ST imprinting and consecutive challenge resulted in a 10-fold increase in the splenic and

hepatic parasite burden compared to the primary infection numbers, though no changes

were noticed in the bone marrow parasite load.

Based on the data exposed above, in terms of parasitological analysis we established that

the onset of pathology (set as hepatosplenomegaly (data not shown) and high parasite

loads) by an infective L. infantum strain confers a degree of protection over a re-infection

episode which correlates with the infectivity of both the imprinting and the challenging

strains that are inoculated in the host. Similar findings were reported previously, where a

high-dose of L. chagasi promastigotes was required for the development of protection

against re-infection, whereas a low-dose immunization either had no effect or slightly

exacerbated disease [15].

Infectivity influences downstream adaptive response-triggering events

To understand the immune response behind this protective phenotype, we analyzed the

splenic populations and the T cells functionality.

We observed that infection with HL produced a significant increase in the total cellularity

and major leukocyte populations when compared to naïve animals, which was not noticed

when mice were infected with ST (Figure 2). Interestingly, when the animals were

subjected to a secondary infection by HL, regardless of the infectivity of the imprinting

strain, we detected the same increase in the number of splenocytes while after challenge

with ST there was no change in the cellularity.

Inflammatory macrophages/monocytes and neutrophils, besides its recognition as host

cells [26, 27], have been implicated in the remodeling of the spleen during splenomegaly

in leishmaniasis [28, 29], as well as in the modulation of the specific CD4+ T cells

response in late phases of infection, at least with L. major [30]. Infiltration of neutrophils

[31], dendritic cells (DCs) [32] and macrophages [33] in inflamed tissues is tightly

regulated by the CC chemokine receptor 2 (CCR2) that also participates in important

processes related to anti-Leishmania defense [32, 33].

RESULTS - SECTION 3

111

   

    

Figure 2. Splenic cellular populations after

infection and challenge with highly and low

infective L. infantum strains

After infection and consequent challenge with both

HL and ST strains, splenocytes were recovered and

surface-stained for identification of major leukocytes

populations. (A) Total cells were counted and (B)

CD4+ T cells (CD3+CD4+), (C) CD8+ T cells

(CD3+CD8+), (D) B cells (CD19+) and (E)

Macrophages (CD11b+Ly6C+) were evaluated by

flow cytometry. Cell numbers from infected mice

were normalized with respective values from age-

matched naïve mice and results are presented as

log2 (fold change relative to naïve). Dashed and solid

lines indicate 2- and 4-fold difference. Boxes and

whiskers with 5-95 percentile and mean (showed

with +) of 5 to 9 animals of one experiment

representative of two independents. Mann Whitney

test was run to calculate statistical significant

differences between mice infected with HL or ST and

results are depicted with +. Differences before and

after challenge are indicated with * and were

calculated with Kruskall-Wallis test followed by

Dunn’s multiple comparison test.

RESULTS - SECTION 3

112

As these are the first cells that need to be committed, we determined the number of

inflammatory macrophages, DCs and neutrophils by the expression of CCR2 (Figure 3).

Infection and challenge with HL led to the significant increase of these inflammatory cells

in the spleen. Similarly, infection with ST also increased significantly the inflammatory

dendritic cells and neutrophils, but only with a second wave of parasites the CCR2+

macrophages arisen in numbers significantly higher than in uninfected animals. However

this difference in the number of CCR2+ macrophages relates with the total macrophages

present in the spleen, as the relative percentages were similar between HL and ST (data

not shown). These CCR2+ macrophages exert an important role in the defense against

leishmaniasis, since it has been previously described that optimal parasite killing require

the recruitment of CCR2+ macrophages, followed by stimulation with combined MCP-1

and IFN-γ [33].

  

Figure 3. Expression of CCR2 on splenic macrophages,

neutrophils and dendritic cells

Number of (A) inflammatory macrophages (CD11b+Ly6C+

CCR2+), (B) inflammatory neutrophils (CD11b+Ly6G+CCR2+)

and (C) activated dendritic cells (CD11c+CCR2+) in infected

mice before (Infection bars) and after challenge (Re-inf bars)

with the strain previously used for imprinting. Bars represent

means ± SD of 5 to 9 animals of one experiment

representative of two independents. Statistical significant

differences were calculated with Mann Whitney test between

naïve and infected or challenged animals.

 

 

 

Thus, monocyte and neutrophil activation showed

no major differences between HL and ST strains,

similarly to the findings of Meddeb-Garnaoui et al.

that compared the cytokine profile of human

monocytes infected with dermotropic and

viscerotropic L. infantum strains that presented

respectively high and low infectivity in vitro [34].

RESULTS - SECTION 3

113

In their in vitro setup, no differences were found in the ability of those two strains in the

modulation of monocyte-secreted cytokines [34], indicating that the infectivity of a

Leishmania strain not always produces a direct effect on the innate immune response.

Nonetheless, in vivo, where other factors that influence macrophage function are present,

the effect of the infectivity was not evaluated. We hypothesize that despite monocyte and

neutrophil activation were similar, HL- and ST-activated cells should present divergent

efficiencies when triggering the adaptive immune response, which may be indicative of

intrinsic characteristics of the strains in modulating downstream events.

Highly infective L. infantum triggers memory and effector CD4+ and CD8+ T cells

We have studied the generation of CD4+ and CD8+ memory T cells 6 weeks post-infection

and upon challenge with the same strain by the surface expression of CD44 and CD62L

(Figure 4).

HL infection potentiated the expansion of central memory CD8+ (Figure 4C, TCM bars)

and especially CD4+ T cells (Figure 4A, TCM bars) that doubled in percentage compared

to uninfected mice. These memory populations are probably an important factor in the

control of the parasite load in the spleen, as presented before (Figure 1A), when the

animals were subjected to re-infection. Memory cells constitute a source of experienced-

antigen cells that are able to rapidly respond to face a similar challenge. While TEM cells

respond rapidly with protective effector functions, TCM are thought to replenish the TEM

pool [35].

In fact, after challenge with HL, both CD4+ (Figure 4B) and CD8+ (Figure 4D) TCM pools

remained high and TEM cells also significantly increased compared to naïve mice.

Moreover, taking into account that the total numbers of T lymphocytes in the infected

animals were significantly increased in relation to naïve mice (Figure 2B and C), the

number of memory (CD44hi) T cells is even more expressive in the spleens of those HL-

re-infected animals. On the contrary, ST strain showed no potential in clonal expansion of

memory populations or at least in their maintenance in high number in order to bring

advantage upon re-infection. Neither in the imprinting infection nor after challenge could

we detect CD4+ or CD8+ central or effector memory T cells in a percentage higher than

that of the naïve animals. The decrease in the CD8+ TCM cells 6 weeks after ST infection

(Figure 4C) was considered not to have any biological meaning since, when adjusted to

total number of cells, both naïve and infected mice have similar amounts of that

subpopulation.

RESULTS - SECTION 3

114

Figure 4. T cell memory repertoire

(A, B) CD4+ and (C, D) CD8+ T cells were analyzed according to their surface expression of CD44 and

CD62L. Naïve (CD44loCD62L+), central memory (TCM; CD44hiCD62L+) and effector memory (TEM;

CD44hiCD62L-) subpopulations were quantified before (A, C) and after (B, D) challenge. Bars show means ±

SD of 5 to 9 animals of one experiment representative of two independents and statistical significant

differences between naïve and infected mice are depicted with *.

From the data exposed, we justified the partial protection that a primary infection with HL

L. infantum strain can generate upon an homologous re-infection with the ability of this

strain to activate the innate defenders (DCs, macrophages and neutrophils) for

mobilization to the spleen where they can drive an effective generation and expansion of

memory CD4+ and CD8+ T cell subsets.

Double producers CD4+IFNγ+IL-10+ and CD8+IFNγ+TNFα+ T cells arise after

re-infection

To appreciate the mechanisms underlying the protection observed after re-infection with a

highly infective strain, we have analyzed the magnitude of the developed T cell response

in infected and re-infected mice with HL strain.

After infection, we detected high levels of IFNγ-producing CD4+ and CD8+ T cells (Figures

5A and C, respectively). This finding was anticipated after having noticed the massive

RESULTS - SECTION 3

115

cellular infiltrate of leukocytes in the spleen (Figure 2) and also the existence of

approximately 15 % of effector memory lymphocytes (combined CD4+ and CD8+) that

classically secrete this cytokine [19]. Upon re-infection (Figures 5B and D), however, a

more interesting panel of effector cells has emerged. Along with the same IFNγ+ cells,

detected in both CD4+ and CD8+ lymphocytes, we identified IL-10 in 1.5 % and IFNγ+IL-

10+ double producers in 0.75 % of the CD4+ T cells, which represent an increment of

1.7 and 3.1, respectively, compared to uninfected animals.

Figure 5. Intracellular cytokines of CD4+ and CD8+ lymphocytes

IFNγ, IL10 and TNFα production was analyzed by flow cytometry in CD4+ (A, B) and CD8+ (C, D)

lymphocytes. Splenocytes were stimulated with PMA, ionomycin and brefeldin A and stained for surface and

intracellular molecules. Cytokine single and double producers in each lymphocyte population are depicted

from naïve, infected (A, C) or challenged (B, D) mice. Bars represent means ± SD of 4 to 9 animals of one

experiment with statistical significant differences between naïve and infected mice pointed out with *.

CD4+T-bet+IFNγ+IL-10+ cells were recently described by us and others upon infection of

BALB/c mice with L. infantum [36] or L. donovani [37]. This Th1 population is driven by

CD4+ T cells activation by the infected DCs and leads to an unprotective phenotype that

accentuates the infection. However, a protective role was previously attributed to

RESULTS - SECTION 3

116

CD4+CD25-Foxp3-IFNγ+IL-10+ cells in a vaccination study with L. donovani LdCen1-/- [38]

and in a non-healing model of CL with L. major [39], which were claimed to arise after a

strong inflammatory stimulus as a feedback control of Th1 responses to avoid tissue

damage.

In CD8+ T cells, conversely, cytokine double producing cells were found for IFNγ+TNFα+,

in a representation of 0.86 %, meaning an increase of 3.4 fold compared to naïve mice.

IFNγ and TNFα concomitant production by Th1 and CD8+ T cells has for long proven to be

more efficient in the killing of L. major [40, 41] and other unrelated microorganisms (e.g.

Mycobacterium tuberculosis [42]) than the production of IFNγ or TNFα alone. More

recently, IFNγ+TNFα+ high quality CD4+ and CD8 T+ cells were described to be generated

after several vaccination protocols against L. major and correlate with prognosis of

protection much better than IFNγ single producers [43]. Moreover, those double producers

CD4+ T cells, which can also be IL-2+, were determined to belong to the central memory

subset, providing long-term protection [43, 44]. As for CD8+IFNγ+TNFα+ T cells, they were

described to have enhanced cytolytic activity compared to IFNγ+ single producers cells in

HIV-infected patients [45]. However, in our study, we could not detect any difference in the

cytotoxicity mediated by CD8+ T cells from HL infected and challenged mice compared to

that from naïve animals (data not shown), which may indicate that cytolytic activity of

those cells was not required in the containment of the parasites in the spleen or the

persistence of the splenic parasite load is due to an incomplete effector function of the

CD8+ T cells.

RESULTS - SECTION 3

117

CONCLUSIONS

Taken together, our results show that HL L. infantum strain promotes a robust activation

of the immune system upon infection initiated by a strong recruitment of leukocytes to the

spleen that stimulates the development of an effective adaptive response. This is a mixed

response as considered by the detection of single producers IFNγ+ and IL-10+ CD4+ T

cells that become more evident when the antigen is re-loaded (re-infection). CD8+ T cells

also exert their effector function by the production of IFNγ. After re-infection, double

producers CD8+IFNγ+TNFα+ and CD4+IFNγ+IL-10+ T cells arise, probably from the

expansion of the central and effector memory subsets, to contain the parasites that

colonized the spleen and to efficiently resolve the infection in the liver and bone marrow,

controlling tissue damage by IL-10 production. To confirm this hypothesis, adoptive

transfer of these memory cells produced after re-infection with our highly infective L.

infantum strain could be performed to evaluate the protective phenotype of such pools of

CD4+ and CD8+ T cells in naïve animals challenged with a posterior L. infantum infection.

Taking the fact that HL is a dermotropic strain that caused CL in a human patient, its

tropism is possibly justified by the inflammatory potential of the strain that impedes a silent

entry into the host. A protective response may immediately be mounted in the skin,

abrogating any chance of the parasite to reach internal organs and visceralize [45].

Concerning ST strain, an agent of human VL, despite some activation of the innate

immune system, it does not translate into efficient adaptive immunity as no memory cells

were detected. With this, a primary infection does not serve as imprinting, since a re-

infection with the same strain led to the increase of the parasite load in the spleen and

liver.

With this work we contributed to the better understanding of the complex modulation that

Leishmania parasites do to surmount the protective strategies developed by the host’s

immune system. Much of the knowledge acquired so far by the scientific community was

based on L. major-infection models that have a clear Th1/Th2 dichotomy on

protection/progression of the disease, and more studies with VL models are needed to

clarify the intriguing modulation that viscerotropic strains provide to take advantage of

their host.

RESULTS - SECTION 3

118

REFERENCES

1. WHO: Control of the leishmaniasis: report of a meeting of the WHO Expert Committee on the

Control of Leishmaniases, Geneva, 22-26 March 2010. World Health Organization technical report

series 2010(949):xii-xiii, 1-186, back cover.

2. Ready PD: Leishmaniasis emergence in Europe. Euro surveillance : bulletin europeen sur les

maladies transmissibles = European communicable disease bulletin 2010, 15(10):19505.

3. Kumar R, Nylen S: Immunobiology of visceral leishmaniasis. Frontiers in immunology 2012, 3:251.

4. Michel G, Pomares C, Ferrua B, Marty P: Importance of worldwide asymptomatic carriers of

Leishmania infantum (L. chagasi) in human. Acta tropica 2011, 119(2-3):69-75.

5. Rivas L, Moreno J, Canavate C, Alvar J: Virulence and disease in leishmaniasis: what is relevant for

the patient? Trends in parasitology 2004, 20(7):297-301.

6. De Trez C, Brait M, Leo O, Aebischer T, Torrentera FA, Carlier Y, Muraille E: Myd88-dependent in vivo

maturation of splenic dendritic cells induced by Leishmania donovani and other Leishmania

species. Infection and immunity 2004, 72(2):824-832.

7. Liu D, Uzonna JE: The early interaction of Leishmania with macrophages and dendritic cells and

its influence on the host immune response. Frontiers in cellular and infection microbiology 2012,

2:83.

8. Tsagozis P, Karagouni E, Dotsika E: Function of CD8+ T lymphocytes in a self-curing mouse model

of visceral leishmaniasis. Parasitology international 2005, 54(2):139-146.

9. Stager S, Smith DF, Kaye PM: Immunization with a recombinant stage-regulated surface protein

from Leishmania donovani induces protection against visceral leishmaniasis. Journal of

immunology 2000, 165(12):7064-7071.

10. Stanley AC, Engwerda CR: Balancing immunity and pathology in visceral leishmaniasis. Immunol

Cell Biol{Stanley, 2007 #209} 2007, 85(2):138-147.

11. Tacchini-Cottier F, Weinkopff T, Launois P: Does T Helper Differentiation Correlate with Resistance

or Susceptibility to Infection with L. major? Some Insights From the Murine Model. Frontiers in

immunology 2012, 3:32.

12. Baptista-Fernandes T, Marques C, Roos Rodrigues O, Santos-Gomes GM: Intra-specific variability of

virulence in Leishmania infantum zymodeme MON-1 strains. Comparative immunology, microbiology

and infectious diseases 2007, 30(1):41-53.

13. Chappuis F, Sundar S, Hailu A, Ghalib H, Rijal S, Peeling RW, Alvar J, Boelaert M: Visceral

leishmaniasis: what are the needs for diagnosis, treatment and control? Nature reviews

Microbiology 2007, 5(11):873-882.

14. Selvapandiyan A, Dey R, Gannavaram S, Lakhal-Naouar I, Duncan R, Salotra P, Nakhasi HL: Immunity

to visceral leishmaniasis using genetically defined live-attenuated parasites. Journal of tropical

medicine 2012, 2012:631460.

RESULTS - SECTION 3

119

15. Streit JA, Recker TJ, Filho FG, Beverley SM, Wilson ME: Protective immunity against the protozoan

Leishmania chagasi is induced by subclinical cutaneous infection with virulent but not avirulent

organisms. Journal of immunology 2001, 166(3):1921-1929.

16. Oliveira DM, Costa MA, Chavez-Fumagalli MA, Valadares DG, Duarte MC, Costa LE, Martins VT,

Gomes RF, Melo MN, Soto M et al: Evaluation of parasitological and immunological parameters of

Leishmania chagasi infection in BALB/c mice using different doses and routes of inoculation of

parasites. Parasitology research 2012, 110(3):1277-1285.

17. Nation CS, Dondji B, Stryker GA: Previous exposure to a low infectious dose of Leishmania major

exacerbates infection with Leishmania infantum in the susceptible BALB/c mouse. Parasitology

research 2012, 111(3):1407-1415.

18. Okwor I, Uzonna J: Persistent parasites and immunologic memory in cutaneous leishmaniasis:

implications for vaccine designs and vaccination strategies. Immunologic research 2008, 41(2):123-

136.

19. Mueller SN, Gebhardt T, Carbone FR, Heath WR: Memory T Cell Subsets, Migration Patterns, and

Tissue Residence. Annual review of immunology 2012.

20. Yang S, Liu F, Wang QJ, Rosenberg SA, Morgan RA: The shedding of CD62L (L-selectin) regulates

the acquisition of lytic activity in human tumor reactive T lymphocytes. PloS one 2011,

6(7):e22560.

21. Zaph C, Uzonna J, Beverley SM, Scott P: Central memory T cells mediate long-term immunity to

Leishmania major in the absence of persistent parasites. Nature medicine 2004, 10(10):1104-1110.

22. Kedzierski L, Curtis JM, Doherty PC, Handman E, Kedzierska K: Decreased IL-10 and IL-13

production and increased CD44hi T cell recruitment contribute to Leishmania major immunity

induced by non-persistent parasites. European journal of immunology 2008, 38(11):3090-3100.

23. Cunha J, Carrillo, E., Sánchez, C., Cruz, I., Moreno, J., Cordeiro-da-Silva, A.: Characterization of the

biology and infectivity of Leishmania infantum viscerotropic and dermotropic strains isolated

from HIV+ and HIV- patients in the murine model of visceral leishmaniasis. Parasites & Vectors

2013, 6:122.

24. Miro G, Oliva G, Cruz I, Canavate C, Mortarino M, Vischer C, Bianciardi P: Multicentric, controlled

clinical study to evaluate effectiveness and safety of miltefosine and allopurinol for canine

leishmaniosis. Veterinary dermatology 2009, 20(5-6):397-404.

25. Cruz I, Chicharro C, Nieto J, Bailo B, Canavate C, Figueras MC, Alvar J: Comparison of new

diagnostic tools for management of pediatric Mediterranean visceral leishmaniasis. Journal of

clinical microbiology 2006, 44(7):2343-2347.

26. Peters NC, Egen JG, Secundino N, Debrabant A, Kimblin N, Kamhawi S, Lawyer P, Fay MP, Germain

RN, Sacks D: In vivo imaging reveals an essential role for neutrophils in leishmaniasis transmitted

by sand flies. Science 2008, 321(5891):970-974.

27. Thalhofer CJ, Chen Y, Sudan B, Love-Homan L, Wilson ME: Leukocytes infiltrate the skin and

draining lymph nodes in response to the protozoan Leishmania infantum chagasi. Infection and

immunity 2011, 79(1):108-117.

RESULTS - SECTION 3

120

28. Yurdakul P, Dalton J, Beattie L, Brown N, Erguven S, Maroof A, Kaye PM: Compartment-specific

remodeling of splenic micro-architecture during experimental visceral leishmaniasis. The

American journal of pathology 2011, 179(1):23-29.

29. Smelt SC, Cotterell SE, Engwerda CR, Kaye PM: B cell-deficient mice are highly resistant to

Leishmania donovani infection, but develop neutrophil-mediated tissue pathology. Journal of

immunology 2000, 164(7):3681-3688.

30. Tacchini-Cottier F, Zweifel C, Belkaid Y, Mukankundiye C, Vasei M, Launois P, Milon G, Louis JA: An

immunomodulatory function for neutrophils during the induction of a CD4+ Th2 response in

BALB/c mice infected with Leishmania major. Journal of immunology 2000, 165(5):2628-2636.

31. Souto FO, Alves-Filho JC, Turato WM, Auxiliadora-Martins M, Basile-Filho A, Cunha FQ: Essential role

of CCR2 in neutrophil tissue infiltration and multiple organ dysfunction in sepsis. American journal

of respiratory and critical care medicine 2011, 183(2):234-242.

32. Sato N, Ahuja SK, Quinones M, Kostecki V, Reddick RL, Melby PC, Kuziel WA, Ahuja SS: CC

chemokine receptor (CCR)2 is required for langerhans cell migration and localization of T helper

cell type 1 (Th1)-inducing dendritic cells. Absence of CCR2 shifts the Leishmania major-resistant

phenotype to a susceptible state dominated by Th2 cytokines, b cell outgrowth, and sustained

neutrophilic inflammation. The Journal of experimental medicine 2000, 192(2):205-218.

33. Conrad SM, Strauss-Ayali D, Field AE, Mack M, Mosser DM: Leishmania-derived murine monocyte

chemoattractant protein 1 enhances the recruitment of a restrictive population of CC chemokine

receptor 2-positive macrophages. Infection and immunity 2007, 75(2):653-665.

34. Meddeb-Garnaoui A, Zrelli H, Dellagi K: Effects of tropism and virulence of Leishmania parasites on

cytokine production by infected human monocytes. Clinical and experimental immunology 2009,

155(2):199-206.

35. Liu D, Uzonna JE: The p110 delta isoform of phosphatidylinositol 3-kinase controls the quality of

secondary anti-Leishmania immunity by regulating expansion and effector function of memory T

cell subsets. Journal of immunology 2010, 184(6):3098-3105.

36. Resende M, Moreira D, Augusto J, Cunha J, Neves B, Cruz MT, Estaquier J, Cordeiro-da-Silva A,

Silvestre R: Leishmania-Infected MHC Class IIhigh Dendritic Cells Polarize CD4+ T Cells toward a

Nonprotective T-bet+ IFN-gamma+ IL-10+ Phenotype. Journal of immunology 2013, 191(1):262-273.

37. Owens BM, Beattie L, Moore JW, Brown N, Mann JL, Dalton JE, Maroof A, Kaye PM: IL-10-producing

Th1 cells and disease progression are regulated by distinct CD11c(+) cell populations during

visceral leishmaniasis. PLoS pathogens 2012, 8(7):e1002827.

38. Selvapandiyan A, Dey R, Nylen S, Duncan R, Sacks D, Nakhasi HL: Intracellular replication-deficient

Leishmania donovani induces long lasting protective immunity against visceral leishmaniasis.

Journal of immunology 2009, 183(3):1813-1820.

39. Anderson CF, Oukka M, Kuchroo VJ, Sacks D: CD4(+)CD25(-)Foxp3(-) Th1 cells are the source of IL-

10-mediated immune suppression in chronic cutaneous leishmaniasis. The Journal of experimental

medicine 2007, 204(2):285-297.

RESULTS - SECTION 3

121

40. Bogdan C, Moll H, Solbach W, Rollinghoff M: Tumor necrosis factor-alpha in combination with

interferon-gamma, but not with interleukin 4 activates murine macrophages for elimination of

Leishmania major amastigotes. European journal of immunology 1990, 20(5):1131-1135.

41. Liew FY, Li Y, Millott S: Tumor necrosis factor-alpha synergizes with IFN-gamma in mediating

killing of Leishmania major through the induction of nitric oxide. Journal of immunology 1990,

145(12):4306-4310.

42. Chan J, Xing Y, Magliozzo RS, Bloom BR: Killing of virulent Mycobacterium tuberculosis by

reactive nitrogen intermediates produced by activated murine macrophages. The Journal of

experimental medicine 1992, 175(4):1111-1122.

43. Darrah PA, Patel DT, De Luca PM, Lindsay RW, Davey DF, Flynn BJ, Hoff ST, Andersen P, Reed SG,

Morris SL et al: Multifunctional TH1 cells define a correlate of vaccine-mediated protection against

Leishmania major. Nature medicine 2007, 13(7):843-850.

44. Seder RA, Darrah PA, Roederer M: T-cell quality in memory and protection: implications for

vaccine design. Nature reviews Immunology 2008, 8(4):247-258.

45. Lichterfeld M, Yu XG, Waring MT, Mui SK, Johnston MN, Cohen D, Addo MM, Zaunders J, Alter G, Pae

E et al: HIV-1-specific cytotoxicity is preferentially mediated by a subset of CD8(+) T cells

producing both interferon-gamma and tumor necrosis factor-alpha. Blood 2004, 104(2):487-494.

46. Maia C, Seblova V, Sadlova J, Votypka J, Volf P: Experimental transmission of Leishmania infantum

by two major vectors: a comparison between a viscerotropic and a dermotropic strain. PLoS

neglected tropical diseases 2011, 5(6):e1181.

DiscussionandConclusions

 

DISCUSSION AND CONCLUSIONS

125

On the importance of establishing the culture conditions for the in vitro growth of

Leishmania sp. parasites

Leishmania spp. are protozoan parasites transmitted to the mammalian host by the bite of

a female phlebotomine sand fly. Inside the vector, Leishmania exists as promastigote form

that evolves through numerous developing stages inside the intestinal tract of the insect.

The metacyclic promastigote is the infective stage for the mammalian host but once it has

been inoculated in the skin is rapidly converted into the amastigote form to survive in the

aggressive intracellular milieu of the macrophages’ phagolysosomes.

For the kind of studies that we proposed to do, and for experimental conduct in general, a

source of fit infective parasites must be available and easy to maintain, whether retrieving

the promastigote or the amastigote form of the parasite.

The fact that in the insect vector promastigotes grow in an extracellular environment

facilitates the transposition to the in vitro culture. This is one of the major arguments that

make the promastigotes the biological stage of choice in many works with Leishmania

spp. Despite the production of promastigotes in an artificial controlled environment may

seem an easy task, the availability of several culture media offers this process a

magnitude of variables that influence the biological, morphological and immunological

characteristics of the generated parasites [88, 102]. This variability could influence the

existence of some discrepancies on the literature and makes strong conclusions between

similar works difficult. Apart from the animal model, the background and the immune

system of the host, the administration route and the number of parasites inoculated, one

not only has to account for intra-species and intra-strain characteristics that impact on the

end results [103], but also has to consider the influence of the in vitro cultivation on the

infective, secretory or immunomodulatory capacities [30], to name some, of the parasite

that is subject of study.

The influence of the culture media on the biology and infectivity of Leishmania infantum

was evaluated in the first section of the Results. It was shown for the

MHOM/MA/67/ITMAP-263 strain (named ST strain on section two and three of Results)

how the cell cycle, promastigote differentiation stages and, ultimately, infectivity strongly

depend on the culture medium chosen to grow the parasites. If RPMI, SDM and NNN

media proved to be good in producing infective promastigotes, Schneider culture medium

failed on this essential requisite, since procyclic promastigotes predominate in the culture,

translating into low in vitro and in vivo parasite loads. Indeed, logarithmic-phase

promastigotes have been shown to be less infective [104].

DISCUSSION AND CONCLUSIONS

126

Another observation made was that a culture medium that promotes high proliferation is

not indicated for long-term maintenance of Leishmania spp. in vitro cultures, as more

generations occur in short time, which leads to the loss of virulence. In this sense, cRPMI,

the culture medium engineered in this work with the objective of producing infective

promastigotes in a long-term culture without the use of fetal calf serum (or other protein

source), proved to perform the best in maintaining the parasites virulence for longer time.

However, as mentioned, long-time virulent cultures are related with low number of

generations so few parasites can be obtained from this cRPMI medium, making it not the

best choice for the preparation of a high dose inoculum used in infection studies or the

isolation of parasites from biopsies as a diagnosis methodology.

The differences in the infectivity detected for L. infantum cultivated in several culture

media were attributed do the capability of each medium in producing promastigotes in

different stages of development [17, 87] and to the more or less generations that are

produced in the same period of culture, leading to loss of virulence with overtime [30].

DISCUSSION AND CONCLUSIONS

127

On the strain-specific characteristics that lead to differential infectivity and tropism

One of the principal objectives of this thesis was to evaluate the inherent infectivity of L.

infantum strains responsible for cutaneous and visceral leishmaniasis in

immunocompetent and immunocompromised patients. The four L. infantum strains that

are subject of this thesis were isolated from human patients that manifested cutaneous

(CL; HL strain) or visceral leishmaniasis (VL; Bibiano, E390M and ST strains); among the

VL cases, two were from HIV+ patients (Bibiano and E390M). After having understood the

major impact that the culture medium has on L. infantum infective capacity, the

establishment of the culture conditions for the four L. infantum strains was one of the main

focuses. The aim was to find a culture medium where the four strains could grow and

develop from logarithmic to stationary phase promastigotes in similar way so the eventual

differences in the infectivity would resume to inherent characteristics of each strain,

therefore reducing the medium bias. The culture of the four strains in NNN medium

accomplished the objective proposed, as presented in the second section of the Results.

Growth, viability, cell cycle progression and metacyclogenesis within the in vitro culture as

well as infectivity of Bibiano, E390M and HL strain were studied for the very first time

within this thesis; ST was included in the experiments as the standard infective strain in

the laboratory and also as an example of a viscerotropic strain isolated from an

immunocompetent host.

The hallmark characterization in Leishmania epidemiology is the zymodeme analysis.

Bibiano, HL and ST belong to MON-1, the most frequent zymodeme for L. infantum in the

Mediterranean area [100]; E390M was determined to belong to the rare MON-284

zymodeme, so far isolated only from HIV/Leishmania coinfected patients [101].

In the era of molecular tools, molecular typing was performed to further characterize these

strains. The four specimens were clustered in the same ITS type A group and MON-1

strains were further classified in the k26 group 1b. These were the expected results since

those are the most common classifications in the Iberian Peninsula and confirm the MON-

1 characterization by MLEE [105]. However, E390M was determined to belong to a new

k26 group, reported here for the first time, which sequence was made available for the

scientific community by the access number KC576808 in the GenBank, adding new

information concerning the MON-284 zymodeme and k26 analysis. A molecular approach

was also used to create a unique signature that allowed the identification of each strain in

in vitro culture or in vivo infection, or even the detection of mixed infections.

DISCUSSION AND CONCLUSIONS

128

In both in vitro and in vivo models, HL proved to be the more infective strain. When

infecting bone marrow-derived macrophages, HL presented higher number of parasites

per infected cell during the four days that lasted the assay compared to the other strains,

including the laboratory’s standard virulent strain, ST. HL was also able to persist in more

cells over time, leading to the higher infection index.

Using the BALB/c model of VL, along with the differences in infectivity it was also

interesting to analyze the organ tropism of each strain in the onset of the infection (the

acute phase, 2 weeks post-infection) and during chronicity (6 weeks post-infection):

- ST showed an accumulative visceralizing phenotype: in the acute phase it

reached the spleen and liver but targeted specially the bone marrow; however, with time,

the visceral organs revealed to be the safety niche for ST persistence and proliferation,

contrary to the bone marrow where a 5-fold reduction in the parasite load was noticed 6

weeks post-infection.

- HL presented high parasite loads in all the tissues analyzed in the acute phase of

the disease. Over time, a visceral tropism was noticed as the parasite load was reduced in

the peripheral organs, maintained in liver and bone marrow and accumulated in the

spleen (7.5-fold increase). This accession of the parasites to the visceral target organs led

to unchanged parasite numbers in the whole animal from 2 to 6 weeks of infection, which

rendered HL the most infective strain.

- E390M revealed a very low infective capacity with complete inability to resist

inside the mice as, with time, parasites were efficiently eliminated from the spleen (22-fold

reduction), lymph nodes (12-fold reduction) and bone marrow (2-fold reduction). A slight

containment of the parasite load was detected in the liver and, curiously, more parasites

were quantified in the blood in the chronic phase of infection, compared to the acute

phase.

- Bibiano exhibited high infectivity of the visceral organs and bone marrow in the

acute phase of the disease, very similar or even higher than HL, but was unable to

counteract the strong protective response generated in the liver, thus suffering a near

450-fold reduction in this organ 6 weeks post-infection. However, the parasite load in the

spleen and bone marrow maintained the initial levels.

The high parasite load resultant from HL infection led to a massive cellular recruitment to

the spleen, increasing the CD4+ and CD8+ T cells, B cells and macrophages, all

accounting for the splenomegaly observed in HL-infected animals during the chronic

phase of the disease.

DISCUSSION AND CONCLUSIONS

129

Differences in the immunogenicity of the four strains were also perceived. Due to the B

cell proliferation, high titers of anti-Leishmania IgG1 and IgG2a were detected in HL-

infected mice 6 weeks post-infection. However, also E390M revealed some Leishmania-

specific immunogenicity despite the absence of B cell proliferation. This may be related to

k26 protein that is highly immunogenic and, in the scope of the molecular typing done for

E390M, was determined to have more PKEDGHTQKND / PKEDGRTQKN repeats than

the MON-1 strains; these repeats were indeed described as being B cell epitopes [106].

The murine model of visceral leishmaniasis used in this thesis put on evidence the

inherent infectivity of several L. infantum strain and their potential and differential

immunomodulatory capacities. These findings contribute to the general acceptance that

leishmaniasis is a multifactorial disease with the clinical outcome being highly dependent

on the infectivity of the strain and the susceptibility of the host.

DISCUSSION AND CONCLUSIONS

130

On the protective role that a highly infective L. infantum strain display against re-

infection

Leishmania infantum is a magnificent example of a parasite that takes advantage of their

host by modulating the environment on its own benefit. It has “engineered” different ways

of silently entering into the host and installing an infection, most of the time without any

clinical symptoms, allowing the safe transmission to other hosts/reservoirs (when present

in the skin and blood) and, therefore, the perpetuation of the species. This constitutes a

real adversity in the containment of the disease in endemic countries, where L. infantum-

infected asymptomatic people can be as prevalent as 71.3 % (0.6 - 71.3 % depending on

the geographic region and the technique used for detection) and the asymptomatic dog

carriers range from 25 to 80 % [6]. Also in these regions, the concomitant presence of

several species and strains is frequent [107], thus mixed de novo infections or re-

infections are possible.

The preexistence of a Leishmania infection can hence exert important modifications on

what would be the natural course of a primary infection, exacerbating the secondary

disease or leading to some degree of protection. In reverse, the secondary infection may

motivate the clinical manifestation of a primary cryptic infection or promote its progression.

This scenario was explored in this thesis using the HL and ST strains and is discussed in

the third section of the Results. Indeed, infection of BALB/c mice with L. infantum strains

with distinct infectivity and consecutive re-infection (with the same strain) or cross

infection (with a different strain from the imprinting) resulted in different outcomes.

The parasite load quantified in mice who underwent HL imprinting followed by

homologous challenge was decreased (in the liver and bone marrow) or maintained (in

the spleen) compared to the primary infection with HL, indicating a partial protection

against re-infection. This was not the case when repeating the infection and challenge

protocol with ST strain, therefore, no protective role could be assigned to ST against a

secondary infection. This inability was evidenced with cross infections in mice previously

imprinted with either HL or ST strains by the analysis of the parasite loads in the spleen

and liver. HL imprinted mice were less susceptible to a ST secondary infection, whereas

ST imprinted animals suffered disease exacerbation after HL challenge.

Despite the differences in the parasite loads, infiltration in the spleen of inflammatory

neutrophils, macrophages/monocytes and activated dendritic cells (DCs) were similarly

increased in infected and challenged mice with both strains. But, interestingly, only in HL

infected animals CD4+ and CD8+ central memory T cells (TCM) were increased compared

DISCUSSION AND CONCLUSIONS

131

to naïve mice, which is indicative of a HL strain-specific ability to trigger the activation of

the adaptive immune responses. Moreover, re-infection with HL also allowed the

appearance of effector memory T cells (TEM) from CD4+ and CD8+ pools along with the

already expanded TCM.

High levels of IFNγ-producing CD4+ and CD8+ T cells were quantified after infection and

re-infection with HL, probably originated from the TEM subpopulations, which explains the

protection observed against re-infection. Additionally, IL-10-producing CD4+ T cells

increased after challenge, probably to balance IFNγ and TNFα inflammatory potential and

reduce tissue damage. In fact, a CD4+IFNγ+IL-10+ population arose after challenge

possibly in response to the CD8+IFNγ+TNFα+ population. This latter population was also

described in HIV+ patients and presented enhanced cytolytic activity in comparison to

IFNγ-single producers cells [108]. However, cytolysis may not be required for the control

of HL parasites in the spleen, since CD8+ T cells derived from HL-infected mice did not

reveal increased cytotoxicity compared to CD8+ T cells from naïve animals. Or a greater

protection effect is not achieved due to incomplete CD8+ effector functions.

To our knowledge, it was the first time that concomitant immunity was studied in the scope

of live virulent L. infantum infection followed by homologous or heterologous re-infections

with different L. infantum strains. The results obtained contribute to the better

understanding of the complex modulation that Leishmania parasites do to surmount the

protective strategies developed by the host immune system. However, more studies are

required to clarify the intriguing modulation that viscerotropic strains mount to take

advantage of their host, as no clear Th1/Th2 dichotomy on protection/progression of the

disease seems to drive the outcome of leishmaniasis as seen with L. major-infection

animal models and human disease.

DISCUSSION AND CONCLUSIONS

132

Final remarks

With the work performed within this thesis it was concluded that inherent characteristics of

each infective strain are responsible for the tropism and memory generation mechanisms,

two processes that remarkably influence the outcome and progression of leishmaniasis.

A clearer idea on the concept of “virulence” was also developed:

One L. infantum strain is considered more virulent not only because is highly infective (this

is related with the concept of “pathogenicity”) but also because is able to downregulate the

activation signals that would normally fire the innate immune mechanisms and trigger the

adaptive response. A highly virulent strain enters the host silently and reaches the internal

organs where it can multiply, usually due to the induction of Th2 responses or IL-10

secretion [109], leading to a severe form of the disease.

Taking the example of the HL strain, isolated from a cutaneous lesion, it is clear that

dermotropic strains are exuberant in their first contact to the host. However, it is important

to consider that the parasite was delivered by intraperitoneal injection, as a model of VL,

instead of subcutaneous or intradermic inoculation traditionally used in CL models. The

recruitment of inflammatory macrophages/monocytes, neutrophils and DCs to the site of

inoculation (in this case the spleen as the representative of the visceral organs and as a

main organ for the generation of the immune response - but otherwise the skin in natural

infections or CL models) is the alert signal for the implementation of a protective response

that restrains the parasites in the skin, impeding its visceralization. Moreover, there is

evidence that different dermal DCs are involved in the early uptake of L. major and L.

donovani and also that higher numbers of L. donovani-infected DCs and macrophages

migrate to the draining lymph nodes, comparatively to L. major-infected cells, which

condition the visceralization ability of the different species [97].

On the contrary, considering the example of the ST strain, an agent of VL, recruitment of

inflammatory innate cells may happen and will transport the parasites to internal organs.

This allows the viscerotropic strains to gain entry and establish a stable infection in the

spleen and bone marrow.

The susceptibility of the host was another factor that was better understood. Strains like

E390M, with low infectivity and low resistance to elimination may absolutely rely on

immunosuppressed hosts, which lack functional protective mechanisms, to perpetuate.

This can support the contribution of the alternative artificial cycle of anthroponotic

transmission in intravenous drug users (IVDUs) in the maintenance of low virulent strains

DISCUSSION AND CONCLUSIONS

133

and the appearance of rare zymodemes so far detected only in HIV/Leishmania

coinfected patients [110].

All these conclusions could have been biased if an effort on the comprehension of the

dependence of Leishmania infectivity on the in vitro culture conditions would not have

been assessed. It is believed that the establishment of the culture settings that allowed

the generation of similar promastigotes for the four studied strains was a pivotal decision

for the resolution of the proposed objectives.

Finally, for the first time it was evaluated the impact of infection-induced immunity on a

secondary homologous or heterologous infection with L. infantum strains in the murine

model of VL. The highly infective strain showed partial protection against re-infection due

to the expansion of TCM and TEM populations and the production of IFNγ by both CD4+

and CD8+ T cells and double producers CD4+IFNγ+IL-10+ and CD8+IFNγ+TNFα+. No

protection upon virulent challenge was observed if a strain with lower infectivity was used

as imprinting, revealing the need of a virulent infection to generate and maintain

appropriate immunity, in agreement with the findings of Streit et al. [59].

Bibliography

BIBLIOGRAPHY

137

List of references embedded in the Introduction, Objectives and Discussion &

Conclusions

1. David CV, Craft N: Cutaneous and mucocutaneous leishmaniasis. Dermatologic therapy 2009,

22(6):491-502.

2. Kumar R, Nylen S: Immunobiology of visceral leishmaniasis. Frontiers in immunology 2012, 3:251.

3. Hide M, Singh R, Kumar B, Banuls AL, Sundar S: A microculture technique for isolating live

Leishmania parasites from peripheral blood of visceral leishmaniasis patients. Acta tropica 2007,

102(3):197-200.

4. Kaye P, Scott P: Leishmaniasis: complexity at the host-pathogen interface. Nature reviews

Microbiology 2011, 9(8):604-615.

5. Alvar J, Velez ID, Bern C, Herrero M, Desjeux P, Cano J, Jannin J, den Boer M, Team WHOLC:

Leishmaniasis worldwide and global estimates of its incidence. PloS one 2012, 7(5):e35671.

6. Michel G, Pomares C, Ferrua B, Marty P: Importance of worldwide asymptomatic carriers of

Leishmania infantum (L. chagasi) in human. Acta tropica 2011, 119(2-3):69-75.

7. Chappuis F, Sundar S, Hailu A, Ghalib H, Rijal S, Peeling RW, Alvar J, Boelaert M: Visceral

leishmaniasis: what are the needs for diagnosis, treatment and control? Nature reviews

Microbiology 2007, 5(11):873-882.

8. Karunaweera ND: Leishmania donovani causing cutaneous leishmaniasis in Sri Lanka: a wolf in

sheep's clothing? Trends in parasitology 2009, 25(10):458-463.

9. WHO: World Health Organization web page on Leishmaniasis. Burden of the disease. Available at

http://wwwwhoint/leishmaniasis/burden/en/.

10. Ready PD: Leishmaniasis emergence in Europe. Euro surveillance : bulletin europeen sur les

maladies transmissibles = European communicable disease bulletin 2010, 15(10):19505.

11. WHO: Report of the Fifth Consultative Meeting on Leishmania/HIV Co-infection. Addis Ababa,

Ethiopia. World Health Organization 2007:p. 1–38.

12. Alvar J, Aparicio P, Aseffa A, Den Boer M, Canavate C, Dedet JP, Gradoni L, Ter Horst R, Lopez-Velez

R, Moreno J: The relationship between leishmaniasis and AIDS: the second 10 years. Clinical

microbiology reviews 2008, 21(2):334-359, table of contents.

13. WHO: World Health Organization web page on HIV/AIDS. Injecting drug use. Available at

http://wwwwhoint/hiv/topics/idu/about/en/indexhtml.

14. Andreani G, Lodge R, Richard D, Tremblay MJ: Mechanisms of interaction between protozoan

parasites and HIV. Current opinion in HIV and AIDS 2012, 7(3):276-282.

15. Solano-Gallego L, Miro G, Koutinas A, Cardoso L, Pennisi MG, Ferrer L, Bourdeau P, Oliva G, Baneth

G, The LeishVet G: LeishVet guidelines for the practical management of canine leishmaniosis.

Parasites & vectors 2011, 4:86.

BIBLIOGRAPHY

138

16. Dostalova A, Volf P: Leishmania development in sand flies: parasite-vector interactions overview.

Parasites & vectors 2012, 5:276.

17. Rogers M, Chance M, Bates P: The role of promastigote secretory gel in the origin and

transmission of the infective stage of Leishmania mexicana by the sandfly Lutzomyia longipalpis.

Parasitology 2002, 124(05):495-507.

18. Ribeiro-Gomes FL, Sacks D: The influence of early neutrophil-Leishmania interactions on the host

immune response to infection. Frontiers in cellular and infection microbiology 2012, 2:59.

19. Ng LG, Hsu A, Mandell MA, Roediger B, Hoeller C, Mrass P, Iparraguirre A, Cavanagh LL, Triccas JA,

Beverley SM et al: Migratory dermal dendritic cells act as rapid sensors of protozoan parasites.

PLoS pathogens 2008, 4(11):e1000222.

20. Thalhofer CJ, Chen Y, Sudan B, Love-Homan L, Wilson ME: Leukocytes infiltrate the skin and

draining lymph nodes in response to the protozoan Leishmania infantum chagasi. Infection and

immunity 2011, 79(1):108-117.

21. Lodge R, Descoteaux A: Leishmania Invasion and Phagosome Biogenesis. In: Molecular

Mechanisms of Parasite Invasion. Edited by Burleigh B, Soldati-Favre D, vol. 47: Springer New York;

2008: 174-181.

22. Morsy TA, Schnur LF, Feinsod FM, Salem AM, Wahba MM, el Said SM: Natural infections of

Leishmania major in domestic dogs from Alexandria, Egypt. The American journal of tropical

medicine and hygiene 1987, 37(1):49-52.

23. Elbihari S, Cheema AH, el-Hassan AM: Leishmania infecting man and wild animals in Saudi Arabia.

4. Canine cutaneous leishmaniasis in the Eastern Province. Transactions of the Royal Society of

Tropical Medicine and Hygiene 1987, 81(6):925-927.

24. WHO: Control of the leishmaniasis: report of a meeting of the WHO Expert Committee on the

Control of Leishmaniases, Geneva, 22-26 March 2010. World Health Organization technical report

series 2010(949):xii-xiii, 1-186, back cover.

25. Cruz I, Morales MA, Noguer I, Rodriguez A, Alvar J: Leishmania in discarded syringes from

intravenous drug users. Lancet 2002, 359(9312):1124-1125.

26. Alvar J, Canavate C, Gutierrez-Solar B, Jimenez M, Laguna F, Lopez-Velez R, Molina R, Moreno J:

Leishmania and human immunodeficiency virus coinfection: the first 10 years. Clinical

microbiology reviews 1997, 10(2):298-319.

27. Silvestre R, Santarem N, Tavares J, Silva AM, Cordeiro-da-Silva A: Recognition of Leishmania

Parasites by Innate Immunity. Immunology Endocrine & Metabolic Agents - Medicinal Chemistry

(Formerly Current Medicinal Chemistry - Immunology Endocrine & Metabolic Agents) 2009, 9(2):106-

127.

28. van Zandbergen G, Klinger M, Mueller A, Dannenberg S, Gebert A, Solbach W, Laskay T: Cutting

edge: neutrophil granulocyte serves as a vector for Leishmania entry into macrophages. Journal

of immunology 2004, 173(11):6521-6525.

29. Neves BM, Silvestre R, Resende M, Ouaissi A, Cunha J, Tavares J, Loureiro I, Santarem N, Silva AM,

Lopes MC et al: Activation of phosphatidylinositol 3-kinase/Akt and impairment of nuclear factor-

BIBLIOGRAPHY

139

kappaB: molecular mechanisms behind the arrested maturation/activation state of Leishmania

infantum-infected dendritic cells. The American journal of pathology 2010, 177(6):2898-2911.

30. Moreira D, Santarem N, Loureiro I, Tavares J, Silva AM, Amorim AM, Ouaissi A, Cordeiro-da-Silva A,

Silvestre R: Impact of continuous axenic cultivation in Leishmania infantum virulence. PLoS

neglected tropical diseases 2012, 6(1):e1469.

31. Fagundes-Silva GA, Vieira-Goncalves R, Nepomuceno MP, de Souza MA, Favoreto S, Jr., Oliveira-Neto

MP, Da-Cruz AM, Gomes-Silva A: Decrease in anti-Leishmania IgG3 and IgG1 after cutaneous

leishmaniasis lesion healing is correlated with the time of clinical cure. Parasite immunology 2012,

34(10):486-491.

32. Chu N, Thomas BN, Patel SR, Buxbaum LU: IgG1 is pathogenic in Leishmania mexicana infection.

Journal of immunology 2010, 185(11):6939-6946.

33. Oliveira DM, Costa MA, Chavez-Fumagalli MA, Valadares DG, Duarte MC, Costa LE, Martins VT,

Gomes RF, Melo MN, Soto M et al: Evaluation of parasitological and immunological parameters of

Leishmania chagasi infection in BALB/c mice using different doses and routes of inoculation of

parasites. Parasitology research 2012, 110(3):1277-1285.

34. Deak E, Jayakumar A, Cho KW, Goldsmith-Pestana K, Dondji B, Lambris JD, McMahon-Pratt D: Murine

visceral leishmaniasis: IgM and polyclonal B-cell activation lead to disease exacerbation.

European journal of immunology 2010, 40(5):1355-1368.

35. Moreno J, Vouldoukis I, Martin V, McGahie D, Cuisinier AM, Gueguen S: Use of a LiESP/QA-21

vaccine (CaniLeish) stimulates an appropriate Th1-dominated cell-mediated immune response in

dogs. PLoS neglected tropical diseases 2012, 6(6):e1683.

36. Resende M, Moreira D, Augusto J, Cunha J, Neves B, Cruz MT, Estaquier J, Cordeiro-da-Silva A,

Silvestre R: Leishmania-Infected MHC Class IIhigh Dendritic Cells Polarize CD4+ T Cells toward a

Nonprotective T-bet+ IFN-gamma+ IL-10+ Phenotype. Journal of immunology 2013, 191(1):262-273.

37. De Trez C, Brait M, Leo O, Aebischer T, Torrentera FA, Carlier Y, Muraille E: Myd88-dependent in vivo

maturation of splenic dendritic cells induced by Leishmania donovani and other Leishmania

species. Infection and immunity 2004, 72(2):824-832.

38. Liese J, Schleicher U, Bogdan C: The innate immune response against Leishmania parasites.

Immunobiology 2008, 213(3-4):377-387.

39. Tomioka H, Tatano Y, Maw WW, Sano C, Kanehiro Y, Shimizu T: Characteristics of suppressor

macrophages induced by mycobacterial and protozoal infections in relation to alternatively

activated M2 macrophages. Clinical & developmental immunology 2012, 2012:635451.

40. Raes G, Beschin A, Ghassabeh GH, De Baetselier P: Alternatively activated macrophages in

protozoan infections. Current opinion in immunology 2007, 19(4):454-459.

41. Surh CD, Boyman O, Purton JF, Sprent J: Homeostasis of memory T cells. Immunological reviews

2006, 211:154-163.

42. Mueller SN, Gebhardt T, Carbone FR, Heath WR: Memory T Cell Subsets, Migration Patterns, and

Tissue Residence. Annual review of immunology 2012.

BIBLIOGRAPHY

140

43. Sallusto F, Geginat J, Lanzavecchia A: Central memory and effector memory T cell subsets:

function, generation, and maintenance. Annual review of immunology 2004, 22:745-763.

44. Baaten BJ, Tinoco R, Chen AT, Bradley LM: Regulation of Antigen-Experienced T Cells: Lessons

from the Quintessential Memory Marker CD44. Frontiers in immunology 2012, 3:23.

45. Garcia de Tena J, Manzano L, Leal JC, San Antonio E, Sualdea V, Alvarez-Mon M: Distinctive pattern

of cytokine production and adhesion molecule expression in peripheral blood memory CD4+ T

cells from patients with active Crohn's disease. Journal of clinical immunology 2006, 26(3):233-242.

46. Ivetic A: Signals regulating L-selectin-dependent leucocyte adhesion and transmigration. The

international journal of biochemistry & cell biology 2013, 45(3):550-555.

47. Sprent J, Surh CD: T cell memory. Annual review of immunology 2002, 20:551-579.

48. Yang S, Liu F, Wang QJ, Rosenberg SA, Morgan RA: The shedding of CD62L (L-selectin) regulates

the acquisition of lytic activity in human tumor reactive T lymphocytes. PloS one 2011,

6(7):e22560.

49. Zaph C, Uzonna J, Beverley SM, Scott P: Central memory T cells mediate long-term immunity to

Leishmania major in the absence of persistent parasites. Nature medicine 2004, 10(10):1104-1110.

50. Liu D, Uzonna JE: The p110 delta isoform of phosphatidylinositol 3-kinase controls the quality of

secondary anti-Leishmania immunity by regulating expansion and effector function of memory T

cell subsets. Journal of immunology 2010, 184(6):3098-3105.

51. Seder RA, Darrah PA, Roederer M: T-cell quality in memory and protection: implications for

vaccine design. Nature reviews Immunology 2008, 8(4):247-258.

52. Uzonna JE, Wei G, Yurkowski D, Bretscher P: Immune elimination of Leishmania major in mice:

implications for immune memory, vaccination, and reactivation disease. Journal of immunology

2001, 167(12):6967-6974.

53. Belkaid Y, Piccirillo CA, Mendez S, Shevach EM, Sacks DL: CD4+CD25+ regulatory T cells control

Leishmania major persistence and immunity. Nature 2002, 420(6915):502-507.

54. Nadim A, Javadian E, Tahvildar-Bidruni G, Ghorbani M: Effectiveness of leishmanization in the

control of cutaneous leishmaniasis. Bulletin de la Societe de pathologie exotique et de ses filiales

1983, 76(4):377-383.

55. Mendez S, Reckling SK, Piccirillo CA, Sacks D, Belkaid Y: Role for CD4(+) CD25(+) regulatory T cells

in reactivation of persistent leishmaniasis and control of concomitant immunity. The Journal of

experimental medicine 2004, 200(2):201-210.

56. Evans KJ, Kedzierski L: Development of Vaccines against Visceral Leishmaniasis. Journal of tropical

medicine 2012, 2012:892817.

57. Khamesipour A, Dowlati Y, Asilian A, Hashemi-Fesharki R, Javadi A, Noazin S, Modabber F:

Leishmanization: use of an old method for evaluation of candidate vaccines against

leishmaniasis. Vaccine 2005, 23(28):3642-3648.

BIBLIOGRAPHY

141

58. McCall LI, Zhang WW, Ranasinghe S, Matlashewski G: Leishmanization revisited: Immunization with

a naturally attenuated cutaneous Leishmania donovani isolate from Sri Lanka protects against

visceral leishmaniasis. Vaccine 2013, 31(10):1420-1425.

59. Streit JA, Recker TJ, Filho FG, Beverley SM, Wilson ME: Protective immunity against the protozoan

Leishmania chagasi is induced by subclinical cutaneous infection with virulent but not avirulent

organisms. Journal of immunology 2001, 166(3):1921-1929.

60. Zijlstra EE, el-Hassan AM, Ismael A, Ghalib HW: Endemic kala-azar in eastern Sudan: a longitudinal

study on the incidence of clinical and subclinical infection and post-kala-azar dermal

leishmaniasis. The American journal of tropical medicine and hygiene 1994, 51(6):826-836.

61. Giunchetti RC, Correa-Oliveira R, Martins-Filho OA, Teixeira-Carvalho A, Roatt BM, de Oliveira Aguiar-

Soares RD, de Souza JV, das Dores Moreira N, Malaquias LC, Mota e Castro LL et al: Immunogenicity

of a killed Leishmania vaccine with saponin adjuvant in dogs. Vaccine 2007, 25(44):7674-7686.

62. Armijos RX, Weigel MM, Aviles H, Maldonado R, Racines J: Field trial of a vaccine against New

World cutaneous leishmaniasis in an at-risk child population: safety, immunogenicity, and

efficacy during the first 12 months of follow-up. The Journal of infectious diseases 1998,

177(5):1352-1357.

63. Noazin S, Khamesipour A, Moulton LH, Tanner M, Nasseri K, Modabber F, Sharifi I, Khalil EA, Bernal ID,

Antunes CM et al: Efficacy of killed whole-parasite vaccines in the prevention of leishmaniasis: a

meta-analysis. Vaccine 2009, 27(35):4747-4753.

64. Das A, Ali N: Vaccine prospects of killed but metabolically active Leishmania against visceral

leishmaniasis. Expert review of vaccines 2012, 11(7):783-785.

65. Breton M, Tremblay MJ, Ouellette M, Papadopoulou B: Live nonpathogenic parasitic vector as a

candidate vaccine against visceral leishmaniasis. Infection and immunity 2005, 73(10):6372-6382.

66. Papadopoulou B, Roy G, Breton M, Kundig C, Dumas C, Fillion I, Singh AK, Olivier M, Ouellette M:

Reduced infectivity of a Leishmania donovani biopterin transporter genetic mutant and its use as

an attenuated strain for vaccination. Infection and immunity 2002, 70(1):62-68.

67. Selvapandiyan A, Dey R, Nylen S, Duncan R, Sacks D, Nakhasi HL: Intracellular replication-deficient

Leishmania donovani induces long lasting protective immunity against visceral leishmaniasis.

Journal of immunology 2009, 183(3):1813-1820.

68. Dey R, Meneses C, Salotra P, Kamhawi S, Nakhasi HL, Duncan R: Characterization of a Leishmania

stage-specific mitochondrial membrane protein that enhances the activity of cytochrome c

oxidase and its role in virulence. Molecular microbiology 2010, 77(2):399-414.

69. Silvestre R, Cordeiro-Da-Silva A, Santarem N, Vergnes B, Sereno D, Ouaissi A: SIR2-deficient

Leishmania infantum induces a defined IFN-gamma/IL-10 pattern that correlates with protection.

Journal of immunology 2007, 179(5):3161-3170.

70. Mizbani A, Taheri T, Zahedifard F, Taslimi Y, Azizi H, Azadmanesh K, Papadopoulou B, Rafati S:

Recombinant Leishmania tarentolae expressing the A2 virulence gene as a novel candidate

vaccine against visceral leishmaniasis. Vaccine 2009, 28(1):53-62.

BIBLIOGRAPHY

142

71. Selvapandiyan A, Dey R, Gannavaram S, Lakhal-Naouar I, Duncan R, Salotra P, Nakhasi HL: Immunity

to visceral leishmaniasis using genetically defined live-attenuated parasites. Journal of tropical

medicine 2012, 2012:631460.

72. Nagill R, Kaur S: Vaccine candidates for leishmaniasis: a review. International immunopharmacology

2011, 11(10):1464-1488.

73. Coler RN, Skeiky YA, Bernards K, Greeson K, Carter D, Cornellison CD, Modabber F, Campos-Neto A,

Reed SG: Immunization with a polyprotein vaccine consisting of the T-Cell antigens thiol-specific

antioxidant, Leishmania major stress-inducible protein 1, and Leishmania elongation initiation

factor protects against leishmaniasis. Infection and immunity 2002, 70(8):4215-4225.

74. Coler RN, Goto Y, Bogatzki L, Raman V, Reed SG: Leish-111f, a recombinant polyprotein vaccine

that protects against visceral Leishmaniasis by elicitation of CD4+ T cells. Infection and immunity

2007, 75(9):4648-4654.

75. Velez ID, Gilchrist K, Martinez S, Ramirez-Pineda JR, Ashman JA, Alves FP, Coler RN, Bogatzki LY,

Kahn SJ, Beckmann AM et al: Safety and immunogenicity of a defined vaccine for the prevention of

cutaneous leishmaniasis. Vaccine 2009, 28(2):329-337.

76. Trigo J, Abbehusen M, Netto EM, Nakatani M, Pedral-Sampaio G, de Jesus RS, Goto Y, Guderian J,

Howard RF, Reed SG: Treatment of canine visceral leishmaniasis by the vaccine Leish-111f+MPL-

SE. Vaccine 2010, 28(19):3333-3340.

77. Gradoni L, Foglia Manzillo V, Pagano A, Piantedosi D, De Luna R, Gramiccia M, Scalone A, Di Muccio

T, Oliva G: Failure of a multi-subunit recombinant leishmanial vaccine (MML) to protect dogs from

Leishmania infantum infection and to prevent disease progression in infected animals. Vaccine

2005, 23(45):5245-5251.

78. Miret J, Nascimento E, Sampaio W, Franca JC, Fujiwara RT, Vale A, Dias ES, Vieira E, da Costa RT,

Mayrink W et al: Evaluation of an immunochemotherapeutic protocol constituted of N-methyl

meglumine antimoniate (Glucantime) and the recombinant Leish-110f + MPL-SE vaccine to treat

canine visceral leishmaniasis. Vaccine 2008, 26(12):1585-1594.

79. Dantas-Torres F: Leishmune vaccine: the newest tool for prevention and control of canine visceral

leishmaniosis and its potential as a transmission-blocking vaccine. Veterinary parasitology 2006,

141(1-2):1-8.

80. Fernandes AP, Costa MM, Coelho EA, Michalick MS, de Freitas E, Melo MN, Luiz Tafuri W, Resende

Dde M, Hermont V, Abrantes Cde F et al: Protective immunity against challenge with Leishmania

(Leishmania) chagasi in beagle dogs vaccinated with recombinant A2 protein. Vaccine 2008,

26(46):5888-5895.

81. Virbac: CaniLeish® veterinary brochure - Portuguese edition. Available at

http://wwwruminalcomar/sites/default/files/vet%20brochurepdf 2011.

82. Alavi-Naini R, Fazaeli A, O'Dempsey T: Topical treatment modalities for old world cutaneous

leishmaniasis: a review. Prague medical report 2012, 113(2):105-118.

83. Volf P, Volfova V: Establishment and maintenance of sand fly colonies. Journal of vector ecology :

journal of the Society for Vector Ecology 2011, 36 Suppl 1:S1-9.

BIBLIOGRAPHY

143

84. Nicolle C: Culture du parasite du button d'Orient. Comptes Rendus de l'Académie des Sciences 1908,

146:842-843.

85. Schuster FL, Sullivan JJ: Cultivation of clinically significant hemoflagellates. Clinical microbiology

reviews 2002, 15(3):374-389.

86. Chang CS, Chang KP: Heme requirement and acquisition by extracellular and intracellular stages

of Leishmania mexicana amazonensis. Molecular and biochemical parasitology 1985, 16(3):267-276.

87. Gossage SM, Rogers ME, Bates PA: Two separate growth phases during the development of

Leishmania in sand flies: implications for understanding the life cycle. International journal for

parasitology 2003, 33(10):1027-1034.

88. Allahverdiyev AM, Bagirova M, Elcicek S, Koc RC, Oztel ON: Effect of human urine on cell cycle and

infectivity of Leismania species promastigotes in vitro. The American journal of tropical medicine

and hygiene 2011, 85(4):639-643.

89. Gupta N, Goyal N, Rastogi AK: In vitro cultivation and characterization of axenic amastigotes of

Leishmania. Trends in parasitology 2001, 17(3):150-153.

90. Cysne-Finkelstein L, Temporal RM, Alves FA, Leon LL: Leishmania amazonensis: long-term

cultivation of axenic amastigotes is associated to metacyclogenesis of promastigotes.

Experimental parasitology 1998, 89(1):58-62.

91. Pan AA, Duboise SM, Eperon S, Rivas L, Hodgkinson V, Traub-Cseko Y, McMahon-Pratt D:

Developmental life cycle of Leishmania - cultivation and characterization of cultured extracellular

amastigotes. The Journal of eukaryotic microbiology 1993, 40(2):213-223.

92. Pescher P, Blisnick T, Bastin P, Spath GF: Quantitative proteome profiling informs on phenotypic

traits that adapt Leishmania donovani for axenic and intracellular proliferation. Cellular

microbiology 2011, 13(7):978-991.

93. Rochette A, Raymond F, Corbeil J, Ouellette M, Papadopoulou B: Whole-genome comparative RNA

expression profiling of axenic and intracellular amastigote forms of Leishmania infantum.

Molecular and biochemical parasitology 2009, 165(1):32-47.

94. Castanys-Munoz E, Brown E, Coombs GH, Mottram JC: Leishmania mexicana metacaspase is a

negative regulator of amastigote proliferation in mammalian cells. Cell death & disease 2012,

3:e385.

95. Wenzel UA, Bank E, Florian C, Forster S, Zimara N, Steinacker J, Klinger M, Reiling N, Ritter U, van

Zandbergen G: Leishmania major parasite stage-dependent host cell invasion and immune

evasion. FASEB journal : official publication of the Federation of American Societies for Experimental

Biology 2012, 26(1):29-39.

96. Ravinder, Bhaskar, Gangwar S, Goyal N: Development of luciferase expressing Leishmania

donovani axenic amastigotes as primary model for in vitro screening of antileishmanial

compounds. Current microbiology 2012, 65(6):696-700.

97. McCall LI, Zhang WW, Matlashewski G: Determinants for the development of visceral leishmaniasis

disease. PLoS pathogens 2013, 9(1):e1003053.

BIBLIOGRAPHY

144

98. Engwerda CR, Ato M, Kaye PM: Macrophages, pathology and parasite persistence in experimental

visceral leishmaniasis. Trends in parasitology 2004, 20(11):524-530.

99. Lozano R, Naghavi M, Foreman K, Lim S, Shibuya K, Aboyans V, Abraham J, Adair T, Aggarwal R, Ahn

SY et al: Global and regional mortality from 235 causes of death for 20 age groups in 1990 and

2010: a systematic analysis for the Global Burden of Disease Study 2010. Lancet 2012,

380(9859):2095-2128.

100. Pratlong F, Rioux JA, Marty P, Faraut-Gambarelli F, Dereure J, Lanotte G, Dedet JP: Isoenzymatic

analysis of 712 strains of Leishmania infantum in the south of France and relationship of

enzymatic polymorphism to clinical and epidemiological features. Journal of clinical microbiology

2004, 42(9):4077-4082.

101. Chicharro C, Jimenez MI, Alvar J: Iso-enzymatic variability of Leishmania infantum in Spain. Annals

of tropical medicine and parasitology 2003, 97 Suppl 1:57-64.

102. Dey T, Afrin F, Anam K, Ali N: Infectivity and virulence of Leishmania donovani promastigotes: a

role for media, source, and strain of parasite. The Journal of eukaryotic microbiology 2002,

49(4):270-274.

103. Baptista-Fernandes T, Marques C, Roos Rodrigues O, Santos-Gomes GM: Intra-specific variability of

virulence in Leishmania infantum zymodeme MON-1 strains. Comparative immunology, microbiology

and infectious diseases 2007, 30(1):41-53.

104. Alvarez-Rueda N, Biron M, Le Pape P: Infectivity of Leishmania mexicana is associated with

differential expression of protein kinase C-like triggered during a cell-cell contact. PloS one 2009,

4(10):e7581.

105. Kuhls K, Mauricio IL, Pratlong F, Presber W, Schonian G: Analysis of ribosomal DNA internal

transcribed spacer sequences of the Leishmania donovani complex. Microbes and infection /

Institut Pasteur 2005, 7(11-12):1224-1234.

106. Zackay A, Nasereddin A, Takele Y, Tadesse D, Hailu W, Hurissa Z, Yifru S, Weldegebreal T, Diro E,

Kassahun A et al: Polymorphism in the HASPB Repeat Region of East African Leishmania

donovani Strains. PLoS neglected tropical diseases 2013, 7(1):e2031.

107. Talmi-Frank D, Nasereddin A, Schnur LF, Schonian G, Toz SO, Jaffe CL, Baneth G: Detection and

identification of old world Leishmania by high resolution melt analysis. PLoS neglected tropical

diseases 2010, 4(1):e581.

108. Lichterfeld M, Yu XG, Waring MT, Mui SK, Johnston MN, Cohen D, Addo MM, Zaunders J, Alter G, Pae

E et al: HIV-1-specific cytotoxicity is preferentially mediated by a subset of CD8(+) T cells

producing both interferon-gamma and tumor necrosis factor-alpha. Blood 2004, 104(2):487-494.

109. Gradoni L, Gramiccia M: Leishmania infantum tropism: strain genotype or host immune status?

Parasitology today 1994, 10(7):264-267.

110. Cruz I, Nieto J, Moreno J, Canavate C, Desjeux P, Alvar J: Leishmania/HIV co-infections in the

second decade. The Indian journal of medical research 2006, 123(3):357-388.