horse cytokine/igg fusion proteins – mammalian expression ......horse cytokine/igg fusion proteins...
TRANSCRIPT
![Page 1: Horse cytokine/IgG fusion proteins – mammalian expression ......Horse cytokine/IgG fusion proteins – mammalian expression of biologically active cytokines and a system to verify](https://reader033.vdocuments.site/reader033/viewer/2022060802/608630a787e9b975c705c752/html5/thumbnails/1.jpg)
www.elsevier.com/locate/vetimm
Veterinary Immunology and Immunopathology 105 (2005) 1–14
Horse cytokine/IgG fusion proteins – mammalian expression of
biologically active cytokines and a system to verify antibody
specificity to equine cytokines
Bettina Wagnera,*,1, Jennifer Robesona, Megan McCrackena, Eva Wattrangb,Douglas F. Antczaka
aBaker Institute for Animal Health, College of Veterinary Medicine, Cornell University, Hungerford Hill Road, Ithaca, NY 14853, USAbSwedish University of Agricultural Sciences, Section of Veterinary Immunology and Virology,
Department of Molecular Biosciences, 751 23 Uppsala, Sweden
Received 29 January 2004; received in revised form 11 November 2004; accepted 16 November 2004
Abstract
Recombinant cytokines are valuable tools for functional studies and candidates for vaccine additives or therapeutic use in
various diseases. They can also be used to generate specific antibodies to analyze the roles of different cytokines during immune
responses. We generated a mammalian expression system for recombinant cytokines using the equine IgG1 heavy chain constant
region as a tag for detection and purification of the expressed cytokine, demonstrated here using equine interferon-gamma (IFN-
g), interleukin-2 (IL-2), interleukin-4 (IL4) and transforming growth factor-b1 (TGF-b1). The resulting IgG1 fusion proteins
were composed of the C-terminal heavy chain constant region of the IgG1 (IgGa), and the N-terminal cytokine replacing the
immunoglobulin heavy chain variable domain. The fusion proteins were expressed in CHO cells as dimers and their structures
had similarity to that of IgG heavy chain antibodies. In contrast to other tags, the IgG1 heavy chain constant region allowed the
selection for clones secreting high levels of the recombinant protein by a sensitive ELISA. In addition, the IgG1 heavy chain
constant region facilitated identification of stable transfectants by flow cytometry and the secreted recombinant fusion protein by
SDS-PAGE and Western blotting. To recover the cytokine from the IgG1 fusion partner, an enterokinase cleavage site was cloned
between the cytokine gene and the immunoglobulin heavy chain constant region gene. The purification of the fusion protein by
protein G affinity columns, the enterokinase digestion of the cytokine from the IgG1 heavy chain region after or during
purification, and the biological activity of the cytokine within the fusion protein or after its isolation was demonstrated in detail
Abbreviations: CHO cells, Chinese hamster ovary cells; ELAW, equine leukocyte antigen workshop; IGHG1, immunoglobulin heavy chain
gamma 1 constant gene, encoding the IgG1 heavy chain constant region; IFN-g, interferon-gamma; IL-2, interleukin 2; IL-4, interleukin 4;
MDBK cells, Madin-Darby bovine kidney cells; MHC, major histocompatibility complex; PVDF, polyvinylidene difluoride; TGF-b1,
transforming growth factor b1
* Corresponding author. Tel.: +1 607 256 5660; fax: +1 607 256 5608.
E-mail address: [email protected] (B. Wagner).1 Bettina Wagner is on a leave from the Immunology Unit, Hannover School of Veterinary Medicine, Bischofsholer Damm 15, 30173
Hannover, Germany.
0165-2427/$ – see front matter # 2004 Elsevier B.V. All rights reserved.
doi:10.1016/j.vetimm.2004.11.010
![Page 2: Horse cytokine/IgG fusion proteins – mammalian expression ......Horse cytokine/IgG fusion proteins – mammalian expression of biologically active cytokines and a system to verify](https://reader033.vdocuments.site/reader033/viewer/2022060802/608630a787e9b975c705c752/html5/thumbnails/2.jpg)
B. Wagner et al. / Veterinary Immunology and Immunopathology 105 (2005) 1–142
for equine IFN-g/IgG1 by up-regulation of major histocompatibility complex (MHC) class II expression on horse lymphocytes.
Biological activity could also be confirmed for the IL-2 and IL-4/IgG1 fusion proteins. To test the crossreactivity and specificity
of anti-human TGF-b1, and anti-bovine and anti-canine IFN-g antibodies to respective horse cytokines, the four cytokine/IgG1
fusion proteins were successfully used in ELISA, flow cytometry and/or Western blotting. In summary, equine IgG1 fusion
proteins provide a source of recombinant proteins with high structural and functional homology to their native counterparts,
including a convenient system for selection of stable, high expressing transfectants, and a means for monitoring specificity of
antibodies to equine cytokines.
# 2004 Elsevier B.V. All rights reserved.
Keywords: IgG; Fusion protein; Mammalian expression; Recombinant cytokine; Anti-cytokine antibodies; MHC class II; Horse
1. Introduction
During the past decade recombinant equine
cytokines have been generated using expression
systems employing bacteria (Vandergrifft and Hor-
ohov, 1993; Steinbach et al., 2002; Hines et al., 2003),
baculoviruses (McMonagle et al., 2001; Wu et al.,
2002), and mammalian cells (Vandergrifft and
Horohov, 1993; Dohmann et al., 2000; McMonagle
et al., 2001; Cunningham et al., 2003). In general,
bacterial expression results in high expression levels
of the recombinant protein, but it can also result in loss
of biological activity, due to differences in protein
folding and the lack of glycosylation in bacterial cells.
In contrast, mammalian expression provides recom-
binant proteins with a high similarity to native proteins
with regard to their structure and biological functions.
Compared with other expression systems, the dis-
advantage of the mammalian system is the consider-
ably lower amount of recombinant protein produced
(Wagner et al., 2002a). Thus, a mammalian expression
system is often the method of choice, particularly if
only a small amount of the recombinant protein with
high similarity to the native molecule is needed, e.g.
for functional testing or for the generation of
monoclonal antibodies.
However, none of the recombinant cytokines
described above have been purified in sufficient
concentrations from transfectants, and consequently
neither purified equine cytokines nor anti-horse
cytokine antibodies are available thus far. The only
exception is a single anti-equine IFN-g antibody. This
monoclonal antibody was produced using a synthetic
peptide of 40 amino acids, corresponding to the
predicted N-terminus of the mature equine IFN-g as
antigen for immunization (Hines et al., 2003). All
other reagents which have been described as
recognizing selected horse cytokines are crossreactive
antibodies from other species (Theoret et al., 2001;
Pedersen et al., 2002).
Nevertheless, to obtain optimal expression rates in
mammalian cells and to establish stable transfectants,
the screening system is very important for the success
of the procedure. Without a system to identify rare,
high producing clones, many stable mammalian
transfectants tend to produce only low amounts of
the recombinant protein. Many of the currently
available commercial mammalian expression systems
offer various tags which are expressed together with
the recombinant protein for its detection by FACS or
Western blotting. These are adequate systems, but
require higher numbers of cells, and thus testing can
usually only be performed for a limited number of
clones. Faster and more efficient screening systems,
such as a specific ELISA, that enable the screening of
hundreds of cell clones in a short time and at an early
stage of the selection or cloning procedure, increase
the chances to select cell clones for high expression of
the recombinant protein. An ELISA requires anti-
bodies specific for at least two different epitopes of the
recombinant protein. This is not the case for most
cytokines and for many other proteins of immunolo-
gical interest of the horse or many other domestic
animals.
Here, we generated a mammalian system to express
proteins of immunological interest of the horse as
IgG1 fusion proteins. Similar fusion proteins, com-
posed of human IL-2/IgG1 (Landolfi, 1991) or IL-2/
IgG2 (Barouch et al., 2000) were previously expressed
in mammalian cells. The IL-2/IgG fusion protein
mediated the specific effector functions of both the IL-
2 and the IgG molecules in vitro (Landolfi, 1991) and
![Page 3: Horse cytokine/IgG fusion proteins – mammalian expression ......Horse cytokine/IgG fusion proteins – mammalian expression of biologically active cytokines and a system to verify](https://reader033.vdocuments.site/reader033/viewer/2022060802/608630a787e9b975c705c752/html5/thumbnails/3.jpg)
B. Wagner et al. / Veterinary Immunology and Immunopathology 105 (2005) 1–14 3
the construct as well as the protein were used in vivo to
increase the humoral and cellular immune response to
HIV-1 DNA vaccines in monkeys (Barouch et al.,
2000).
The horse cytokine/IgG expression vector con-
tains the gene encoding the equine IgG1 (previously
called IgGa) heavy chain constant region (IGHG1
gene) as a tag used for detection of stable
transfectants secreting high concentrations of the
recombinant fusion proteins. The IgG1 heavy chain
region can further be used for purification by
previously established methods (Sheoran and
Holmes, 1996; Wagner et al., 2003). The cytokine
gene was cloned upstream of the IGHG1 gene, and a
sequence encoding the enterokinase recognition site
(Asp)4-Lys (Anderson et al., 1977) was cloned in
between. The enterokinase cleavage site allowed the
isolation of the cytokine from the IgG1 heavy chain
constant region after expression. The entire recom-
binant protein is a cytokine/IgG1 fusion protein,
composed of two chimeric cytokine-gamma 1 heavy
chains. Here, the equine IFN-g, IL-2, IL-4 and TGF-
b1 cDNA sequences were used for expression
together with the IgG1 heavy chain constant region
gene.
2. Materials and methods
2.1. Polymerase chain reaction (PCR)
The cDNAs of the equine IGHG1 (AJ300675),
IFN-g (U04050), IL-2 (X69393), IL-4 (AF305617)
and TGF-b1 (X99438) genes were cloned previously
(Vandergrifft and Horohov, 1993; Grunig et al., 1994;
Penha-Goncalves et al., 1997; Dohmann et al., 2000;
Wagner et al., 2002b). The equine IL-2 and IL-4 genes
were kindly provided by Dr. D.W. Horohov, and the
TFG-b1 gene was generously given by Dr. L.
Nicolson. All genes were amplified from plasmids
by PCR using Pfu DNA polymerase (Stratagene, La
Jolla, CA, USA) as previously described (Wagner
et al., 2001). The primers contained appropriate
restriction sites (underlined) for later cloning steps
(Fig. 1).
IFN-g (forward, XhoI) – 50 GCGCGCTCGAGATGA-
ATTATACAAGTTTTATCTTGGC 30;
IFN-g (reverse, BamHI) – 50 CGCGGATCCAGTTG-
CAACGCTCTCCGGCCTCG 30;IL-2 (forward, NotI) – 50 CCGCGGCCGCATGTA-
CAAGATGCAACTCTTGG 30
IL-2 (reverse, BamHI) – 50 CCGGATCCAGAGTCAT-
TGTTGAGAAGATGCT 30
IL-4 (forward, NotI) – 50 GCGGCCGCATGGGTCT-
CACCTACCAACTG 30;IL-4 (reverse, BamHI) – 50 CCGGATCCAGACACT-
TGGAGTATTTCTCTTTC 30;TGF-b1 (forward, NheI) – 50 GCCGGCTAGCAATG-
CCGCCCTCCGGCCTGCGG 30;TGF-b1 (reverse, BamHI) – 50 CGCGGATCCAGGC-
TGCACTTGCAGGAGCGCACG 30;IGHG1 (forward) – 50 GACGATGACGATAAGGC-
CTCCACCACCGCCCCGAAG 30;and IGHG1 (reverse, HindIII) – 50 CGCAAGCTT-
CATTTACCCGGGTTCTTGG 30.
The IGHG1 PCR product was used as template in
an additional amplification reaction with the IGHG1
reverse and IGHG1 (forward 2, BamHI) – 50 CCG-
GATCCGGATCTGTACGACGATGACGATAAG 30
primers, creating a cDNA sequence that encoded
the equine IgG1 heavy chain constant region and the
enterokinase cleavage site (Asp)4-Lys (Anderson et-
al., 1977) at its N-terminal end. All PCR products were
cloned into the pCR4 TopoBlunt vector (Invitrogen,
Carlsbad, CA, USA) and controlled by nucleotide
sequencing using an ABI automatic sequencer at the
BioResource Center, Cornell University.
2.2. Cloning into the mammalian expression vector
and transfection
The mammalian expression vector pcDNA3.1
(Invitrogen, Carlsbad, CA, USA) was used for
sequential cloning of the amplified equine IGHG1
and in a second cloning step for the cytokine genes
using the incorporated restriction sites. The 1170 bp
TGF-b1 cDNA contained an additional BamHI site at
position 929. The TGF-b1 cDNA was isolated from
the pCR4 plasmid by partial digestion using sub-
optimal restriction enzyme concentrations and only
the 1170 bp complete TGF-b1 fragment was purified
and used for cloning.
For stable transfection, a total of 12 mg DNA of
the pcDNA-IFN-g/IGHG1 expression vector was
![Page 4: Horse cytokine/IgG fusion proteins – mammalian expression ......Horse cytokine/IgG fusion proteins – mammalian expression of biologically active cytokines and a system to verify](https://reader033.vdocuments.site/reader033/viewer/2022060802/608630a787e9b975c705c752/html5/thumbnails/4.jpg)
B. Wagner et al. / Veterinary Immunology and Immunopathology 105 (2005) 1–144
Fig. 1. Cloning site of the mammalian expression vector for equine IgG1 fusion proteins and model of the recombinant fusion protein dimer. The
expression vector (pcDNA-IGHG1) contains the equine IGHG1 gene including the coding sequence of the enterokinase cleavage site at the 50
end, and a multiple cloning site upstream of the BamHI site. Instead of XhoI, other restriction sites like NotI or NheI were used together with
BamHI for cloning of the equine IL-2, IL-4 or TGF-b1 genes (not shown). The example in this figure shows the cloning of the equine IFN-g gene
into the expression vector. The pcDNA-IFN-g/IGHG1 construct encodes single chains, which form dimers resulting in the IFN-g/IgG1 fusion
protein. BGHpA = bovine growth hormone polyadenylation signal; CH1, CH2, CH3 = heavy chain constant gene exons; CMV = cytomega-
lovirus; H = hinge exon; IGHG1 = immunoglobulin heavy chain constant gene encoding the IgG1 heavy chain constant region; L = leader
sequence; T7 = T7 primer site.
linearized with PvuI and purified by phenol extraction
and ethanol precipitation (Sambrook et al., 1989). The
transfection of Chinese hamster ovary (CHO) cells
was performed using Geneporter II transfection
reagent (Gene Therapy Systems, San Diego, CA,
USA). The following day, the expression of the IgG1
fusion protein was detected in the cells and cell culture
supernatant by flow cytometry and ELISA, respec-
tively (see below). The transfected CHO cells were
subsequently plated into 96-well plates using 100
cells/well in F12 medium (Invitrogen, Carlsbad, CA,
USA), containing 10% (v/v) FCS (Hyclone, Logan,
UT, USA), 50 mg/ml gentamycin, and 1.5 mg/ml
geneticin (G418) (both from: Invitrogen, Carlsbad,
CA, USA). After G418 selection, clones were selected
for highest secretion of the fusion protein by ELISA
![Page 5: Horse cytokine/IgG fusion proteins – mammalian expression ......Horse cytokine/IgG fusion proteins – mammalian expression of biologically active cytokines and a system to verify](https://reader033.vdocuments.site/reader033/viewer/2022060802/608630a787e9b975c705c752/html5/thumbnails/5.jpg)
B. Wagner et al. / Veterinary Immunology and Immunopathology 105 (2005) 1–14 5
and cloned by limiting dilution until the entire cell
population expressed the fusion protein as measured
by intracellular staining. To collect serum free
supernatants, stable transfectants were grown until
they were 70–80% confluent. Then the cells were
washed with F12 medium without FCS and main-
tained for 2 days in F12 medium with 50 mg/ml
gentamycin.
2.3. ELISA
The ELISA to detect the IgG1 fusion protein was
described previously for measuring equine IgG1 in
serum or heterohybridoma supernatants (Wagner
et al., 1998). The lower limit of sensitivity of this
assay was determined to be about 8 ng/ml of IgG1.
Briefly, a goat anti-horse IgG(H + L) antibody
(Jackson Immuno-Research Lab., West Grove, PA,
USA) was used to coat the plates (Immunoplate
Maxisorp, Nalge Nunc Int., Rochester, NY, USA). The
coated antibodies bound the equine IgG1 heavy chains
in the supernatants of IgG1 fusion protein transfec-
tants, which were detected in the next steps by the
monoclonal antibody CVS45 (kindly provided by Drs.
M.A. Holmes and D.P. Lunn). The CVS45 antibody is
specific for IgG1 (IgGa) (Sheoran et al., 1998) and a
secondary peroxidase conjugated goat anti-mouse
IgG(H + L) antibody (Jackson ImmunoResearch Lab.,
West Grove, PA, USA) was used for its detection.
Equine IgG1, purified from horse serum using a
protein G affinity column, was used as a standard to
determine the IgG1 fusion protein concentration. All
buffers and substrate solutions were the same as
described before in detail (Wagner et al., 2003).
To detect the cytokine within the IgG1 fusion
protein, three different crossreactive antibodies were
tested: (1) monoclonal mouse anti-bovine IFN-g
(MCA1783, Serotec Inc., Raleigh, NC, USA); (2)
biotinylated polyclonal goat anti-canine IFN-g
(BAF781, R&D Systems, Minneapolis, MN,
USA); and (3) biotinylated polyclonal chicken
anti-human TGF-b1 (BAF240, R&D Systems,
Minneapolis, MN, USA). The monoclonal anti-
bovine IFN-g antibody (1) was used to coat the
ELISA plates in a concentration of 4 mg/ml. After
incubating the plate with the IgG1 fusion protein
supernatants, detection was performed using a
peroxidase conjugated goat anti-horse IgG(H + L)
antibody (Jackson ImmunoResearch Lab., West
Grove, PA, USA). The biotinylated polyclonal
antibodies (2 and 3) were used as detection
antibodies instead of CVS45 in the ELISA described
above. After incubation of the biotinylated antibody,
peroxidase conjugated streptavidin (Jackson Immu-
noResearch Lab., West Grove, PA, USA) was added
to the plates, followed by substrate solution.
2.4. Intracellular staining and flow cytometric
analysis
Transfected and control CHO cells were harvested
from tissue culture plates using 0.05% Trypsin,
0.53 mM EDTA (Invitrogen, Carlsbad, CA, USA)
and fixed in 2% (v/v) formaldehyde. Intracellular
staining was performed in saponin buffer (PBS,
supplemented with 0.5% (w/v) BSA, 0.5% (w/v)
saponin and 0.02% (w/v) NaN3) using the monoclonal
antibodies CVS45 detecting horse IgG1 or FITC
conjugated anti-bovine IFN-g (Serotec Inc., Raleigh,
NC, USA), which has been demonstrated previously
to recognize intracellular equine IFN-g by flow
cytometric analysis (Pedersen et al., 2002). The
monoclonal CVS45 antibody was detected by Cy5
conjugated goat anti-mouse IgH(H + L) (Jackson
ImmunoResearch Lab., West Grove, PA, USA). Flow
cytometry was carried out using a FACS CaliburTM
(Becton Dickinson, San Jose, CA).
2.5. Protein G purification and enterokinase
digestion
The IgG1 fusion protein was purified from serum
free cell culture supernatant using protein G columns as
described before for IgG1 (IgGa) from horse serum
(Sheoran and Holmes, 1996; Wagner et al., 2003). The
IFN-g was cleaved from the IgG1 heavy chain using
Enterokinase MaxTM (Invitrogen, Carlsbad, CA, USA)
following the manufacturer’s instructions. The digestion
was performed either after fusion protein elution or on
the protein G column. For the latter step, the column
containing the fusion protein was washed with PBS and
equilibrated with enterokinase buffer. Then, enteroki-
nase solution was applied to the column and incubated
over night at room temperature with slow rotation. The
following day, the isolated IFN-g was eluted with PBS.
Afterwards, the column was washed with additional
![Page 6: Horse cytokine/IgG fusion proteins – mammalian expression ......Horse cytokine/IgG fusion proteins – mammalian expression of biologically active cytokines and a system to verify](https://reader033.vdocuments.site/reader033/viewer/2022060802/608630a787e9b975c705c752/html5/thumbnails/6.jpg)
B. Wagner et al. / Veterinary Immunology and Immunopathology 105 (2005) 1–146
PBS and the IgG1 constant heavy chain fragments were
recovered by a pH 3 elution step. The pH 3 eluate was
immediately neutralized using a 1 M Tris, pH 8 solution.
2.6. SDS-PAGE and Western blotting
SDS-PAGE, Western blotting and immunoblotting
were performed as described (Wagner et al., 1995). In
brief, the samples were separated in 7.5% polyacry-
lamide gels or in 4–15% Tris–HCl gradient gels
(BioRad Laboratories, Hercules, CA, USA) under non-
reducing conditions. Gels were either stained with
Coomassie Brilliant Blue or proteins were transferred
by Western blotting. After the transfer and a blocking
step using 5% (w/v) non-fat dry milk, the blotting
membranes (PVDF, BioRad Laboratories, Hercules,
CA, USA) were incubated with the peroxidase
conjugated goat anti-horse IgG(H + L) antibody.
Membranes were washed three times with PBS
containing 0.05% (v/v) Tween 20, and antibody
binding was visualized by the ECL chemiluminescence
method (Amersham Bioscience, Piscataway, NJ, USA).
2.7. Interferon antiviral bioassay
Antiviral interferon activity was detected by
inhibition of vesicular stomatitis virus cytopathic
effect on Madin-Darby bovine kidney (MDBK) cells
performed as previously described for equine type I
interferons (Jensen-Waern et al., 1998; Wattrang et al.,
2003). This assay has also been validated for detection
of equine IFN-g antiviral activity (Nicolson et al.,
2001). Different preparations of recombinant equine
IFN-g were titrated by two-fold dilutions in the assay
and the interferon content in each sample was
calculated by defining 1 unit interferon as the amount
protecting 50% of the cells in one well from lysis.
Laboratory standards of equine leukocyte interferon
(Jensen-Waern et al., 1998) and human IFN-a were
included on every test plate to calibrate the assay.
2.8. MHC class II up-regulation on equine
lymphocytes
Six thoroughbred horses homozygous for the
equine MHC ELA-A2 haplotype were chosen from
the Baker Institute’s herd of horses selectively bred for
MHC haplotypes. The lymphocytes of these horses
were tested beforehand and chosen to give comparable
mean fluorescence intensities and percentages of
MHC class II expression using the anti-equine MHC
class II monoclonal antibody WS48 (Barbis et al.,
1994), which was renamed as WS43 at the 2nd equine
leukocyte antigen workshop (ELAW, Lunn et al.,
1998). PBMC were isolated from heparinized horse
blood by Ficoll-PaqueTM Plus gradients (Amersham
Bioscience, Piscataway, NJ, USA). A total of 5 � 106
PMBC were cultured overnight in 6 well/plates and
F12 medium containing 10% (v/v) FCS, 1% (v/v) non-
essential amino acids, 2 mM L-glutamine, 50 mM 2-
mercaptoethanol, 50 mg/ml gentamycin and different
concentrations of the IFN-g/IgG1 fusion protein
supernatant, IL-2/IgG1 fusion protein supernatant or
the purified recombinant IFN-g described here. The
cells were harvested the next day and stained for
surface MHC class II expression in PBS containing
0.5% (w/v) BSA and 0.02% (w/v) NaN3. Mouse IgG1
was used for the isotype control and detection was
performed with a secondary Cy5 conjugated goat anti-
mouse IgG(H + L) antibody. The mean fluorescence
intensity of MHC class II expression was measured by
flow cytometry.
3. Results
3.1. Expression system for equine IgG1 fusion
proteins
A new construct was generated for expression of
equine cytokines in mammalian cells, using the
immunoglobulin heavy chain gamma 1 constant
(IGHG1) gene of the horse as a tag. The IGHG1
gene encodes the equine IgG1 constant heavy chain
region, which is also known as IgGa. The multiple
cloning site of the pcDNA3.1 expression vector allows
the incorporation of any cytokine gene, including its
leader sequence, upstream of the IGHG1 gene (Fig. 1).
In between, a sequence was incorporated encoding an
enterokinase digestion site (Asp)4-Lys that enables the
cleavage of the cytokine from the IgG1 heavy chain
constant region after purification. The expected
recombinant protein was a modified IgG1 heavy
chain, composed of the N-terminal cytokine and the
CH1 to CH3 domains of the IgG1 heavy chain at the
C-terminal end. Due to the dimerization that occurs
![Page 7: Horse cytokine/IgG fusion proteins – mammalian expression ......Horse cytokine/IgG fusion proteins – mammalian expression of biologically active cytokines and a system to verify](https://reader033.vdocuments.site/reader033/viewer/2022060802/608630a787e9b975c705c752/html5/thumbnails/7.jpg)
B. Wagner et al. / Veterinary Immunology and Immunopathology 105 (2005) 1–14 7
between cysteine residues of the IgG1 hinge regions, it
was suggested that the secreted fusion protein would
have structural similarity to an IgG1 heavy chain
antibody (Fig. 1), with the cytokine replacing the
variable immunoglobulin heavy chain domains. It was
further anticipated that the recombinant IgG1 fusion
protein could be detected in the ELISA for horse IgG1
(Wagner et al., 1998) or purified by protein A or
protein G affinity chromatography (Sheoran and
Holmes, 1996; Wagner et al., 2003).
3.2. Generation of stable cell lines expressing IgG1
fusion proteins
To determine the properties of cytokine/IgG1
fusion proteins, the equine IFN-g, IL-2, IL-4 and
TGF-b1 genes were cloned separately into the
pcDNA-IGHG1 expression vector upstream of the
equine IGHG1 gene (Fig. 1). CHO cells were
Fig. 2. Flow cytometric analysis of intracellular IFN-g/IgG1 fusion protein
the monoclonal antibody CVS45, for IFN-g using a monoclonal anti-bovin
on the axes of the plots. (A) CHO cells 24 h after transfection stained for IgG
for analysis; (2–4) cells transfected using no construct (mock), the pcDNA
the pcDNA-IFN-g/IGHG1 vector encoding the IFN-g/IgG1 fusion protein;
IGHG1 construct, which were double stained 24 h after transfection with an
IgG1 in stable transfectants after G418 selection and limiting dilution cl
expressing IL-4/IgG1.
transfected with these constructs to generate stable
transfectants expressing IFN-g/IgG1, IL-2/IgG1,
IL-4/IgG1 or TGF-b1/IgG1, respectively. The IgG1
fusion proteins were detected in the cytoplasm of
the transfectants using antibodies specific for horse
IgG1 and flow cytometric analysis. Twenty-four hours
after transfection, intracellular IgG1 heavy chain
expression was compared for the pcDNA-IFN-g/
IGHG1 construct and the pcDNA-IGHG1 cassette
vector, containing the IGHG1 gene, but no cytokine
gene and consequently no leader sequence (Fig. 2A
(1–4)). Compared with the mock control the cassette
vector resulted in a detectable expression of the IgG1
heavy chain, characterized by a low fluorescence
intensity (<10). This indicated the expression of a few
copies of the IgG1 heavy chain induced by the
cytomegalovirus promoter even in the absence of the
cytokine gene. The cloning of the IFN-g gene
upstream of the IGHG1 gene (pcDNA-IFN-g/IGHG1)
expression. Permeabilized transfectants were stained for IgG1 using
e IFN-g antibody, or double stained with both antibodies, as marked
1: (1) cell morphology and gate R1, showing the cell population used
-IGHG1 vector containing the IGHG1 gene but no cytokine gene, or
(5) CHO cells from a different transfection using the pcDNA-IFN-g/
ti-IFN-g and anti-IgG1 antibodies. (B) Double staining for IFN-g and
oning: (6) mock control, (7) IFN-g/IgG1 or (8) stable transfectant
![Page 8: Horse cytokine/IgG fusion proteins – mammalian expression ......Horse cytokine/IgG fusion proteins – mammalian expression of biologically active cytokines and a system to verify](https://reader033.vdocuments.site/reader033/viewer/2022060802/608630a787e9b975c705c752/html5/thumbnails/8.jpg)
B. Wagner et al. / Veterinary Immunology and Immunopathology 105 (2005) 1–148
Fig. 3. ELISA to detect IgG1 fusion proteins in the cell culture
supernatant from CHO cells transfected using different cytokine/
IGHG1 expression constructs. In the ELISA, the IgG1 heavy chain
constant region of the fusion protein is detected by the use of two
different antibodies recognizing equine IgG1 (white bars). To detect
the IFN-g within the fusion protein, the ELISA was modified using
an anti-bovine IFN-g antibody for coating and a polyclonal goat
anti-horse IgG antibody for detection (light grey bars), or goat anti-
horse IgG for coating and an anti-canine antibody for detection (dark
grey bars). In an additional test, an anti-human TGF-b1 antibody
was used for detection (striped bars). All the different cytokine/IgG1
fusion proteins were tested in the ELISA using the three cross-
reactive anti-cytokine antibodies, which recognized their specific
cytokine only. Bars represent mean � S.D. from three different
experiments.
resulted in 30–50% of cells with high expression of
IgG1 after transfection. The mean fluorescence
intensity of the population expressing the IgG1 heavy
chain was distinctly increased about 100-fold com-
pared with transfections with the pcDNA-IGHG1
cassette vector. To detect IFN-g expression, double
staining for IgG1 and IFN-g was performed 24 h after
transfection with pcDNA-IFN-g/IGHG1. All cells
which expressed the IgG1 heavy chain also expressed
IFN-g (Fig. 2A (5)).
The cells shown in Fig. 2A (4) were selected in
medium with the antibiotic G418 and cloned by
limiting dilution until all cells expressed the IgG1
fusion protein. This was performed by selecting the
clones for highest IgG1 secretion by ELISA (see
below) and in addition, by intracellular staining. As
shown in Fig. 2B (6–8) for IFN-g/IgG1 and IL-4/IgG1,
stable transfectants were obtained that way expressing
high levels of equine IgG1. For the IFN-g/IgG1
transfectant, double staining for IgG1 and IFN-g was
performed and indicated the homogenous expression
of both IgG1 and IFN-g in all cells (Fig. 2B (7)). Other
cytokine/IgG1 fusion proteins (IL-4/IgG1, IL-2/IgG1
and TGF-b1/IgG1) were expressed using the same
expression system and procedure. The stable trans-
fectant expressing IL-4/IgG1 contained identical IgG1
heavy chain constant regions and differed only in the
N-terminal cytokine. The IL-4/IgG1 transfectant
showed a comparable high intracellular IgG1 produc-
tion, but no IFN-g was detected, confirming the
specificity of the anti-bovine IFN-g antibody for
equine IFN-g (Fig. 2B (8)).
3.3. Selection of high producing clones and the
identification of crossreactive anti-cytokine
antibodies by ELISA
During the entire selection and cloning procedure
of transfectants producing the four cytokine/IgG1
fusion proteins, the secreted IgG1 was detected in cell
culture supernatants by ELISA. In particular, the
ELISA was used to identify high IgG1 producers
(Fig. 3 – white bars). The concentration of the IgG1
fusion proteins in the cell culture supernatants of
stable transfectants was around 500 ng/ml, as deter-
mined by comparison to purified equine IgG1. Using
the anti-bovine and anti-canine IFN-g antibodies in
the ELISA, only the IFN-g/IgG1 was detected, and
none of the other cytokine/IgG1 fusion proteins (Fig. 3 –
grey bars). In another experiment a biotinylated chicken
anti-human TGF-b1 antibody was used for detection of
the IgG1 fusion proteins. This antibody detected the
TGF-b1/IgG1, only (Fig. 3 – striped bars).
3.4. Purification of the IgG1 fusion protein and
enterokinase digestion to isolate the cytokine
The IFN-g/IgG1 secreting cell line was cultured in
serum free medium and a protein G affinity column
was used to purify the IFN-g/IgG1 fusion protein
from the cell culture supernatant. After purification,
the fusion protein was digested over night with
enterokinase or incubated in enterokinase buffer for
control. The samples were separated in a 7.5% SDS
polyacrylamide gel under non-reducing conditions
and blotted. The immunoblots, which were detected
with a polyclonal goat anti-horse IgG(H + L) anti-
body, indicated a distinct reduction of the relative
molecular mass of the fusion protein from around 120
to 90 kDa after enterokinase digestion (Fig. 4A). This
corresponded to the calculated molecular masses of
the IFN-g/IgG1 fusion protein, the IgG1 heavy chain
![Page 9: Horse cytokine/IgG fusion proteins – mammalian expression ......Horse cytokine/IgG fusion proteins – mammalian expression of biologically active cytokines and a system to verify](https://reader033.vdocuments.site/reader033/viewer/2022060802/608630a787e9b975c705c752/html5/thumbnails/9.jpg)
B. Wagner et al. / Veterinary Immunology and Immunopathology 105 (2005) 1–14 9
Fig. 4. SDS-PAGE and Western blotting of the purified IFN-g/IgG1 fusion protein. All samples were run in SDS gels under non-reducing
conditions. (A) The IFN-g/IgG1 fusion protein was purified by protein G affinity chromatography and digested with or without enterokinase
(EK). The samples were separated on a 7.5% SDS gel, transferred to a PVDF-membrane, and detected with a polyclonal goat anti-horse
IgG(H + L) antibody. (B) Enterokinase digestion was performed on the protein G column and different fractions were separated on 4–15%
gradient gels: lane 1 = IFN-g/IgG1 fusion protein before enterokinase digestion; lanes 2 and 3 show the IFN-g/IgG1 fragments after enterokinase
digestion; 2 = PBS eluate after enterokinase digestion; 3 = pH 3.0 eluate after enterokinase digestion. (Left panel) The gel was stained by
Coomassie Brilliant Blue. (Middle panel) Samples from an identical gel were transferred by Western blotting and the membranes were incubated
with the anti-horse IgG(H + L) antibody. (Right panel) The blot was incubated with anti-canine IFN-g.
constant region dimer and the IFN-g monomer of
109.3, 74.1 and 17.6 kDa, respectively. The molecular
masses were calculated according to the predicted
amino acid sequences without taking into considera-
tion any glycosylation of the molecules. The equine
IFN-g and the IgG1 heavy chain constant region have
two N-glycosylation sites, each (Grunig et al., 1994;
Wagner et al., 2002b). We suggest that the increase in
the relative molecular masses, which were observed in
SDS-PAGE of the IFN-g/IgG1 fusion protein or its
fragments after enterokinase digestion, was due to
glycosylation at these sites.
Alternatively to the cleavage after purification, the
fusion protein was digested with enterokinase directly
on the protein G column. After digestion the IFN-g
was eluted with PBS. This procedure allows a very
careful elution of the pure cytokine and avoids
structural modifications of the cytokine during
purification. The IgG1 heavy chain constant region
was still bound on the column and required an
additional elution step at pH 3 (Fig. 4B, left panel).
The purified equine IFN-g appeared on the SDS gel
with a relative molecular mass of approximately
24 kDa (Fig. 4B, lane 2). The goat anti-horse
IgG(H + L) antibody recognized the IFN-g/IgG1
fusion protein and the IgG1 heavy chain constant
region dimer, but not the purified IFN-g (Fig. 4B,
middle panel). In addition, the anti-bovine and anti-
canine IFN-g antibodies were used for immunoblot-
ting to detect the purified IFN-g under non-reducing
conditions. The anti-bovine IFN-g antibody, which
detected the fusion protein in the flow cytometric
analysis and in ELISA, did not recognize the purified
IFN-g on the immunblot. This suggested that the
conformational changes occurring during SDS-treat-
ment and denaturation of the SDS-PAGE procedure
modified the specific epitope recognized by the anti-
bovine IFN-g antibody in a way that inhibited its
detection by this method. By contrast, the anti-canine
IFN-g antibody, detecting the IFN-g/IgG1 fusion
protein by ELISA but not in the flow cytometic
analysis, recognized the purified IFN-g by immuno-
blotting (Fig. 4B, right panel). The results using the
crossreactive antibodies to detect the equine cytokines
by the various methods are summarized in Table 1.
3.5. Antiviral activity of IFN-g/IgG1
The recombinant equine IFN-g/IgG1 was tested for
antiviral activity in a virus cytopathic effect inhibition
bioassay. Using this assay, cell culture supernatants
containing recombinant equine IFN-g/IgG1 fusion
protein consistently displayed antiviral activity of 2–4
units interferon per milliliters. According to the
concentration of the fusion protein in the different
supernatants this equalled an antiviral activity of 6
![Page 10: Horse cytokine/IgG fusion proteins – mammalian expression ......Horse cytokine/IgG fusion proteins – mammalian expression of biologically active cytokines and a system to verify](https://reader033.vdocuments.site/reader033/viewer/2022060802/608630a787e9b975c705c752/html5/thumbnails/10.jpg)
B. Wagner et al. / Veterinary Immunology and Immunopathology 105 (2005) 1–1410
Table 1
Comparison of anti-equine IgG1 (CVS45) and of anti-cytokine antibodies with crossreactivity to horse cytokines to detect the corresponding
IgG1 fusion proteins using different methods
Antibodya Antibody isotype Flow cytometry ELISA SDS-PAGE and immunoblot
Anti-equine IgG1 Murine IgG1 + + +
Anti-bovine IFN-g Murine IgG1 + + �Anti-canine IFN-g Polyclonal goat IgG � + +
Anti-human TGF-b1 Polyclonal chicken IgY (+) weak + n.t.b
a See Section 2 for full description of the antibodies.b n.t.: not tested.
units per micrograms recombinant IFN-g/IgG1.
Control supernatants containing other recombinant
equine cytokine fusion proteins, i.e. equine IL-2/IgG1
and equine IL-4/IgG1, did not display any antiviral
activity (data not shown).
3.6. IFN-g induced up-regulation of MHC class II
expression on equine lymphocytes
Equine MHC class II antigens have been shown to
be expressed on both B- and T-lymphocytes (Crepaldi
et al., 1986), although the level of expression has been
shown to vary by MHC haplotypes (Barbis et al.,
1994). To minimize this variation we used PBMC
from six related horses of defined MHC haplotypes to
test the biological activity of the IFN-g/IgG1 fusion
protein to up-regulate MHC class II surface expres-
sion. The mean fluorescence intensity of MHC class II
expression was compared with that of equine
lymphocytes after over night cultivation in the
presence of IFN-g/IgG1, IL-2/IgG1 or cell culture
medium alone (Fig. 5A and B). MHC class II antigens
were significantly up-regulated after incubation with
the IFN-g/IgG1 fusion protein, as compared with the
medium (p = 0.0066) or IL-2/IgG1 (p = 0.0005)
controls. No significant difference in MHC class II
expression was found between medium and IL-2/IgG1
treatments (p = 0.2).
The activities of the IFN-g/IgG1 fusion protein and
the purified IFN-g to up-regulate MHC class II
expression were compared in an additional experiment
using PBMC of four horses (Fig. 5C). The purified
IFN-g was concentrated during the protein G
purification and enterokinase digestion procedure by
about 200-fold compared with the IFN-g/IgG1
supernatant, without consideration of any loss of
protein during the operations. Thus, the purified IFN-g
was used in a 200-fold higher dilution (1:6000) to
induce MHC class II expression than the IFN-g/IgG1
supernatant (1:30). Again in this experiment, the
lymphocytes of the medium control expressed
significantly lower amounts of MHC class II antigens
on their surface compared to the cells stimulated with
IFN-g/IgG1 (p = 0.0092) or purified IFN-g
(p = 0.0062), but no significant difference was found
between the IFN-g/IgG1 fusion protein and the
purified IFN-g (p = 0.45). This suggested that the
biological activity of the IFN-g was not inhibited by
its conjugation to the immunoglobulin heavy chain
constant region and that the recombinant IFN-g was
able to form functional dimers even within the IgG1
fusion protein.
Bioassays using the supernatants of IL-2/IgG1 and
IL-4/IgG1 were performed as previously described
and compared with transiently expressed myc-tagged
IL-2 and IL-4 (Dohmann et al., 2000). The IgG1
fusion protein and the corresponding myc-tagged
cytokine showed a comparable biological activity,
regarding their stimulatory effects on proliferation of
mitogen prestimulated PBMC for both, IL-4 and IL-2
(data not shown).
4. Discussion
Here we describe the generation of a new
construct for expression of equine cytokines in
mammalian cells, taking advantage of the principle
of IgG fusion proteins, which have been shown to
possess the biological functions of both fusion
partners (Landolfi, 1991; Barouch et al., 2000),
and our previous studies on horse IgG isotypes and
their corresponding IGHG genes (Wagner et al.,
1998, 2002b, 2004).
![Page 11: Horse cytokine/IgG fusion proteins – mammalian expression ......Horse cytokine/IgG fusion proteins – mammalian expression of biologically active cytokines and a system to verify](https://reader033.vdocuments.site/reader033/viewer/2022060802/608630a787e9b975c705c752/html5/thumbnails/11.jpg)
B. Wagner et al. / Veterinary Immunology and Immunopathology 105 (2005) 1–14 11
Fig. 5. MHC class II antigen expression detected on the surface of horse lymphocytes by flow cytometry. PBMCs were separated by Ficoll
gradient centrifugation and the cells were incubated over night with IgG1 fusion proteins or medium alone. MHC class II antigen expression was
detected using antibody WS43 from the second ELAW (Lunn et al., 1998). (A) The cells were analyzed by gating on the lymphocyte population
(R1) and by comparison of the mean fluorescence intensity of the entire lymphocyte population after different treatments. The histogram shows a
typical staining for lymphocytes of one horse, comparing the isotype control and MHC class II staining after cultivation with the IFN-g/IgG1
fusion protein or medium. (B) Mean � S.E.M. of the MHC class II staining on lymphocytes obtained from six horses after treatment with
different IgG1 fusion proteins. (C) Mean � S.E.M. of the MHC class II staining from another experiment (n = 4), comparing the treatment of the
cells with IFN-g/IgG1 fusion protein and purified IFN-g. (***) p < 0.001; (**) p < 0.01.
Besides the IFN-g, IL-2, IL-4, and TGF-b1/IgG1
fusion proteins we demonstrated here, the new
construct allows the cloning of virtually any cDNA
of interest upstream of the equine IGHG1 gene in a
single cloning step by incorporating appropriate
restriction sites at the 50 end of the gene specific
primers. Within the IgG1 fusion protein, the equine
IgG1 heavy chain constant region is used as a tag for
detection of high producing transfectant clones and
purification of the recombinant protein. For species
like the horse or other domestic or companion animals,
where availability of specific reagents is still limited,
the use of the IgG1 heavy chain constant region as a
C-terminal tag to detect the cytokine offers several
improvements compared to commercial expression
tags.
(1) F
or mammalian expression, the selection proce-dure is a crucial step in the generation of stable
‘high expressing’ transfectants. As the most
important advantage, the secreted IgG1 fusion
protein can be detected by an anti-equine IgG1
ELISA using two different epitopes of the IgG1
heavy chain constant region. This allows the
![Page 12: Horse cytokine/IgG fusion proteins – mammalian expression ......Horse cytokine/IgG fusion proteins – mammalian expression of biologically active cytokines and a system to verify](https://reader033.vdocuments.site/reader033/viewer/2022060802/608630a787e9b975c705c752/html5/thumbnails/12.jpg)
B. Wagner et al. / Veterinary Immunology and Immunopathology 105 (2005) 1–1412
sensitive detection of a few ng/ml of the
recombinant IgG1 fusion protein in the cell
culture supernatant of transfected cells, indepen-
dent of whether specific antibodies to the cytokine
are available or not. High secreting clones can be
selected quickly and quantitatively by the anti-
IgG1 ELISA.
(2) T
he ELISA also improves the selection andlimiting dilution cloning steps during the estab-
lishment of stable transfectants. This allows the
testing of hundreds of clones in a 1-day procedure,
and thus increases the chance to detect rare high
producers.
(3) T
he IgG1 fusion protein can be purified byconventional affinity chromatography methods
using protein A or protein G. Both purification
methods have been used successfully for recovery
of equine IgG1 from horse serum (Sheoran and
Holmes, 1996; Wagner et al., 2003) and allow the
isolation of the IgG1 fusion protein from cell
culture supernatant with a high purity (>95%) and
recovery rate.
(4) T
he N-terminal recombinant protein can becleaved from the IgG1 heavy chain constant
region by enterokinase digestion. According to
the physico-chemical properties of the indivi-
dual cytokine or protein, this step can also be
done directly on the protein G column, which
avoids conformational changes during the pH
elution procedure. Thus, the opportunity to
cleave acid labile cytokines directly on the
protein G affinity column combines a high
affinity purification method and the goal of
maintaining the structure and function of the
cytokine during this procedure. This is of
particular interest for the generation of anti-
bodies to equine cytokines and enables immu-
nization of mice with the pure cytokine without
any additional antigenic tags.
(5) D
ifferent cytokine/IgG1 fusion proteins, whichcontain identical IgG1 constant heavy chain
regions and vary only in their N-terminal
cytokines, provide new reagents to test antibodies
specific for cytokines of other species. Antibody
crossreactivity and specificity to horse cytokines
can be easily proved with the IgG fusion protein
system using various methods. This was shown
here using anti-bovine IFN-g and anti-human
TGF-b1 antibodies for ELISA flow cytometry
and/or Western blotting.
One argument against the IgG fusion protein system
could be that the large IgG1 heavy chain constant region
could influence the structure and function of the cyt-
okine. Although this might be true for some cytokine/
IgG combinations, we found no evidence for changes in
conformation or biological activity of the cytokine/
IgG1 fusion proteins described here. In particular, IL-2/
IgG1 and IL-4/IgG1 were compared to the respective
myc-tagged cytokines expressed earlier (Dohmann e-
t al., 2000), and showed no functional differences.
The IFN-g/IgG1 fusion protein was investigated in
detail to show the structural and functional properties
of equine IgG1 fusion proteins. In vivo, IFN-g is
produced by CD8+ and CD4+ T-cells and NK cells. It
is involved in various phases of immune and
inflammatory responses and is a key cytokine of
Th1 differentiation (Fitzgerald et al., 2001). The
coding nucleotide sequence of equine IFN-g is 501 bp
in size and encodes for a predicted protein of 166
amino acids, 23 of which represent the signal peptide
(Grunig et al., 1994; Curran et al., 1994). The mature
IFN-g forms a homodimer by antiparallel association
of two subunits (Fitzgerald et al., 2001). Bioassays
have been developed to detect IFN-g based on its
capacity to activate monocytes or macrophages to up-
regulate MHC class II expression and to induce
antiviral activity in several cell lines. The latter is
however considerably lower than that of the type I
interferons IFN-a and IFN-b (Fitzgerald et al., 2001).
The biological activity of the IFN-g/IgG1 fusion
protein and purified IFN-g was determined by up-
regulation of MHC class II expression on equine
lymphocytes. In addition, the antiviral activity of the
fusion protein was demonstrated in a MDBK cell
based assay. This suggests that both the equine IgG
fusion proteins and the isolated N-terminal cytokines
can be used for a variety of applications in the horse,
including further characterization of molecular struc-
ture and functional properties in vitro or even in vivo.
Identical observations were made for human IL-2/
IgG1, which had a bioactivity comparable to
recombinant IL-2 and the advantage of divalent
avidity and an extended in vivo half life, mediated
by the IgG heavy chain constant region (Landolfi,
1991). This suggested the use of the IL-2/IgG or its
![Page 13: Horse cytokine/IgG fusion proteins – mammalian expression ......Horse cytokine/IgG fusion proteins – mammalian expression of biologically active cytokines and a system to verify](https://reader033.vdocuments.site/reader033/viewer/2022060802/608630a787e9b975c705c752/html5/thumbnails/13.jpg)
B. Wagner et al. / Veterinary Immunology and Immunopathology 105 (2005) 1–14 13
respective plasmid DNA as an additive during DNA
vaccination to direct the immune response for a
particular antigen towards the TH1-pathway (Barouch
et al., 2000).
Similar applications of cytokine/IgG1 fusion
proteins can be imagined for the horse, combining
the biological functions of the cytokine and that of
IgG1. Regarding the IgG1 heavy chain region of the
fusion protein, equine IgG1 (IgGa) was found to bind
to protein A and protein G (Sheoran and Holmes,
1996) and fix complement after antigen interaction
(Klinman et al., 1966). In addition, the equine IgG1
heavy chain constant region contains an amino acid
motif at the N-terminal part of its CH2 domain
suggested to be involved in Fcg-receptor binding
(Wagner et al., 2002b). Other immunoglobulin heavy
chain constant region genes could be used for
expression together with the protein of interest to
modify the immunoglobulin effector function of the
fusion proteins, e.g. to direct the immune response of
the horse during vaccination or other applications.
In summary, the mammalian expression system for
equine IgG1 fusion proteins combines a sensitive and
rapid screening procedure to select high producing
stable transfectants, a high affinity purification
method, and the ability to isolate the recombinant
protein from the IgG1 fusion partner. Due to their high
similarity to native cytokines, the IgG1 fusion proteins
are valuable tools for generating monoclonal anti-
bodies to horse cytokines. As shown for the IFN-g/
IgG1 and TGF-b1/IgG1 fusion proteins, the system
also provides a sensitive method for testing antibodies
recognizing cytokines of other species for their
specificity to corresponding equine cytokines. Using
both strategies we expect to develop systems in the
near future that allow detection of equine cytokines on
the protein level. The constructs and IgG1 fusion
protein supernatants are available to other investiga-
tors for research purposes.
Acknowledgements
This work was supported by the Max Kade
Foundation, the Dorothy Russell Havemeyer Founda-
tion, Inc., the Morris Animal Foundation, the
Grayson-Jockey Club Research Foundation, and the
Zweig Memorial Fund for Equine Research. The work
on the interferon antiviral bioassay was supported by
the AGRIA research foundation. Eva Wattrang thanks
Lisbeth Fuxler for her technical assistance.
References
Anderson, L.E., Walsh, K.A., Neurath, H., 1977. Bovine enteroki-
nase. Purification, specificity, and some molecular properties.
Biochemistry 26, 3354–3360.
Barbis, D.P., Bainbrigde, D., Crump, A.L., Zhang, C.H., Antczak,
D.F., 1994. Variation in expression of MHC class II antigens on
horse lymphocytes determined by MHC haplotype. Vet. Immu-
nol. Immunopathol. 42, 103–114.
Barouch, D.H., Craiu, A., Kuroda, M.J., Schmitz, J.E., Zheng, X.X.,
Santra, S., Frost, J.D., Krivulka, G.R., Lifton, M.A., Crabbs,
C.L., Heidecker, G., Perry, H.C., Davies, M.-E., Xie, H., Nick-
erson, C.E., Steenbeke, T.D., Lord, C.I., Montefiori, D.C.,
Strom, T.B., Shiver, J.W., Lewis, M.G., Letvin, N.L., 2000.
Augmentation of immune responses to HIV-1 and simian immu-
nodeficiency virus DNA vaccines by IL-2/Ig plasmid adminis-
tration in rhesus monkeys. Proc. Natl. Acad. Sci. U.S.A. 97,
4192–4197.
Crepaldi, T., Crump, A., Newman, M., Ferrone, S., Antczak, D.F.,
1986. Equine T lymphocytes express MHC class II antigens. J.
Immunogenet. 13, 349–360.
Cunningham, F.M., Vandergrifft, E., Bailey, S.R., Sepulveda, M.F.,
Goode, N.T., Horohov, D.W., 2003. Cloning, expression and
biological activity of equine interleukin (IL)-5. Vet. Immunol.
Immunopathol. 95, 63–72.
Curran, J.A., Argyle, D.J., Cox, P., Onions, D.E., Nicolson, L., 1994.
Nucleotide sequence of the equine interferon gamma cDNA.
DNA Seq. 4, 405–407.
Dohmann, K., Wagner, B., Horohov, D.W., Leibold, W., 2000.
Expression and characterisation of equine interleukin 2 and
interleukin 4. Vet. Immunol. Immunopathol. 77, 243–256.
Fitzgerald, K.A., O’Neill, L.A.J., Gearing, A.J.H., Callard, R.E.,
2001. The Cytokine Facts Book, 2nd ed. Academic Press, San
Diego, San Francisco, New York, Boston, London, Sydney,
Tokyo, PP. 322–323.
Grunig, G., Himmler, A., Antczak, D.F., 1994. Cloning and sequen-
cing of horse interferon-gamma cDNA. Immunogenetics 39,
448–449.
Hines, S.A., Stone, D.M., Hines, M.T., Alperin, D.C., Knowles, D.P.,
Norton, L.K., Hamilton, M.J., Davis, W.C., McGuire, T.C.,
2003. Clearance of virulent but not avirulent Rhodococcus equi
from the lungs of adult horses is associated with intracytoplas-
mic gamma interferon production by CD4+ and CD8+ T lym-
phocytes. Clin. Diag. Lab. Immunol. 10, 208–215.
Jensen-Waern, M., Persson, S.G., Nordengrahn, A., Merza, M.,
Fossum, C., 1998. Temporary suppression of cell-mediated
immunity in standardbred horses with decreased athletic capa-
city. Acta Vet. Scand. 39, 25–33.
Klinman, N., Rockey, J.H., Frauenberger, G., Karush, F., 1966.
Equine anti-hapten antibody. III. The comparative properties of
gG- and gA-antibodies. J. Immunol. 96, 587–595.
![Page 14: Horse cytokine/IgG fusion proteins – mammalian expression ......Horse cytokine/IgG fusion proteins – mammalian expression of biologically active cytokines and a system to verify](https://reader033.vdocuments.site/reader033/viewer/2022060802/608630a787e9b975c705c752/html5/thumbnails/14.jpg)
B. Wagner et al. / Veterinary Immunology and Immunopathology 105 (2005) 1–1414
Landolfi, N.F., 1991. A chimeric IL-2/Ig molecule possesses the
functional activity of both proteins. J. Immunol. 146, 915–919.
Lunn, D.P., Holmes, M.A., Antczak, D.F., Agerwal, N., Baker, J.,
Bendali-Ahcene, S., Blanchard-Channell, M., Byrne, K.M.,
Cannizzo, K., Davis, W., Hamilton, M.J., Hannant, D., Kondo,
T., Kydd, J.H., Monier, M.C., Moore, P.F., O’Neil, T., Schram,
B.R., Sheoran, A., Stott, J.L., Sugiura, T., Vagnoni, K.E., 1998.
Report of the Second Equine Leukocyte Antigen Workshop,
Squaw Valley, California, July 1995. Vet. Immunol. Immuno-
pathol. 62, 101–143.
McMonagle, E.L., Taylor, S., van Zuilekom, H., Sanders, L.,
Scholtes, N., Keanie, L.J., Hopkins, C.A., Logan, N.A., Bain,
D., Argyle, D.J., Onions, D.E., Schijns, V.E., Nicolson, L., 2001.
Production of biologically active equine interleukin 12 through
expression of p35, p40 and single chain IL-12 in mammalian and
baculovirus expression systems. Equine Vet. J. 33, 693–698.
Nicolson, L., McMonagle, L., Taylor, S., Hopkins, C., Sanders, L.,
van Kuilekom, H., Scholtes, N., Argyle, D., Onions, D., Schijns,
V., 2001. Equine cytokines and associated reagents. In: Lunn,
D.P., Wade, J.F. (Eds.), Equine Immunology in 2001, 4. R & W
Publications, Newmarket, pp. 57–58.
Pedersen, L.G., Castelruiz, Y., Jacobsen, S., Aasted, B., 2002.
Identification of monoclonal antibodies that cross-react with
cytokines from different animal species. Vet. Immunol. Immu-
nopathol. 88, 111–122.
Penha-Goncalves, M.N., Onions, D.E., Nicolson, L., 1997. Cloning
and sequencing of equine transforming growth factor-beta 1
(TGF-beta1) cDNA. DNA Seq. 7, 375–378.
Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular Cloning:
A Laboratory Manual. Cold Spring Harbor Laboratory Press,
New York.
Sheoran, A.S., Holmes, M.A., 1996. Separation of equine IgG
subclasses (IgGa, IgGb and IgG(T)) using their different binding
characteristics for staphylococcal protein A and streptococcal
protein G. Vet. Immunol. Immunopathol. 55, 33–43.
Sheoran, A.S., Lunn, D.P., Holmes, M.A., 1998. Monoclonal anti-
bodies to subclass-specific antigenic determinants on equine
immunoglobulin gamma chains and their characterization. Vet.
Immunol. Immunopathol. 62, 153–165.
Steinbach, F., Mauel, S., Beier, I., 2002. Recombinant equine
interferons: expression cloning and biological activity. Vet.
Immunol. Immunopathol. 84, 83–95.
Theoret, C.L., Barber, S.M., Moyana, T.N., Gordon, J.R., 2001.
Expression of transforming growth factor beta(1), beta(3), and
basic fibroblast growth factor in full-thickness skin wounds of
equine limbs and thorax. Vet. Surg. 30, 269–277.
Vandergrifft, E.V., Horohov, D.W., 1993. Molecular cloning and
expression of equine interleukin 2. Vet. Immunol. Immuno-
pathol. 39, 395–406.
Wagner, B., Radbruch, A., Richards, C., Leibold, W., 1995. Mono-
clonal equine IgM and IgG immunoglobulins. Vet. Immunol.
Immunopathol. 47, 1–12.
Wagner, B., Overesch, G., Sheoran, A.S., Holmes, M.A., Richards,
C., Leibold, W., Radbruch, A., 1998. Organization of the equine
immunoglobulin heavy chain constant region genes. III. Align-
ment of cm, cg, ce and ca genes. Immunobiology 199, 105–119.
Wagner, B., Siebenkotten, G., Radbruch, A., Leibold, W., 2001.
Nucleotide sequence and restriction fragment length poly-
morphisms of the equine Ce gene. Vet. Immunol. Immuno-
pathol. 82, 193–202.
Wagner, B., Siebenkotten, G., Leibold, W., Radbruch, A., 2002a.
Expression of a 4-(Hydroxy-3-nitro-phenyl) acetyl (NP) specific
equi-murine IgE antibody that mediates histamine release in
vitro and a type I skin reaction in vivo. Equine Vet. J. 34, 657–
665.
Wagner, B., Greiser-Wilke, I., Wege, A., Radbruch, A., Leibold, W.,
2002b. Evolution of the six horse IGHG genes and correspond-
ing immunoglobulin gamma heavy chains. Immunogenetics 54,
353–364.
Wagner, B., Radbruch, A., Rohwer, J., Leibold, W., 2003. Mono-
clonal anti-equine IgE antibodies with specificity for different
epitopes on the immunoglobulin heavy chain of native IgE. Vet.
Immunol. Immunopathol. 92, 45–60.
Wagner, B., Miller, D.C., Lear, T.L., Antczak, D.F., 2004. The
complete map of the immunoglobulin heavy chain constant
gene region reveals evidence for seven IgG isotypes and for
IgD in the horse. J. Immunol. 173, 3230–3242.
Wattrang, E., Jessett, D.M., Yates, P., Fuxler, L., Hannant, D., 2003.
Experimental infection of ponies with equine influenza A2
(H3N8) virus strains of different pathogenicity elicits varying
interferon and interleukin-6 responses. Viral. Immunol. 16, 57–
67.
Wu, D., Murakami, K., Liu, N., Inoshima, Y., Yokoyama, T.,
Kokuho, T., Inumaru, S., Matsumura, T., Kondo, T., Nakano,
K., Sentsui, H., 2002. Expression of biologically active recom-
binant equine interferon-g by two different baculovirus gene
expression systems using insect cells and silkworm larvae.
Cytokine 20, 63–69.