UNIVERSITY OF CALGARY

Understanding and Preventing the Neurodegenerative Cascade: Large Conductance

Calcium and Voltage Activated Potassium Channel Dysregulation and

Neurodegeneration

by

Brandon Jansonius

A THESIS

SUBMITTED TO THE CUMMING SCHOOL OF MEDICINE

IN PARTIAL FULFILMENT OF THE REQUIREMENTS FOR THE

DEGREE OF BACHELOR OF HEALTH SCIENCES HONOURS

Bachelor of Health Sciences Cumming School of Medicine

University of Calgary Calgary, AB

March 2015

SELECT YOUR GRADUATE PROGRAM

MONTH, YEAR

© Brandon Jansonius 2015

ii

Abstract

Cysteine string protein alpha (CSPα) is a neuroprotective molecular chaperone important for the

maintenance of synapses. A CSPα mutation in humans is the cause of adult onset neuronal

ceroid lipofuscinosis (ANCL), a fatal neurodegenerative disease brought on by the accumulation

of lysosomes in neurons. The mechanism initiating this neurodegenerative process is not known.

CSPα knockout mice show increased expression of large conductance calcium and voltage

activated potassium (BK) channels. Quantification of BK channel expression in mice at postnatal

day 25 reveals no significant change compared to wild-type controls. Treatment with

chloroquine, a lysosome inhibitor, decreases BK channel expression in CSPα heterozygous

(p=0.046) and knockout (p=0.023) mice. Understanding how BK channel expression leads to

neurodegeneration could uncover new therapeutic targets for neurodegenerative diseases.

iii

Acknowledgements

A huge thank you to Dr. Braun for accepting me into her lab, teaching me how to think and work

as a scientist, and taking an interest in and supporting my career goals. Your mentorship has

taught me so much about working in science and has encouraged me to continue forward in the

field.

To Julien Donnelier for his incredible support, patience, and guidance throughout my learning

experience.

To Dr. Carolina Koutras and Wesley Chow for their friendship and encouragement.

iv

Table of Contents

Abstract ............................................................................................................................... ii!Acknowledgements ............................................................................................................ iii!Table of Contents ............................................................................................................... iv!List of Tables .......................................................................................................................v!List of Figures and Illustrations ......................................................................................... vi!Epigraph ............................................................................................................................ vii!

Chapter 1- Background ........................................................................................................1 Chapter 2- Rationale ............................................................................................................6 Chapter 3- Materials and Methods .....................................................................................10 Chapter 4- Results ..............................................................................................................14 Chapter 5- Discussion ........................................................................................................21 References ..........................................................................................................................26 Appendix I- Supplementary Figures ..................................................................................30 Appendix II- Supplementary Tables ..................................................................................32

v

List of Tables

TABLE Page 1. CSPα Primer Sequences ................................................................................... 32 2. Antibody Details ............................................................................................... 32

vi

List of Figures and Illustrations

FIGURE Page 1. Comparison of Protein Levels for BK, Cav2.2, Kv1.1, and Kv1.2 Channels in Whole Brain Tissue From CSPα Wild-Type, Heterozygous and Null Mice ........................................................................................................... 7 2. BK Channel Expression Does Not Change Between CSPα +/+, +/-, or -/- Mice at P25 ................................................................................................ 15 3. Western Analysis of BK channel expression between CSPα wild-type and knockout mice at P5, P15, P20, and P25 ............................................ 16 4. Rab-5 Expression Does Not Change Between CSPα +/+, +/-, or -/- Mice at P25 ......................................................................................................... 17 5. Treatment of Lysosomes with Chloroquine Reduces BK Channel Expression in CSPα +/- and -/- Mice ........................................................................... 19 6. DMK and Chloroquine Treatments Do Not Affect Lamp-1 Expression .......... 20 7. Functional Domains of CSPα ........................................................................... 30 8. A schematic illustration of BK channel α, β, and γ subunit architecture with major structuress defined ........................................................................... 30 9. Representative Western Blot of CSPα Expression in Wild-Type, Heterozygous and Knockout Mice ............................................................ 31

vii

Epigraph

By Endurance We Conquer

-Ernest Shackleton family motto

! 1!

Chapter 1- Background

Steady growth of the over-65 demographic worldwide is putting an ever-greater number of

individuals at risk for neurodegenerative diseases. The WHO estimates that by 2050 this age

group will triple in size from 524 million in 2010 to 1.5 billion by 2050 (1). Alzheimer’s disease

(AD) is the most common neurodegenerative disorder followed by Parkinson’s disease (PD),

with a collective 48.1 million affected by these diseases worldwide (2). In tandem with global

population aging, AD cases alone have been projected to reach 107 million by 2050 (3). There

are currently no cures available, likely due to the fact that the neuropathogenic cascade in either

of these diseases is not well understood (4,5). As such, there is an urgent need to clearly define

the sequence of neurodegenerative events that result in these diseases.

A shared feature between AD, PD and other neurodegenerative diseases such as Huntington’s

disease, is the harmful aggregation of proteins in the brain (6). The two classic features of AD

are amyloid-β (Aβ) plaques and neurofibrillary tangles, which are the result of Aβ and tau

protein aggregation respectively (7). In Parkinson’s disease α-synuclein aggregates in neurons to

form Lewy bodies (8). This commonality has prompted researchers to categorize these

neurodegenerative diseases more broadly as protein misfolding disorders, and suggests a similar

neurodegenerative mechanism between them (9). An ongoing area of inquiry is focused on the

protein quality control network and its ability to clear misfolded proteins from the cell. This

network consists of proteins collectively known as molecular chaperones.

! 2!

1.1- Molecular Chaperones

Molecular chaperones are proteins dedicated to quality control and maintenance of the cellular

proteome. They help proteins to fold into their physiologically active conformations, prevent

unwanted aggregation, and help to clear misfolded proteins from the cell (10). Many of the

known chaperone proteins are designated under the heat shock protein (Hsp) family, since some

of the first discovered were found to be inducible by heat (11). Hsp70/Hsc70 (heat shock/heat

shock cognate protein) is a group of ~70 kDa chaperones which are central mediators of protein

folding (12). While Hsp70 expression is stress dependent Hsc70 is continuously expressed in the

cell (13). Hsc70 will be focused on here as it especially relevant in maintaining synaptic function

(14).

Hsc70 binds to the exposed hydrophobic regions of unfolded proteins and uses ATPase-driven

activity to promote correct folding (12). However, Hsc70 cannot accomplish this on its own but

rather in a complex with two additional proteins (15). A nucleotide exchange factor (NEF) is

needed to exchange hydrolyzed ADP for a new ATP molecule (15). The co-chaperone

Hsp40/DNAJ is also required. Its binding is necessary to increase the rate of ATP hydrolysis

since the intrinsic ATPase activity of Hsc70 is very low (15).

All DNAJ proteins contain a 70 amino acid J-domain that is required for binding with Hsc70

(16). This interaction takes place via a histidine-proline-aspartic acid loop, which is found

connecting helices II and III of the four-helix J-domain (16). DNAJ chaperones can either

associate with an Hsc70-substrate complex to stimulate ATPase activity, or directly bind to a

! 3!

client protein and then recruit Hsc70 for folding (15). It is thought that healthy synapses are

dependent in part on the reliable function of DNAJ proteins.

Dysfunctional chaperone proteins have been identified as the cause of various neurodegenerative

diseases. One striking example is the neurodegenerative disorder adult onset neuronal ceroid

lipofuscinosis (ANCL). ANCL is a lysosomal storage disease caused by a mutation of the

DNAJC5 gene (17). This gene codes for the neuroprotective DNAJ chaperone DNAJC5, or

cysteine string protein alpha (CSPα) (18).

1.2- Cysteine String Protein Alpha

CSPα (Supplemental figure 1) is expressed by the DNAJC5 gene and localized to vesicles at the

synaptic cleft (19). It carries out its role in a complex that includes Hsc70 and the nucleotide

exchange factor small glutamine-rich tetratricopeptide protein (SGT) (14). A string of

palmitoylated cysteine residues near its C-terminus, known as the cysteine string region, allows

the protein to anchor itself into synaptic vesicles (20). While its neuroprotective role is not

entirely understood, some client proteins have been identified. One of these proteins is SNAP-25

(synaptosomal associated protein of 25 kDa) which is located on the presynaptic cleft (14).

SNAP-25 forms a complex with synaptic vesicle proteins syntaxin-1 and synaptobrevin-2 to

allow vesicle fusion and exocytosis (14). CSPα is important for keeping SNAP-25 in its active

conformation when it is not bound within this SNARE (soluble N-ethylamide-sensitive factor

attachment protein receptor) complex (11,14). CSPα increases the rate of dynamin-1

polymerization at the post synaptic terminal, which is important for vesicle endocytosis (21).

Both of these proteins are reduced at the synapse in the absence of functional CSPα, disrupting

! 4!

synaptic function (22). In CSPα knockout mice much work has been done to understand the

mechanisms behind synaptic loss, which occurs between postnatal days 20-28 (P20-P28) (23).

SNAP-25 and dynamin-1 are both found in decreased levels before this timeframe (22). CSPα is

also capable of regulating the expression of large conductance calcium and voltage activated

potassium (BK) channels at the synapse (24).

1.3- Adult Onset Neuronal Ceroid Lipofuscinosis

ANCL is a rare form of neuronal ceroid lipofuscinosis (NCL) that occurs in adulthood and is

inherited in an autosomal-dominant fashion (18). Seven additional genes have been found to

cause NCL, but these diseases are autosomal-recessive and almost all have onset during

childhood (18). As in other forms of the disease, the two main features of ANCL are

neurodegeneration and the accumulation of lysosomes with autoflourescent interiors (18,25,26).

The link between lysosome dysfunction and synaptic loss has not yet been investigated in great

detail.

Two different mutations of CSPα are known to cause ANCL, a Leu115Arg substitution and a

ΔLeu116 deletion (18,27). Both of these mutations occur in the cysteine string domain (27).

Mutant CSPα forms non-functional oligomers with itself and also with the wild-type protein,

explaining the dominant-negative nature of the mutations (27). It has been proposed that the

continued need for lysosomes to degrade CSPα oligomers is what leads to lysosomal dysfunction

(27).

! 5!

1.4- Large Conductance Calcium and Voltage Activated (BK) Potassium Channels

BK channels (Supplementary figure 2) are voltage and Ca2+ activated potassium ion channels

important for repolarization after an action potential (28). Neurotransmitter release at the

presynaptic cleft is also regulated in part by BK channel activity (28). Each channel is composed

of four BKα subunits which are expressed by the slo1 gene (28). BKβ and BKγ subunits,

expressed by separate genes, can bind with the BKα tetramer to modify Ca2+ and voltage

sensitivity (29). Increased BK channel activity has been implicated in neurological disorders. For

example, epilepsy has been linked to gain of function mutations and overexpression of BK

channels causing a harmful increase in neuron excitability (28,29). The mechanisms linking

abnormal BK channel activity to neurodegeneration are not precisely understood. Previous work

from this lab has begun to investigate the relationship between CSPα and BK channel expression

(24,30). The work presented here will help to characterize the link between the CSPα knockout

condition, neurodegeneration, and increased BK channel expression.

! 6!

Chapter 2- Rationale

CSPα has been studied in various animal models, providing valuable insight into potential

neurodegenerative mechanisms. CSPα mutant models such as murine, Drosophila, and

Caenorhabditis elegans have shown that neuronal dysfunction and death occurs in the absence of

this chaperone (19,31,32). The similarities across species suggest that CSPα plays a fundamental

role in maintaining synaptic function. For this project a murine model will be used to explore the

functions of CSPα.

In mice comprehensive neurodegeneration begins around P20, with the most active synapses

being the first to deteriorate (19,23). Neurodegeneration and synapse loss continues to

accumulate resulting in early death between P40 and P80 (19). A 2.5 fold increase in BK channel

levels has been observed in the synaptosome enriched fractions of CSPα knockout mice (24).

The extra BK channels are functional, suggesting that membrane excitability is likely affected

(24). However, the mechanism by which abnormal BK channel expression causes

neurodegeneration has not been established. A better understanding of this process could

uncover new therapeutic targets for ANCL and other neurodegenerative diseases.

The role of CSPα in neurodegenerative diseases such as AD or PD is not yet known. However,

some recent links have been drawn between abnormal CSPα expression and AD. Similar to

ANCL, one of the principal histopathological changes observed in AD brains is the loss of

synapses (5). A study of AD brain samples found that CSPα expression was reduced by 40% in

the frontal cortex (21). Another group analyzing the AD brain transcriptome discovered that

CSPα is expressed by different promoters and undergoes alternative splicing not found in normal

! 7!

brain tissue (33). Finally, a paper published earlier this year found some evidence that CSPα

expression was reduced in brain regions affected by AD, but elevated in the cerebellum which

does not undergo neurodegeneration (34).

2.1-Preliminary Results

As mentioned earlier our lab has already begun to explore the role of CSPα in regulating BK

channel expression. Kyle et al. (24) were able to demonstrate that CSPα null mice express

higher levels of BK channels. The figure below shows a sample Western blot analysis for BK,

Cav2.2, Kv1.1, and Kv1.2 ion channel expression in mice that were wild-type, heterozygous, or

null for CSPα. Mice were aged between P20 and P27. A significant increase in BK channel

expression was observed between the wild-type and null mice.

!!!!!!!!!!!!!!!!!!!!

Figure 1- The large conductance, calcium-activated K+ (BK) channel is regulated by cysteine string protein. Sci Rep. 2013 Jan;3:2447. Figure 1: Comparison of protein levels for BK, Cav2.2, Kv1.1, and Kv1.2 channels in whole brain tissue from CSPα wild-type, heterozygous and null mice. Kyle BD, Ahrendt E, Braun AP, Braun JEA. (Pg 2)

! 8!

Expression of BKα mRNA was not elevated in the absence of CSPα. This indicates that the

increase is due to BK channels remaining in the cell and not upregulated gene transcription (24).

In addition, increased BK channel current density in CAD (CNS-derived catecholaminergic)

cells with disabled CSPα shows that the BK channels are functional (24). !

Ahrendt et al. (30) built on this work by studying the ability of wild-type CSPα to reduce BK

channel expression. A high baseline expression of murine BK channels in CAD cells was

established, and then transfected with increasing concentrations of CSPα cDNA (30). Greater

amounts of CSPα caused a reduction in BK channel levels (30). Currents generated by BK

channels were also reduced in cells with increased CSPα (30). Experimental modifications of

CSPα showed that an intact J-domain was required to regulate BK channel expression (30).

These two studies provide a strong basis to further explore the link between increased BK

channel expression and neurodegeneration. Kyle et al. (24) linked the increase in BK channel

expression to the absence of CSPα in the CSPα knockout mouse model of neurodegeneration.

Ahrendt et al. supported this finding by demonstrating that wild-type CSPα can reduce the

amount of BK channels found in the cell membrane (30). This raises new questions, such as

whether or not BK channel expression increases early, if this increase is sustained in the

neurodegenerative process, and if pharmacological manipulation of lysosome activity can alter

BK channel expression.

! 9!

2.2- Hypothesis

The above evidence clearly establishes that CSPα activity affects BK channel expression. I

hypothesize that increased BK channel expression contributes to the neurodegenerative process.

The hypothesis will be addressed with three specific aims.

2.2.1- Aim 1: To determine at what stage in the neurodegenerative process BK channel levels

increase in CSPα knockout mice. This will be addressed by quantifying BK channel levels in

mice split into age groups of 5, 15, 20, 25, 30, and 50 days.

2.2.2- Aim 2: To quantify BK channel expression in CSPα +/+ and -/- mice. This will be

accomplished by isolating synaptosomes from whole brain homogenate and using Western blot

analysis to measure BK channel levels.!

2.2.3- Aim 3: To establish how increased or decreased lysosomal activity may influence BK

channel expression. An important pathological feature of ANCL is the accumulation of

dysfunctional lysosomes in neurons. As such, the potential link between BK channel expression

and lysosome activity will also be explored.

!

! 10!

Chapter 3- Materials and Methods

3.1- Mouse Model

CSPα knockout mice were purchased from The Jackson Laboratory (Bar Harbour, ME). The

mouse model was created by targeted knockout of the DNAJC5 gene. A neomycin resistance

gene replaces the DNA sequence coding for exon 1 (35). CSPα +/- breeding pairs produce

wild-type, heterozygous, and knockout mice. Animal handling carried out in accordance with

University of Calgary policy, protocol # AC13-0079.

3.2- PCR Genotyping

DNA is extracted from mouse ear and/or toe samples using the Red Extract Tissue PCR kit from

Sigma Aldrich (Oakville, ON). Samples are mixed with 100µL of extraction buffer and 25µL of

tissue preparation solution. Samples are then vortexed and incubated at room temperature for 15

minutes, followed by a 3 minute incubation at 95°C. 100µL of neutralization buffer is then

added, and the DNA is ready to extract. PCR samples are prepared with 4µL double-distilled

H2O, 10µL Red Extract Master Mix (Sigma), and 1.5µL of forward and reverse primers. Primers

are made in house at the University of Calgary DNA/RNA Synthesis Laboratory (Supplementary

Table 1). CSPα PCR products are run on a 0.9% agarose gel. Mice are also weighed before they

are sacrificed as another metric for distinguishing CSPα wild-type heterozygous and knockout

mice. Genotype confirmed with CSPα western blot (Supplementary figure 3).

! 11!

3.3- Z-phenylalanine-alanine-diazomethylketone (DMK) and Chloroquine (CQ) Treatment

DMK is a cathepsin B inhibitor. However, at low concentrations it increases the localization of

cathepsin B and other hydrolases to the lysosome (36). This leads to an increase in lysosome

activity by improving the proteolytic capacity of each lysosome. Mice were injected

intraperitoneally with 20 mg/kg DMK every two days for 15 days, starting at P5. Mice were

sacrificed after the last treatment at P21. CQ reduces lysosome activity by increasing the pH

within the lysosome (36). Mice were injected intraperitoneally with 5 mg/kg CQ every two days

for 15 days, starting at P5. Mice were sacrificed after the last treatment at P21.

3.4- Brain Extraction and Synaptosome Isolation

Mice are anesthetized using isoflourane, weighed, and then decapitated. The brain is isolated,

excluding the cerebellum, and put into a homogenizing tube with 5mL of ice-cold SHEEP buffer

(54.77g sucrose, 50mL of 100mM HEPES-KOH at pH 7.0, 5mL 0.5M EGTA, 100µL EDTA,

40µL phenylethylsulfonyl fluoride (PMSF)) and 70µL of PMSF. The homogenized brain tissue

is centrifuged at 1000 G for 7 minutes at 4°C. The supernatant is separated and centrifuged at

10 000g for 15 minutes. After this spin the supernatant is discarded and the pellet is resuspended

in 7mL of ice-cold SHEEP buffer and 70µL PMSF. Resuspended pellets are centrifuged at

10 000g for 15 minutes at 4°C. The supernatant is then discarded. The pellet is resuspended in

4mL ice-cold SHEEP buffer and then 35µL of sodium orthovanadate, PMSF and protease

inhibitor (Sigma) are added. Samples are vortexed then transferred into new aliquots and frozen.

! 12!

3.5- Bradford Assay

Protein concentration in each sample is measured using a Pierce BCA assay kit (Thermo

Scientific, Rockford, IL). 5µL of sample is used for the assay. The absorbance value of each

sample is measured three times and the concentration is determined by plotting the average

absorbance value (taken at 560nm) against a standard curve. Average absorbance values are used

to calculate the volume required for 30µg of protein to be loaded in the SDS-PAGE.

3.6- Western Blot Analysis

Each sample is loaded into the SDS-PAGE gel with 30µg of protein in 30µL of buffer solution

(280µL 4X laemmli buffer, 10µL DTT, 10µL β-mercaptoethanol, 5µL 10X phosphate buffered

saline (PBS)). A 6% stacking gel and 10% resolving gel are used for CSPα, BKα and Lamp-1.

Rab5 is run on a 12% resolving gel. Gels are run for 2:25 hours at 110V. Proteins are then

transferred from the gel onto a 0.2µm nitrocellulose membrane. A semi-dry transfer is run for 45

minutes at 0.6A, 15V and 9W.

Membranes are stained with Ponceau S to visualize the proteins and ensure successful transfer.

Next, membranes are washed twice for five minutes in PBS to remove the Ponceau S stain.

Membranes are then blocked in tris-buffered saline (TBS) with 1% bovine serum albumin (BSA)

and 0.1% Tween-20 detergent. Primary antibodies are added in 12mL of TBS 1% BSA 0.1%

Tween-20 and incubated overnight at 4°C in a darkroom (see Supplementary Table 2 for

antibody concentrations). Next, membranes are washed for five minutes three times in PBS 4%

milk 0.1% Tween-20 solution. The secondary antibody is added to 12mL of PBS 4% milk 0.1%

Tween-20 solution and incubated for 30 minutes at room temperature. After incubation the

! 13!

membranes are washed for five minutes three times in PBS 4% milk 0.1% Tween-20 solution,

and for five minutes three times in 1X PBS solution.

3.7- Statistics

All statistical analyses were done using one-way ANOVA. Significance was considered to be at

p<0.05.

! 14!

Chapter 4- Results

4.1- Determining at what stage in the neurodegenerative process BK channel expression

increases in CSPα knockout mice.

Given that an increase in BK channel expression has been observed in mice aged between P20

and P27 (Figure 1) I decided to quantify BK channel expression at P25. This time point was

chosen to see if increased BK channel expression is sustained early in the neurodegenerative

process. In CSPα knockout mice synaptic degeneration is observed at the calyx of Held by P25

(23). The calyx of Held forms a large synapse with auditory neurons in the mammalian auditory

system, and is therefore a popular location to study synaptic function. (37). Since

neurodegeneration was observed by P25, synaptosome enriched fractions from mice aged P25

were examined for changes in BK channel expression (Figure 2).

At P25 there was no significant difference in BK channel expression between wild-type,

heterozygous, and knockout mice (Figure 2B, 2C). This indicates that changes in BK channel

expression at P25 are likely transient instead of sustained. Littermate wild-type, heterozygous

and knockout mice were compared to remove inter-litter variability as a confounding variable. In

two cases two litters were used to create a full genotype set. This is because not all litters had

each of the three genotypes. Thus inter-litter genetic variability was still present in this

experiment, and could be masking differences in BK channel expression caused by the CSPα

genotype. Taken together these data suggest that a sustained elevation in BK channel expression

is not driving activity dependent neurodegeneration in the CSPα knockout mice. BK channels

! 15!

Figure 2- BK channel expression does not change between CSPα +/+, +/-, or -/- mice at P25.A: Western analysis of BK channel expression in CSPα wild-type, heterozygous, or knockout mice at P25. B: Quantification of BK channel expression. All data normalized to wild-type control. n=8 for all groups, error bars represent SEM. C: Quantification of BK channel expression normalized to β-actin control. All data normalized to wild-type control. n=8 for all groups, error bars represent SEM. No significant changes. •- Band due to non-specific binding.

A

B C

WTHet M

0.0

0.5

1.0

1.5Fo

ld C

hang

e O

ver C

ontro

l(N

orm

aliz

ed to

Act

in)

WTHet M

0.0

0.5

1.0

1.5

Fold

Cha

nge

Ove

r Con

trol

are subject to multiple regulatory mechanisms, and transient nature of BK channel elevation

suggests that the knockout of CSPα may have an indirect effect on BK channel expression.

4.2- Quantification of BK channel expression in CSPα +/+ and -/- mice.

BK channels levels were probed between age-matched wild-type and knockout mice at P5, P15,

P20 and P25 (Figure 3). There was no consistent difference in BK channel expression between

wild-type and knockout mice at any of the age groups. However, there was a noticeable increase

! 16!

Figure 3- Western analysis of BK channel expression between CSPα wild-type and knockout mice at P5, P15, P20 and P25. Blots for P15, P20, and P25 by Julien Donnelier.

of BK channel expression in both wild-type and knockout mice in the P25 age group compared

to the younger groups.

This result suggests that any pathological changes in BK channel expression are overpowered by

physiological and genetic variables beyond CSPα genotype.

ANCL is one type of multiple lysosomal storage diseases (17). The link between CSPα and

lysosome dysfunction as not been established. Importantly, the relationship between CSPα

knockout and lysosome function in the CSPα knockout mouse model is not known. I therefore

asked the question of whether or not lysosome dysfunction contributes to elevated BK channel

expression at the synapse. As such, the same P25 sample group used in Figure 2 was probed for

! 17!

A

B C

Figure 4- Rab-5 expression does not change between CSPα +/+, +/-, or -/- mice at P25.A: Western analysis of Rab-5 expression in CSPα wild-type, heterozygous, or knockout mice at P25. B: Quantification of Rab-5 expression. All data normalized to wild-type control. n=8 for all groups, error bars represent SEM. C: Quantificantion of Rab-5 expression normalized to β-actin control. All data normalized to wild-type control. n=8 for all groups, error bars represent SEM. No significant changes.

WT Het M0.0

0.5

1.0

1.5

Fold

Cha

nge

Ove

r Con

trol

(Nor

mal

ized

to A

ctin

)

WT Het M0.0

0.5

1.0

1.5

Fold

Cha

nge

Ove

r Con

trol

the lysosome marker Rab-5 (Figure 4). Rab-5 is a small GTPase protein located on early

endosomes that is essential for protein trafficking (38). There was no significant difference in

Rab5 expression between CSPα wild-type, heterozygous, or knockout mice at P25. This suggests

that lysosome levels are not significantly different among wild-type, heterozygous and knockout

mice in synaptosome encriched fractions. (Figure 4B, 4C). However, these results do not indicate

whether lysosome activity is altered.

! 18!

4.3- Effect of lysosome activity on BK channel expression.

I directly modulated lysosome activity to study the effects on BK channel expression. DMK was

used to upregulate lysosome activity while CQ was used to reduce it. The effects on BK channel

expression were studied in CSPα wild-type, heterozygous and knockout mice (Figure 5). All

groups were normalized to the wild-type, non-injected control. The treatment effect was then

measured by comparing the fold change between each set of genotypes. Both polyclonal and

monoclonal antibodies were used to probe for the BKα subunit for additional accuracy. A

significant decrease in BK channel expression was observed between CQ treated heterozygous

and knockout mice as compared to their respective controls, but only when the samples were

probed using the polyclonal antibody (Figure 5D, 5F). Samples probed using the monoclonal

antibodies did display a similar trend (Figure 5C, 5E) but none of the comparisons reached

significance.

It is possible that the DMK or CQ treatments could be changing the number of lysosomes

generated in the cell in addition to modifying their intrinsic activity levels. To test this, the same

treated groups from Figure 5 were probed for lysosome associated membrane protein-1

(Lamp-1), which is an integral component of the lysosome structure (Figure 6). No significant

difference was found between any of the treatment groups, demonstrating that overall lysosome

levels were not affected by the treatments (Figure 6B, 6C).

! 19!

WTHet M WT

Het M WTHet M

0

1

2

3

4

5

Fold

Cha

nge

Ove

r WT

Cont

rol

(Nor

mal

ized

to A

ctin

) Control DMK CQ

C D

WTHet M WT

Het M WTHet M

0

1

2

3

4

5

Fold

Cha

nge

Ove

r WT

Cont

rol

Control DMK CQ

Figure 5- Treatment of lysosomes with chloroquine reduces BK channel expression in CSPα +/- and -/- mice. A: Western analysis of BK channel expression in CSPα wild-type, heterozygous, and knockout mice with monoclonal anti-BKα antibody. Groups consist of non-injected control, injected 20mg/kg Z-Phe-Ala-diazomethylmethylketone, or injected 5 mg/kg chloroquine. Treatments were administered every two days for 15 days. Mice aged P5 at start of treatment. B: Western analysis of BK channel expression in CSPα wild-type, heterozygous and knockout mice with polyclonal anti-BKα antibody. Samples probed were the same samples used in A. C: Quantification of BK channel expression detected with monoclonal antibody. All data normalized to wild-type control. n=4 for all groups, error bars represent SEM. D: Quantification of BK channel expression detected with polyclonal antibody. All data normalized to wild-type control. n=4 for all groups, error bars represent SEM. E: Quantification of BK channel expression detected with monoclonal antibody normalized to β-actin loading control, then all data normalized to wild-type control. n=4 for all groups, error bars represent SEM. F: Quantification of BK channel expression detected with polyclonal antibody normalized to β-actin loading control, then all data normalized to wild-type control. n=4 for all groups, error bars represent SEM. •- Band due to non-specific binding. *- p<0.05, **-p<0.01, ***p<0.001

A B

E F WTHet M WT

Het M WTHet M

0.0

0.5

1.0

1.5

Fold

Cha

nge

Ove

r WT

Cont

rol

Control DMK CQ

*** ***

WTHet M WT

Het M WTHet M

0.0

0.5

1.0

1.5

Fold

Cha

nge

Ove

r WT

Cont

rol

(Nor

mal

ized

to A

ctin

)

Control DMK CQ

**

! 20!

WTHet M WT

Het M WTHet M

0

5

10

15

Fold

Cha

nge

Ove

r WT

Cont

rol

WTHet M WT

Het M WTHet M

0

5

10

15

Fold

Cha

nge

Ove

r WT

Cont

rol

(Nor

mal

ized

to A

ctin

)

B C

A

Figure 6- DMK and Chloroquine treatments do not affect Lamp-1 expression.A: Western analysis of Lamp-1 expression in CSPα wild-type, heterozygous, and knockout mice. Groups consist of treated non-injected control, 20mg/kg Z-Phe-Ala-diazomethylmethylketone, or 5 mg/kg chloroquine injections. Treatments were administered every second day for 15 days. Mice aged P5 at start of treatment. B: Quantification of Lamp-1 expression. All data normalized to wild-type control. Mice aged P5 at start of treatment. n=2 for all groups, error bars represent SEM. C: Quantification of Lamp-1 expression normalized to β-actin loading control, then all data normalized to wild-type control. Mice aged P5 at start of treatment. n=2 for all groups, error bars represent SEM.

! 21!

Chapter 5- Discussion

The mechanism by which CSPα dysfunction leads to neurodegeneration is not known. The

murine CSPα knockout model provides an excellent platform to study this process. Dynamin-1

and SNAP-25 levels are reduced in the absence of CSPα early in the neurodegenerative process

(22). How BK channel expression is affected within this timeframe is less well understood. This

thesis has explored in detail the effects of CSPα knockout on BK channel expression in the early

stages of neurodegeneration.

5.1- Determining at what stage in the neurodegenerative process BK channel levels increase in

CSPα knockout mice.

There is no difference in BK channel expression between wild-type, heterozygous, or knockout

mice at P25. The sample size is adequate (n=8) and therefore the conclusions drawn here can be

considered well supported. In CSPα knockout mice neurodegeneration is observed starting at

P20, and has been detected in the calyx of Held synapse by P25 (23). The calyx of Held forms a

large synapse with neurons in the mammalian auditory system and is frequently used to study

synaptic activity (37). If BK channels do indeed play a role in the neurodegenerative process

then I would expect to see a sustained increase in expression at P25. However, it has also been

noted that the synapses in CSPα knockout mice degrade in an activity dependent manner (23). It

could be the case that at P25 only certain regions of the brain are undergoing significant

degeneration. This specificity could be overlooked in the whole brain homogenate sample used

here. Transient increases in BK channel expression could also indicate a compensatory response

to neurodegeneration instead of a pathological process.

! 22!

As previously described however, this experiment includes comparisons between different litters.

A challenge of this work is obtaining complete genotype sets from one litter. If there is a

significant change at P25 it must be quite subtle given that a relatively small amount of genetic

variance is able to mask it. A more complete survey of BK expression in P5, P15, P20, P30, and

P50 age groups will give a better understanding of protein expression throughout the lifetime of

the mice. Thus future experimentation is required to more fully understand the transient increases

in BK channel expression.

Quantification of lysosome levels at P25 also did not uncover a difference between the

genotypes. Lysosome function has not yet been well characterized in the CSPα knockout mouse

model. This finding suggests that lysosomal dysfunction does not appear until later in the

neurodegenerative process. It could be that lysosome dysfunction is a downstream consequence

of CSPα knockout as opposed to an initiator of the neurodegenerative process.

5.2- Quantification of BK channel expression in CSPα +/+ and -/- mice.

The hypothesis that BK channel expression contributes to neurodegeneration was supported by

the findings that BK channel expression is increased in CSPα knockout mice, and that abnormal

expression or activity of these channels has been implicated in other neurological diseases

(28,30,39). As such, the purpose of this series of experiments was to bring to light any overt

changes in BK channel expression between wild-type and knockout mice of increasingly older

ages. If BK channel expression became elevated early on in the knockout mice (at P5 or P15 for

example) compared to control levels, it would suggest that BK channel elevation is a contributor

! 23!

to the neurodegenerative process. Here I report that BK channel expression does not consistently

increase in age-matched wild-type and knockout mice.

During this experiment I found that the inclusion of multiple litters on each blot introduced a

large amount of inherent genetic variability. It is possible that more subtle differences in

expression would have been apparent between wild-type and knockout mice if they had all been

littermates. Therefore future experiments studying BK channel expression should be done using

littermates. In addition, some of the blots had an uneven number of wild-type and heterozygous

mice. This limited the number of pairs that could be compared on each blot.

5.3- Effect of lysosome activity on BK channel expression

In heterozygous and knockout mice a downregulation in lysosome activity significantly reduces

BK channel expression. This was a surprising result, as I expected a decrease in lysosome

activity to increase the amount of BK channels that remain in the membrane. It could be that the

inhibition of a protein recycling pathway is causing a backup in the protein synthesis system. If

old and misfolded proteins are not effectively cleared from the membrane for example, newly

synthesized proteins may not be able to translocate to that overcrowded region of the cell. As a

result BK channels may be accumulating in the endoplasmic reticulum, or other cellular

compartments, instead of moving to the synaptic membrane. Lamp-1 expression was not

changed with either the DMK or CQ treatments as compared to the control. This demonstrates

that lysosome biogenesis is not changed by the treatments, and is supported in the literature (36).

Therefore the downregulation in BK channel expression observed with CQ treatment was due to

reduced lysosome function alone.

! 24!

One limitation of these results is the relatively small sample size (n=4). Significance in the BK

channel western analysis was reached in the samples probed with the anti-BKα polyclonal

antibody, but not with the monoclonal. This suggests that the change is just bordering on

significance, and could be made more apparent with additional replicates. The pattern of BK

channel expression found using the monoclonal antibody is very similar to that observed with the

polyclonal antibody. Slightly more variance from the monoclonal data could be the problem, and

could be mitigated with a larger sample size.

5.4- Future Directions

Future experiments could include the crossing of CSPα knockout mice with mice either

overexpressing or not expression BK channels. This would be another helpful method to

determine how BK channel levels affect the neurodegenerative process in CSPα knockout mice.

Characterizing the complete timeline of BK channel expression from P5 to P50 will also help to

give a clearer picture as to when and how transient expression may occur. More work could also

be completed on regulatory mechanisms that, in addition to CSPα, could be affecting BK

channel expression.

I have found that a decrease in lysosome activity significantly decreases BK channel expression.

To better understand this mechanism, it would be helpful to see how BK channels locate in a cell

with impaired lysosome function. If there is a buildup of channels elsewhere in the cell it could

help to explain why fewer channels are found in the synaptosome-enriched fractions studied

here.

! 25!

5.5 Conclusion

The CSPα mouse model of neurodegeneration makes it possible to study a close link between

chaperone dysfunction and neurodegeneration. My work has shown that BK channel expression

is not significantly increased in the synaptosomes of P25 mice, nor is the number of lysosomes.

When lysosomes are inhibited using CQ there is a significant reduction in BK channel

expression. Further exploration of this effect could help to explain how other pathways

regulating BK channel expression may be altered in CSPα knockout mice. Uncovering when this

increase takes place will provide a better understanding of whether or not elevated BK channel

levels are a root cause of neurodegeneration.

As it stands today, individuals suffering from AD and related neurodegenerative diseases have

very limited treatment options. There is nothing currently available that can halt or reverse the

neurodegeneration caused by these diseases (40). Further investigation into the

neurodegenerative cascade is necessary to identify new therapeutic targets for those with ANCL,

AD or related protein folding disorders.

! 26!

References

1.!! World!Health!Organization.!Global!Health!and!Aging.!2011;1–27.!!

2.!! Whiteford!HA,!Ferrari!AJ,!Degenhardt!L,!Feigin!V,!Vos!T.!The!Global!Burden!of!Mental,!Neurological!and!Substance!Use!Disorders:!An!Analysis!from!the!Global!Burden!of!Disease!Study!2010.!PLoS!One.!2015;10:1–14.!!

3.!! Brookmeyer!R,!Johnson!E,!ZieglerYGraham!K,!Arrighi!HM.!Forecasting!the!global!burden!of!Alzheimer’s!disease.!Alzheimer’s!Dement.!2007;3:186–91.!!

4.!! De!Lau!LML,!Breteler!MMB.!Epidemiology!of!Parkinson’s!disease.!Lancet!Neurol.!2006;5:525–35.!!

5.!! Perl!DP.!Neuropathology!of!Alzheimer’s!disease.!Mt!Sinai!J!Med.!2010;77(1):32–42.!!

6.!! Skovronsky!DM,!Lee!VMYY,!Trojanowski!JQ.!Neurodegenerative!diseases:!new!concepts!of!pathogenesis!and!their!therapeutic!implications.!Annu!Rev!Pathol.!2006;1:151–70.!!

7.!! Castello!MA,!Soriano!S.!On!the!origin!of!Alzheimer’s!disease.!Trials!and!tribulations!of!the!amyloid!hypothesis.!Ageing!Res!Rev.!Elsevier!B.V.;!2014;13:10–2.!!

8.!! EbrahimiYfakhari!D,!Wahlster!L,!Mclean!PJ.!Molecular!chaperones!in!Parkinson!’!s!disease!–!present!and!future.!J!Parkinsons!Dis.!2011;299–320.!!

9.!! Muchowski!PJ,!Wacker!JL.!Modulation!of!neurodegeneration!by!molecular!chaperones.!Nat!Rev!Neurosci.!2005!Jan;6(1):11–22.!!

10.!! Hartl!FU,!Bracher!A,!HayerYHartl!M.!Molecular!chaperones!in!protein!folding!and!proteostasis.!Nature.!2011!Jul!21;475(7356):324–32.!!

11.!! Kakkar!V,!Prins!LCB,!Kampinga!HH.!DNAJ!proteins!and!protein!aggregation!diseases.!Curr!Top!Med!Chem.!2012!Jan;12(22):2479–90.!!

12.!! Mayer!MP.!Hsp70!chaperone!dynamics!and!molecular!mechanism.!Trends!Biochem!Sci.!Elsevier!Ltd;!2013!Oct;38(10):507–14.!!

13.!! Tavaria!M,!Gabriele!T,!Kola!I,!Anserson!RL.!A!hitchhiker’s!guide!to!the!human!Hsp70!family.!Cell!Stress!Chaperones.!1996;1(1):23–8.!!

14.!! Sharma!M,!Burré!J,!Südhof!TC.!CSP!α!promotes!SNAREYcomplex!assembly!by!chaperoning!SNAP!Y!25!during!synaptic!activity.!Nat!Cell!Biol.!2011;13(1):30–9.!!

! 27!

15.!! Kampinga!HH,!Craig!EA.!The!Hsp70!chaperone!machinery:!JYproteins!as!drivers!of!functional!specificity.!Nat!Rev!Mol!Cell!Biol.!2010;11(8):579–92.!!

16.!! Qiu!XYB,!Shao!YYM,!Miao!S,!Wang!L.!The!diversity!of!the!DnaJ/Hsp40!family,!the!crucial!partners!for!Hsp70!chaperones.!Cell!Mol!Life!Sci.!2006!Nov;63(22):2560–70.!!

17.!! Anderson!GW,!Goebel!HH,!Simonati!A.!Human!pathology!in!NCL.!Biochim!Biophys!Acta!Y!Mol!Basis!Dis.!Elsevier!B.V.;!2013;1832:1807–26.!!

18.!! Nosková!L,!Stránecký!V,!Hartmannová!H,!Přistoupilová!A,!Barešová!V,!Ivánek!R,!et!al.!Mutations!in!DNAJC5,!encoding!cysteineYstring!protein!alpha,!cause!autosomalYdominant!adultYonset!neuronal!ceroid!lipofuscinosis.!Am!J!Hum!Genet.!2011!Aug!12;89(2):241–52.!!

19.!! Koutras!C,!Braun!JEA.!J!protein!mutations!and!resulting!proteostasis!collapse.!Front!Cell!Neurosci.!2014!Jan;8(191):1–7.!!

20.!! Evans!GJO,!Morgan!A,!Burgoyne!RD.!Tying!everything!together:!the!multiple!roles!of!cysteine!string!protein!(CSP)!in!regulated!exocytosis.!Traffic.!2003!Oct;4(10):653–9.!!

21.!! Zhang!Y,!Henderson!MX,!Colangelo!CM,!Stephen!D,!Bruce!C,!Wu!T,!et!al.!Identification!of!CSP!alpha!clients!reveals!a!role!in!dynamin!1!regulation.!2013;74(1):136–50.!!

22.!! Sheng!J,!Wu!LYG.!Cysteine!string!protein!α:!a!new!role!in!vesicle!recycling.!Neuron.!Elsevier!Inc.;!2012!Apr;74(1):6–8.!!

23.!! FernándezYChacón!R,!Wölfel!M,!Nishimune!H,!Tabares!L,!Schmitz!F,!CastellanoYMuñoz!M,!et!al.!The!synaptic!vesicle!protein!CSP!alpha!prevents!presynaptic!degeneration.!Neuron.!2004!Apr;42(2):237–51.!!

24.!! Kyle!BD,!Ahrendt!E,!Braun!AP,!Braun!JEA.!The!large!conductance,!calciumYactivated!K+!(BK)!channel!is!regulated!by!cysteine!string!protein.!Sci!Rep.!2013!Jan;3(2447):1–11.!!

25.!! Benitez!B!a.,!Alvarado!D,!Cai!Y,!Mayo!K,!Chakraverty!S,!Norton!J,!et!al.!ExomeYsequencing!confirms!DNAJC5!mutations!as!cause!of!adult!neuronal!ceroidYlipofuscinosis.!PLoS!One.!2011;6(11).!!

26.!! Velinov!M,!Dolzhanskaya!N,!Gonzalez!M,!Powell!E,!Konidari!I,!Hulme!W,!et!al.!Mutations!in!the!gene!DNAJC5!cause!autosomal!dominant!kufs!disease!in!a!proportion!of!cases:!Study!of!the!parry!family!and!8!other!families.!PLoS!One.!2012;7(1):1–8.!!

27.!! Zhang!Y,!Chandra!SS.!Oligomerization!of!Cysteine!String!Protein!alpha!mutants!causing!adult!neuronal!ceroid!lipofuscinosis.!Biochim!Biophys!Acta!Y!Mol!Basis!Dis.!Elsevier!B.V.;!2014;1842(11):2136–46.!!

! 28!

28.!! Contreras!GF,!Castillo!K,!Enrique!N,!CarrasquelYUrsulaez!W,!Castillo!JP,!Milesi!V,!et!al.!A!BK!(Slo1)!channel!journey!from!molecule!to!physiology.!Channels.!2013;7(6):442–58.!!

29.!! Kyle!BD,!Braun!AP.!The!regulation!of!BK!channel!activity!by!preY!and!postYtranslational!modifications.!Front!Physiol.!2014!Aug!22;5(316):1–10.!!

30.!! Ahrendt!E,!Kyle!B,!Braun!AP,!Braun!JEA.!Cysteine!string!protein!limits!expression!of!the!large!conductance,!calciumYactivated!K+!(BK)!channel.!PLoS!One.!2014!Jan;9(1Y9):e86586.!!

31.!! Donnelier!J,!Braun!JEA.!CSPαYchaperoning!presynaptic!proteins.!Front!Cell!Neurosci.!2014!Jan;8(116):1–5.!!

32.!! Kashyap!SS,!Johnson!JR,!Mccue!H!V,!Chen!X,!Edmonds!J,!Ayala!M,!et!al.!Caenorhabditis!elegans!dnjY14,!the!orthologue!of!the!DNAJC5!gene!mutated!in!adult!onset!neuronal!ceroid!lipofuscinosis,!provides!a!new!platform!for!neuroprotective!drug!screening!and!identifies!a!SIRY2.1Yindependent!action!of!resveratrol.!Hum!Mol!Genet.!2014;1–35.!!

33.!! Twine!N!a,!Janitz!K,!Wilkins!MR,!Janitz!M.!Whole!transcriptome!sequencing!reveals!gene!expression!and!splicing!differences!in!brain!regions!affected!by!Alzheimer’s!disease.!PLoS!One.!2011!Jan;6(1):1–13.!!

34.!! Tiwari!SS,!d’Orange!M,!Troakes!C,!Shurovi!BN,!Engmann!O,!Noble!W,!et!al.!Evidence!that!the!presynaptic!vesicle!protein!CSPalpha!is!a!key!player!in!synaptic!degeneration!and!protection!in!Alzheimer’s!disease.!Mol!Brain![Internet].!2015;8:1–12.!Available!from:!http://www.molecularbrain.com/content/8/1/6!

35.!! Jackson!Laboratory.!Dnajc5tm1Sud!Targeted!Allele!Detail![Internet].!2015![cited!2015!Mar!19].!Available!from:!http://www.informatics.jax.org/allele/MGI:3050763!

36.!! Bahr!B!a.,!Wisniewski!ML,!Butler!D.!Positive!Lysosomal!Modulation!As!a!Unique!Strategy!to!Treat!AgeYRelated!Protein!Accumulation!Diseases.!Rejuvenation!Res.!2012;15(2):189–97.!!

37.!! Borst!JGG,!Soria!van!Hoeve!J.!The!Calyx!of!Held!Synapse:!From!Model!Synapse!to!Auditory!Relay.!Annu!Rev!Physiol.!2012;74(1):199–224.!!

38.!! Pfeffer!SR.!Rab!GTPases:!Specifying!and!deciphering!organelle!identity!and!function.!Trends!Cell!Biol.!2001;11(12):487–91.!!

39.!! N’Gouemo!P.!BK!Ca!channel!dysfunction!in!neurological!diseases.!Front!Physiol.!2014;5:1–6.!!

! 29!

40.!! Saraceno!C,!Musardo!S,!Marcello!E,!Pelucchi!S,!Luca!M!Di.!Modeling!Alzheimer’s!disease:!from!past!to!future.!Front!Pharmacol.!2013!Jan;4(77):1–22.!!

!!!!!!!!!!!!!!!!!!!!!!!!

!!!!!!

! 30!

Appendix!IY!Supplementary!Figures!!! !

Figure 1- Functional domains of CSPα. The J-domain contains the HPD sequence required for interaction with Hsc70. L represents the leucine residues within the poly-cysteine repeat region that are mutated in ANCL. Palmitoylation of the cysteine string region allows for protein anchoring into the synaptic vesicle. Contributed from the Braun lab.

Figure 2- Kyle BD, Braun AP. The regulation of BK channel activity by pre- and post-translational modifications. Front Physiol. 2014 Aug;5:316. Figure 1: A schematic illustration of BK channel α, β, and γ subunit architecture with major structures defined. Abbreviations: N, amino-terminus; C, carboxy-terminus; LRR, leucine-rich repeat; S, transmembrane segment; RCK, regulator of K+ conductance. (Pg 2)

! 31!

!!!

! !!!!!!!!

!!!

!!!!!!!!!!!!!!!!!!!!

Figure 3- Representative!western!blot!of!CSPα!expression!in!wildYtype,!heterozygous!and!knockout!mice.!Blot!done!by!Julien!Donnelier.!

! 32!

Appendix!IIY!Supplemental!Tables!!!!

!Table 1- CSPα Primer Sequences

CSPα! !WildYtype! TGGTAGACTAACCTAACATGGCCG!Mutant! GAGCGCGCGCGGCGGAGTTGTTGAC!Common!! TTGGCCCACCAGCTGGAGAGTAC!

!!

!!

Table 2- Antibody Details

!!!!

!!!!

Antibody! Provider! Type!(Concentration)! Required!Secondary!(Concentration)!

Expected!Band!(kDa)!

βYActin! Sigma! Monoclonal!(1:10!000)! Goat!AntiYMouse!(1:10!000)!

42!

BKα!Sigma! Polyclonal!(1:4000)! Goat!AntiYRabbit!

(1:10!000)!130!

BKα!BD!Transduction!Laboratories! Monoclonal!(1:2000)!

Goat!AntiYMouse!(1:10!000)!

130!

CSPα! BD!Transduction!Laboratories! Polyclonal!(1:8000)! Goat!AntiYRabbit!

(1:10!000)!35!(monomer)!70!(dimer)!

RabY5! Santa!Cruz!!

Polyclonal!(1:500)! Goat!AntiYRabbit!(1:10!000)!

25!

LampY1!BD!Transduction!Laboratories! Monoclonal!(1:1000)!

Goat!AntiYMouse!(1:10!000)!

120!!