ORIGINAL PAPER

Green Tea Polyphenols Protects Cochlear Hair Cellsfrom Ototoxicity by Inhibiting Notch Signalling

Lin-Tao Gu1 • Jia Yang2 • Shi-Zheng Su3 • Wen-Wen Liu4 • Zhong-Gang Shi2 •

Qi-Rong Wang1

Received: 17 February 2015 / Revised: 6 April 2015 / Accepted: 15 April 2015

� Springer Science+Business Media New York 2015

Abstract Notch signalling pathway plays an essential

role in the development of cochlea, which inhibits the

proliferation of hair cells. Epigallocatechin-3-gallate

(EGCG) is the most abundant polyphenol in green tea,

which presents strong antioxidant activation and has been

applied for anti-cancer and anti-inflammatory. In this

study, we treated the cochlear explant cultures with EGCG

and found that EGCG can protect cochlear hair cells from

ototoxic drug gentamicin. We demonstrated that EGCG

could down-regulate the expression of Notch signalling

pathway target genes, such as Hes1, Hes5, Hey1 and Hey5.

However, the Notch pathway ligands such as Delta1, Jag1

and Jag2 were not affected by EGCG. To further illustrate

the mechanism of recover cochlear hair cells, we demon-

strated that EGCG inhibited the activity of c-secrectase to

suppress Notch signalling pathway and promoted the pro-

liferation and regeneration of hair cells in the damaged

cochlea. Our results suggest for the first time the role of

EGCG as an inhibitor of the Notch signalling pathway, and

support its potential value in hearing-impaired recovery in

clinical therapy.

Keywords Cochlear hair cells � Notch signalling

pathway � Polyphenol � EGCG � c-Secrectase

Abbreviations

IHCs Inner hair cells

EGCG Epigallocatechin-3-gallate

NICD Notch intracellular domain

Introduction

In all mammalians, the sensory receptors of both the au-

ditory system and the vestibular system are cochlear hair

cells. Cochlear hair cells are arranged in four rows in the

organ of corti along the entire length of the cochlear coil.

The row of cells close to the centre of cochlea are called

inner hair cells (IHCs), which provide the main neural

output of the cochlea [1, 2]. The other three rows consist of

outer hair cells and receive neural input from the brain,

which detect movement through mechanotransduction as

part of the cochlea’s mechanical pre-amplifier. Damage to

these hair cells resulted in decreased hearing sensitivity and

sensorineural hearing loss [3]. Because human hair cells

are terminally differentiated and are incapable of regen-

eration, this damage could lead to permanent hearing loss.

There are two avenues for the generation of new hair cells

[4, 5]: one is the differentiation from inner ear stem cells;

another is the trans-differentiation from supporting cells. A

series of specific genes and signalling pathways control

Electronic supplementary material The online version of thisarticle (doi:10.1007/s11064-015-1584-3) contains supplementarymaterial, which is available to authorized users.

& Qi-Rong Wang

qrwang1234@163.com

1 Department of Otolaryngology-Head and Neck Surgery,

Qianfo Shan Hospital Affiliated to Shandong University,

Jinan 250014, People’s Republic of China

2 Department of Otolaryngology-Head and Neck Surgery,

Zhangqiu People’s Hospital, Jinan 250200,

People’s Republic of China

3 Department of Ophthalmology, Zhangqiu People’s Hospital,

Jinan 250200, People’s Republic of China

4 Department of Otolaryngology-Head and Neck Surgery,

Provincial Hospital Affiliated to Shandong University,

Jinan 250022, People’s Republic of China

123

Neurochem Res

DOI 10.1007/s11064-015-1584-3

these two avenues. In 1999, Bermingham et al. have re-

ported that the gene Atoh1 (as also known as Math-1)

serves to initiate inductive signals that regulate the devel-

opment for hair cell in mice. In subsequent studies, the

forced expression of Atoh1 in the mammalian adult inner

ear has been reported to cause the trans-differentiation of

supporting cells into hair cells [6–9]. Chen and Segil [10]

have reported the cyclin-dependent kinase inhibitor p27

(Kip1) plays an essential role in the developmental control

of progenitors of the hair cells and supporting cells. White

et al. [11] have found the relationship between the ex-

pression of p27 (Kip1) and the proliferative capacity of

supporting cells, which suggest p27 (Kip1) may be po-

tential target for controlling the trans-differentiation of

supporting cells into hair cell. Lanford et al. [12] have

firstly demonstrated that the Notch pathway regulate the

development of progenitor cells into hair cells, which

support a role for the Notch pathway in the development of

the cochlea.

The Notch signalling pathway is a highly conserved

cell signalling system in multicellular organisms and

controls numerous cellular processes, such as cell differ-

entiation, proliferation and apoptosis. As a transmem-

brane receptor, Notch plays an important role in

mediating critically cellular functions by cell to cell

communications [13]. Activation of Notch upon DSL

(Delta/Serrate/Lag-2) ligands induces proteolytic pro-

cessing of Notch receptor, within its extracellular domain

(NECD) via a disintegrin and metalloprotease (ADAM),

which facilitates c-secrectase proteolysis to release the

Notch intracellular domain (NICD) from the plasma

membrane [14, 15]. The NICD then translocates to the

nucleus and interacts with the DNA-binding protein CSL

(CBF1, SuH, LAG-1), and participates in the transcrip-

tional regulation of target genes, such as Hes1, Hes2,

Hey1 and Hey2 [16, 17]. With the further research of the

development of cochlear hair cell, various studies have

demonstrated Notch signalling pathway plays essential

roles in the regulation of the cochlear hair cell. In 1998,

both of Adam et al. [18] and Haddon et al. [19] have

reported the lateral inhibition mediated by Notch sig-

nalling pathway in the control of hair cell differentiation,

which plays an essential role in the development of ver-

tebrate inner ear. In 1999, Lanford et al. have demon-

strated the same inhibition in the differentiation of

mammalian hair cell by Notch signalling pathway. In their

studies, Notch signalling pathway exerts lateral inhibition

in the development of cochlear mosaic, which plays an

important role in the determination of various cell fates.

According to the recent studies, inactivation of the Notch

signalling pathway can promote the proliferation of hair

cells [7, 20–22]. Therefore, the inhibitors of c-secrectasemight promote the proliferation and regeneration of hair

cells in the damaged cochlea by targeting the Notch re-

ceptors to suppress the Notch activity [22].

In recent years, tea has attracted increasing attention for

health and delaying aging because of their powerful an-

tioxidant properties. Tea polyphenols (include catechins,

theaflavins, tannins and flavonoids) extracted from tea

leaves have been extensively used for the prevention and

treatment of human cancers [23]. Among the various

polyphenols in tea, the most significant phytochemical is

Epigallocatechin gallate (EGCG). EGCG is a type of

catechin, which is the most abundant, and active compound

and presents much stronger antioxidant activation than

Vitamin C [24]. In biochemical research fields, the benefits

of EGCG have begun to emerge [25]. In 1998, Pietta et al.

[26] have found that EGCG has the ability to inhibit lipid

peroxidation, which may decrease the risk of heart disease.

In 2000, Fujiki et al. [27] have suggested EGCG can inhibit

the release of tumor necrosis factor-alpha causing the

suppression of tumor promotion. Besides cancer and heart

disease, lots of studies have reported EGCG can confer

protection against other diseases, such as osteoporosis [28],

liver and kidney damage [29], bacterial infection [30] and

viral infection [31].

In the present work, we demonstrated EGCG can pro-

mote the regeneration of cochlear hair cells damaged by

ototoxic drug gentamicin. From immunostaining assay, we

found the number of cochlear hair cells remained the same

by EGCG treatment after gentamicin insult. Mechan-

otransduction currents recordings from cochlear hair cells

indicate that EGCG not only protects the number of

cochlear hair cells but also their functions. Furthermore, we

provide evidence that the protective effect of EGCG on

cochlear hair cells was due to its inhibition of Notch

pathway. These findings offer insights into the function of

EGCG in regeneration of cochlear hair cells and support

the medical value of tea polyphenols on the hearing-im-

paired recovery.

Materials and Methods

Ethics Statement

This study was carried out in strict accordance with the

recommendations in the Guide for the Care and Use of

Laboratory Animals of the National Institutes of Health.

The protocol was approved by the Committee on the Ethics

of Animal Experiments of Qianfo Shan Hospital Affiliated

to Shandong University. The IACUC committee members

at Qianfo Shan Hospital Affiliated to Shandong University

approved this study. All surgery was performed under

sodium pentobarbital anesthesia, and all efforts were made

to minimize suffering.

Neurochem Res

123

Experimental Animals

Transgenic mice carrying GFP under the control of an

enhancer from the Atoh1 gene (Atoh1/GFP) were purchase

from Cyagen, Shanghai. The promoter of Atoh1/GFP

transgene contains about 1.4 kb sequence from the Math1

enhancer which is fused to the reporter gene BGnEGFP.

The reporter gene BGnEGFP contains the positive au-

toregulatory elements, the h-actin promoter, and a nuclear

localization signal for GFP [32, 33]. Transgenic mice were

identified by direct observation of GFP-mediated fluores-

cence. The following primers were used for PCR based

genotyping: 50 CGAAGGCTACGTCCAGGAGCGCAC

CAT 30 and 50 GCACGGGGCCGTCGCCGATGGGGG

TGTTCTGC 30.

Cochlear Tissue Isolation and In Vitro Culture

According to the procedure from published reports [33,

34], the timed mated pregnant mice at E13 to E14.5 were

sacrificed and the embryos were isolated and placed in PBS

(GIBCO). Then unfixed bulla from embryos were dissected

and incubated in calcium-magnesium-free PBS (Invitro-

gen) containing dispase (1 mg/ml; Invitrogen) and colla-

genase (1 mg/ml; Worthington) to free the cochlear duct

from the surrounding condensed mesenchyme for

10–15 min. After that, the enzyme solution was replaced

with Hank’s balanced salt solution (HBSS, Life Tech-

nologies) and the spiral ganglia, Reissner’s membrane, and

the most basal cochlear segment should be removed to

obtain a flat cochlear surface preparation. For RT-PCR

experiments, both the most cochlear base and the cochlear

apex were removed, only the cochlear mid-turn was used.

The remaining cochlear tissue was cultured on SPI filter

membranes (Spi Supplies) in DMEM-F12 (Invitrogen)

with B27 supplement (Invitrogen), 2.5 ng/ml FGF2 (NIH),

5 ng/ml EGF (Sigma) and 100 U/ml Penicillin (Sigma). All

cultures were maintained in a 5 % CO2/20 % O2-hu-

midified incubator.

Drug Treatments

After 24 h cultured in the incubator, cochlear tissues (3 in a

group) were randomly divided into 3 groups of 3–5

cochlear tissues per treatment group. These 3 groups were

separately treated with PBS (as control), 40 lg/ml gen-

tamicin or 40 lg/ml gentamicin ? 40 lg/ml EGCG for

24 h.

EdU Incorporation Assay

EdU (5-ethynyl-29-deoxyuridine, Life Technologies) was

prepared in DMSO as 100 mM stock solution and used at a

final concentration of 3 mM. Click-iT Alexa Fluor 555 Kit

(Life Technologies) was used to detect incorporated EdU.

The assay was performed according to manufacturer’s

specifications.

Hair Cell Electrophysiology

The hair cell electrophysiology procedures were modified

from published reports [35, 36] as follows: after cochlear

tissues treated separately with PBS, gentamicin or gen-

tamicin ? EGCG for 24 h, utricles and cochleae were

excised, mounted on glass coverslips, and viewed on an

Axioskop FS upright microscope (Zeiss) equipped with a

633 water-immersion objective and differential interfer-

ence contrast optics. Electrophysiological recordings were

performed at room temperature in solutions containing (in

mM): 137 NaCl, 5.8 KCl, 10 HEPES, 0.7 NaH2PO4, 1.3

CaCl2, 0.9 MgCl2, and 5.6 D-glucose, vitamins (1:100) and

amino acids (1:50) as in MEM (Invitrogen), pH 7.4

(311 mOsm/kg). Recording electrodes (2–4 MX) were

pulled from R-6 glass (King Precision Glass) and filled

with (in mM): 135 KCl, 5 EGTA-KOH, 5 HEPES, 2.5

Na2ATP, 2.5 MgCl2, and 0.1 CaCl2, pH 7.4 (284 mOsm/

kg). The whole-cell, tight-seal technique was used to

record mechanotransduction currents using an Axopatch

200B (Molecular Devices) for utricles and a Multiclamp

700A amplifier (Molecular Devices) for cochleae. Cells

were held at 84 mV, a physiologically relevant holding

potential. Currents were filtered at 2–5 kHz with a low-

pass Bessel filter, digitized at at least 20 kHz with a 12-bit

acquisition board (Digidata 1322A or 1440A), and

recorded using pClamp 8.2 software (Molecular Devices).

Inner hair bundles were deflected using a stiff glass probe

mounted on a PICMA chip piezo actuator (Physik Instru-

ments) driven by a 400-mA ENV400 amplifier (Piezosys-

tem Jena) filtered with an 8-pole Bessel filter at 10–40 kHz

to eliminate residual pipette resonance.

Western Blotting Assay

For western blotting analysis, mouse fibroblasts cells were

seeded in 6-well plates and treated for 24 h with PBS,

EGCG or L685458 (Sigma). L685458 is a potent, selective,

structurally novel c-secretase inhibitor [37]. To isolate

protein, cells were washed with PBS, and harvested using

the lysis buffer (50 mM tris�Cl pH = 6.8, 2 % SDS, 6 %

glycerol, 1 % b-mercapitalethanol, 0.004 % bromophenol

blue). Protein bands in the gel were then transferred to

Nitrocellulose Blotting membranes and incubated with the

appropriate primary antibody. The antibody dilutions were

as follows: 1:1000 for Notch (ab27526) and 1:1000 for

actin (ab1801). Membranes were incubated overnight at

4 �C and washed the next day with buffer (19 PBS, 0.05 %

Neurochem Res

123

Tween 20). Goat anti-rabbit secondary antibody was used

for secondary incubation for 1 h at room temperature.

Proteins were then visualized with chemiluminescent

substrates.

RNA Isolation and Quantitative RT-PCR Statistical

Analysis

Twenty-four hours after cochlear tissues treated separately

with PBS, gentamicin or gentamicin ? EGCG, cochlear

epithelia were isolated from these treated cochlear tissues

using dispase (1 mg/ml; Invitrogen) and collagenase

(1 mg/ml; Worthington) [34]. The total RNA was extracted

from cochlear epithelia using TRIzol reagent (Invitrogen)

and the amount of RNA was quantitated by a spectropho-

tometer (Nano-Drop ND-2000). Total RNA (2 lg) was

reverse transcribed to cDNA using the reverse transcriptase

kit from Bio-Rad according to the manufacturer’s instruc-

tions. The mRNA levels of the target genes were quantified

by real time PCR using SYBR green (Life Technologies) in

an ABI Prism 7500 real-time PCR system (Applied

Biosystems). Each PCR reaction was carried out in

triplicate.

Cell Counts

Hair cells were quantified after the cochlear tissues treated

with PBS, gentamicin or gentamicin ? EGCG and identi-

fied by Atoh1/GFP expression. High-power images of

cochlear explants were assembled and analysed in Adobe

PhotoShop CS3. ImageJ software (NIH) was used to

measure the length of analysed cochlear segments and hair

cell density (cells per 100 micron) was then calculated for

each segment. The total number of inner hair cells or outer

hair cells was counted in each of the four cochlear seg-

ments of 1200–1400 mm (apical, mid-apical, mid-basal,

and basal). Values are presented as mean ± standard error

(SEM) (n = 3, cochlear explants per condition were

analyzed from two independent experiments). Two-tailed

unpaired Student’s t tests were used to determine confi-

dence interval. p B 0.05 was considered as significant

differences.

Statistical Analysis

Two-tailed Student’s t tests were used to determine confi-

dence interval. The statistical differences between the ex-

perimental and control groups were analyzed by one-way

analysis of variance (ANOVA). Values are presented as

mean ± standard error (SEM). Statistical significance is

indicated as *p B 0.05, **p B 0.01, ***p B 0.001.

*p B 0.05 was considered as significant difference,

**p B 0.01 was considered as very significant difference,

***p B 0.001 was considered as extremely significant

difference.

Results and Discussion

Chemical Structure of EGCG and DIC Image

of Stage P2 Isolated Mouse Cochlear Explant

Tea is a popular worldwide beverage with numerous po-

tential beneficial effects such as refreshing and antioxidant

properties. The main active compounds in green tea are

polyphenols. In this study, we aimed to study the role of

EGCG (Fig. 1a), which is the most abundant and powerful

antioxidant in polyphenols in green tea leaves, in regen-

eration of cochlear hair cells. According to the procedure

from published reports [33, 34], we isolated the cochlear

tissues from the embryos of timed mated pregnant Atoh1/

GFP transgenic mice at E13 to E14.5 and cultured these

tissues in vitro. To further observe the cochlear tissues

carefully, the specimens were mounted in Slow Fade and

were captured the differential interference contrast (DIC)

and fluorescent images by an inverted microscope and a

cooled CCD camera. In Fig. 1b, the structure of the

cochlear tissues was shown by the DIC image, including

apex (AP), mid apex (MA), mid base (MB) and base (BA)

parts. Then we tested the expression of Atoh1/GFP in the

isolated cochlear tissues. The Atoh1/GFP was expressed in

inner and outer hair cell nuclei clearly (Fig. 1c).

EGCG Rescues Cochlear Hair Cell Number

from Gentamicin Damage

Gentamicin is an aminoglycoside antibiotic to treat many

types of bacterial infections, which is composed of a

mixture of related gentamicin components and fractions.

However, gentamicin can cause severe hearing and kidney

problems. Therefore gentamicin is frequently used as the

agent to induce damage in studies on cochlear hair cell

protection [38, 39]. Prior to our major experiments, we

examined the dosage effects of gentamicin and EGCG in

the culture, and found their respectively optimal concen-

tration both to be 40 lg/ml (supplementary Fig. S1),

therefore these dosages have been used throughout the

study. Therefore to examine whether EGCG could protect

the hair cells from damage caused by gentamicin, we

treated cochlear explant cultures with PBS as control,

gentamicin or gentamicin ? EGCG respectively (Fig. 2).

In the PBS treated group, the highly organised structure

composed by neat and orderly cells of cochlea could be

clearly seen, with three regular rows of outer hair cells

(OHC) and one regular row of inner hair cells (IHC).

Following the treatment with gentamicin, the hair cells

Neurochem Res

123

showed serious signs of damage and the number of hair

cells were significantly decreased, causing obvious struc-

tural lesions in cochlea. In the third group treated with the

combination of gentamicin and EGCG, the structure lesion

was rescued (Fig. 2a). Quantitative analysis in Fig. 2b di-

rectly indicated an 80 % reduction of hair cells cause by

gentamicin compared to the control. EGCG exhibited ex-

cellent protection against the damage caused by gentam-

icin, the number of hair cells has remained almost the same

as the control. In order to rule out the possibility that

EGCG only abolishes the adverse effect of gentamicin

rather than promoting hair cell proliferation originated

from dividing cells, EdU incorporation assay was per-

formed, where EdU can be actively incorporated into

newly synthesized DNA of dividing cells. No EdU labeled

hair cells were observed in control or hair cell-ablated

culture treated gentamicin, whereas a number of hair cells

treated with the combination of gentamicin and EGCG are

positively stained for EdU (Fig. 2c). These results indi-

cated EGCG regenerates cochlear hair cells from damages

induced by ototoxic drug gentamicin.

Rescue of the Gentamicin Damaged Hair Cell

Mechanotransduction by EGCG

According to the fluorescent images and cell counting ex-

periments, EGCG exhibit powerful ability to protect

cochlear hair cells from the damage caused by gentamicin,

evident by the number of hair cells as well as cochlea

structure. We further examined whether the cochlear hair

cells rescued by EGCG retain their mechanosensory

functions. We recorded mechanotransduction currents from

the cochlear hair cells in the same three experimental

groups (Fig. 3). To avoid using hair bundles damaged

during dissection, we selected the hair cells from the mid

apex cochlea for analysis. The three groups of hair cells

were bathed in 1.3 mM Ca2? with no other permeant ca-

tions. As expected, the hair cells treated with gentamicin

had significantly attenuated transduction currents, reduced

to only one third of the control group. However, the hair

cells treated with gentamicin ? EGCG had normal trans-

duction currents as control. These data provided strong

evidence that, apart from rescuing cochlea structural

Fig. 1 Epigallocatechin gallate and mouse cochlear explant.

a Chemical structure of epigallocatechin gallate (EGCG). b DIC

image of stage P2 isolated mouse cochlear explant. White lines

subdivide auditory sensory epithelium into apex (AP), mid apex

(MA), mid base (MB) and base (BA). c Atoh1/GFP is expressed in

inner and outer hair cell nuclei of stage P2 isolated mouse cochlear

explant. Scale bar 100 lm

Fig. 2 EGCG protects cochlear hair cells from ototoxic drug

gentamicin. a Hair cell from mid apex segment of cochlear (Fig. 1c,

white box) showing OHC, outer hair cells (OHC) and inner hair cells

(IHC) labeled with Atoh1/GFP (green) were treated for 24 h with

control (pbs), gentamicin (40 lg/ml in PBS) and gentam-

icin ? EGCG (both at 40 lg/ml in PBS). b Quantification of hair

cells treated with control, gentamicin and gentamicin ? EGCG

respectively as in a. c Hair cell from mid apex segment of cochlear

treated as in a, labeled with Atoh1/GFP (green) and EdU (red). Data

were presented by the mean ± SEM. *p\ 0.05 versus control. n.s.

not significant versus control. Scale bar 25 lm (Color figure online)

Neurochem Res

123

lesions damaged by gentamicin, EGCG also recovers the

mechanosensory function of the hair cells.

EGCG Efficiently Inhibits the Activity of Notch

Signalling Pathway

The differentiation and proliferation of hair cells have been

shown to be controlled by Notch signalling pathway. The

inactivation of the Notch signalling pathway can promote

the proliferation of hair cells. To further study the

mechanisms of EGCG protection of hair cells, we focused

on four Notch pathway target genes (Hes1, Hes5, Hey1 and

Hey5), which are also negative regulators of neurogenesis

[40–42]. In Fig. 4, we analysed the expression of Hes1,

Hes5, Hey1 and Hey5 in these 3 groups (the hair cells are

separately treated with PBS, gentamicin or gentam-

icin ? EGCG) by RT-PCR assay. EGCG treatment alone

didn’t have any effect on the expression levels of these

Notch effector genes (data not shown). As shown in Fig. 4,

compared to the control, we found these four genes had no

obvious changes at mRNA level when the hair cells were

treated with gentamicin. Whereas in the gentam-

icin ? EGCG group of hair cells, the mRNA levels of all

these four genes have been significantly down-regulated.

Therefore, EGCG can negatively regulate the expression of

Hes1, Hes5, Hey1 and Hey5. These results suggest that

EGCG may inhibit the expression of the target genes of

Notch signalling to cause the inactivation of Notch

signalling.

To further study how EGCG down-regulated Notch

signalling pathway, we analysed the expression of the

Notch pathway ligands Delta1, Jag1 and Jag2 in the 3

groups (the hair cells are separately treated with PBS,

gentamicin or gentamicin ? EGCG) by RT-PCR. In

Fig. 5a, compared to the control, the mRNA level of

Delta1, Jag1 and Jag2 had been down-regulated by Gen-

tamicin. However, we found that this down-regulation was

due to the reduced number of hair cells rather than low

expression of genes in intracellular level, since the protein

levels of Delta1 in individual hair cells were not affected

(data not shown). It was worth noting that, in the gen-

tamicin ? EGCG treated group, there was no obvious

change of the mRNA levels of these 3 genes compared to

the control. According to the results of Figs. 4 and 5a, we

hypothesized that the inhibitory effect of EGCG on Notch

signalling was not conferred by interfering with either its

upstream ligands or downstream effectors, but rather on the

Notch receptor itself. One of the top candidates of EGCG

target we examined was c-secrectase. To test our hy-

pothesis, we employed L685458, known inhibitor of c-secrectase [37], and compared its effect with EGCG in

mouse fibroblasts. The cells were separately treated with

PBS (as control), EGCG or L685458 for 24 h, and the

release of NICD was analysed by Western Blot assay. In

Fig. 5b, there was clear NICD bands (indicated by the ar-

row) in the control group, whereas in the EGCG or

L685458 treated groups there were no NICD bands. This

Fig. 3 Mechanotransduction currents recorded from cochlear hair

cells. a Representative families of currents recorded at -84 mV from

hair cells after control, gentamicin, gentamicin ? EGCG treatments

as indicated above. Cells were from the mid apex cochlears bathed in

1.3 mM Ca2?. The scale bar applies to all current families. b Stimulus

protocol as used in a

Fig. 4 EGCG treatment down-regulated Notch signalling pathway.

Relative mRNA levels of Notch signalling pathway effector genes

(Hes1, Hes5, Hey1, Hey5) were analyzed in control, gentamicin and

gentamicin ? EGCG treated cochlear after 24 h in culture using RT-

PCR. Data were presented by the mean ± SEM. n.s. not significant

versus control. *p\ 0.05 versus gentamicin alone

Neurochem Res

123

finding suggests that EGCG acts as an inhibitor of c-se-crectase, same as L685458, to suppress the proteolysis of

Notch receptor, and in turn down-regulates Notch sig-

nalling pathway.

Mammalian cochlea is composed of highly differentiated

and stabilized cells. Under normal circumstances, these cells

are incapable of regeneration when damaged by internal or

external factors. Therefore, this damage could lead to per-

manent hearing loss. To date, ototoxicity has been reported

of some anti-cancer drugs (CDDP etc.) and anti-bacterial

drugs (gentamicin etc.). However, the protection and curing

of hearing loss are still challenging. Notch signalling path-

way is a highly conserved cell signalling system and plays

an essential role in controlling the development of cochlea.

It has been shown that inactivation of the Notch signalling

pathway can promote the proliferation of hair cells [7, 20–

22]. In the recent studies, more and more scientists devote to

explore the targets in Notch signalling pathway to recover

the regeneration of damaged hair cells.

In this study, we found that EGCG has the ability to

protect cochlear hair cells from ototoxic drug gentamicin.

Both number (Fig. 2) and function (Fig. 3) of cochlear hair

cells can be recovered by EGCG and the Notch signalling

target genes has been suppressed under the treatment of

EGCG (Fig. 4). However, the Notch pathway ligands

Delta1, Jag1 and Jag2 have no obvious change at mRNA

level with the treatment by EGCG and gentamicin

(Fig. 5a). We speculated that the inactivation of Notch

signalling pathway by EGCG was caused by the Notch

receptor itself, rather than interfering with either Notch

upstream ligands or downstream effectors. To further il-

lustrate this essential mechanism, we examined the top

candidate of EGCG target c-secrectase. Our studies re-

vealed that the suppression of Notch signalling pathway by

EGCG depends on the inactivation of c-secrectase (Fig. 5).EGCG is the most abundant, and active compound in tea

polyphenols, which presents strong antioxidant activation

and has been reported to exhibit anti-cancer [43] and anti-

inflammatory [44] activities in biochemical research. Ac-

cording to abundant studies, EGCG could play different

roles in various pathways and targets to participate the

therapies of diseases. In 2008, Shimizu et al. [45] have

reported EGCG decreased the mRNA and protein levels of

IGF-1 and IGF-2, which might be an inhibitor of critical

RTKs involved in hepatocellular carcinoma proliferation.

In our research, compared with L685458, EGCG may be-

come a potential inhibitor of c-secrectase to suppress the

Notch signalling pathway and be useful for hearing-im-

paired recovery in clinical therapy. Further studies can use

the drug-tagging system with EGCG into the needed por-

tion of the inner ear [46], thereby making EGCG to repair

the hair cell efficiently and selectively.

Conclusions

In summary, we demonstrated EGCG could protect

cochlear hair cells against the damage from gentamicin in

the cochlear explant cultures. The mechanism is based on

the inactivation of c-secrectase by EGCG and eventually

causes suppression of Notch signalling pathway. In the

near future, we envision that the drug-tagging system with

EGCG into the targeted portion of the inner ear could be

useful for clinical research and bring emerging prospects

for hearing-impaired recovery.

Acknowledgments This study was supported by the Natural Sci-

ence Foundation of Shandong province (No. ZR2011HM047) to

Fig. 5 EGCG inhibited c-secrectase activity. a Relative mRNA

levels of Notch ligand genes (Delta1, Jag1, Jag2) were analyzed in

control, gentamicin and gentamicin ? EGCG treated cochlear after

24 h in culture using RT-PCR. Data were presented by the

mean ± SEM. *p\ 0.05 versus control. #p\ 0.05 versus gentamicin

and not significant versus control. b Mouse fibroblasts were treated

with control, EGCG or L685458 for 24 h and subjected to western

blot analysis using antibodies against Notch1. Arrow head indicated

released NICD. Anti-actin was used as loading control

Neurochem Res

123

Qirong Wang and the Natural Science Foundation of Shandong pro-

vince (No. ZR2014HQ076) to Wenwen Liu.

Conflict of interest The authors declare that they have no com-

peting interests.

References

1. Romand R (1997) Proliferation of auditory hair cells in organ-

otypic cultures of the cochlea. Eur J Cell Biol 74:138

2. Borg E, Viberg A (2002) Extra inner hair cells in the developing

rabbit cochlea. Hear Res 172:10–13

3. Bodmer D (2008) Protection, regeneration and replacement of

hair cells in the cochlea: implications for the future treatment of

sensorineural hearing loss. Swiss Med Wkly 138:708–712

4. Geleoc GS, Holt JR (2014) Sound strategies for hearing

restoration. Science 344:1241062

5. Liu QW, Chen P, Wang JF (2014) Molecular mechanisms and

potentials for differentiating inner ear stem cells into sensory hair

cells. Dev Biol 390:93–101

6. Cai TT, Seymour ML, Zhang HY, Pereira FA, Groves AK (2013)

Conditional deletion of Atoh1 reveals distinct critical periods for

survival and function of hair cells in the organ of Corti. J Neu-

rosci 33:10110–10122

7. Groves AK (2010) The challenge of hair cell regeneration. Exp

Biol Med 235:434–446

8. Chonko KT, Jahan I, Stone J, Wright MC, Fujiyama T, Hoshino

M, Fritzsch B, Maricich SM (2013) Atoh1 directs hair cell dif-

ferentiation and survival in the late embryonic mouse inner ear.

Dev Biol 381:401–410

9. Yang SM, Chen W, Guo WW, Jia SP, Sun JH, Liu HZ, Young

WY, He DZZ (2012) Regeneration of stereocilia of hair cells by

forced Atoh1 expression in the adult mammalian cochlea. Plos

One 7:e46355

10. Chen P, Segil N (1999) p27(Kip1) links cell proliferation to

morphogenesis in the developing organ of Corti. Development

126:1581–1590

11. White PM, Doetzlhofer A, Lee YS, Groves AK, Segil N (2006)

Mammalian cochlear supporting cells can divide and trans-dif-

ferentiate into hair cells. Nature 441:984–987

12. Lanford PJ, Lan Y, Jiang RL, Lindsell C, Weinmaster G, Gridley

T, Kelley MW (1999) Notch signalling pathway mediates hair

cell development in mammalian cochlea. Nat Genet 21:289–292

13. Baron M (2003) An overview of the Notch signalling pathway.

Semin Cell Dev Biol 14:113–119

14. Brou C, Logeat F, Gupta N, Bessia C, LeBail O, Doedens JR,

Cumano A, Roux P, Black RA, Israel A (2000) A novel prote-

olytic cleavage involved in Notch signaling: the role of the dis-

integrin-metalloprotease TACE. Mol Cell 5:207–216

15. Mumm JS, Schroeter EH, Saxena MT, Griesemer A, Tian XL,

Pan DJ, Ray WJ, Kopan R (2000) A ligand-induced extracellular

cleavage regulates gamma-secretase-like proteolytic activation of

Notch1. Mol Cell 5:197–206

16. D’Souza B, Miyamoto A, Weinmaster G (2008) The many facets

of Notch ligands. Oncogene 27:5148–5167

17. Fischer A, Schumacher N, Maier M, Sendtner M, Gessler M

(2004) The Notch target genes Hey1 and Hey2 are required for

embryonic vascular development. Gene Dev 18:901–911

18. Adam J, Myat A, Le Roux I, Eddison M, Henrique D, Ish-

Horowicz D, Lewis J (1998) Cell fate choices and the expression

of Notch, Delta and Serrate homologues in the chick inner ear:

parallels with Drosophila sense-organ development. Develop-

ment 125:4645–4654

19. Haddon C, Jiang YJ, Smithers L, Lewis J (1998) Delta–Notch

signalling and the patterning of sensory cell differentiation in the

zebrafish ear: evidence from the mind bomb mutant. Develop-

ment 125:4637–4644

20. Li W, Wu J, Yang J, Sun S, Chai R, Chen Z, Li H (2014) Notch

inhibition induces mitotically generated hair cells in mammalian

cochleae via activating the Wnt pathway. In: Proceedings of the

National Academy of Sciences of the United States of America

21. Jeon SJ, Fujioka M, Kim SC, Edge ASB (2011) Notch signaling

alters sensory or neuronal cell fate specification of inner ear stem

cells. J Neurosci 31:8351–8358

22. Mizutari K, Fujioka M, Hosoya M, Bramhall N, Okano HJ,

Okano H, Edge AS (2013) Notch inhibition induces cochlear hair

cell regeneration and recovery of hearing after acoustic trauma.

Neuron 77:58–69

23. Kanwar J, Taskeen M, Mohammad I, Huo C, Chan TH, Dou QP

(2012) Recent advances on tea polyphenols. Front Biosci (Elite

Ed) 4:111–131

24. Shah A, Kurlandsky S (2007) Green tea and bilberry extracts but

not vitamin C protect retinal epithelial cells from oxidative

damage. FASEB J 21:A172

25. Mukhtar H, Ahmad N (2000) Tea polyphenols: prevention of

cancer and optimizing health. Am J Clin Nutr 71:1698S–1702S

(discussion 1703S–1694S)

26. Pietta P, Simonetti P, Gardana C, Brusamolino A, Morazzoni P,

Bombardelli E (1998) Relationship between rate and extent of

catechin absorption and plasma antioxidant status. Biochem Mol

Biol Int 46:895–903

27. Fujiki H, Suganuma M, Okabe S, Sueoka E, Suga K, Imai K,

Nakachi K (2000) A new concept of tumor promotion by tumor

necrosis factor-alpha, and cancer preventive agents (-)-epigal-

locatechin gallate and green tea: a review. Cancer Detect Prev

24:91–99

28. Jin P, Wu HY, Xu GJ, Zheng L, Zhao JM (2014) Epigallocatechin-

3-gallate (EGCG) as a pro-osteogenic agent to enhance osteogenic

differentiation of mesenchymal stem cells from human bone

marrow: an in vitro study. Cell Tissue Res 356:381–390

29. Niu YC, Na LX, Feng RN, Gong LY, Zhao Y, Li Q, Li Y, Sun

CH (2013) The phytochemical, EGCG, extends lifespan by re-

ducing liver and kidney function damage and improving age-

associated inflammation and oxidative stress in healthy rats.

Aging Cell 12:1041–1049

30. Gordon NC, Wareham DW (2010) Antimicrobial activity of the

green tea polyphenol (-)-epigallocatechin-3-gallate (EGCG)

against clinical isolates of Stenotrophomonas maltophilia. Int J

Antimicrob Agents 36:129–131

31. Xiao X, Yang ZQ, Shi LQ, Liu J, Chen W (2008) Antiviral effect

of epigallocatechin gallate (EGCG) on influenza A virus. China J

Chin Mater Med 33:2678–2682

32. Doetzlhofer A, White PM, Johnson JE, Segil N, Groves AK

(2004) In vitro growth and differentiation of mammalian sensory

hair cell progenitors: a requirement for EGF and periotic mes-

enchyme. Dev Biol 272:432–447

33. Chen P, Johnson JE, Zoghbi HY, Segil N (2002) The role of

Math1 in inner ear development: uncoupling the establishment of

the sensory primordium from hair cell fate determination.

Development 129:2495–2505

34. Doetzlhofer A, Basch ML, Ohyama T, Gessler M, Groves AK,

Segil N (2009) Hey2 regulation by FGF provides a Notch-inde-

pendent mechanism for maintaining pillar cell fate in the organ of

Corti. Dev cell 16:58–69

35. Kawashima Y, Geleoc GS, Kurima K, Labay V, Lelli A, Asai Y,

Makishima T, Wu DK, Della Santina CC, Holt JR, Griffith AJ

(2011) Mechanotransduction in mouse inner ear hair cells re-

quires transmembrane channel-like genes. J Clin Investig

121:4796–4809

Neurochem Res

123

36. Pan BF, Geleoc GS, Asai Y, Horwitz GC, Kurima K, Ishikawa K,

Kawashima Y, Griffith AJ, Holt JR (2013) TMC1 and TMC2 are

components of the mechanotransduction channel in hair cells of

the mammalian inner ear. Neuron 79:504–515

37. Shearman MS, Beher D, Clarke EE, Lewis HD, Harrison T, Hunt

P, Nadin A, Smith AL, Stevenson G, Castro JL (2000) L-685,458,

an aspartyl protease transition state mimic, is a potent inhibitor of

amyloid beta-protein precursor gamma-secretase activity. Bio-

chemistry 39:8698–8704

38. Hirose K, Hockenbery DM, Rubel EW (1997) Reactive oxygen

species in chick hair cells after gentamicin exposure in vitro.

Hear Res 104:1–14

39. Lombarte A, Yan HY, Popper AN, Chang JS, Platt C (1993)

Damage and regeneration of hair cell ciliary bundles in a fish ear

following treatment with gentamicin. Hear Res 64:166–174

40. Tateya T, Imayoshi I, Tateya I, Ito J, Kageyama R (2011) Co-

operative functions of Hes/Hey genes in auditory hair cell and

supporting cell development. Dev Biol 352:329–340

41. Jung JY, Avenarius MR, Adamsky S, Alpert E, Feinstein E,

Raphael Y (2013) siRNA Targeting Hes5 Augments Hair Cell

Regeneration in Aminoglycoside-damaged Mouse Utricle. Mol

Ther 21:834–841

42. Zheng JL, Shou JY, Guillemot F, Kageyama R, Gao WQ (2000)

Hes1 is a negative regulator of inner ear hair cell differentiation.

Development 127:4551–4560

43. Du GJ, Zhang ZY, Wen XD, Yu CH, Calway T, Yuan CS, Wang

CZ (2012) Epigallocatechin gallate (EGCG) is the most effective

cancer chemopreventive polyphenol in green tea. Nutrients

4:1679–1691

44. Zhong Y, Chiou YS, Pan MH, Shahidi F (2012) Anti-inflam-

matory activity of lipophilic epigallocatechin gallate (EGCG)

derivatives in LPS-stimulated murine macrophages. Food Chem

134:742–748

45. Shimizu M, Shirakami Y, Sakai H, Tatebe H, Nakagawa T, Hara

Y, Weinstein IB, Moriwaki H (2008) EGCG inhibits activation of

the insulin-like growth factor (IGF)/IGF-1 receptor axis in human

hepatocellular carcinoma cells. Cancer Lett 262:10–18

46. Kanzaki S, Fujioka M, Yasuda A, Shibata S, Nakamura M,

Okano HJ, Ogawa K, Okano H (2012) Novel in vivo imaging

analysis of an inner ear drug delivery system in mice: comparison

of inner ear drug concentrations over time after transtympanic

and systemic injections. Plos One 7:e48480

Neurochem Res

123