god so loved the world that he gave his …"god so loved the world that he gave his only...
TRANSCRIPT
JJune 14th, 2020
Good Shepherd & Holy Family Parishes
www.berlingorhamcatholics.org
Office Address 151 Emery Street, Berlin, NH 03570
Phone: (603).752.2880 FAX: (603).752.1855
HHoly Family Church
7 Church Street Gorham, NH
Temporarily closed to walk-ins
Office Hours Tuesday - Thursday
9:00am - 12:00pm / 1:00pm - 3:00pm
Fridays: 9:00am - 12:00pm
St. Anne Church
345 Pleasant Street Berlin, NH
Reverend Kyle Stanton Pastor [email protected] Reverend David Wong Parochial Vicar [email protected] Deacon Mitch Couture Permanent Deacon [email protected]
Ben Robertson Director of Faith Formation [email protected] Sandy Patrick Director of Music [email protected]
Meet Our Pastoral Staff
Bridget Goudreau [email protected]
Victoria Goudreau Temp. Administrative Assistant [email protected]
Meet Our Office Staff
The churches will open during the day for private prayers from 9:00 am to 5:00 pm. Sundays 10:30 am to 5:00 pm. PPlease practice social distancing.
The office will be closed to walk-ins, if you have questions or concerns, please call us at 752-2880 or email Victoria Goudreau at: [email protected]
Holy Communion can only be brought to the homebound by a Priest or Deacon please contact Fr David 752-2880 at the office by email [email protected] to make a request.
Changes Due to COVID-19
The Collection/Offertory Will not be taken up during Mass after the “Prayers of the Faithful” as we are accustomed to. As a
way to observe social distancing we no longer have ushers “passing the basket”. Please look for the offertory collection
safes (see picture to the left) near the entrances of the church and simply deposit your offering in the opening at the top of
the safe as you enter the church. This is actually so much easier. We can use these boxes on weekends, Holy Day Masses and any time the Holy Spirit moves you to support the work of
the parish Financially. Page 2 - 979
Collections and Offertory Information
As you know, we have been working every year to restore and renew both Holy Family Church and St Anne Church. Our next endeavor is to restore the floor of St Anne Church
Choir loft. The floor does take a beating from those feet up there, as you can see it is very worn out! Please consider your continual and even increased financial support to our
parishes. We have done so much and have so much more to do. I thank Sandy Patrick our Director of Sacred Music for initiating this step and our facilities crew for always saying yes
to my requests to get things done. Will you say yes with your strong financial commitment? PPage 3 - 979
Fr. Kyle recently delivered a brief baccalaureate message to the
graduates of Gorham High school as he has for many years. This year he did so via video recording from Holy Family
Parish. It can be viewed online by going to the Gorham Middle High School
website and clicking the blue banner that says ‘Baccalaureate 2020’.
Fr. Kyle would like to extend his
congratulations to the graduates of Berlin High School as well. “We as a parish are very proud of our young
parishioners who have completed their studies and now look to the future. So
many of them have lived their faith despite being in a very secular
culture.”
As we return to Mass inside the Church safety precautions are being taken as we are still living in the time of a Pandemic. Here are a few pointers:
The Offertory (collection) will not be taken during the usual time. Please deposit your offertory in the new collection depository as you enter the Church. If you forget on the way in you can always make you an offering on the way out. Please consider signing up for Electronic Giving and reducing the need for our staff to handle loose cash or envelopes. Masks are encouraged for anyone above the age of 2. Please remove them before receiving Holy Communion Please practice social distancing, staying six feet away from others in the pew, while processing for Holy Communion, and while entering and exiting the Church. The sign of peace is suspended. The procession of the gifts of bread and wine is suspended. There are no social gatherings before or after mass Only the Clergy will distribute Holy Communion, they will wear masks and sanitize their hands before and after. They will repeatedly sanitize their hands during distribution, if necessary. No one should present a pix for the homebound. If you cannot safely or steadily walk to the altar rail please try to sit in one of the front pews (chairs) and a minister will come to you at the end of the distribution, remain in your seat and we will come to you. If we should ever miss the opportunity see you waiting in a pews and give you holy communion, our apologies, please remain patient and have someone tell us after Mass so we can give you holy communion. For receiving Holy Communion please read page 5.
Page 4 - 979
St. Anne Church
Saturday: 4:00 pm
Sunday: 8:30 am 6:00 pm
Holy Family Church
Saturday: 6:00 pm
Sunday: 10:30 am
Mass Times
Daily Mass: Monday though Saturday 8:00am at St. Anne.
Directions for Receiving Holy Communion
For both Holy Family and St. Anne Church: For those sitting in the two center row pews: Exit your pews as you usually would, but form one single file line down the center aisle staying six feet apart from all sides. Couples and families may walk
together. To receive Holy Communion: Please approach the Altar Rail, where marked by green tape, and kneel to receive on the tongue or stand to receive on the tongue
or the hand. If standing, do not step up on the step. Place your toes against the bottom step, we can reach you. After receiving communion, return to you pew by the isle with the pillars (at St. Anne) as you usually would. Throughout this process,
again please allow for six feet apart from those around you.
Additional directions for St. Anne Church: For those sitting in the two outer row pews: Exit the pew as you usually would, to walk along the wall towards the sanctuary. To receive Holy Communion: Please approach the Altar Rail, where marked by green tape, and kneel to receive on the tongue or stand to receive on the tongue or the hand. If standing, do not step up on the step. Place your toes against the bottom step, we can reach you. After receiving communion, return to you pew by the isle
with the pillars as you usually would. Throughout this process, again please allow for six feet apart from those around you.
See Pictures Below on How to Receive Holy Communion Standing or Kneeling at the Alter
Page 5 - 979
Parishioners properly kneeling to receive, 6 feet apart.
Parishioners properly standing to receive, 6 feet apart.
Eucharistic Procession Sunday, June 14th, is the Solemnity of the Body and Blood of Jesus Christ (otherwise known as “Corpus Christi”). On this feast, each year we renew our belief in the Eucharist—that Jesus Christ is truly present in the bread and wine consecrated at every Mass and reserved in the Tabernacle. This year, many of us observe the feast by returning to the public celebration of Mass in church, others continue to participate by watching from home and making a spiritual communion. After two of the Masses there will be a brief procession of the faithful to walk with Jesus in the Eucharist outside. If you attend the Sunday 8:30 am Mass at St Anne Church or the 10:30 am Mass at Holy Family Church this weekend you are invited to join us in a Eucharistic Procession. At St Anne Church, 8:30 am mass, after the reception of Holy Communion, congregants, who are able to do so, will be invited to follow the priest as he carries Jesus: through the center isle, down the grand stairs, around the church (staying on the sidewalk), back to the grand stairs and then back into the church. The Priest will bless everyone present, those at home and the city. Those who would prefer not to climb down and up the stairs or navigate the city sidewalk please remain in your pew and pray with us. We will soon return to the church and conclude prayer with you. At Holy Family Church, 10:30 am Mass, after the reception of Holy Communion, congregants, who are able to do so, will be invited to follow the priest as he carries
Jesus though the center isle, down the stairs, walking up Church Street (staying on the sidewalk), then making a loop through Holy Family Cemetery, and then back into the church. The Priest will bless everyone present, those at home and the town. Those who would prefer not to climb down and up the stairs or navigate the town sidewalk please remain in your pew and pray with us. We will soon return to the church and conclude prayer with you.
It is important to practice social distancing walking six feet apart from each other. This also makes it safer to
remove masks, if needed, outside and reduce any chance the mask might reduce your visibility as you
walk. Remember social distancing. Please choose only to attend one of the processions, not both.
Page 6 - 979
SRA End of the School Year Parade Celebration Come join us for our “End of the School Year Parade” to celebrate the students’ great success during this inaugural year. Some of our teachers have been working hard to hash out the details and here they are: When: Friday, June 12 @ 6:00 p.m. Where: Railroad St. The parade will begin at the Gorham Park and finish at SRA parking lot. ~We ask that viewers of the parade park in the free parking spaces along Railroad Street. Viewers may get out of their cars while following social distancing. (It’s a pretty long stretch from Gorham Park to the SRA parking lot so this should not be a problem.) SRA Staff will be decorating their cars and driving down the parade path while waving at students. We may also have a fire truck and police cruiser joining our little parade! Once the parade is finished families are asked to follow in their cars to the SRA parking lot and line up as was normally done for pick-up. Here you will be able to hand the teachers any school supplies that need to be returned and they will hand you any labeled personal belongings left at the school. (This event is set up so families are all able to stay in their vehicles. However, if you need to leave your vehicle to check on belongings we ask that you park your car in a space that will not block the pick-up line and please follow social distancing rules. If able, please wear a mask.) All students will receive a special end of the year gift at this event! Below is a list of all items that need to be returned to the school. All items can be placed in the original basket they were received. We all can't wait to see you all there!
K-2nd Grade All workbooks math/spelling/handwriting (used and unused) Composition books and any worksheets that were completed Workbooks can be returned after Mrs. Lawrence finishes grading them. (Maps can be kept at home)
English Language Arts 3/4 Grades
"A Book of Gladness" 5th Grade
"These are Our People" 6th Grade
"This is Our Heritage" "Robin Hood" novel (belongs to the Gorham Public library)
7th Grade "These Are Our Freedoms" "Robin Hood" novel (belongs to the Gorham Public library) Blue saint story book
Science 5th-7th Grade
Science Textbooks Theology K-7th Grade
All Bibles and Catechisms Math 4th Grade
HMH Textbook Additional Items
All school Chromebooks Any book checked out from the Gorham Library All baskets that take home materials were put in Saint Story Books
3rd & 4th Grade: Series of a smaller collection saint stories 5th-7th Grade: Individual saint books
~ No items need to be returned for Pre-K (Unless Miss Meadow reached out to you), nor for 3rd, 5th, 6th & 7th grade Math. ~ All items can be placed in the original basket they were received. Page 7 - 979
PPage 8 - 979
Thank You to the Notre Dame High School Class of
1954 for your donation of $450 towards the St. Anne Church repairs fund!
A Fresh Look for Holy Family Parish
ne Church repa
Holy Family parishioner, Bridget Goudreau, did some much needed weeding this past
weekend. She even planted some new flowers in the front to help give Holy Family
Church a new and fresh look!
“This is the meaning of the parable: The seed is the word of God..."
Luke 8:11
PPage 7 - 979
Mass Intentions
St. Anne Church In Memory of: Roger Frenette
By: Wife
Rectory In Memory of:
Scott Fletcher (6) By: Mom & Dad
Holy Family Church
In Memory of: Chuck Pearson By: wife, Jackie
WEEKDAY MASSES Monday, June 15th
8:00am - Berlin Louis Gagnon by Wife, Rita & family; Sylvio & Violet Vien by Family; Leo Roy by Ann & Roland Gosselin; June Couture by Family
Tuesday, June 16th 8:00am - Berlin George Cloutier by cousins, Mary Lou & Rachel; Deceased Members of the Labrecque Family by Richard & Jeannette Houle
Wednesday, June 17th 8:00am - Berlin Rene Ramsey by Wife, Jacqueline & Sons
Friday, June 19th 8:00am - Berlin Sr. Anne Marie Rooney by Family; Coakley Rooney by Family
Saturday, June 20th 8:00am - Berlin Maurice Legere (11) by Peter & Louise Marquis; George Arsenault by his wife; Elmer Blackburn by Family; Rosaire Cote Family by Cote Family
NEXT WEEKEND’S MASSES
Saturday, June 20th
4:00pm - Berlin George 'Bill' Lamarre by wife, Cecile; Cecile Parent by Estate; Ernest Gagne by Family; Fernand Fortin by John & Helene
6:00pm - Gorham For the people of Good Shepherd & Holy Family Parishes.
Sunday, June 21st 8:30am - Berlin Maurice A. Couture by Deacon Mitch & Terry; Lionel Gagnon by Paul & Theresa; Leon Cloutier (15) by wife, Jeanne & family; Denis Bisson by Mom & Dad
6:00pm - Berlin Lionel Roy (3) by Wife, Beverly & Family; Henry Hachez by wife, Yvette; Aurore Jutras by Roland & Terry Montminy
10:30am - Gorham Henry Gilbert (76) by daughter in law, Esther
Page 9 - 979
Sanctuary Lamps
Mother Marie Rivier Food Pantry
The pantry is located on 153 Grafton Street Berlin, NH
Open Hours are Tuesday and Friday from 2:00pm – 3:30 p.m.
Honor Your Loved Ones Memory
Honor your loved ones memory by purchasing a memorial brick to be placed in the brick walkway
leading to the original steeple bell at Holy Family Church.
Memorial bricks for a loved one are available for $150 per brick.
If you are interested, call or email the office to request the form.
Good Shepherd Parish
Weekly Offertory Budget $7,700.00 Offertory collection 5,785.00 (-1,915.00) Youth Formation 195.50 Adult Formation 66.00 Maintenance 142.00 Energy 145.50 Ascension 762.50 Other Collections 1298.50
Holy Family Parish
Weekly Offertory Budget $2,500.00 Offertory collection 1,728.50 (-771.50) Youth Formation 82.00 Adult Formation 17.00 Maintenance 53.00 Energy 52.00 Other Collections 222.00
Weekly Collections
O God, my heavenly Father, To You, I come as child adoring For every marvel, You have made.
May who I am now and will become Give You glory, gratitude,
and praise. Jesus, Son in the Father’s being, In You, is mercy
and compassion, For You came as Savior and friend. May all that I do reflect Your love To those whose brokenness love can mend. Holy Spirit, One with Father and Son, Through You, come inspiration and grace To live in faith and
heaven seek. May my heart and soul and mind rejoice In the
forgiveness that sets me free. Amen.
Page 10 - 979
979 Good Shepherd & Holy Family Parishes, Berlin/Gorham, NH (I) John Patrick Publishing Company • 1-800-333-3166 • www.jppc.net
GENERAL CONTRACTINGResidential & Commercial
Free Est. • New Construction • Remodeling603-723-9816 • [email protected]
603-723-3636Berlin, NH
912 West Milan Rd., Milan, NH 03588603-449-6674
Jim Welch • Cell: 603-723-8626
Debi Davis - Sales AssociateCell: 603-723-2828
180 Main St., Berlin, NH 03570www.BadgerRealtyNorth.com
107 Main St., Berlin, NH603.752.1520
Kelli Poulin - PresidentFull Time Goldsmith
BRYANTFuneral Homes
Local Family Owned & OperatedOn Site Crematory
752-1344B. Edward Bryant
Berlin & Gorham, NH
Moe Tremblay(HandyMan)
Don’t Let Any Small Job,Become A BIG Problem!603-728-7977/752-6665
COMMERCIAL & RESIDENTIALDRIVEWAYS • PARKING LOTS
Edward Stanley, Owner603-586-4554 • Rt. 2, JeffersonFree Estimate 1-800-287-6007www.CentralPavingNH.com~”All Work Guaranteed”~
• SCRAP METAL & RCY. • STEEL & DEMOLITION • TRAILERS & USED EQUIP. SALESROBERT A. CHAPMAN Sr.
Off.:603-466-9966Cell: 603-723-9985
603-752-0003www.TeamNER.com
232 Glen AvenueBerlin, NH 03570
603-752-6466756 Third Ave.
Berlin, NH 03570www.mrautoberlin.comRichard & Mike Grondin
360 Main St., Gorham NH752-6445
Investments & Tax Planning
LINDASJOSTROM
BranchManager
Rosaries From Flowers“Handmade from the Flowers
of your Loved One”
841 MAIN STREET TEWKSBURY, MA 01876 www.rosariesfromfl owers.com
(978) 851-9103
232 Jericho Rd., Berlin, NH 03570603-215-6002 | F. 603-215-6415
www.jerichooutdoors.net
Custom Made SandwichesPizzas • Burgers • Desserts
& Lots MoreWe Serve a Full Breakfast, Lunch & DinnerWe Do Catering For Any And All Occasions
174 Jericho Rd., Berlin, NH 03570 603-752-5600
7 Main St., Errol, NH
(603) 482-7777Visit Us At:llcote.com
WE BUY & SELL GUNS
Since 1957
ResidentialCommercial
IndustrialPO Box 597
33 Jericho RoadBerlin, NH 03570603-752-1370
And General Contracting
Mallory’s Army FoundationUnited Together In The Fight Against Bullying...
Don’t Just Teach Kindness... BE KINDNESS!www.MallorysArmy.com
(973) 440-8657 [email protected]
It’s easy to join our mailing list! Just send your email address by text message:
Text MALLORYSARMY to 22828 to get started.
Message and data rates may apply.
What’s My Name?The #WHATSMYNAME Movement asks everyone to simply ask drivers “What’s my name?” before entering
their vehicle to make sure it is the car they are supposed to enter.
In Rememberance of Samantha Josephson
#WHATSMYNAME
MOMS 244 MAIN ST., LANCASTER, NH
LANCASTER | GROVETON“The North Country’s Newest and Soon to be Largest Polaris Dealer”
MOMS North Country MOMS North Country PowersportsPowersports
TRAILERS • MOTORCYCLESTRAILERS • MOTORCYCLES
WHERE SALES & SERVICE GO WHERE SALES & SERVICE GO HAND IN HANDHAND IN HAND
603-788-2281
We have access to vast fi nancing resources and off er personalized fi nancing to suit each customer’s unique needs.
Maureen Patry603-752-7569
146 Main St., Berlin NH 03570FINDNEWROADS©
EXIT REALTY TRAILBLAZERSIndependently Owned and Operated
Chris Capitelli Broker/OwnerCell: 603.915.1531
[email protected] www.ExitRealtyTrailblazersNH.com
39 Union Street • Berlin, NH 03570603-752-1500 • 800-439-1508
www.caron-building.com
Advertise Your Business Here800-333-3166
ext. 161www.jppc.net
Jennifer StewartAssociate Broker/ Realtor
(603) 723-4215 cell/text • NH License # 057293 RE/MAX Northern Edge Realty
NH license # 059307 RE/MAX 100% club for outstanding sales
achievement (2013-2018) RE/MAX Hall of Fame!
Weddings, Portraits, Events and More
Sonlight Photography LLCBy Sarah Roy
[email protected] • 603.383.2076
Private & Public Healthcare - Law Enforcement, Public Safety - Offi cers & First Responders - Food & Agri-culture - Energy Sector - Waste & Waterwaste - Transportation & Logis-tics - Public Works & - Infrastructure - Communications & Information Technology Workers - Community & Government Workers - Critical Man-ufacturing - Chemical & Hazardous Materials Financial Services - Defense Industrial Base - Commercial Facili-ties Workers - Residential & Shelter Services & Facilities - Hygiene Prod-ucts & Services - Private & Public Healthcare - Law Enforcement, Public Safety - Offi cers & First Responders - Food & Agriculture - Energy Sec-tor - Waste & Waterwaste - Trans-portation & Logistics - Public Works & - Infrastructure - Communications & Information Technology Workers - Community & Government Work-ers - Critical Manufacturing - Chemi-cal & Hazardous Materials Financial Service - Private & Public Healthcare - Law Enforcement, Public Safety - Of-fi cers & First Responders - Food & Agriculture - Energy Sector - Waste & Waterwaste - Transportation & Logis-tics - Public Works & - Infrastructure - Communications & Information Technology Workers - Community & G W k C i i l M
To all those essential workers keeping us safe,
yourservice is
invaluable & appreciated.
afety --- OffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOf cercercercercececeFirst Responders - Food & d & d & d &d &d &d &d &d &d d d d d d AgAgAAAAgAgAgAgrAgrAgrAgAgAgrAg
y Sector - WaWaWaWaWaWaWaWaWaWaWaWaWaWaWastestestestestesteteestestestestestestest &Waterwaste - Transportatatatttttttttion ionion ionioionion ioniononion onion & L& L& L& L& L& L& L& Lo& L& L& L& L& & gis
cs - Public Works & - Infrnfrnfrnfrnfrnfrnfnfnfnfnfrnfrnfrnfrnfrastructuucucucucucucuc rCommunications & IIIIIIIIIIIIIIInfornfornfornfornfornfornfornfonfornfornfornfornfornfornformatimammmmmmammmmmm o
echnology Workers - ComComComComComComComComComComComComComComCommunimumumummmmmmm ty &Workers -s -s -s -s -s -s -s -s -s -s --- CriCriCriririririiiiriiticacaticacacaticaticaticaticaticaticaticaticaticatical Ml Ml Ml Ml Ml Ml Ml Ml Ml Ml Mal l Ml M n
acturing - Chemical &&&&&&&&&&&l & l & l &l & HazaHazaHazaHazaHazaHazaHazaHazaHazaHazaHHHH rdourdrdrdrdrdrdrrdrdrdrdncial Services - DDDDDDDDDefeeeeeeefefens
dustrial Base - Commercial Faciles Workerssrssssss - RResidesidesidesidesidesidesidesididesidesidesidesideentientientientientientientientientiential &aaaaaaaa Shelteervices & FFFFFFFFFFFFFFFaciaciacilacilacilacilacilacilacilcilaciacilacilacilacilitieitieitieitieitieitietieitietieitieies -s -s - - - - - HyHyHygiHyHyHyHyHyHyHyHyHH ene Prodcts & Services es esesesesesesesesessss - Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Priiiiivivivivivivivaivaivativ e & Publiealthcare - Lawawawawawawawawawaw EnfEnfEnfnfnfnffnfnffffffforcorcorcorcorcorcorcorcorcorcorcorceorc ment, Publiafety - Officercercercercerererercercers &&&s &s &s &s &s &s &s &s &s &s &s &s & FiFiFiFFirsFFFFFFFFF t ResponderFood & Agrgrgrgrrrrriculiculiculiculiculiculiculiculiculiculicuiculiculicic turturturturturturureturturturturturtutut - Energy Secr - Waste e eee ee & Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& ttttterwtttettt aste - Trans
ortation &&&&& & & & & &&&&&& LogiLogiLogiLogiLogiogiogiogiLogiLogLogLogiLogLogLog stististststststisticststststsss s - Public Work- Infrastrtrrrrrrrrrrrrrrucucucucucuctctctuucucucucuctucuc re -e e e ee e CommunicationInformatioatioatioiooooooioooooonnn Tn Tn Tn Tn Tn Tn Tn Tn Tn Tn Tn Tn Technology Worker
CoCoCoCoCoCoCoCoCoCoCoCoCoCoCommunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunity ity ity ity ity ity ity ity ity ity ity ity ityityity & Go&&&&&&&&&&& vernment Works - CrCrCrCrCrCrCrCrCrCrCrCrCrCrCriticiticiticticiticiticticiticiticticiiticiticiticitical al Mal Mal Mal Mal Mal Mal Mal a anufacturing - Cheml l ll & Ha& Ha& H& H& H& H& H& H& H& H&&&&& zardzardzardzardzardzardardardardardardardzardardardooooooous ooooooo Materials Financia
ervrvrvvvvice ice ice ice ice iceicicice icicicicicic - P- Pr- Pr- P- P- P- P- - - P- - - - ivativaivivvvvvvv e & Public HealthcarLaw EnEEE forcforcforcffforcforcforforcforcforcforceement, Public Safety - O
To all thosenforcement, Public Sanforcement, Public Sa
essentiallture - Energylture - EnergyWater aste TraWater aste Tra
workerscs - Public Wors - Public WorCommunicatioCommunicatio
keepingechnology Wochnology Woovernment Wovernment W
us safe,acturing Caterials Finanaterials Finan
yournicationnicationWorkerWorke
service isovernment Workovernment Workacturing Chemacturing Chem
invaluable &us Materials Financiaus Materials Financiae & Public Healthcare & Public Healthcar
ment, Public Safety - OSafety - Othan
k yo
u
g gyWatateatttatatatattaaaaaa rwaswaswawaswwaswwwwaswwaswwwwasswasawawaw ste -tettttttetttee Transportation & Log
cccscccccc - PPPPPPPPPPPPPPPubliubliubliubliublililublibubbliubuubuuubu c c WoWoc WoWWWoWoWoWWoWWWoWc oc WoWWc Woc WWc WWWWccc rks rksrrksrkskrrkkkkrrk & - & -& -&& -&& -&&&&&&& --&&&& -&&& -&&& InfrInfInfrnfrInfInfrnfrII ffI ffInI fnfI fInfnfInnfnfn astructuCCoCoCoCoCoCoCCoCCoCCCCoooCCCCCCC mmunmmunmmmmmmunmm nmmmm nmmmmm nmmmm nnm nm nmmmm nicaticacaticaticatcatcatcatcattcatcatcatcattcatcatcatccacatcccatcc ionsionsionsnsionononsonsiooionssonsonsonsionoonoooon & I&&& I&& I&&& I& II& I& I& I&& nfornfornfornfornfornforforfornfornfoforfnfnfornfornfornfornforfofornfornforrrrnnffforrrmatimatimatmatmatiamatimatmattimatiatitimatiattatmatmatimattattmattmmmati
echhhhhhhhhnolonononoonnoloonolonnoln lonnolonooolonolonolonnnn on oonoo ggy Wgggg orkers - Community
Commercial Rates are at an All Time Low. Contact us today to get a free analysis to see if
we can help Save you money with your monthly payments on your commercial property.
Multi-Family, Retail, Offi ce Building, Apartment and Condos. Can close in as little as 45 days!
Four season customer service is our top priority.
www.duqfunding.com1650 Market Street - Suite 3600
Philadelphia, PA 19103
979 Good Shepherd & Holy Family Parishes, Berlin/Gorham, NH (B) John Patrick Publishing Company • 1-800-333-3166 • www.jppc.net
In Memory ofRaymond & Muriel Binette
From Your Children
Making Sense Of InvestingRichard R. (Rich) LandryCFP®, CRPC®
Financial Advisor820 Main St., Berlin, NH 03570Bus 603-752-7612Toll Free 888-752-9226
®
Certifi ed Locksmith603-915-1162
115 Sweden St., Berlin [email protected]
Like us on Facebook
Plumbing & Heating
Plumbing & HeatingWater SystemsPumps & More!
603-449-343982 Success Rd., Milan
Fully Insured
Reclaim Your Space! LLC
Organizing &Cleaning ServicesFor Less Clutter &
More Living!Debra L. Bousquet
752-5339 • 723-5882
Bisson’s Sugar House61 Cates Hill Rd
603-752-1298
1.800.423.3536603.752.8473
Fax: 603.752.268715 Industrial Park Rd., Berlin NH
Mr. Pizza160 Main St.Gorham, NH
Take Out & DeliveryCall 466-5573
www.mrpizzanh.com
Restaurant & Dairy Bar603-752-6210
1826 Riverside DriveBerlin, NH 03570
190 Mt. Forist StreetBerlin, NH 03570
603-752-4244
167 Glen Ave. • PO Box 529Berlin, NH 03570603-752-6111Fax 603-752-3825
Family Restaurant288 Main St., Gorham, NH 03581
603-466-2501Family Owned & Operated Since 1964
Lynn & Mike Tremblay, Owners/Operators
752-2150
Commercial Off set Printing
Color Copies • Bulk Mailing Services
Wide Format & Vinyl Cutting Now Available!!
www.smithandtownprinters.com
Gorham HouseFlorist
Gorham HouseFlorist
Full Service Flower Shop10 Exchange St., Gorham
Owner: Terri Colarusso466-5588
St. KieranSt. KieranCommunity CenterCommunity Center
for theor the ArtsEnjoy a Full Year of
Quality Live Entertainment603-752-1028603-752-1028
stkieranarts.orgstkieranarts.org
E M R • P.O. B 7B , NH 03570 • 603.752.1000
A H
A la Mémoire deJean-Louis
et de Cécile Blais
19 Pleasant St.Berlin, NH 03570
752-1050
M C -W M
Est.1937 • Award Winning CompanyLocations in Shelburne & Groveton
T C MGlass Art & Color Laser Etchwork
Cleaning-Lettering-Bronze Plaques
603-466-5134 or [email protected]
In ThanksgivingSteve & Cindy
Griffi n
Marie’s Boutique, LLCWoman’sWoman’sApparelApparel603.466.5811
101 Main St., Gorham, NH 03581
Open 10am - Monday thru SaturdayAnn Marie Demers
SpecializedOversizedTransportation603-723-5985 Milan, NH 03588
Weekend Appointments Available!Saturday & Sunday
8am to 3pmFor illnesses, injuries or mildlare up of COPD & AsthmaCall Page Hill Of ice at752-2900
Barn weddings at the base of Black Mountain in Jackson
603.383.8916www.thebarnatwhitneys.com
www.shovelhandlepub.com
Wayne MicucciAssociate Broker, REALTOR®
Northern Edge Realty232 Glen Ave., Berlin, NH 03570
(603) 723-7015 • Offi ce: 603-752-0003
[email protected] • www.teamner.comEach Offi ce Independently Owned & Operated.
Council 506White Mountain Council
Berlin-Gorham
Assembly 632Msgr. Patrick Walsh
Berlin-GorhamIn Service to One. In Service To All.
Information about membership in the Knights of Columbus callRoland Theberge, Grand Knight at 603-752-7033
Greg Estrella Membership Director at 603-752-7118Visit us at kofccouncil506.org
Kristy & Glen BadgerEldercare Advisor & Owner
kristyb@assistedlivinglocators.comNewHampshire.AssistedLivingLocators.com
Free Service Matching Seniors with the right living solutions at the right time
Long Term Care | Memory CareHospice Care & Skilled Nursing29 Providence Ave., Berlin, NH 03570
603-752-1820
Dino AmatoREALTOR®
Direct: 603-275-1191Offi ce: 603-569-HOMEEmail: [email protected] White Mountain Highway, North Conway, NH 03860Each offi ce is independently owned and operated
herefore let us not pass judgement on one another any longer, but
rather decide never to put a stumbling block or hindrance in the way of a brother.
- Romans 14:13
hhhpa
hhT
COMPLIMENTS OF DAVIS TREE EXPERT CO.
BERLIN SPRINGBERLIN SPRING INC.Big Rig, Truck, And Utility Trailer SpringsBig Rig, Truck, And Utility Trailer Springs
Service All Makes & ModelsService All Makes & ModelsBig Rigs and Passenger VehiclesBig Rigs and Passenger VehiclesOffi ce/Garage: 603-752-6230Offi ce/Garage: 603-752-6230
[email protected]@berlinspring.com755 Third Ave., Berlin, NH 03570755 Third Ave., Berlin, NH 03570
Serving Berlin, Gorham and Surrounding CommunitiesOn-site Crematory
A Local, Caring, Professional Staff
72 High Street • Berlin, NH 03570 • 603-752-1212 • www.fl eury-patry.com
Fleury-Patry Funeral Home
Cremations from $2195 | Traditional Funerals $4300 plus merchandise & third party charges