goal 3.04 assess the impacts of genomics on individuals and society. scrapetv.com blog.makezine.com...
TRANSCRIPT
![Page 1: Goal 3.04 Assess the impacts of genomics on individuals and society. scrapetv.com blog.makezine.com There are many ways that humans have manipulated genes](https://reader036.vdocuments.site/reader036/viewer/2022081513/56649e035503460f94aef041/html5/thumbnails/1.jpg)
Goal 3.04 Assess the impacts of genomics on individuals and society.
scrapetv.com
blog.makezine.comThere are many ways that humans have manipulated genes.
Let’s look at a few of these…
![Page 2: Goal 3.04 Assess the impacts of genomics on individuals and society. scrapetv.com blog.makezine.com There are many ways that humans have manipulated genes](https://reader036.vdocuments.site/reader036/viewer/2022081513/56649e035503460f94aef041/html5/thumbnails/2.jpg)
1. ARTIFICIAL BREEDING/SELECTION1. ARTIFICIAL BREEDING/SELECTION
Artificial Breeding/Selection is …
z.about.commichaeldodsracing.co.uk
When humans select who mates to whom to improve the breed.
![Page 3: Goal 3.04 Assess the impacts of genomics on individuals and society. scrapetv.com blog.makezine.com There are many ways that humans have manipulated genes](https://reader036.vdocuments.site/reader036/viewer/2022081513/56649e035503460f94aef041/html5/thumbnails/3.jpg)
Artificial Breeding/SelectionArtificial Breeding/Selection
Artificial Breeding/Selection is …
When humans select which plants to cross to improve the plant.
Wild mustard plantWild mustard plant
Wild rose plantWild rose plant
Wild corn called TEOSINTE was bred to create today’s corn
Wild corn called TEOSINTE was bred to create today’s corn
nescent.org
![Page 4: Goal 3.04 Assess the impacts of genomics on individuals and society. scrapetv.com blog.makezine.com There are many ways that humans have manipulated genes](https://reader036.vdocuments.site/reader036/viewer/2022081513/56649e035503460f94aef041/html5/thumbnails/4.jpg)
Artificial Breeding/SelectionArtificial Breeding/Selection
What if humans selected which humans to mate?!
Mother Teresa?Mother Teresa?
static.howstuffworks.com
Venus Williams?Venus Williams?
2009.wimbledon.org
Rosalind Franklin?Rosalind Franklin?
gandt.blogs.brynmawr.edu
Angelina Jolie?Angelina Jolie?
www.enjoyfrance.com
?
![Page 5: Goal 3.04 Assess the impacts of genomics on individuals and society. scrapetv.com blog.makezine.com There are many ways that humans have manipulated genes](https://reader036.vdocuments.site/reader036/viewer/2022081513/56649e035503460f94aef041/html5/thumbnails/5.jpg)
2. BIOTECHNOLOGY2. BIOTECHNOLOGY
Biotechnology is …
The use of organisms or their products to improve human life.
HOW DO THEY DO IT?! biotechresearchandfinance.com
![Page 6: Goal 3.04 Assess the impacts of genomics on individuals and society. scrapetv.com blog.makezine.com There are many ways that humans have manipulated genes](https://reader036.vdocuments.site/reader036/viewer/2022081513/56649e035503460f94aef041/html5/thumbnails/6.jpg)
The code is UNIVERSAL!
• Since all living organisms… – use the same DNA– use the same code
book– read their genes the
same way
• Since all living organisms… – use the same DNA– use the same code
book– read their genes the
same way
Remember that ALL organisms are made using
the same four DNA bases A,T,C,G.
AND
Those bases code the same way in ALL
organisms using A,U,C,G.Remember that ALL organisms are made using
the same four DNA bases A,T,C,G.
AND
Those bases code the same way in ALL
organisms using A,U,C,G.
![Page 7: Goal 3.04 Assess the impacts of genomics on individuals and society. scrapetv.com blog.makezine.com There are many ways that humans have manipulated genes](https://reader036.vdocuments.site/reader036/viewer/2022081513/56649e035503460f94aef041/html5/thumbnails/7.jpg)
CLONING = making genetically identical copiesCLONING = making genetically identical copies
HSW: Genetics: Cloning Time: 03:20
Reversing Human Destruction through Cloning
http://player.discoveryeducation.com/index.cfm?guidAssetId=4CDB02CD-6421-42B4-AF9D-B940E1393F19&blnFromSearch=1&productcode=US
The ControversyThe Controversy
![Page 8: Goal 3.04 Assess the impacts of genomics on individuals and society. scrapetv.com blog.makezine.com There are many ways that humans have manipulated genes](https://reader036.vdocuments.site/reader036/viewer/2022081513/56649e035503460f94aef041/html5/thumbnails/8.jpg)
Let’s look at Dolly
![Page 9: Goal 3.04 Assess the impacts of genomics on individuals and society. scrapetv.com blog.makezine.com There are many ways that humans have manipulated genes](https://reader036.vdocuments.site/reader036/viewer/2022081513/56649e035503460f94aef041/html5/thumbnails/9.jpg)
Human Genome ProjectIdentified the entire sequence of DNA bases for humans.Human Genome ProjectIdentified the entire sequence of DNA bases for humans.
There are 3.2 billion bases in the human genome.There are 3.2 billion bases in the human genome.
What do you think can be done now that we
know the order (sequence) in which all 3.2 billion bases occur?
Human Genome Project Explained 15:24 min
http://www.5min.com/Video/The-Human-Genome-Project-Applications-151426688
![Page 10: Goal 3.04 Assess the impacts of genomics on individuals and society. scrapetv.com blog.makezine.com There are many ways that humans have manipulated genes](https://reader036.vdocuments.site/reader036/viewer/2022081513/56649e035503460f94aef041/html5/thumbnails/10.jpg)
Now
, how
man
y ch
rom
osom
es d
o yo
u se
e?Is
this
a m
ale
or fe
mal
e?
How many chromosomes do you see?How many chromosomes do you see?
IT’S A GIRL!
KARYOTYPE = display of chromosomes laid out in pairs from largest to smallest. Sex chromosomes are always placed at the end.KARYOTYPE = display of chromosomes laid out in pairs from largest to smallest. Sex chromosomes are always placed at the end.
![Page 11: Goal 3.04 Assess the impacts of genomics on individuals and society. scrapetv.com blog.makezine.com There are many ways that humans have manipulated genes](https://reader036.vdocuments.site/reader036/viewer/2022081513/56649e035503460f94aef041/html5/thumbnails/11.jpg)
How many chromosomes? Which gender (sex)?
How many chromosomes? Which gender (sex)?
It’s a BOY!
![Page 12: Goal 3.04 Assess the impacts of genomics on individuals and society. scrapetv.com blog.makezine.com There are many ways that humans have manipulated genes](https://reader036.vdocuments.site/reader036/viewer/2022081513/56649e035503460f94aef041/html5/thumbnails/12.jpg)
How scientists and doctors use karyotypeshttp://learn.genetics.utah.edu/content/begin/traits/predictdisorder/
Karyotypes are a way or organizing chromosomes to make it easier to study and identify certain characteristics within an
individual’s DNA.
Karyotypes are a way or organizing chromosomes to make it easier to study and identify certain characteristics within an
individual’s DNA.
Make a Karyotype http://learn.genetics.utah.edu/content/begin/traits/karyotype/
![Page 13: Goal 3.04 Assess the impacts of genomics on individuals and society. scrapetv.com blog.makezine.com There are many ways that humans have manipulated genes](https://reader036.vdocuments.site/reader036/viewer/2022081513/56649e035503460f94aef041/html5/thumbnails/13.jpg)
What do you get when you cross …
instanta.blogspot.com
i57.photobucket.comclouddragon.wordpress.com
smh.com.au
www.chemcases.comwww.scienceclarified.com
Genetic Engineering is…
Inserting genes from one organism into a different organism.
Genetic Engineering is…
Inserting genes from one organism into a different organism.
![Page 14: Goal 3.04 Assess the impacts of genomics on individuals and society. scrapetv.com blog.makezine.com There are many ways that humans have manipulated genes](https://reader036.vdocuments.site/reader036/viewer/2022081513/56649e035503460f94aef041/html5/thumbnails/14.jpg)
How do we do mix genes??• Genetic engineering
– find gene– cut DNA in both organisms– paste gene from one creature into other creature’s
DNA– insert new chromosome into organism– organism copies new gene as if it were its own– organism reads gene as if it were its own– organism produces NEW protein:
Remember: we all use the same genetic code!
![Page 15: Goal 3.04 Assess the impacts of genomics on individuals and society. scrapetv.com blog.makezine.com There are many ways that humans have manipulated genes](https://reader036.vdocuments.site/reader036/viewer/2022081513/56649e035503460f94aef041/html5/thumbnails/15.jpg)
Cutting DNA
• DNA “scissors”– enzymes that cut DNA– Restriction Enzymes
• used by bacteria to cut up DNA of attacking viruses
• EcoRI, HindIII, BamHI
– cut DNA at specific sites• enzymes look for specific base sequences
ACTGA ATTCGGATCA TGACTTAAGCC TAGT
![Page 16: Goal 3.04 Assess the impacts of genomics on individuals and society. scrapetv.com blog.makezine.com There are many ways that humans have manipulated genes](https://reader036.vdocuments.site/reader036/viewer/2022081513/56649e035503460f94aef041/html5/thumbnails/16.jpg)
Restriction enzymes• Cut DNA at specific sites - leave “sticky ends”
GTAAC GAATTCACGCTTCATTGCTTAAG TGCGAA
GTAACGAATTCACGCTTCATTGCTTAAGTGCGAA
restriction enzyme cut site
restriction enzyme cut site
Locate the section of gene we want.Restriction EnzymeRestriction Enzyme
DNA double strand.
![Page 17: Goal 3.04 Assess the impacts of genomics on individuals and society. scrapetv.com blog.makezine.com There are many ways that humans have manipulated genes](https://reader036.vdocuments.site/reader036/viewer/2022081513/56649e035503460f94aef041/html5/thumbnails/17.jpg)
Recombining DNA – Use the same enzymes for both pieces.– leave “sticky ends” on both– can glue DNA together at “sticky ends”
GTAAC GAATTCACGCTTCATTGCTTAAG TGCGAA
Cut the gene
you want.
Cut the gene
you want.
GTAAC GAATTCACGCTTCATTGCTTAAG TGCGAA
GTAACCATTGCTTAAG
Cut the chromosome
you want to add
the gene to
.Cut th
e chromosome
you want to add
the gene to
.
Recombinant DNA:DNA with foreign genes inserted.
GAATTCACGCTT TGCGAA
Use “sticky ends” to glue
the two genes
together.
Use “sticky ends” to glue
the two genes
together.
DNA Ligase joins the ends.DNA Ligase joins the ends.
![Page 18: Goal 3.04 Assess the impacts of genomics on individuals and society. scrapetv.com blog.makezine.com There are many ways that humans have manipulated genes](https://reader036.vdocuments.site/reader036/viewer/2022081513/56649e035503460f94aef041/html5/thumbnails/18.jpg)
Why use Bacteria??• Recombined Gene produces needed protein in a
different organism.• Use Bacteria because it reproduces rapidly and is
one-celled so easy to grow.
How can bacteria read human DNA?
10 bacteria
20 minutes
40 bacteria
60 minutes
160 bacteria
100 minutes
5120 bacteria
200 minutes
1,310,720 bacteria1,310,720 bacteria
6 hours
![Page 19: Goal 3.04 Assess the impacts of genomics on individuals and society. scrapetv.com blog.makezine.com There are many ways that humans have manipulated genes](https://reader036.vdocuments.site/reader036/viewer/2022081513/56649e035503460f94aef041/html5/thumbnails/19.jpg)
Bacterial DNA and plasmids
• Single circular chromosome– only one copy = haploid– no nucleus
• Other DNA = plasmids! bacterialchromosome
plasmids
![Page 20: Goal 3.04 Assess the impacts of genomics on individuals and society. scrapetv.com blog.makezine.com There are many ways that humans have manipulated genes](https://reader036.vdocuments.site/reader036/viewer/2022081513/56649e035503460f94aef041/html5/thumbnails/20.jpg)
How can plasmids help us?
• A way to get genes into bacteria easily– insert new gene into plasmid– insert plasmid into bacteria = vector– bacteria now expresses new gene
• bacteria make new protein
+
transformedbacteriagene from
other organism
plasmid
cut DNA
recombinantplasmid
vector
glue DNA
![Page 21: Goal 3.04 Assess the impacts of genomics on individuals and society. scrapetv.com blog.makezine.com There are many ways that humans have manipulated genes](https://reader036.vdocuments.site/reader036/viewer/2022081513/56649e035503460f94aef041/html5/thumbnails/21.jpg)
Grow bacteria…make more
growbacteria
harvest (purify)protein
transformedbacteria
plasmid
gene fromother organism
+
recombinantplasmid
vector
![Page 22: Goal 3.04 Assess the impacts of genomics on individuals and society. scrapetv.com blog.makezine.com There are many ways that humans have manipulated genes](https://reader036.vdocuments.site/reader036/viewer/2022081513/56649e035503460f94aef041/html5/thumbnails/22.jpg)
Virtual Lab 12:Bacterial Transformation-Ampicillin Resistance
![Page 23: Goal 3.04 Assess the impacts of genomics on individuals and society. scrapetv.com blog.makezine.com There are many ways that humans have manipulated genes](https://reader036.vdocuments.site/reader036/viewer/2022081513/56649e035503460f94aef041/html5/thumbnails/23.jpg)
Other uses of Genetic Engineering:• Genetically modified organisms (GMO)
– enabling plants to produce new proteins• Produce medications: insulin
– Used by diabetics
• Extend growing season: fishberries – strawberries with an anti-freezing gene from flounder
• Improve quality of food: golden rice – rice producing vitamin A
![Page 24: Goal 3.04 Assess the impacts of genomics on individuals and society. scrapetv.com blog.makezine.com There are many ways that humans have manipulated genes](https://reader036.vdocuments.site/reader036/viewer/2022081513/56649e035503460f94aef041/html5/thumbnails/24.jpg)
Genetic Engineering and MedicineGenetic Engineering and Medicine
Gene Therapy = using genetic engineering to combat disease.
Hemophilia – patients suffer from a lack of Factor VIII.
Hemophilia – patients suffer from a lack of Factor VIII.
![Page 25: Goal 3.04 Assess the impacts of genomics on individuals and society. scrapetv.com blog.makezine.com There are many ways that humans have manipulated genes](https://reader036.vdocuments.site/reader036/viewer/2022081513/56649e035503460f94aef041/html5/thumbnails/25.jpg)
Stem Cells…the key to our future?Stem Cells…the key to our future?
Stem CellsStem Cells
Red Blood Cellsfor accident victimsand transfusions.
Red Blood Cellsfor accident victimsand transfusions.
Muscle Cellsto repair damaged or weak muscles.
Muscle Cellsto repair damaged or weak muscles.
Heart Cellsto repair damaged heart tissues.
Heart Cellsto repair damaged heart tissues.
![Page 26: Goal 3.04 Assess the impacts of genomics on individuals and society. scrapetv.com blog.makezine.com There are many ways that humans have manipulated genes](https://reader036.vdocuments.site/reader036/viewer/2022081513/56649e035503460f94aef041/html5/thumbnails/26.jpg)
Stem Cells
![Page 27: Goal 3.04 Assess the impacts of genomics on individuals and society. scrapetv.com blog.makezine.com There are many ways that humans have manipulated genes](https://reader036.vdocuments.site/reader036/viewer/2022081513/56649e035503460f94aef041/html5/thumbnails/27.jpg)
BiotechnologyGel Electrophoresis
http://videos.howstuffworks.com/hsw/11820-genetics-using-dna-evidence-to-solve-crimes-video.htm
![Page 28: Goal 3.04 Assess the impacts of genomics on individuals and society. scrapetv.com blog.makezine.com There are many ways that humans have manipulated genes](https://reader036.vdocuments.site/reader036/viewer/2022081513/56649e035503460f94aef041/html5/thumbnails/28.jpg)
Many uses of restriction enzymes…• Now that we can cut DNA with restriction
enzymes…– we can cut up DNA from different people… or
different organisms… and compare it
– why?• forensics• medical diagnostics• paternity• evolutionary relationships • and more…
![Page 29: Goal 3.04 Assess the impacts of genomics on individuals and society. scrapetv.com blog.makezine.com There are many ways that humans have manipulated genes](https://reader036.vdocuments.site/reader036/viewer/2022081513/56649e035503460f94aef041/html5/thumbnails/29.jpg)
Comparing cut up DNAGel Electrophoresis
• How do we compare DNA fragments?– separate fragments by size
• How do we separate DNA fragments?– run it through a gelatin – gel electrophoresis
• How does a gel work?
http://www.dnatube.com/video/701/DNA-Fingerprinting
![Page 30: Goal 3.04 Assess the impacts of genomics on individuals and society. scrapetv.com blog.makezine.com There are many ways that humans have manipulated genes](https://reader036.vdocuments.site/reader036/viewer/2022081513/56649e035503460f94aef041/html5/thumbnails/30.jpg)
Gel electrophoresis
• A method of separating DNA in a gelatin-like material using an electrical field– DNA is negatively charged– when it’s in an electrical field it
moves toward the positive side
+–
DNA
“swimming through Jello”
![Page 31: Goal 3.04 Assess the impacts of genomics on individuals and society. scrapetv.com blog.makezine.com There are many ways that humans have manipulated genes](https://reader036.vdocuments.site/reader036/viewer/2022081513/56649e035503460f94aef041/html5/thumbnails/31.jpg)
• DNA moves in an electrical field…– so how does that help you compare DNA
fragments?• size of DNA fragment affects how far it travels
– small pieces travel farther– large pieces travel slower & lag behind
Gel electrophoresis
+–
DNA
![Page 32: Goal 3.04 Assess the impacts of genomics on individuals and society. scrapetv.com blog.makezine.com There are many ways that humans have manipulated genes](https://reader036.vdocuments.site/reader036/viewer/2022081513/56649e035503460f94aef041/html5/thumbnails/32.jpg)
Running a gel
1 2
cut DNA with restriction enzymes
fragments of DNAseparate out based on size
3
Stain DNA– ethidium bromide
binds to DNA– fluoresces under UV
light
![Page 33: Goal 3.04 Assess the impacts of genomics on individuals and society. scrapetv.com blog.makezine.com There are many ways that humans have manipulated genes](https://reader036.vdocuments.site/reader036/viewer/2022081513/56649e035503460f94aef041/html5/thumbnails/33.jpg)
Virtual Lab 11Restriction Enzyme Cleavage and Electrophoresis
Lab: Electrophoresis
![Page 34: Goal 3.04 Assess the impacts of genomics on individuals and society. scrapetv.com blog.makezine.com There are many ways that humans have manipulated genes](https://reader036.vdocuments.site/reader036/viewer/2022081513/56649e035503460f94aef041/html5/thumbnails/34.jpg)
DNA Fingerprinting
• Why is each person’s DNA pattern different?– sections of “junk” DNA
• doesn’t code for proteins• made up of repeated patterns
– CAT, GCC, and others
– each person may have different number of repeats• many sites on our 23 chromosomes with
different repeat patterns
GCTTGTAACGGCCTCATCATCATTCGCCGGCCTACGCTTCGAACATTGCCGGAGTAGTAGTAAGCGGCCGGATGCGAA
![Page 35: Goal 3.04 Assess the impacts of genomics on individuals and society. scrapetv.com blog.makezine.com There are many ways that humans have manipulated genes](https://reader036.vdocuments.site/reader036/viewer/2022081513/56649e035503460f94aef041/html5/thumbnails/35.jpg)
Uses: Evolutionary relationshipsUses: Evolutionary relationships
• Comparing DNA samples from different organisms to measure evolutionary relationships
• Comparing DNA samples from different organisms to measure evolutionary relationships
–
+
DNA
1 32 4 51 2 3 4 5
turtle snake rat squirrel fruitfly
![Page 36: Goal 3.04 Assess the impacts of genomics on individuals and society. scrapetv.com blog.makezine.com There are many ways that humans have manipulated genes](https://reader036.vdocuments.site/reader036/viewer/2022081513/56649e035503460f94aef041/html5/thumbnails/36.jpg)
Sequencing DNA: http://www.pbs.org/wgbh/nova/genome/sequ_flash.html