RESEARCH Open Access

Glycyrrhizin improves the pathogenesis ofpsoriasis partially through IL-17A and theSIRT1-STAT3 axisHuang Qiong†, Ling Han†, Nanxue Zhang†, Huyan Chen, Kexiang Yan, Zhenghua Zhang, Ying Ma* and Jinhua Xu*

Abstract

Background: The anti-inflammatory effect of glycyrrhizin has been widely recognized, while the specificmechanism of glycyrrhizin in psoriasis remains poorly understood.

Results: In the imiquimod-induced mouse model of psoriasis (IMD), we found that glycyrrhizin can substantiallyimprove the adverse symptoms in mice. The hematoxylin-eosin staining results showed that glycyrrhizin can alsoimprove the pathological state of skin cells in IMD mice. Using enzyme-linked immunosorbent assay (ELISA), wefound that glycyrrhizin substantially inhibited the expression of IL-17A and IFN-γ in the serum of IMD mice. In orderto simulate the effect of IL-17A on keratinocytes in psoriasis, we treated HaCaT cells with 100 ng/mL IL-17A (IL-17A-HaCaT cells) for 48 h. Then, using cell-counting kit-8 (CCK-8) and ELISA assays, we found that glycyrrhizin inhibitedthe proliferation of IL-17A-HaCaT cells and reversed the promotion of IL-6, CCL20, and TNF-α induced by IL-17A.Further, western blotting (WB) results indicated that glycyrrhizin promoted the expression of SIRT1 and inhibitedthe expression of STAT3 and phosphorylated STAT3 (p-STAT3). By treating IL-17A-HaCaT cells with EX-527 (a potentand selective inhibitor of SIRT1), combined with CCK-8 and WB experiments, we initially found that EX-527 inhibitedthe proliferation of IL-17A-HaCaT cells and promoted the expression of STAT3, p-STAT3, and acetylated STAT3 (a-STAT3). However, when glycyrrhizin was added at the same time, the proliferation of IL-17A-HaCaT cells increased,and the expression of STAT3, p-STAT3, and a-STAT3 reduced. We then knocked down the expression of SIRT1 viasmall interfering RNA in IL-17A-HaCaT cells, and the results were consistent with those of EX-527.

Conclusions: Together, these results indicated that glycyrrhizin improved psoriasis by inhibiting the expression ofIL-17A and IFN-γ in vivo and suppressed the proliferation of IL-17A-HaCaT cells and the expression of STAT3, p-STAT3, and a-STAT3 by upregulating SIRT1 in vitro.

Keywords: Psoriasis, Glycyrrhizin, IL-17A, SIRT1-STAT3 pathway

© The Author(s). 2021 Open Access This article is licensed under a Creative Commons Attribution 4.0 International License,which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you giveappropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate ifchanges were made. The images or other third party material in this article are included in the article's Creative Commonslicence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commonslicence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtainpermission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to thedata made available in this article, unless otherwise stated in a credit line to the data.

* Correspondence: yingmayingma@126.com; jinhuaxu1989@163.com†Huang Qiong, Ling Han and Nanxue Zhang contributed equally to thiswork.Department of Dermatology, Huashan Hospital Affiliated to Fudan University,Shanghai 200040, China

Qiong et al. BMC Immunology (2021) 22:34 https://doi.org/10.1186/s12865-021-00421-z

Highlight

1. Glycyrrhizin improves psoriasis by reducing thesecretion of IL-17A and IFN-γ in serum.

2. Glycyrrhizin may inhibit the proliferation ofkeratinocytes by reducing the expression of IL-17Aand IFN-γ.

3. Glycyrrhizin may inhibit the proliferation ofkeratinocytes through the SIRT1-STAT3 pathway.

4. Glycyrrhizin inhibits the expression of p-STAT3and a-STAT3 through a SIRT1-dependent pathway

IntroductionClinically, glycyrrhizin is often used to treat patientswith acute and chronic hepatitis, liver poisoning, andearly liver cirrhosis [1, 2], and the efficacy of glycyrrhizinin improving psoriasis has attracted the attention of cli-nicians. A previous study showed that glycyrrhizin com-bined with methotrexate (MTX) can be used as aneffective alternative therapy for the treatment of erythro-dermic psoriasis with bullous pemphigoid [3]. Moreover,glycyrrhizin combined with acitretin can improve psoria-sis by regulating T helper 17 (TH17) cells [3]. However,the clinical value of glycyrrhizin in psoriasis has not beenfully developed.The imbalance in the dynamic interaction of immune

cells and keratinocytes plays important roles in the ini-tial and maintenance stages of psoriasis [4]. Psoriasis isconsidered as the chronic T helper 1(TH1)/TH17-medi-ated inflammatory disease [5]. IL-17A is mainly synthe-sized and secreted by TH17 cells [6] and is consideredto play a key role in the pathogenesis of psoriasis [7, 8].Moreover, IL-17A is also key to the interaction betweenTH17 cells and keratinocytes, specifically, the secretionof many cytokines and chemokines, such as TNF-α, IL-6, IL-17A and CCL20 in keratinocytes were stimulatedby TH17 cells-secreted IL-17A [9, 10]. Therefore, weaimed to further explore the relationships between gly-cyrrhizin, TH17 cells, and keratinocytes.The imbalance between pro-inflammatory and anti-

inflammatory signals may lead to the development ofpsoriasis [11]. Keratinocytes are the main source of in-hibitory cytokines, which maintains the skin in an in-flammatory quiescent state [4]. A previous study hasshown that SIRT1 inhibits keratinocyte proliferation andpromotes keratinocyte differentiation [12]. Therefore,SIRT1 may regulate the release of inhibitory cytokinesby affecting the keratinocyte proliferation and play a keyrole in the occurrence and development of psoriasis.A previous study reported that oxidative stress con-

tributes to the pathogenesis of psoriasis, and the activa-tion of SIRT1 inhibits the MAPK, NF-κB, and STAT3oxidative stress signaling pathways, thereby down-regulating inflammatory factors and inhibiting excessive

keratinocyte proliferation [13]. The activation of STAT3in keratinocytes partly stimulates the activation of Lang-erhans cells through IL-1α, and their presence is vital tothe pathogenesis of psoriasis through the production ofIL-23 [11]. Therefore, we speculate that the SIRT1-STAT3 axis may be a potential mechanism for glycyrrhi-zin to regulate the pathogenesis of psoriasis, which isworthy of further study.Based on the above findings, our study sheds light on

the following important connections between glycyrrhi-zin, IL-17A, SIRT1, STAT3, and the pathogenesis ofpsoriasis. First, we set out to characterize the regulatoryrelationship between glycyrrhizin and IL-17A in vivo.We found that glycyrrhizin inhibits the expression of IL-17A and its related genes, IL-6, CCL20, and TNF-α. Inaddition, the regulatory relationship between glycyrrhi-zin and the SIRT1-STAT3 axis was investigated in vitro,and the results showed that glycyrrhizin inhibits STAT3expression by promoting SIRT1 expression. In summary,these data indicate that glycyrrhizin may play a thera-peutic role in improving psoriasis through IL-17A andthe SIRT1-STAT3 axis.

Materials and methodsClinical samplesClinical skin samples from female patients with psoriasisand healthy persons (mean age: psoriasis 38.6 years vs.healthy volunteers 41.3 years) were collected from Hua-shan Hospital (Shanghai, China). Under local anesthesia,4 mm punch biopsy samples were obtained from thelower limb skin of psoriasis patients and healthy donors.The experiment was approved by the Huashan HospitalClinical Research Ethics Committee. All methods werecarried out in accordance with relevant guidelines andregulations, and all participants/donors provided writteninformed consent for the study.

Animal experimentsAll male BALB/c mice (10 weeks old, 25–35 g) were ob-tained from the Animal Experiment Centre of HuashanHospital and fed under sterile specific-pathogen-free(SPF) conditions. The mice were randomly assigned intofour groups (n = 6 each) for further study, and the micein group A were not treated. In group B-D, mice wereevenly smeared with 62.5 mg imiquimod cream on theirbacks once a day for three consecutive days. On thefourth day, 50 mg imiquimod cream was applied evenlyon the backs of the mice once a day for two consecutivedays. On day seven, the psoriasis animal models (imiqui-mod-induced mouse model of psoriasis, IMD) were suc-cessfully established in the B-D groups. In group B,normal saline was intragastrical injected for the positivecontrol group (model group). MTX has been used totreat psoriasis and other skin diseases for more than 50

Qiong et al. BMC Immunology (2021) 22:34 Page 2 of 11

years [13]. For mice in group C, 20 mg/kg MTX wasintragastrical injected for the treatment control group(model + MTX group). In addition, in mice of group D,20 mg/kg glycyrrhizin was intragastrical injected for thetreatment observation group (model + glycyrrhizingroup). In groups B–D, the treatment was performedonce a day for four consecutive days, and on the elev-enth day, the back skin of the mice in groups A-D wasphotographed, and the mice were sacrificed by cervicaldislocation. On the eleventh day, the Psoriasis Area andSeverity Index (PASI) was used to monitor and gradethe severity of psoriasis-like lesions. The detection indi-cators included skin erythema, scale and thickness.Among them, 0 represents no clinical signs; 1 representsmild clinical signs; 2 represents moderate clinical signs;3 represents obvious clinical signs; 4 represents very ob-vious clinical signs [14]. The animal experiments usedmeet the requirements of animal welfare and animal eth-ics of Huashan Hospital, and are approved by the EthicsCommittee of animal experiments of Huashan Hospital.All animal experiments met the ARRIVE guidelines [15],and the mice were anesthetized with isoflurane and thensacrificed by cervical dislocation. The experimental de-sign in vivo was shown in supplement Figure 1.

HE stainingAfter the tissues were baked, dewaxed and rehydrated,they were stained with hematoxylin for 10 min and eosinfor 8 min, and were treated with xylene I, xylene II, andxylene III for transparency. The infiltration of immunecells was evaluated by two pathologists in a double-blindmanner.

Cell culture and treatmentHaCaT cells were purchased from the cell bank of theChinese Academy of Sciences and met the cell line STRidentification criteria. HaCaT cells were cultured in Dul-becco’s Modified Eagle’s Medium (L110, Basamedia Biol-ogy, Shanghai, China) supplemented with 10% fetalbovine serum (Thermo Fisher), 100 g/mL penicillin, and100 g/mL streptomycin (L110, Basamedia Biology,Shanghai, China) in a moist incubator with 5% CO2 at37 °C. Wild type HaCaT cells were treated with IL-17A(100 ng/mL), glycyrrhizin (0.5, 1.0, 1.5 and 2 μM), andIL-17A (100 ng/mL) + glycyrrhizin (2 μM) for 48 h. TheIL-17A-HaCaT cells (treated with 100 ng/mL IL-17A)were treated with glycyrrhizin (2 μM) and EX527 (100nM, SIRT1 inhibitor, Med Chem Express) for 48 h.

Cell-counting kit-8 (CCK-8)HaCaT cells were seeded in a 96-well plate at a densityof 5 × 103 cells per well (triple replication). The next day,after the HaCaT cells adhered, the culture solution wasdiscarded, and a mixture of 10 μL CCK-8 solution +

90 μL serum-free medium was added, and the cells werecultured in an incubator for 2 h. After 2 h, the absorb-ance of the cells at 450 nm was measured using a micro-plate reader (SpectraMax M2e; Molecular Devices,Sunnyvale, CA, USA). The above steps were repeated forfive consecutive days.

Immunohistochemical experimentsFor the immunohistochemical analyses, skin sampleswere dewaxed and rehydrated, followed by endogenousperoxidase quenching, antigen retrieval (saline sodiumcitrate, autoclaving), and blocking with 10% goat serum.The sections were then incubated with anti-rabbitSTAT3 antibody (1:2000, CST, USA), phosphorylatedSTAT3 (p-STAT3) antibody (1:2000, CST, USA), acety-lated STAT3 (a-STAT3) antibody (1:2000, CST, USA),SIRT1 antibody (1:2000, CST, USA), AMPK antibody (1:2000, CST, USA), phosphorylated AMPK (p-AMPK)antibody (1:2000, CST, USA), and GAPDH antibody (1:2000, CST, USA). After washing with PBS, the sectionswere incubated for 50 min with secondary antibody,stained with DAB working solution, and then counter-stained with hematoxylin.

Enzyme linked immunosorbent assay (ELISA)The cell lysis solution was collected to detect the expres-sion of IL-6 (1:2000, Abcam, USA), TNF-α (1:2000,Abcam, USA), and CCL20 (1:2000, Abcam, USA) ac-cording to the manufacturer’ s instructions. The absorb-ance was then measured with a microplate reader(SpectraMax M2e, USA) at 450 nm.

Real-time fluorescence quantitative PCR (RT-PCR)Trizol reagent (Thermo Fisher Scientific) was used toextract total RNA from cells and tissues, and a reversetranscription kit (TaKaRa) was used to reverse the totalRNA to cDNA. The primers used in this experimentwere listed in Table 1. The fluorescent quantitative PCRkit (TaKaRa) was used to perform RT-PCR and 2-ΔΔCTwas used to calculate the relative gene expression.GAPDH was used as an internal reference.

Western blottingThe protein concentrations were determined using thebicinchoninic acid protein assay kit (Beyotime, China).All protein concentrations were adjusted to 2 mg/mL,and then separated by 8% SDS-PAGE. Then, the pro-teins were transferred to a nitrocellulose membrane(731,809, Millipore, USA) and blocked with 5% skimmedmilk for 1 h, and the membrane was sequentially incu-bated with a primary antibody and a horseradishperoxidase-conjugated secondary antibody. The anti-bodies used in WB experiments were the same as thoseused in immunohistochemistry experiments. Final, the

Qiong et al. BMC Immunology (2021) 22:34 Page 3 of 11

enhanced chemiluminescence method was used to de-tect protein levels.

Cell transfectionHaCaT cells in the logarithmic phase were incubated insix-well plates at a density of 5 × 104 cells/mL overnight.The next day, HaCaT cells were transfected with siRNAs(Table 2) using Lipofectamine 3000 (L3000015, ThermoFisher Scientific), and incubated for 24 h in accordancewith the manufacturer’s instructions. Then, fresh mediawas added, and the corresponding stimulant was addedto the media for 48 h.

Statistical analysisData are presented as the mean ± S.D. of at least threeindependent experiments. Non-parametric statisticaltests of variance was performed using SPSS 19.0 soft-ware (SPSS Inc., Chicago, IL, USA) to determine thestatistical significance of the results between two groups.P < 0.05 was considered statistically significant.

ResultsGlycyrrhizin can improve the adverse symptoms ofpsoriasis in IMDAs shown in Fig. 1a (upper part), on the seventh day, theobvious clinical symptoms of psoriatic lesions appearedon the back skin of IMD mice, specifically as keratino-cyte hyperproliferation, erythema, scales, etc. However,after four consecutive days of treatment with MTX orglycyrrhizin, the adverse symptoms of IMD mice sub-stantially improved (Fig. 1a, lower part). Furthermore,on the 11th day, HE staining showed cytokeratinizationand infiltration of inflammatory cells in the skin cells ofuntreated IMD mice, while these pathological phenom-ena substantially improved in the skin cells of MTX- orglycyrrhizin-treated IMD mice (Fig. 1b). In order to

further investigate whether the potential mechanism ofglycyrrhizin for the treatment of psoriasis involves theregulation of the inflammatory response, ELISA wasused to detect the expression of IL-17A and IFN-γ inthe serum of wild-type mice or IMD mice, with or with-out treatment. The results showed that IL-17A and IFN-γ expression in the serum of IMD mice treated withMTX or glycyrrhizin was substantially reduced com-pared to expression levels in non-treated mice (Fig. 1c).Together, glycyrrhizin may improve the clinical symp-toms and pathological status of IMD by inhibiting theexpression of IL-17A and IFN-γ in the serum.

Glyrrhizin inhibits the expression of IL-17A-relatedinflammatory cytokines in HaCaT cells through itscytotoxicityAs shown in Supplement Figure 2 A, glycyrrhizin in-hibits the proliferation of HaCaT cells in a dose-dependent manner, and 1.0–2.0 μM glycyrrhizin arecytotoxic. In addition, only 2 μM glycyrrhizin can signifi-cantly inhibit the secretion of IL-6 (Supplement Figure 2B), CCL-20 (Supplement Figure 2 C) and TNF-α (Sup-plement Figure 2 D) in HaCaT cells. Therefore,glycyrrhizin-mediated inflammation inhibition is due toits own cytotoxicity. The CCK-8 results showed that2 μM glycyrrhizin substantially reduced the proliferationof HaCaT cells, while IL-17A substantially promoted theproliferation of HaCaT cells (Fig. 2a). Compared withIL-17A group, the proliferation of HaCaT cells was sub-stantially reduced in IL-17A + 2 μM glycyrrhizin group(Fig. 2a). In addition, as shown in Fig. 2b, the expressionof IL-6 and CCL20 substantially increased in the lysateand supernatant of IL-17A-HaCaT cells. However, whenglycyrrhizin was added, glycyrrhizin substantially re-versed the increased expression of IL-6 (Fig. 2b) andCCL20 (Fig. 2c) induced by IL-17A. Moreover, theELISA results showed that glycyrrhizin substantially re-duced the expression of TNF-α in the lysate and super-natant of HaCaT cells and effectively reversed TNF-αstimulation by IL-17A (Fig. 2d). Together, glycyrrhizinsuppresses the expression of inflammatory cytokines re-lated to IL-17A in HaCaT cells due to its owncytotoxicity.

Table 1 The primers used in this experiment

Gene Forward Primer (5′ - > 3′) Reverse Primer

Human STAT3 CAGCAGCTTGACACACGGTA AAACACCAAAGTGGCATGTGA

Mouse STAT3 CACCTTGGATTGAGAGTCAAGAC AGGAATCGGCTATATTGCTGGT

Human SIRT1 TAGCCTTGTCAGATAAGGAAGGA ACAGCTTCACAGTCAACTTTGT

Mouse SIRT1 TGATTGGCACCGATCCTCG CCACAGCGTCATATCATCCAG

Human GAPDH ACCTTAACCGCCTTATTAGCCA CACCACGGTACAACAGGCA

Mouse GAPDH CCTAAACAGGTTGATAGGCCAAA CTCGCCTTCCACAGAATCCA

Table 2 Sequences of the siRNA oligonucleotides

Name Sense (5′-3′) Antisense (5′-3′)

siRNA1 CCAUCUCUCUGUCACAAAUTT AUUUGUGACAGAGAGAUGGTT

siRNA2 CCCUGUAAAGCUUUCAGAATT UUCUGAAAGCUUUACAGGGTT

siRNA3 GGAGAUGAUCAAGAGGCAATT UUGCCUCUUGAUCAUCUCCTT

Qiong et al. BMC Immunology (2021) 22:34 Page 4 of 11

Glycyrrhizin promotes SIRT1 expression and reducesSTAT3 expressionThe mRNA expression of STAT3 was up-regulated whileSIRT1 was down-regulated in human psoriasis skin tissuesthan normal skin tissues via RT-PCR detection (Fig. 3a).However, the mRNA expression of AMPK was not statisti-cally different between the two groups (Fig. 3a). Comparedwith the skin tissues of IMD model, the protein expressionof STAT3 was down-regulated while SIRT1 was up-

regulated in Model+MTX or Model+GA group via westernblotting detection (Fig. 3b). The immunohistochemistry re-sults showed that compared with the skin cells of normalsubjects, the skin cells of patients with psoriasis showedsubstantially increased STAT3 expression and substantiallydecreased SIRT1 expression (Fig. 3c). However, the expres-sion of AMPK, a-STAT3 and p-STAT3 were not statisti-cally different between the two groups (Fig. 3c). Theexpression of STAT3, a-STAT3 and p-STAT3 were

Fig. 1 Glycyrrhizin may improve the adverse symptoms and pathological status of IMD by inhibiting the expression of IL-17A and IFN-γ. aCompared with the control IMD mice (treated with normal saline), after continuous treatment with 20 mg/kg MTX or 20mg/kg glycyrrhizin for 4days, the adverse symptoms of IMD were substantially improved by MTX or glycyrrhizin. b The HE staining experiments show that MTX orglycyrrhizin substantially improved the pathological status of the skin cells in IMD. c By the ELISA experiments, we found that the pro-inflammatory cytokines IL-17A and INF-γ were substantially inhibited by MTX or glycyrrhizin in the serum of IMD. NOTES: Data are presented asthe mean ± SD (n = 3). ***P < 0.001; GA represents glycyrrhizin; IL-17 represents IL-17A; Model represents IMD mice

Qiong et al. BMC Immunology (2021) 22:34 Page 5 of 11

Fig. 2 (See legend on next page.)

Qiong et al. BMC Immunology (2021) 22:34 Page 6 of 11

decreased and the expression of SIRT1 was increased whentreated with glycyrrhizin (Fig. 3d). However, glycyrrhizinhad no effect on the expression of AMPK (Fig. 3d). More-over, glycyrrhizin substantially reversed the high expressionof STAT3 and p-STAT3 and reversed the low expressionof SIRT1 induced by IL-17A, at the protein level, in HaCaTcells (Fig. 4a and b). Together, these results indicate thatglycyrrhizin may improve psoriasis by promoting SIRT1 ex-pression and inhibiting STAT3 expression.

Glycyrrhizin suppresses keratinocyte proliferation andSTAT3 expression by upregulating SIRT1As shown in Fig. 5a, EX-527 promoted the proliferationof IL-17A-HaCaT cells, while glycyrrhizin substantially

reduced this effect. This finding suggests that glycyrrhi-zin partially reduces the proliferation of IL-17a-HaCaTcells by promoting SITR1 expression. Further, westernblotting experiments showed that EX-527 substantiallypromoted the expression of STAT3, p-STAT3, and a-STAT3 in IL-17A-HaCaT cells. Compared with EX-527group, the expression of STAT3, p-STAT3, and a-STAT3 were substantially reduced in glycyrrhizin+EX-527 group (Fig. 5b and c). Moreover, interfering RNAs(siRNA-1, siRNA-2, and siRNA-3) that knock downSIRT1 were constructed, and the RT-PCR resultsshowed that siRNA-1 substantially knocked down SIRT1expression in IL-17A-HaCaT cells (Fig. 6a). As shown inFig. 6b, the CCK-8 results further confirmed that

(See figure on previous page.)Fig. 2 Glycyrrhizin suppresses cell proliferation and the expression of inflammatory factors in HaCaT cells. a The CCK-8 results indicate that IL-17Apromoted the proliferation of HaCaT cells, while glycyrrhizin inhibited the proliferation of HaCaT cells. b-d After treatment with IL-17A for 48 h,the expression of IL-6 was substantially higher in the lysate and supernatant of HaCaT cells, while glycyrrhizin could reverse the promotion of IL-6induced by IL-17A (b). Besides, glycyrrhizin has the same regulation of CCL20 (c) and TNF-α (d) as IL-6. NOTES: Data are presented as mean ± SD(n = 3). *P < 0.05, **P < 0.01 and ***P < 0.001 vs control; Con represents wild type HaCaT cells; GA represents glycyrrhizin; IL-17 represents IL-17A;#P < 0.05 vs IL-17A lysate or supernatant group

Fig. 3 Glycyrrhizin regulates SIRT1 and STAT3 expression in vivo. a RT-PCR results showed that the mRNA expression of STAT3 was up-regulatedwhile SIRT1 was down-regulated in human psoriasis skin tissues (N = 10) than normal skin tissues (N = 10). b western blotting results showed thatcompared with the skin tissues of IMD model, the protein expression of STAT3 was down-regulated while SIRT1 was up-regulated in Model+MTXor Model+GA group. c The immunohistochemical results showed that compared with normal subjects, the expression of STAT3 weresubstantially increased, and the expression of SIRT1 was substantially decreased, while the expression of AMPK was not substantially changed. dIn IMD, the immunohistochemical results showed that when treated with glycyrrhizin, the expression of STAT3 was decreased while theexpression of SIRT1 was increased in IMD. *P < 0.05, **P < 0.01 and ***P < 0.001

Qiong et al. BMC Immunology (2021) 22:34 Page 7 of 11

reduced SIRT1 expression promoted the proliferation ofIL-17A-HaCaT cells. Compared with siRNA1 group, theproliferation of IL-17A-HaCaT cells were substantiallyreduced in glycyrrhizin+siRNA1 group (Fig. 6b). Inaddition, the western blotting results indicated thatwhen IL-17A-HaCaT were treated with glycyrrhizin, theSTAT3, p-STAT3, and a-STAT3 expression levels thatincreased upon SIRT1 knockdown were substantially re-versed (Fig. 6c and d). Together, these results suggestthat glycyrrhizin might partially inhibit the proliferationof keratinocytes via SIRT1-STAT3 axis, thereby playinga therapeutic role in psoriasis.

DiscussionIn this study, we characterized the biological role of gly-cyrrhizin in psoriasis in vivo and in vitro. Glycyrrhizin isa therapeutic substance that improves psoriasis bydown-regulating IL-17A and INF-γ, and further inhibitsthe expression of IL-6, TNF-α, and CCL20 induced byIL-17A. Mechanically, glycyrrhizin inhibits the expres-sion of STAT3 by reversing the inhibitory effect of IL-17A on SIRT1, which may be a potential mechanism bywhich glycyrrhizin improves psoriasis.Psoriasis is a chronic immune skin disease mediated

by T cells, keratinocytes, dendritic cells, and other im-mune cells. The interaction between IL-17A secreted byTH17 cells and epidermal keratinocytes plays a keypathogenic role in triggering psoriasis [16]. It has beenreported that glycyrrhizin inhibits liver fibrosis by regu-lating the balance of Th1 / Th2 and TH17 / regulatoryT cells in mouse models of liver fibrosis [17]. Moreover,glycyrrhizin combined with acitretin has been shown toinhibit the synergistic effects produced by TH17 cells,and improve psoriasis [3]. In this study, we found thatglycyrrhizin can improve the adverse reactions and

pathological status of IMD mice by reducing the serumexpression of IL-17A, which suggests that glycyrrhizinmay inhibit the secretion of IL-17A in TH17 cells andreduce the effects of IL-17A on other cells.Increased levels of IL-17A will produce a self-

amplifying inflammatory response in keratinocytes andpromote keratinocyte proliferation, which will furtherpromote the formation of mature psoriatic plaques [15].In this study, the CCK-8 results indicated that glycyrrhi-zin substantially inhibited the proliferation of IL-17A-HaCaT cells. In addition to IL-17A, IFN-γ can also pro-mote keratinocyte growth [16]. Using an ELISA assay,we found that glycyrrhizin not only inhibits IL-17A ex-pression, but also inhibits IFN-γ expression. Therefore,glycyrrhizin might inhibit the growth of keratinocytes byinhibiting the expression of IL-17A and IFN-γ.The expression of TNF-α, IL-6, and CCL20 is regu-

lated by IL-17A [9, 10]. We found that in the lysate andsupernatant of HaCaT cells, glycyrrhizin significantly re-versed the promotion of TNF-α, IL-6, and CCL20 in-duced by IL-17A. In addition to IL-17A, STAT3 hasbeen reported to regulate the expression of TNF-α, IL-6,and CCL20 [18]. Moreover, SIRT1 is involved in regulat-ing the expression of STAT3 in various diseases, includ-ing cancer [19], diabetic kidneys [20] and hepaticgluconeogenesis [21]. In this study, we found that glycyr-rhizin inhibited the expression of STAT3 by promotingthe expression of SIRT1 in keratinocytes, which suggeststhat glycyrrhizin may also reduce the expression ofTNF-α, IL-6, and CCL20 through the SIRT1-STAT3pathway. IL-17A activates STAT3 in keratinocytes [22],and STAT3 also promotes the transcription of IL-17A[18]. Therefore, we speculate that glycyrrhizin reducesthe expression of IL-17A by inhibiting the expression ofSTAT3, while the low expression of IL-17A further

Fig. 4 Glycyrrhizin regulates the expression of SIRT1 and STAT3 in IL-17A-HaCaT cells. a In IL-17A-HaCaT cells, glycyrrhizin can substantially reversethe high expression of STAT3 and p-STAT3 while reverse the low expression of SIRT1 induced by IL-17A. b Histogram of western blotting results.NOTES: Data are presented as the mean ± SD (n = 3). *P < 0.05, **P < 0.01 and ***P < 0.001; Con represents wild type HaCaT cells; GA representsglycyrrhizin; IL-17 represents IL-17A

Qiong et al. BMC Immunology (2021) 22:34 Page 8 of 11

weakens the expression of STAT3 in keratinocytes,thereby forming a positive feedback pathway, which isbeneficial for improving psoriasis.Protein modifications not only affect protein homeosta-

sis, but can also establish new cellular functions and playimportant and complex roles in cell signal transduction[23]. Protein phosphorylation is an important cellularregulatory mechanism in which enzymes and receptorsare activated or inactivated by phosphorylation and de-phosphorylation events via protein kinases [24]. Inaddition, acetylation of lysine residues is also a proteinmodification mechanism that regulates protein activitythrough the function of acetyltransferases [25]. STAT3 ac-tivation also depends on post-translational modifications,phosphorylation, and acetylation [26]. A previous reportindicated that sunitinib reduces imiquimod-inducedpsoriasis-like inflammation by inhibiting p-STAT3 [27]. In

this study, we found that glycyrrhizin can attenuate thepromotion of p-STAT3 induced by SIRT1, which suggeststhat glycyrrhizin may be beneficial for improving psoriasisby inhibiting the expression of p-STAT3. Moreover, IL-22has a pathogenic role in psoriasis, and IFN-γ can enhancethe basic expression of a-STAT3, thereby weakening theresponse of keratinocytes to IL-22 [28]. In this study, wefound that glycyrrhizin can attenuate the promotion of a-STAT3 induced by SIRT1, which suggests that glycyrrhi-zin may attenuate the response of keratinocytes to IL-22by inhibiting the expression of a-STAT3, thereby playing arole in improving psoriasis.AMPK, as an evolutionarily conserved serine/threo-

nine kinase, is considered to be a key factor in maintain-ing cell energy homeostasis, and is essential in regulatingmetabolic-inflammation [29, 30]. GLP-1 partially inhibitsthe inflammatory signals of HaCaT cells by activating

Fig. 5 Glycyrrhizin suppresses the expression of STAT3 via SIRT1 in IL-17A-HaCaT cells. a The CCK-8 assay was used to determine the effect ofEX527 and glycyrrhizin on proliferation of IL-17A-HaCaT cells. b The western blotting results show that EX527 promotes the expression of STAT3,p-STAT3, a-STAT3 in IL-17A-HaCaT cells, and glycyrrhizin can reverse the promotion of STAT3, p-STAT3 and a-STAT3 induced by EX527. cHistogram of western blotting statistical results. NOTES: Data are presented as the mean ± SD (n = 3). *P < 0.05, **P < 0.01 and ***P < 0.001; Conrepresents wild type HaCaT cells; GA represents glycyrrhizin; GAPDH is used for internal reference

Qiong et al. BMC Immunology (2021) 22:34 Page 9 of 11

AMPK [31]. Study has shown that MTX partially re-stores the immunosuppressive function of Tregs by acti-vating AMPK [32]. In this study, we found thatglycyrrhizin promotes the expression of p-AMPK, sug-gesting that glycyrrhizin exerts an immunosuppressiveeffect in HaCaT cells.In summary, glycyrrhizin may reduce the secretion of IL-

17A through the SIRT1-STAT3-IL-17A pathway in TH17cells and keratinocytes in vivo, thereby weakening the regula-tion of IL-17A in other cells and improving psoriasis. Par-ticularly, glycyrrhizin improves psoriasis by inhibiting thesecretion of IL-17A and IFN-γ in TH17 cells. Meanwhile,the proliferation of keratinocyte was reduced when Th17cells secreted less IL-17A and IFN-γ, which also played a rolein improving psoriasis. As for keratinocytes, glycyrrhizin mayinhibit keratinocyte proliferation through the SIRT1-STAT3pathway. In addition, through the SIRT1-dependent path-way, the inhibition of p-STAT3 and a-STAT3 expression byglycyrrhizin may also be related to the improvement of psor-iasis. Together, the SIRT1-STAT3 pathway may be the keyfor glycyrrhizin to improve psoriasis, and this pathway maynot be limited to TH17 cells and keratinocytes. Therefore, infuture studies, we will elucidate whether glycyrrhizin canregulate additional cells related to psoriasis through theSIRT1-STAT3 pathway.

Supplementary InformationThe online version contains supplementary material available at https://doi.org/10.1186/s12865-021-00421-z.

Additional file 1: Supplement Figure 1. The experimental designin vivo

Additional file 2: Supplement Figure 2. Glycyrrhizin-mediated inflam-mation inhibition is due to its own cytotoxicity. (A) CCK-8; (B-D) ELISA.*P < 0.05, **P < 0.01 and ***P < 0.001; GA represents glycyrrhizin

AcknowledgementsWe thank the individuals and their families who participated in this project.We also thank the State Key Laboratory of Bioreactor Engineering andShanghai Key Laboratory of New Drug Design, School of Pharmacy, EastChina University of Science and Technology.

Authors’ contributionsQH, HL, NXZ, YM, and JX participated in study design; QH, HL, NXZ, HYC, KYand ZHZ conducted the experiments; QH, HL, NXZ, YM, and JX performeddata analysis; QH, HL, NXZ, YM, and JX wrote the manuscript. The author(s)read and approved the final manuscript.

FundingThis study was supported by funding from the Skin Research by ShenzhenJianan (Group) Co,LTD, the major research and development project ofinnovative drugs, Ministry of Science and Technology (2017ZX09304005).

Availability of data and materialsThe datasets generated and/or analysed during the current study are notpublicly available due to the commercial interests of Shenzhen Jianan

Fig. 6 Glycyrrhizin inhibits the expression of STAT3 by up-regulating SIRT1 in IL-17A-HaCaT cells. a and b By constructing SIRT1-knockdown smallinterfering RNA (a) and combining with CCK-8 experiments (b), we found that SIRT1-knockdown promoted the proliferation of IL-17- HaCaT cells.c When knock-down SIRT1 in IL-17- HaCaT cells, glycyrrhizin could reverse the promotion of STAT3, p-STAT3 and a-STAT3 induced by SIRT1knock-down. d Histogram of western blotting statistical results. NOTES: Data are presented as the mean ± SD (n = 3). *P < 0.05, **P < 0.01 and***P < 0.001; NC represents siRNA-NC transfected HaCaT cells; GA represents glycyrrhizin; GAPDH is used for internal reference

Qiong et al. BMC Immunology (2021) 22:34 Page 10 of 11

(Group) Co., Ltd., but are available from the corresponding author onreasonable request.

Declarations

Ethics approval and consent to participateThe experiment was approved by the Huashan Hospital Clinical ResearchEthics Committee. All participants provided written informed consent for thestudy. All methods were carried out in accordance with relevant guidelinesand regulations. The animal experiments used meet the requirements ofanimal welfare and animal ethics of Huashan Hospital, and are approved bythe Ethics Committee of animal experiments of Huashan Hospital. All animalexperiments met the ARRIVE guidelines [14], and the mice were anesthetizedwith isoflurane and then sacrificed by cervical dislocation.

Consent for publicationConsent for Publication-Not Applicable.

Competing interestsAll authors declare no conflict of interest. Data and information are availableand there is no dispute of interest.

Received: 19 November 2020 Accepted: 27 April 2021

References1. Hoque R, Vodovotz Y, Mehal W. Therapeutic strategies in inflammasome

mediated diseases of the liver. J Hepatol. 2013;58(5):1047–52. https://doi.org/10.1016/j.jhep.2012.12.017.

2. van Rossum TG, Vulto AG, Hop WC, Schalm SW. Glycyrrhizin-inducedreduction of ALT in European patients with chronic hepatitis C. Am JGastroenterol. 2001;96(8):2432–7. https://doi.org/10.1016/S0002-9270(01)02612-0.

3. Mou KH, Han D, Liu WL, Li P. Combination therapy of orally administeredglycyrrhizin and UVB improved active-stage generalized vitiligo. Braz J MedBiol Res. 2016;49(8):e5354.

4. Benhadou F, Mintoff D, Del Marmol V. Psoriasis: keratinocytes or immunecells - which is the trigger? Dermatology. 2019;235(2):91–100. https://doi.org/10.1159/000495291.

5. Zhou F, Zhu Z, Gao J, Yang C, Wen L, Liu L, et al. NFKB1 mediates Th1/Th17activation in the pathogenesis of psoriasis. Cell Immunol. 2018;331:16–21.https://doi.org/10.1016/j.cellimm.2018.04.016.

6. Clark RA. Human skin in the game. Sci Transl Med. 2013;5(204):204ps213.7. Cai Y, Shen X, Ding C, Qi C, Li K, Li X, et al. Pivotal role of dermal IL-17-

producing gammadelta T cells in skin inflammation. Immunity. 2011;35(4):596–610. https://doi.org/10.1016/j.immuni.2011.08.001.

8. Riol-Blanco L, Ordovas-Montanes J, Perro M, Naval E, Thiriot A, Alvarez D,et al. Nociceptive sensory neurons drive interleukin-23-mediatedpsoriasiform skin inflammation. Nature. 2014;510(7503):157–61. https://doi.org/10.1038/nature13199.

9. Harper EG, Guo C, Rizzo H, Lillis JV, Kurtz SE, Skorcheva I, et al. Th17cytokines stimulate CCL20 expression in keratinocytes in vitro and in vivo:implications for psoriasis pathogenesis. J Invest Dermatol. 2009;129(9):2175–83. https://doi.org/10.1038/jid.2009.65.

10. Chiricozzi A, Krueger JG. IL-17 targeted therapies for psoriasis. Expert OpinInvestig Drugs. 2013;22(8):993–1005. https://doi.org/10.1517/13543784.2013.806483.

11. Nakajima K, Kataoka S, Sato K, Takaishi M, Yamamoto M, Nakajima H, et al.Stat3 activation in epidermal keratinocytes induces Langerhans cellactivation to form an essential circuit for psoriasis via IL-23 production. JDermatol Sci. 2019;93(2):82–91. https://doi.org/10.1016/j.jdermsci.2018.11.007.

12. Blander G, Bhimavarapu A, Mammone T, Maes D, Elliston K, Reich C, et al.SIRT1 promotes differentiation of normal human keratinocytes. J InvestDermatol. 2009;129(1):41–9. https://doi.org/10.1038/jid.2008.179.

13. Raaby L, Zachariae C, Ostensen M, Heickendorff L, Thielsen P, Gronbaek H,et al. Methotrexate use and monitoring in patients with psoriasis: aconsensus report based on a Danish expert meeting. Acta Derm Venereol.2017;97(4):426–32. https://doi.org/10.2340/00015555-2599.

14. Chen H, Lu C, Liu H, Wang M, Zhao H, Yan Y, et al. Quercetin amelioratesimiquimod-induced psoriasis-like skin inflammation in mice via the NF-

kappaB pathway. Int Immunopharmacol. 2017;48:110–7. https://doi.org/10.1016/j.intimp.2017.04.022.

15. Percie du Sert N, Ahluwalia A, Alam S, Avey MT, Baker M, Browne WJ, et al.Reporting animal research: Explanation and elaboration for the ARRIVEguidelines 2.0. PLoS Biol. 2020;18(7):e3000411.

16. Furue M, Furue K, Tsuji G, Nakahara T. Interleukin-17A and Keratinocytes inPsoriasis. Int J Mol Sci. 2020;21(4):1275.

17. Yamashita T, Asano Y, Taniguchi T, Nakamura K, Saigusa R, Miura S, et al.Glycyrrhizin ameliorates fibrosis, vasculopathy, and inflammation in animalmodels of systemic sclerosis. J Invest Dermatol. 2017;137(3):631–40. https://doi.org/10.1016/j.jid.2016.08.037.

18. Wu S, Rhee KJ, Albesiano E, Rabizadeh S, Wu X, Yen HR, et al. A humancolonic commensal promotes colon tumorigenesis via activation of T helpertype 17 T cell responses. Nat Med. 2009;15(9):1016–22. https://doi.org/10.1038/nm.2015.

19. Zhang S, Yang Y, Huang S, Deng C, Zhou S, Yang J, et al. SIRT1 inhibitsgastric cancer proliferation and metastasis via STAT3/MMP-13 signaling. JCell Physiol. 2019;234(9):15395–406. https://doi.org/10.1002/jcp.28186.

20. Hong Q, Zhang L, Das B, Li Z, Liu B, Cai G, et al. Increased podocyte Sirtuin-1 function attenuates diabetic kidney injury. Kidney Int. 2018;93(6):1330–43.https://doi.org/10.1016/j.kint.2017.12.008.

21. Xu J, Li Y, Lou M, Xia W, Liu Q, Xie G, et al. Baicalin regulates SirT1/STAT3pathway and restrains excessive hepatic glucose production. Pharmacol Res.2018;136:62–73. https://doi.org/10.1016/j.phrs.2018.08.018.

22. Sano S, Chan KS, Carbajal S, Clifford J, Peavey M, Kiguchi K, et al. Stat3 linksactivated keratinocytes and immunocytes required for development ofpsoriasis in a novel transgenic mouse model. Nat Med. 2005;11(1):43–9.https://doi.org/10.1038/nm1162.

23. Mijakovic I, Grangeasse C, Turgay K. Exploring the diversity of proteinmodifications: special bacterial phosphorylation systems. FEMS MicrobiolRev. 2016;40(3):398–417. https://doi.org/10.1093/femsre/fuw003.

24. Ardito F, Giuliani M, Perrone D, Troiano G, Lo Muzio L. The crucial role ofprotein phosphorylation in cell signaling and its use as targeted therapy(review). Int J Mol Med. 2017;40(2):271–80. https://doi.org/10.3892/ijmm.2017.3036.

25. Drazic A, Myklebust LM, Ree R, Arnesen T. The world of protein acetylation.Biochim Biophys Acta. 2016;1864(10):1372–401. https://doi.org/10.1016/j.bbapap.2016.06.007.

26. Haghikia A, Ricke-Hoch M, Stapel B, Gorst I, Hilfiker-Kleiner D. STAT3, a keyregulator of cell-to-cell communication in the heart. Cardiovasc Res. 2014;102(2):281–9. https://doi.org/10.1093/cvr/cvu034.

27. Xian D, Song J, Yang L, Xiong X, Lai R, Zhong J. Emerging roles of redox-mediated angiogenesis and oxidative stress in Dermatoses. Oxidative MedCell Longev. 2019;2019:2304018.

28. Sestito R, Madonna S, Scarponi C, Cianfarani F, Failla CM, Cavani A, et al.STAT3-dependent effects of IL-22 in human keratinocytes arecounterregulated by sirtuin 1 through a direct inhibition of STAT3acetylation. FASEB J. 2011;25(3):916–27. https://doi.org/10.1096/fj.10-172288.

29. Jeon SM. Regulation and function of AMPK in physiology and diseases. ExpMol Med. 2016;48(7):e245. https://doi.org/10.1038/emm.2016.81.

30. Lyons CL, Roche HM. Nutritional Modulation of AMPK-Impact uponMetabolic-Inflammation. Int J Mol Sci. 2018;19(10):3092.

31. Yang J, Wang Z, Zhang X. GLP-1 receptor agonist impairs keratinocytesinflammatory signals by activating AMPK. Exp Mol Pathol. 2019;107:124–8.https://doi.org/10.1016/j.yexmp.2019.01.014.

32. Yan K, Xu W, Huang Y, Zhang Z, Huang Q, Xin KZ, et al. Methotrexaterestores the function of peripheral blood regulatory T cells in psoriasisvulgaris via the CD73/AMPK/mTOR pathway. Br J Dermatol. 2018;179(4):896–905. https://doi.org/10.1111/bjd.16560.

Publisher’s NoteSpringer Nature remains neutral with regard to jurisdictional claims inpublished maps and institutional affiliations.

Qiong et al. BMC Immunology (2021) 22:34 Page 11 of 11