MOLECULAR AND CELLULAR BIOLOGY, Nov. 1985. p. 2984-2992 Vol. 5 No. 110270-7306/85/112984-09$02.00/0Copyright © 1985, American Society for Microbiology

Glucocorticoid Receptor Binding and Activation of a HeterologousPromoter by Dexamethasone by the First Intron of the Human

Growth Hormone GeneEMILY P. SLATER,"* OLIVER RABENAU,' MICHAEL KARIN,3 JOHN D. BAXTER,' AND MIGUEL BEATO2

Metabolic Research Unit and Departments of Physiology and Medicine, University of California, San Francisco,California 94143'; Institit flir Physiologische Chemie der Philipps-Universitdt, 3550 Marburg, Federal Republic ofGermany2; and Department of Microbiology, University of Souithern California School of Medicine, Los Angeles,

Califrrnia 900333

Received 22 April 1985/Accepted 8 August 1985

In this study DNA-binding and gene transfer experiments were performed to examine a potentialglucocorticoid regulatory element (GRE) in the human growth hormone gene. As assayed by nitrocellulosefilter binding, only two regions of the human growth hormone gene, the 5'-flanking sequences and a fragmentcontaining part of the first intron, were retained preferentially by purified glucocorticoid-receptor complexes.The relative binding by the transcribed sequences was three times greater than the relative binding by the5'-flanking sequences, but less than the relative binding by a fragment containing the human metallothionein-IA gene GRE. The intron, but not the 5'-flanking sequences, generated a "footprint" when the receptorcomplex was used to protect the segments against exonuclease III digestion; the protected sequence spannednucleotides +86 to +115 In the first intron and contained a structure homologous in 14 of 16 nucleotides to a16-nucleotide consensus GRE. The hexanucleotide 5'-TGTCCT-3', thought to be important for GRE activity,not only was found in this sequence and in the 5'-flanking region, but also was present twice in the 3' end ofthe gene that did not show specific receptor binding. The latter results suggest that the hexanucleotide alone isnot sufficient to generate specific receptor binding tight enough to be assayed in this way. To test the biologicalactivity of the intron binding site, a fragment containing these sequences was fused 5' to the humanmetallothionein-IIA gene promoter depleted of its GRE and linked to the structural sequences of the herpessimplex virus thymidine kinase (TK) gene. When this hybrid gene was transfected into Rat 2 TK- cells, itsexpression was induced threefold by the glucocorticoid dexamethasone, as assessed by transfection efficiencyand RNA blotting analyses. Expression of the same gene without the human growth hormone gene segment wasnot affected by the steroid, whereas the wild-type human metallothionein-IIA gene promoter containing its GREresponded to the hormone by a sixfold increase in thymidine kinase mRNA. These results indicate that thehuman growth hormone gene contains a structure within its first intron that can function as a GRE.

Glucocorticoids exert many of their physiological effectsby modulating the expression of specific genes (for a review,see reference 30). In most cases studied these effects are atthe transcriptional level. Baxter et al. (2) demonstrated thatglucocorticoid-receptor complexes or proteins associatedwith them bind to DNA. It has been postulated that thesecomplexes recognize specific sequences on responsive genesand affect their transcription (for reviews, see references 30and 43). The cloning of glucocorticoid-responsive genes (6,14-16, 21) and the purification of the activated form of thereceptor (39, 42) have enabled testing of this hypothesis. Invitro studies of the binding of purified receptor to clonedDNA (13, 22, 26, 32, 37) in conjunction with gene transferstudies (4, 10, 13, 26) have been used to identify specificsequences, distinct from promoter elements, that bind thereceptor and regulate the activity of the promoter. Thesesequences, when fused 5' to a heterologous promoter, canconfer on this promoter the ability to be regulated by theglucocorticoid (4, 10, 12) and have been termed glucocorti-coid-responsive or glucocorticoid regulatory elements(GREs) (4, 13). In murine mammary tumor virus (MMTV)and the human metallothionein-IIA (hMT-IIA) gene, thesequences recognized by the glucocorticoid receptor arelocated in the 5'-flanking region, between 70 and 260 base

* Corresponding author.

pairs (bp) upstream from the transcription initiation site (4,13, 22, 24, 32). A comparison of these regions has led to theproposal of three consensus sequences that vary from 6 to 16nucleotides in length (13,22,32). The 16-nucleotide consen-sus sequence (13), 5'-cGGTTACACTNTGTCCT-3', contains inits 3' portion the hexanucleotide and a close match with theoctanucleotide.The human growth hormone (hGH) gene can also be

regulated by glucocorticoids. Robins et al. (29) reported thatelements responsive to these steroids are located in the5'-flanking region of the hGH gene. However, the structurethat bears the greatest resemblance to the 16-nucleotideconsensus sequence is found in the first intron. Althoughthere are no structures that perfectly match the octa-nucleotide consensus sequence, sequences containing thehexanucleotide, 5'-TGTCCT-3', are found in the 5'-flankingregion, the first intron, and the 3' untranslated and 3'-flanking regions of the hGH gene.

In this paper we describe the glucocorticoid receptor-binding and GRE properties of the hGH gene. A structure inintron A displayed the most extensive receptor-glucocor-ticoid complex binding in nitrocellulose assays and was theonly structure that was protected by receptor-glucocorticoidcomplexes from exonuclease III digestion. This structure ishighly homologous to the 16-nucleotide consensus sequence.Gene transfer experiments demonstrated that this structure

2984

on Novem

ber 17, 2018 by guesthttp://m

cb.asm.org/

Dow

nloaded from

hGH GENE GLUCOCORTICOID REGULATORY ELEMENT

-270

Bam HI Bgl II+75 +53

yMTK

-170

AMTK

EcoRI

//+1

+199 -170y

I-.- / l//AK

FIG. 1. Structure of fusion genes used to test GRE activity. Construction of the fusion genes used is described in Materials and Methods.The open bars represent the TK gene from the Bglll site at position +53 to the EcoRI site at the 3' end. The cross-hatched bars representthe 5' deletions (positions -270 and -170) of the hMT-IIA gene regulatory sequences obtained by BAL 31 digestion (13). The stippled barrepresents the hGH gene segment containing the intron A sequence. The solid bars represent the 16-nucleotide segments in each gene thoughtto comprise the GRE. The arrowheads indicate cap sites.

can also confer glucocorticoid responsiveness to the hMT-IIA promoter. However, this structure did not bind receptoras well as the hMT-IIA gene GRE, and the level of induc-ibility conferred by the hGH gene structure was aboutone-half the level conferred by the hMT-IIA gene GRE. Thisis the first demonstration of a structure in an intron that hasthe potential to function as a GRE and supports the conceptthat a GRE is a hormone-dependent enhancer element (4, 10,12). Our data also suggest that this intron A structure is a

strong candidate to mediate glucocorticoid responsivenessof the hGH gene and that the hexanucleotide consensussequence (5'-TGTYCT-3') alone is not sufficient to generatehigh-affinity receptor binding. Our data also correlate thedegree of responsiveness of a gene with the extent of bindingof the hormone-receptor complex to a given GRE.

MATERIALS AND METHODS

Receptor-binding experiments. The 90,000-M, form of theglucocorticoid receptor was purified from rat liver cytosol inthe activated form (7). The receptor preparations used forthese studies were on average 60% pure, as judged by silverstaining of sodium dodecyl sulfate-polyacrylamide gels (20)and photoaffinity labeling (40).

Nitrocellulose filter binding experiments (28) were per-formed in 50-,ul assay mixtures containing end-labeled re-striction fragments and increasing receptor concentrations,at several concentrations of NaCl, and in the presence ofvariable amounts of competitor calf thymus DNA (7). Otherexperimental details are indicated in the legends to thefigures.The exonuclease III "footprint" experiments were per-

formed with restriction fragments labeled at one 5' end aspreviously described (37).

Plasmid constructions. The hybrid constructions AMTKand MTK containing the 5'-flanking DNA of the hMT-IIAgene and 75 bp of the 5' untranslated region fused to thestructural sequences beginning at position +53 of the herpessimplex virus thymidine kinase (TK) gene have been de-scribed previously (13) and are shown schematically in Fig.1. MTK and AMTK contain 270 and 170 bp of the hMT-IIAgene 5'-flanking DNA, respectively. The 199-bp BamHI-BalIDNA fragment containing the first exon and 133 bp of the

first intron of the hGH gene (5) was subcloned with Hindlillinkers (New England Biolabs) into the HindlIl site of thepUC8 polylinker 5' to theAMTK gene to form GHAMTK(Fig. 1).A TaqI restriction fragment extending from position -322

of the hMT-IIA gene promoter to position + 181 of the fusiongene was used for comparison in filter binding studies.

All recombinant DNA procedures were performed accord-ing to the National Institute of Health guidelines for recom-binant DNA research.

Cell culture, transfection and selection. Rat 2 fibroblasts(36) were maintained in Dulbecco modified Eagle mediumsupplemented with 10% fetal calf serum (Hyclone), penicil-lin, and streptomycin. Rat cells were transfected with acalcium phosphate coprecipitate (41) of plasmid DNA andcalf thymus carrier DNA (5 ,ug/100-mm plate each). Cellswere selected and maintained in the same medium supple-mented with 100 ,uM hypoxanthine, 1 ,uM aminopterin, and16 ,uM thymidine starting 48 h after transfection. Control anddexamethasone (Dex)-selected cells were cultured in theabove medium supplemented with 0.1% ethanol and 1 ,uMDex (Sigma Chemical Co.) in 0.1% ethanol, respectively,beginning 24 h after addition of the precipitate. TK+ cellswere maintained either in the presence or in the absence of1 ,uM Dex for 14 to 20 days; then duplicate plates were fixedand Giemsa (J. T. Baker Chemical Co.) stained, and colonieswere counted. Mixed mass cultures of TK+ cells werederived by trypsinizing and mixing large numbers of differentTK' colonies. The cells selected in the presence of Dexwere maintained with the steroid until 3 days before aninduction experiment; then they were cultured in the ab-sence of Dex, hypoxanthine, aminopterin, and thymidine,and the cultures were fed daily. For induction experimentsconfluent cultures were given fresh medium containing 1 puMDex in 0.1% ethanol or 0.1% ethanol.

Preparation and analysis of RNA. Cells were harvested byscraping them with a rubber policeman into phosphate-buffered saline and were lysed in TSM buffer (10 mM Trishydrochloride [pH 7.5], 150 mM NaCl, 2 mM MgCl2) con-taining 0.5% Nonidet P-40 for 3 to 5 min on ice. Nuclei werepelleted by a 20-s centrifugation in an Eppendorf Microfuge.Total cytoplasmic RNA was extracted from the cytosolfraction as described by Karin et al. (11). RNA samples (20

2985VOL. S, 1985

L I

I

IGHAMTK

on Novem

ber 17, 2018 by guesthttp://m

cb.asm.org/

Dow

nloaded from

2986 SLATER ET AL.

A Eco Ql0.9

iPvu of

.

i~~~~~~

Pvu It \ i Pvu If

Tr 0.8

I;7ECO RI

2.0

B 1 2 3 4 5 6 7 8 9

43

2.6.

Ckb:

2.3

0.0

0.3

I 1i 3 4 5 B 7 8 9F10

^ ----I

a.. __ ......

FIG. 2. Binding of glucocorticoid receptor to restriction fragments of phGH 2.6. (A) Recombinant plasmid phGH 2.6 (5). Exons are shownas open boxes, and the direction of transcription is shown by an arrow. The bacterial genes coding for ampicillin and tetracycline resistanceare indicated as Apr and Tcr, respectively. The plasmid was digested with EcoRl and labeled at the 3' ends with [a-32P]dATP by using theKlenow fragment of Escherichia coli DNA polymerase I (7). Receptor binding was performed in a 50-,ul assay mixture containing 4 ng oflabeled DNA (-13,000 Cerenkov cpm), 10 mM Tris hydrochloride (pH 7.5), 0.1 mM disodium EDTA, 1 mM MgCl., 1 mM dithiothreitol, anddifferent concentrations of NaCl, receptor, and native calf thymus DNA. After incubation at 25°C for 45 min, the samples were filteredthrough nitrocellulose filters (diameter 7 mm), and the retained DNA was analyzed on 1% agarose gels as previously described (7). (B)Autoradiogram of the gel. Lane 1, Input DNA; lane 2, DNA retained on the filter in the absence of receptor; lanes 3, 4, and 5, DNA retainedon the filter at an NaCl concentration of 60 mM in the presence of 5, 10, and 20 ng of purified rat liver glucocorticoid-receptor complex,respectively; lanes 6 and 7, DNA retained by 30 ng of receptor at NaCl concentrations of 100 and 120 mM, respectively; lanes 8 and 9, DNAretained by 30 ng of receptor at an NaCl concentration of 60 mM in the presence of 20 and 50 ng of competitor calf thymus DNA, respectively.(C) Plasmid digested with EcoRI and end labeled as described above before secondary restriction with PvuII. Lanes 1 and 2, Input DNA andDNA bound to the filter in the absence of receptor, respectively; lanes 3, 4, 5, and 6, DNA bound to the filter at an NaCl concentration of60 mM in the presence of 2, 5, 10, and 20 ng of purified receptor, respectively; lanes 7 and 8, DNA retained on the filter by 30 ng of receptorat NaCl concentrations of 100 and 120 mM, respectively; lanes 9 and 10, DNA retained by 30 ng of receptor at an NaCl concentration of 60mM in the presence of 20 and 50 ng of competitor calf thymus DNA, respectively.

,ug) were denatured by glyoxalation, separated by electro-phoresis on 1.5% agarose gels, and transferred to nitrocel-lulose membranes (Schleicher & Schuell, Inc.) as describedby Thomas (35). The blots were probed sequentially with aPvuII TK gene fragment and a PstI mouse a-actin genefragment. Both fragments were labeled with [a-32P]dATPand [a-32P]dCTP (.3,000 Ci/mmol; Amersham Corp.) bynick translation to S5 x 108 cpm/,ug (27).

Si nuclease analysis. The 5' end mapping experiment wascarried out essentially as described by Weaver and Weis-sman (38). Briefly, 50-pg portions of total RNA from thevarious TK+ cultures described above were hybridized to 5x 104 cpm of a HindIII-NcoI MTK gene fragment end-labeled with T4 polynucleotide kinase (P-L Biochemicals,Inc.) and [_y-32P]ATP (ICN Biomedicals) at the NcoI site in25 ,lI of a solution containing 80% formamide, 0.4 M NaCl,40 mM PIPES [piperazine-N,N'-bis(2-ethanesulfonic acid)](pH 6.5), and 1 mM EDTA for 3 to 5 h at 55°C. The hybridswere incubated for 60 min at 30°C with 100 U of S1 nuclease(P-L Biochemicals) in 400 ,ul of a solution containing 0.25 MNaCl, 30 mM sodium acetate, and 1 mM ZnCl2. ProtectedDNA fragments were electrophoresed through an 8% poly-acrylamide-8 M urea gel (17).

RESULTS

Nitrocellulose filter binding experiments. Figure 2 showsthe results of binding of the partially purified glucocorticoid-receptor complexes to a cloned 2.6-kilobase (kb) EcoRIfragment containing the entire hGH gene, including 500 bp of5'-flanking DNA and 525 bp of 3'-flanking DNA. It is evident(Fig. 2B, lane 3) that, especially in the presence of high salt(lanes 6 and 7) or in the presence of competitor DNA (lanes8 and 9), the fragment containing the hGH gene was retainedpreferentially on the filters compared with pBR322 DNA.The relative binding of the receptor by this fragment underoptimal conditions was 10-fold higher than the relativebinding by the 4.3-kb vector fragment, based on the relativeintensities of the bands. This value is a minimal estimate,since longer DNA fragments exhibited higher nonspecificbinding of the receptor.

If the recombinant plasmid was digested with EcoRI, endlabeled, and then digested with PvuII, four radiolabeledfragments were obtained (Fig. 2). Of these, only the 0.9-kbEcoRI-PvuII fragment containing the 5'-flanking sequences,exon 1, intron A, and part of exon 2 was preferentially boundby the receptor (Fig. 2C). Quantitative evaluation of the

MOL. CELL. BIOL.

on Novem

ber 17, 2018 by guesthttp://m

cb.asm.org/

Dow

nloaded from

hGH GENE GLUCOCORTICOID REGULATORY ELEMENT

Eco

5,

A

iRI Bam Hi Pvu 11t

Cap

a

450

40

% DNAbinding

30,

20

10

b

39

450 bp

B

b

a~~~~~10 iV

24 a 16 36

ng Rec.

FIG. 3. Receptor titration curves with restriction fragments

around the 5' end of the hGH gene. (A) Restriction sites used for

preparing the two DNA fragments (fragments a and b). The site used

for initiation of transcription is labeled Cap. The large boxes indicate

the positions of the first and second exons, with the 5'-untranslated

region cross-hatched, and the small open boxes indicate the posi-

tions of hexanucleotide 5'-TGTCCT-3'. (B) Titration curves ob-

tained by using 0.8 ng of either restriction fragment a or b at an NaCl

concentration of 60 mM in standard binding assays (see the legend to

Fig. 2). Curve c was obtained with a 503-bp TaqI restriction

fragment containing the GRE of the hMT-IIA gene. The conditions

of binding were the same as those used for curves a and b except

that1 ng of DNA was used for each assay. Values obtained with a

380-bp pBR322 fragment were not significantly different from the

values obtained with blanks in the absence of added receptor. This

value (less than 1% of the input DNA) was subtracted from the

experimental data.

autoradiogram yielded preferential binding data similar to

those obtained with the 2.6-kb EcoRI fragment (Fig. 2B).

Additional experiments failed to show preferential binding to

the PvuII fragment containing the central region of the gene

(data not shown).To determine more precisely the fragment responsible for

binding to the receptor, the 0.9-kb EcoRI-PvuII fragment

was subcloned in pBR322 (Fig. 2). After digestion at the cap

site with BamHI and end labeling, one half of the sample was

further digested with EcoRI, and the other half was digested

with PvuII (Fig. 2). Two fragments about 450 bp long were

isolated after electrophoresis through low-melting-point

agarose and used for filter binding studies. The saturation

curves obtained with increasing receptor concentrations are

shown in Fig. 3. Under these conditions, a 380-bp pBR322

fragment did not show any significant binding. The fragment

containing the 5'-flanking sequences (Fig. 3, curve a) showed

weak but detectable binding, whereas the fragment contain-

ing the transcribed region bound the receptor more avidly(curve b). However, this binding was only one-half thatexhibited by a 502-bp hMT-IIA gene TaqI fragment (curve c)containing the hMT-IIA gene GRE that was studied forcomparison.

Exonuclease III footprints. To locate the nucleotide se-quences responsible for receptor binding, exonuclease IIIfootprint experiments (37) were performed. In these exper-iments the presence of a protein bound to a defined sequenceon the DNA prevents the progression of the exonuclease IIItoward the labeled 5' end of a double-stranded DNA frag-ment (34). A band of the appropriate length is observed in asubsequent polyacrylamide-7 M urea gel (17).The results of an experiment performed by labeling the

coding strand at the BamHI site are shown in Fig. 4A and B.In the control lane, without added receptor, there wereseveral bands that represented random stops of the enzyme.In the presence of the glucocorticoid receptor new bandsappeared at positions +114 and + 115, and these bandsdelimited the 3' border of the footprint. Other bands betweenthese positions and position +87 were enhanced, but thesebands corresponded to bands already visible in the controllane and therefore were not receptor dependent. Figures 4Cand D show the results when the complementary strand waslabeled at the BalI site at position +199 (5). In this case theonly receptor-dependent band was observed at position +86,and thus this band delimited the 5' border of the footprint.Again several other bands were enhanced, but these bandscorresponded to fainter bands in the control lane. Thus, theregion that was protected by receptor binding from exonu-clease III digestion extended from position +86 to position+115 in the first intron.An analysis of the nucleotide sequence in this region (Fig.

SA) showed that the hexanucleotide 5'-TGTCCT-3' was atposition +100 in the coding strand. This hexanucleotide hasbeen found in the receptor binding site of the hMT-IIA gene(13), whereas the homolog 5'-TGTTCT-3' is located inreceptor-binding sites of MMTV and the chicken lysozymegene (26,32). The rest of the nucleotide sequence protectedby the receptor showed additional homology to strongreceptor-binding sites in the MMTV long terminal repeat andthe hMT-IIA gene (Fig.5B). Of 16 bp, 9 are preserved in allthree binding sites, 13 are common to both human se-quences, and 14 are contained within the 16-nucleotideconsensus sequence.

Exonuclease III footprint experiments with the EcoRI-BamHI restriction fragment containing the hGH gene 5'-flanking DNA sequences failed to show receptor-dependentbands (data not shown).

Construction of GHAMTK. The experiments describedabove identified a 30-bp sequence in the first intron of thehGH gene which is the most prominent binding site in thisgene for the glucocorticoid receptor. To test the ability ofthis region to act as a GRE, a 199-bp BamHI-BalII fragmentcontaining the first exon and 133 bp of the first intron wasfused to the 5' end of a deletion mutant of the hMT-IIA gene5'-flanking DNA, as shown in Fig. 1. The endpoint of thishMT-IIA gene deletion mutant is position -170; thus, thismutant does not contain its own GRE. This hMT-IIA genepromoter had been fused to the structural gene of TK(pAMTK) (Fig. 1) (12). The deletion mutant (position -170)was chosen to place the hGH binding site the same distancefrom the start of transcription as the GRE in the hMT-IIAwild-type gene. The resulting recombinant was termedpGHAMTK to distinguish it from wild-type vector pMTK.

Effect of Dex on transfection efficiency. Rat 2 TK- cells are

VOL. 5, 1985 2987

on Novem

ber 17, 2018 by guesthttp://m

cb.asm.org/

Dow

nloaded from

2988 SLATER ET AL.

Bal i3-200

Bar-n 1HI

3

W_

+113--- 100

+89 ---

Exon I

- cap

12 3

a

a..*... ...G - +

Rec.

1 2 3 4

*

39*

lw

aC+T G - +

Rec.

L

-- CioF

E xor-

- 100

L 200

Bam HI 5'

A BBalA B C DFIG. 4. (A and B) Exonuclease III footprint on the coding strand. (A) Restriction fragment used. The 5' end of the BaniHI site at the

initiation of transcription was labeled. The first exon is boxed. Stripes indicate the 5'-untranslated region. (B) Autoradiogram of a 6.5%polyacrylamide-7 M urea gel. Lane 1 G-sequencing reaction (17); lanes 2 and 3, exonuclease Ill digestion in the absence and presence ofreceptor (170 ng), respectively. Incubations were performed in 60-,ul standard assay mixtures containing 100 mM NaCl and 1.2 ng of labeledDNA. After 40 min at 25°C the temperature was shifted to 37°C for 5 min, and 2 ,ul of 70 mM MgCI. and 5 p.1 of exonuclease III (10 U/,ul;Bethesda Research Laboratories) were added. Incubation was continued at 37°C for 6 min. and the reaction was stopped by adding 30 p.l ofcold stop buffer (20 mM disodium EDTA, 0.15% sodium dodecyl sulfate, 50 p.g of calf thymus DNA per ml) and placing the samples in anice bath. After repeated phenol extractions, the samples were ethanol precipitated and applied to 0.2-mm sequencing gels (17). (C and D)Exonuclease III footprint on the complementary strand. (D) Restriction fragment used. The Baill site at position +199 was labeled at the 5'end. Other symbols are described above. (C) Autoradiogram of a 6.5% sequencing gel. ILanes 1 and 2, C+T- and G-sequencing reactions,respectively; lanes 3 and 4, exonuclease III digestion patterns in the absence and presence of receptor. respectively. The experimental detailsare described above.

not growth inhibited by Dex (12) and therefore are useful fortransfection experiments in which the TK gene is expressedfrom a glucocorticoid-responsive promoter. In such experi-ments the presence of Dex during the selection periodincreases the number of TK+ colonies (12). This assay can

be used as a rapid test to detect functional GREs. As shownin Table 1, the presence of the first intron of the hGH gene in

GHAMTK led to a three- to fivefold increase in the numberof TK+ colonies when Dex was present during selection. Bycontrast, the steroid did not affect the transfection efficiencyof AMTK, which does not contain a GRE, and had a

negligible (1.3-fold) effect on cells transfected with TK109(18). In comparison, Dex elicited a sixfold effect when thecells were transfected with MTK, which contains the hMT-IA gene GRE.

Expression of TK mRNA in the transfected cell lines. Cellswere induced with 1 F.M Dex for 12 to 16 h, and then totalcytoplasmic RNA was harvested and analyzed for TKmRNA by RNA blot hybridization (35). An autoradiogram of

a blot containing TK mRNAs from GHAMTK-, AMTK-, andMTK-transfected cells grown either in the presence or in theabsence of Dex is shown in Fig. 6. As an internal standardfor loading of RNA, the blot was also hybridized with amouse ox-actin probe, as this gene does not respond toglucocorticoids. The two autoradiograms were scanned on adensitometer, and the TK signal was normalized to thect-actin signal (Table 2). Although the level of TK mRNAexpressed from the parental pAMTK vector was not affectedby hormone treatment, TK mRNA from cells transfectedwith pGHA\MTK was induced 2.6-fold by Dex. Thus, theregion containing the first intron of the hGH gene can indeedact as a GRE. Accumulation of RNA derived from thepMTK vector was induced 6.2-fold with Dex.Mapping the 5' termini of the TK mRNA. A nuclease SI

analysis was performed on mRNAs from the varioustransfectants to identify the mRNA transcriptional start site.A HindIII-NcoI probe (positions -170 to +75) that wasderived from the AMTK gene and was end labeled at the

I

1iIF;Ii-

ile

MC)L. CEI-t-. BIOL.

BB+8 ...

11'..,

mI

on Novem

ber 17, 2018 by guesthttp://m

cb.asm.org/

Dow

nloaded from

hGH GENE GLUCOCORTICOID REGULATORY ELEMENT

A 5--REGION OF THiE h-OH-I GEME

-2 10 -260 -250 -240 -230 -220

AGGGCACCCACGTGACCCTTAAAGA6AGGACAAGTTGGGTGGTATTTTCTGGCTGACACTTCCCGTGGGTGCACIGGAATTTCTCTCCTGTTrAACCCACCATAAAAGACCGACTGTGA

-110 -200 -190 -180 -170 -160

CTGTGCACAACCCTCACAACACTGGTTGACGGGIGGGAAGGGAAAGATGACAAGCCAGGG6GACALCITIII,E,1AbTGTTGTIGACCAICTGLACLLI LLLIILIRLIOI lOU IL1AA

-150 -140 -130 -120 -110 -100

CATGATCCCAGCATGTGTGGGAGGAGCTTCTAAATTATCCATTAGCACAAGCCCGTCAGTGTACTAGGGTCGTACACACCCTCCTCGAAGATTTAATAGGTAATCGTGTTCGGGCAGTCA

-90 -80 -70 -60 -50 -40

GGCCCCATGCATAAATGTACACAGAAACAGGTGGG6GCAACAGIG6GAGAGAAGGGGCCArrTAe'TArATTTTArATATATrTTTTrrArrrrrGTTrTrArrrTTCfrrTrCCCGGT

-30 -20 -10 .10 20

GGGTATAAAGGGCCCACAAGAGACCGGCTCAAGGATCCCAAGGCCCAACTCCCCGAACCCCATATTMCCCGGGTGTTCTCTGGCCGAGTTCCTAGGGTTCCGGGTTGAGGGGCTTG

.30 .40 .50 .60 *70 .80

CACTCAGGGTCCTGTGGACGCTCACCTAGCTGCAATGGCTACAGGTAAGCGCCCCTAAAAGTGAGTCCCAGGACACCTGCGAGIGGATCGACGTTACCGATGTCCATTCGCGGGGATTTT

--:+90 +10 It1 4 - 120 .130 +140

TCCCMGGGCACAATGTGTCCTGAGGGGAGAGGCAGCGACCTGIAGATGGGACGGGGGCAGGGAAACCCGTGTTACACAGGACTCCCCTCTCCGTCGCTGGACATCTACCCTGCCCCCG

B COMPARISON OF GLUCOCORTICOID RECEPTOR BINDING SITES

1 2 3 4 5 6 7 8 91011121314151hGH +92 5'- E G GC A C A A T G T G T C C T-3' +107

hMT-IIA -262 5'- C G G T A C A C G T G T C C T -3' -247

iv, VMMTV -185 5'- L. G TI A C A 2 A C T -3' -170

Consensus: 5'- g G G t A C A a T G T G T c C T -3'3'- c C c a T G T t A C A C A G G A -5'

FIG. 5. (A) Nucleotide sequence around the 5' end of hGH. Thenucleotide sequences of both DNA strands around the transcriptioninitiation site (cap) are shown (5). The sequences of the first exonand the TATA box are underlined. The vertical arrows indicate thelimits of the exonuclease III footprint, and the horizontal arrowsindicate the positions of the hexanucleotide 5'-TGTCCT-3'. (B)Comparison of the nucleotide sequences of three binding sites forthe glucocorticoid receptor. Sixteen nucleotides of the binding sitesfor the glucocorticoid receptors in the hGH, hMT-IIA (13), andMMTV (32) genes are aligned. The numbers indicate the distancefrom the start of transcription to the first and the sixteenth positions.A consensus sequence based on these three structures is shown atthe bottom. Those positions that are conserved in all sites areindicated by large capital letters; those that are only common to thetwo human genes are shown by small capital letters. Also indicated(by triangles) are the guanosine residues that have been shown to bein intimate contact with the receptor in the MMTV long terminalrepeat (31).

NcoI site was hybridized to RNAs from cells harboring thegenes shown in Fig. 1 that were grown in the absence orpresence of Dex. After digestion of the hybrids with nucle-ase Si, protected fragments that were 70 to 74 nucleotideslong were generated. As shown in Fig. 7, the TK mRNAsexpressed from the various chimeric genes had identical 5'termini, and Dex had no effect on the selection of start sites.

DISCUSSIONIn this study receptor binding and gene transfer analyses

demonstrated that a DNA segment contained in the firstintron of the hGH gene has the properties of a GRE. Thisregion exhibited the most preferential binding by the gluco-corticoid receptor of all the hGH gene segments examined in

TABLE 1. Transfection of Rat 2 TK- cells"

No. of TKcolonies per 106 cellsPlasmid DNA Increase (fold)

Without Dex With Dex

pAMTK 6 5 0.87 5

pMTK 7 46 6.09 49

pGHAMTK 7 19 3.77 323 12

TK109 6 8 1.3

" At 14 to 20 days after transfection with a plasmid, the plates were fixedand stained. and the colonies were counted. The results of individualexperiments are shown. The increase represents the number of colonies onDex-treated plates divided by the number on control plates.

nitrocellulose filter binding assays and was the only regionthat generated a detectable exonuclease III footprint. Theregion protected from the exonuclease occurs between po-sition +86 and position +115 within the first intron. Thisregion contains a nucleotide sequence which is 81% homol-ogous to the 16-nucleotide GRE of the hMT-IIA gene (13).The essential quanosine residues that have been reported tobe involved in the interaction of several binding sites in theMMTV along terminal repeat and the glucocorticoid recep-tor (31) are also preserved in the hGH gene binding site.These sites are at positions 2 and 12 in the coding strand andat positions 6 and 15 in the complementary strand of theconsensus sequence (Fig. SB).The filter binding experiments demonstrated a less exten-

sive, but preferential, binding of the receptor by the 5'-

AMTK GHAMTK MTK- + - + _ +

FIG. 6. Expression of TK mRNA in Rat 2 cells transfected withAMTK, GHAMTK, and MTK. Mixed populations of Rat 2 cellstransfected with the three fusion genes described in Fig. 1 wereincubated in growth medium containing 10-6 M Dex (+) or 0.1%ethanol (-) for 12 to 16 h. Total cytoplasmic RNA (20 ,ug) wasanalyzed by RNA blot hybridization, and TK mRNA was identifiedby hybridization to a 3'P-labeled TK fragment. The arrow indicatesthe 1.3-kb TK transcript.

I.

2989VOL. 5, 1985

I

on Novem

ber 17, 2018 by guesthttp://m

cb.asm.org/

Dow

nloaded from

2990 SLATER ET AL.

flanking sequences. However, receptor-glucocorticoid com-plexes did not show detectable interactions with this site inexonuclease III footprint experiments. Thus, this site prob-ably binds receptors more weakly than the intron A segmentdoes. The 5'-flanking DNA contains the hexanucleotideportion of the consensus sequence (5'-TGTCCT-3') on thecomplementary strand from positions -244 to -249 (Fig.SA). However, the nucleotides 5' to this hexanucleotideshow only 30% homology to the rest of the 16-nucleotideconsensus sequence shown in Fig. SB. Thus, it is not clearwhether this 5'-flanking DNA site is important for glucocor-ticoid control of the hGH gene. However, it could accountfor the report by Robins et al. (29) that a hybrid genecontaining the 5'-flanking region of the hGH gene fused tothe TK gene coding sequences is induced by glucocorticoidsafter transfection into mouse L cells.The hexanucleotide 5'-TGTCCT-3' is also found at the 3'

end of the hGH gene immediately upstream from and a fewnucleotides downstream from the polyadenylation signalAATAAA. These two hexanucleotides are included withinthe 0.6-kb PvuII-EcoRI restriction fragment shown in Fig. 2.Since there is no preferential retention of this fragment in thepresence of receptor, it appears that the interaction of thpreceptor with these sites is weak. In fact, a comparison ofthe 10 nucleotides 5' to the hexanucleotide with the corre-sponding structure of the 16-nucleotide consensus sequencefor glucocorticoid receptor binding (Fig. SB) showed le§sthan 50% homology. These data suggest that Whereas thehexanucleotide may be necessary for tight binding, it is notsufficient. This may also be true for biological activity. Asequence containing only the hexanucleotide motif is alsopresent in the hMT-IIA gene on the complementary strandfrom position -322 to position -327. This region has beenshown by deletion mapping studies not to affect the regula-tion of this gene by glucocorticoids (13).Because of its strong glucocorticoid receptor binding

properties, the segment containing the first intron of thehGH gene was tested for GRE activity. To compare the hGIfgene GRE with that of the hMT-IIA gene, the GHAMTkhybrid gene was constructed since the AMTK gene ha$ beenwell characterized and has no intrinsic glucocorticoid re-sponsivity (13). The presence of the hGH gene GRE in-creased the number of TK+ colonies 3- to 5-fold whencolonies were selected in the presence of Dex, whereas thehMT-IIA gene GRE increased the number 5- to 10-fold. Adensitometric analysis of the RNA blots demonstrated athreefold increase by Dex of TK mRNA from cellstransfected with the construction containing the hGH GRE,whereas RNA from the hMT-IIA GRE-transfected cellsyielded a sixfold increase. The differences in the amounts ofinduction of these gene fusions by Dex probably reflect atranscriptional component of the hormone response because

TABLE 2. Induction of TK mRNA by Dex in transfected cells

Densitometry Units

Plasmid TK a-Actin StimulationWithout With Without With (fold)aDex Dex Dex Dex

pAMTK 5 4 49 48 0.8pMTK 2 13 43 45 6.2pGHAMTK 6 13 49 41 2.6

a Normalized to a-actin exposure.

A B C D E F

- 309

- 217

-90

- 76

-67

FIG. 7. Mapping the start sites of transcripts derived from MTK,AMTK, and GHAMTK in transfected Rat 2 cells. After induction for12 to 16 h in the presence of 10-6 M Dex, total cytoplasmic RNAwas extracted, and 50-,ug samples were analyzed as described inMaterials and Methods. Lanes A and B, RNA from cells transfectedwith AMTK; lanes C and D, RNA from cells transfected withGHA&MTK; lanes E and F, RNA from cells transfected with MTK.Lanes A, C, and E contained the control samples. Lanes B, D, andF contained samples from Dex-treated cells. The positions ofHpaII-digested pBR322 markers are indicated on the right.

the TK mRNA itself is not subject to either transcriptional orposttranscriptional regulation by glucocorticoids (12).These results indicate that the putative GRE in the intron

of the hGH gene can be active. The GREs whose activitieshave been documented previously are located in the 5'-flanking regions of the inducible genes. The distance fromthe transcription initiation site varies from about 50 nucleo-tides in the case of the chicken lysozyme gene (26) to morethan 2,600 nucleotides in the rabbit uteroglobin gene (3). Toour knowledge, this is the first documentation that a poten-tially functional GRE can be found downstream from thetranscription initiation site (namely, within the first intron).However, what role this segment has in the regulation of theintact hGH gene remains to be established. During the

MOL. CELL. BIOL.

on Novem

ber 17, 2018 by guesthttp://m

cb.asm.org/

Dow

nloaded from

hGH GENE GLUCOCORTICOID REGULATORY ELEMENT

preparation of this paper, Moore et al. (19) also reported thatthe first intron of the hGH gene exhibits preferential bindingof the glucocorticoid receptor, although biological activityand exonuclease footprint analyses were not described. Inaddition, Payvar et al. (23) reported in summary form thatinternal MMTV gene segments are active. However, thenature of the promoter used and the transcripts generatedwere not reported. Our finding that the hGH gene contains apotentially active GRE in an intron suggests thatglucocorticoids may affect the expression of genes throughactions on transcribed gene sequences. These findings mayalso imply that the primary structure of the GRE may bemore important than its actual location relative to thepromoter. Indeed, the transcription of immunoglobulingenes is enhanced by sequences in an intron (1, 8, 25).

It is noteworthy that the GRE of the hMT-IIA geneexhibits greater relative binding of the receptor than theGRE of the hGH gene and that this is correlated with thetwofold-greater capacity of the hMT-IIA GRE to conferinducibility to the hMT-IIA promoter. Thus, in this case theextent of the response of the gene to the hormone can becorrelated with the binding of the receptor-glucocorticoidcomplexes.

ACKNOWLEDGMENTSWe thank Uwe Vaupel and Hannes M. Westphal for the

preparation of the glucocorticoid receptor.This work was supported by a grant from the Deutsche

Forschungsgemeinschaft and the Fond der Chemischen Industrie (toM.G.), by Public Health Service grants AM 31337 (to J.D.B.), AM19997 (to J.D.B.), and R01-ES-03222-01 (to M.K.) from the NationalInstitutes of Health, by grant R-810531-01 from the EnvironmentalProtection Agency (to M.K.), and by a gift from CaliforniaBiotechnology, Inc. (to J.D.B.).

LITERATURE CITED1. Banerji, J., L. Olson, and W. Schaffner. 1983. A lymphocyte-

specific cellular enhancer is located downstream of the joiningregion in immunoglobulin heavy chain genes. Cell 33:729-740.

2. Baxter, J. D., G. G. Rousseau, M. C. Benson, R. L. Garcea, J.Ho, and G. M. Tomkins. 1972. Role of DNA and specificcytoplasmic receptors in glucocorticoid action. Proc. Natl.Acad. Sci. USA 69:1892-18%.

3. Cato, A. C. B., S. Geisse, M. Wenz, H.M. Westphal, and M.Beato. 1984. The nucleotide sequences recognized by the glu-cocorticoid receptor in the rabbit uteroglobin gene region arelocated far upstream from the initiation of transcription. EMBOJ. 3:2771-2778.

4. Chandler, V. L., B. A., Maler, and K. R. Yamamoto. 1983. DNAsequences bound specifically by glucocorticoid receptor in vitrorender a heterologous promoter hormone responsive in vivo.Cell 33:489-499.

5. DeNoto, F. M., D. D. Moore, and H. M. Goodman. 1981. Humangrowth hormone DNA sequence and mRNA structure: possiblealternative splicing. Nucleic Acids Res. 9:3719-3730.

6. Fiddes, J. C., P. H. Seeburg, F. M. DeNoto, R. A. Hallewell,J. D. Baxter, and H. M. Goodman. 1979. Structure of genes forhuman growth hormone and chorionic somatomammotropin.Proc. Natl. Acad. Sci. USA 76:4294-4298.

7. Geisse, S., C. Scheidereit, H. H. Westphal, N. E. Hynesi B.Groner, and M. Beato. 1982. Glucocorticoid receptors recognizeDNA sequences in and around murine mammary tumor virusDNA. EMBO J. 1:1613-1619.

8. Gilies, S. D., S. L. Morrison, V. T. Oi, and S. Tonegawa. 1983.A tissue-specific enhancer element is located in the major intronof a rearranged immunoglobulin heavy chain gene. Cell33:717-728.

9. Greediberg, B. D., G. H. Bencen, J. J. Seilhamer, J. A. Lewcki,and J. C. Fiddes. 1984. Nucleotide sequence of the geneencoding human atrial natriuretic factor precursor. Nature

(London) 312:656-658.10. Hynes, N. E., A. van Ooyen, N. Kennedy, P. Herrlich, H. Ponta,

and B. Groner. 1983. Subfragments of the large terminal repeatcause glucocorticoid-responsive expression of mouse mammarytumor virus and of an adjacent gene. Proc. Natl. Acad. Sci.USA 80:3637-3641.

11. Karin, M., R. D. Andersen, E. Slater, K. Smith, and H. R.Herschman. 1980. Metallothionein mRNA induction in HeLacells in response to zinc or dexamethasone is a primary induc-tion response. Nature (London) 286:295-297.

12. Karin, M., A. Haslinger, H. Holtgreve, G. Cathala, E. Slater,and J. D. Baxter. 1984. Activation of a heterologous promoter inresponse to dexamethasone and cadmium by metallothioneingene 5'-flanking DNA. Cell 36:371-379.

13. Karin, M., A. Haslinger, H. Holtgreve, R. I. Richards, P.Krauter, H. M. Westphal, and M. Beato. 1984. Characterizationof DNA sequences through which cadmium and glucocorticoidhormones induce human metallothionein-IIA gene. Nature(London) 308:513-519.

14. Karin, M., and R. I. Richards. 1982. Human metallothineingenes-primary structure of the metallothionein-II gene and arelated processed gene. Nature (London) 299:797-802.

15. Kurtz, D. T. 1981. Hormonal inducibility of rat a2-globulingenes in transfected mouse cells. Nature (London) 291:629-631.

16. Majors, J. E., and H. E. Varmus. 1981. Nucleotide sequences athost-proviral junctions for mouse mammary virus. Nature (Lon-don) 289:253-258.

17. Maxam, A., and W. Gilbert. 1977. A new method for sequencingDNA. Proc. Natl. Acad. Sci. USA 74:560-564.

18. McKnight, S. L., E. R. Gavis, R. Kingsbury, and R. Axel. 1981.Analysis of transcriptional regulatory signals of the HSV-thymidine kinase gene: identification of an upstream controlregion. Cell 25:385-398.

19. Moore, D. D., A. R. Marks, D. I. Buckley, G. Kapler, F. Payvar,and H. M. Goodman. 1985. The first intron of the human growthhormone gene contains a binding site for glucocorticoid recep-tor. Proc. Natl. Acad. Sci. USA 82:699-702.

20. Morrisey, J. H. 1981. Silver stain for proteins in polyacrylamidegels: a modified procedure with enhanced uniform sensitivity.Anal. Biochem. 117:307-310.

21. Nguyen-Huu, M. C., M. Stratmann, B. Groner, T. Wurtz, H.Land, K. Giesecke, A. E. Sippel, and G. Schutz. 1979. Chickenlysozyme gene contains several intervening sequences. Proc.Natl. Acad. Sci. USA 76:76-80.

22. Payvar, F., D. DeFranco, G. L. Firestone, B. Edgar, 0. Wrange,S. Okret, J.-A. Gustafsson, and K. Yamamoto. 1983. Sequence-specific binding of glucocorticoid receptor to MTV DNA at siteswithin and upstream of the transcribed region. Cell 35:381-392.

23. Payvar, F., G. L. Firestone, S. R. Ross, V. L. Chandler, 0.Wrange, J. Carlstedt-Duke, J.-A. Gustafsson, and K. R.Yamamoto. 1982. Multiple specific binding sites for purifiedglucocorticoid receptors on mammary tumor virus DNA. J.Cell. Biochem. 19:241-247.

24. Pfahl, M., D. McGinnis, M. Hendricks, B. Groner, and N. E.Hynes. 1983. Correlation of glucocorticoid receptor binding siteson MMTV proviral DNA with hormone inducible transcription.Science 222:1341-1343.

25. Queen, C., and D. Baltimore. 1983. Immunoglobulin gene tran-scription is activated by downstream sequence elements. Cell33:741-748.

26. Renkawitz, R., G. Schutz, D. von der Ahe, and M. Beato. 1984.Sequences in the promoter region of the chicken lysozyme generequired for steroid regulation and receptor binding. Cell37:503-510.

27. Rigby, P. W. J., M. Dieckmann, C. Rhodes, and C. P. Berg.1977. Labelling of DNA to high specific activity in vitro by nicktranslation with DNA polymerase I. J. Mol. Biol. 113:237-251.

28. Riggs, A. D., H. Suzuki, and S. Bourgeois. 1970. Lac repressor-operator interaction. I. Equilibrium studies. J. Mol. Biol.48:67-83.

29. Robins, D. M., I. Paek, P. H. Seeburg, and R. Axel. 1982.Regulated expression of human growth hormone genes in mousecells. Cell 29:623-631.

VOL. 5, 1985 2991

on Novem

ber 17, 2018 by guesthttp://m

cb.asm.org/

Dow

nloaded from

MOL. CELL. BIOL.

30. Rousseau, G. G., and J. D. Baxter. 1979. Glucocorticoid hor-mone action. Springer-Verlag, Heidelberg.

31. Scheidereit, C., and M. Beato. 1984. Contacts between hormonereceptor and DNA double helix within a glucocorticoid regula-tory element of mouse mammary tumor virus. Proc. Natl. Acad.Sci. USA 81:3029-3033.

32. Scheidereit, C., S. Geisse, H. M. Westphal, and M. Beato. 1983.The glucocorticoid receptor binds to defined nucleotide se-

quences near the promoter of mouse mammary tumor virus.Nature (London) 304:749-752.

33. Seidman, C. E., K. D. Bloch, K. A. Klein, J. A. Smith, and J. G.Seidman. 1984. Nucleotide sequences of the human and mouseatrial natriuretic factor genes. Science 226:1206-1209.

34. Shalloway, D., T. Kleinberger, and D. M. Livingston. 1980.Mapping of SV40 DNA replication origin region binding sites forthe SV40 T antigen by protection against exonuclease III

digestion. Cell 20:411-422.35. Thomas, P. S. 1980. Hybridization of denatured RNA and small

DNA fragments transferred to nitrocellulose. Proc. Natl. Acad.Sci. USA 77:5201-5205.

36. Topp, W. C. 1981. Normal rat cell lines deficient in nuclearthymidine kinase. Virology 113:408-411.

37. von der Ahe, D., S. Janich, C. Scheidereit, R. Renkawitz, G.

Shutz, and M. Beato. 1985. Glucocorticoid and progesteronereceptors bind to the same sites in two hormonally regulatedpromoters. Nature (London) 3IJ:706-709.

38. Weaver, F. R.^ and C. Weissmnh. 1979. Mapping of RNA by amodification of the Berk-Sharp procedure: the 5'-termini of 15S,-globin mRNA precursor and mature 10S ,B-globin mRNA haveidentical map coordinates. Nucleic Acids Res. 7:1175-1193.

39. Westphal, H. M., and M. Beato. 1980. The activated glucocor-ticoid receptor of rat liver: purification and physical character-ization. Eur. J. Biochem. 106:395-403.

40. Westphal, H. M., G. Fieischmann, and M. Beato. 1981. Photoaf-finity labeling of steroid binding proteins with unmodifiedligands. Eur. J. Biochem. 119:101-106.

41. Wigler, M., R. Sweet, G. K. Sim, IB.-Wold, A. Pellicer, E. Lacy,T. Maniatis, S. Silvei-stein, and R. Aol. 1979. Transformation ofmammalian cells with genes from pbcaryotes and eucaryotes.Cell 16:777-785.

42. Wrange, O., J. Carlstedt-Duke, and J.-A. Gustafsson. 1979.Purification of the glucocorticoid receptor from rat liver cytosol.J. Biol. Chem. 254:9284-9290.

43. Yamamoto, K. R., and B. M. Alberts. 1976. Steroid receptors:elements for modulation of eukaryotic transcription. Annu.Rev. Biochem. 45:721-746.

2992 SLATER ET AL.

on Novem

ber 17, 2018 by guesthttp://m

cb.asm.org/

Dow

nloaded from