globin gene analysis in a ghanaian population

HEMIS #: 363667Globin gene Haplotype analysis in a Ghanaian population 2009/2010

Globin gene Haplotype analysis in a Ghanaian population

1. Introduction

1.1 Haemoglobin: structure and function

The Haemoglobin molecule is made up of four polypeptide chains, each of which has a

single haem group consisting of an iron atom located at the centre of a porphyrin ring(Bragg

and Perutz, 1952). This molecule is spherical in structure with the Globin chains folded so that

the four haem groups lie in surface clefts equal distance and parallel from each other. The

molecule is held together in its quaternary structure by bonds between the opposite polar

chains and the structure changes as oxygen is taken up by each haem group. The structure

of haemoglobin is shown in fig 1.1 below

Fig 1.1 Quaternary structure of haemoglobin

When an Oxygen molecule binds to the haem group on one of the polypeptide subunit

chains it causes a structural change of the whole haemoglobin molecule and this allows

more oxygen molecules to bind to the three remaining subunit molecules in a summative

fashion from one of the subunits (Ogata and McConnell, 1972).

1


Each molecule of haemoglobin can carry up to four molecules of oxygen when fully

oxygenated, with one oxygen molecule binding to each haem group, transporting Oxygen

from the lungs around the body. As blood travels through the arterial system and flows back

to the lungs, haemoglobin picks up Carbon Dioxide from the tissues and carries it to the

lungs. Haemoglobin also acts as a red blood cell buffer and reduces changes in pH within the

red blood cell when they are oxygenated or deoxygenated. Red blood cells contain

approximately 640 million haemoglobin molecules.

1.2 Haemoglobin gene clusters- classification and expression

The genes that code for haemoglobin in humans are found in two clusters on an α or α-like

complex on chromosome 16 and a β complex on chromosome 11 (Manning and Russell.,

2007). The α-like cluster can be found close to the end of chromosome 16 and is made up of

the functional genes α1, α2 and ζ, three pseudo genes ( genes closely resembling functional

genes but contain mutations which render them inactive):ψ ζ, ψα1 and ψα2 and ѳ, which

have no known function in haemoglobin synthesis. The α1 and 2 genes code α Globin chains

from late embryonic stage of life towards the liver and spleen are developed enough to

produce Haemoglobin and by the sixth month of pregnancy bone marrow of becomes the

main site of haemoglobin synthesis (Pallister, 2005). The ζ gene codes for an α like zeta chain

in early embryonic life and is active during the 5th week of gestation and Haemoglobin is

synthesized from erythroblasts in the gestational sac (Kunkel et al., 1955).

The β-like gene cluster is located on the short arm of chromosome 11. (Sutton et al., 1989) It

contains a single pseudo gene (ψβ), and five functional genes (€, Gγ, Aγ, δ and β) which

encode for the €, γ, δ, and β chains respectively. The γ chains are mainly coded in foetal life

by Gγ and Aγ when they combine with α chains to form foetal haemoglobin (Hb F). β Globin

gene synthesis begins after birth(Korf., pg 208., 2007). This shows therefore that locations,

types and rates of synthesis of different Haemoglobins can vary during foetal and adult life.

2


The locations of the haemoglobin genes are shown in fig 1.2 below

Fig 1.2 Location of Hb clusters on chromosome 11 and 16

Adult human haemoglobin (Hb A) consists of 2 α-Globin and 2β-globin chains of 141 and 146

amino acid chains respectively and also has a small percentage of Hb A 2 which has 2 δ-

globins and 2 α-globins.

Synthesis of globins is a complex process where transcription produces a messenger RNA

precursor; post transcriptional processing with 5’ end capping and methylation as well as the

various phases of translation, and finally the ionic interaction between the haemoglobin

chains to form mature active haemoglobin(Paul., 1976). Because of this myriad of active

processes and their complex nature, errors can occur during processing causing

haemoglobin disorders. Disorders of haemoglobin are categorised into two kinds; those

causing abnormalities of haemoglobin structure and those causing reduced Globin synthesis

(World Health Organization., 2006)

There are various kinds of structurally abnormal haemoglobins; some are clinically silent

however others have serious clinical implications that affect people who have abnormal

haemoglobin. The mutational mechanisms normally consist of point mutations but in some

3


case also include frame-shift mutations, in frame deletions, mis-pairing of homologous

sequences that lead to unequal cross-over of genes and formation of fused genes (Korf., pg

209., 2007)

1.3 Single nucleotide polymorphisms (SNP’s)

Single nucleotide polymorphisms, commonly referred to as “snips” (SNP’s) are the most

prolific type of genetic variation among people. SNP’s show a difference in a singleDNA

nucleotide, where one nucleotide is replaced by another for example, A G, C T and vice

versa in a certain stretch on a DNA strand.

SNP’s occur throughout DNA and are normally exhibited approximately every 300

nucleotides meaning there are around 10 million SNP’s occurring on the human genome.

SNP’s are usually found on DNA in between functional genes however when they occur on a

functional gene or on the regulatory region for a gene, they may cause or have a role in gene

abnormality and disease.

SNP’s usually have no effect on health and development and this explains why they occur so

frequently on the human genome. They do however sometimes provide important insight

into human health. Studies conducted have found that they may affect people’s responses to

drug metabolism (Kudzi et al., 2009), endogenous factors, and the risk of developing

diseases associated with the genome. SNP’s are also useful tools in determining hereditary

passing on of certain disease states such as obesity, diabetes, and cancer (Eftychi et al., 2004,

Herbert et al., 2006,).

1.4.1Haemoglobin Abnormalities

Hb abnormalities are inherited disorders in the Globin chains when the haem group is in the

normal state. They are mostly autosomal recessive abnormalities and common worldwide,

particularly within the malarial regions of Africa, the Mediterranean basin, the Middle East

4


and south East Asia (Modell and Darlison, 2008). It is thought that some of the heterozygous

carrier states with abnormal Hb afford protection against malaria (see Section 1.6).

When a haemoglobin abnormality causes a blood disorder it is known as a

haemoglobinopathy and the nature of the Hb abnormality will determine the clinical

significance.

Haemoglobinpathies are described as any blood disorder caused by defects in Globin gene

chain synthesis. Classified into two broad categories; those which cause a reduction in

haemoglobin synthesis (the Thalassaemias), and structural haemoglobinopathies where

haemoglobin variants cause the disorder (Sickle cell disease).

Haemoglobinopathies are the most common single gene disorders in man. They are passed on to

generation to generation and these conditions are more prevalent in populations of African, Arab,

Middle Eastern and Hispanic descent. The most common type of haemoglobinopathies are the

thalassaemias, and sickle cell anaemia.

According to the NHS In the UK, an estimated one in 300 babies of African-Caribbean parents and

one in 60 of West African parents are born with sickle cell disease each year. An estimated 8,000-

10,000 people with sickle cell disease and 600 with β Thalassaemia live in the UK. Approximately 1

in 4 West African, 1 in 10 African-Caribbean, 1 in 50 Asian and 1 in 100 Northern Greek have sickle

cell trait (carrier state). Whilst 1 in 7 Greek, 1 in 10-20 Asian, 1 in 50 African and African-Caribbean

and 1 in 1000 English people have beta thalassaemia trait. Worldwide α thalassaemia carrier states

are commoner than ß thalassaemia carrier states(European haemoglobinopathy registry., 2003)

Sickle cell anaemia and the Thalassaemias exhibit some clinical similarities between the two

conditions. Both are expressed as a direct result of a defect in the Globin chain and patients

suffer chronic haemolysis throughout their life. Patients of both conditions may also need

chronic blood transfusions. Subsequently, patients may be at risk of iron overload that has

5


its own clinical implications (Fung et al., 2008). Thalassaemias fall into three major categories;

α-thalassaemia, β-thalassaemia and High Persistence of Foetal Haemoglobin (HPFH). There

are rare thalassaemias which fall outside of these categories, namely δβ and εδβ-

thalassaemia and Hb Lepore (Weatherall, 2001).

1.3.2 Haemoglobin variants

Different kinds of Hb variants exist caused from autosomal recessive pairing of alleles and

are mainly due to substitutions in the β-chain(refer to fig 1.2 ) Rare Hb variants such as

Haemoglobin H and Haemoglobin Barts may also come about from the extension or deletion

of the Globin chain ( Giardine et al., 2007).

The occurrence of abnormal haemoglobins varies significantly between ethnic groups

(Modell and Darlison, 2008). Haemoglobin C occurs in approximately 2-3% of people of West

African descent and most people are heterozygous for it. Homozygosis is rare and has mild

clinical symptoms. Haemoglobin E is one of the more common β globin chain variants and

is relatively common in Southeast Asia (Flatz., 1967). Amino acid substitutions along one

polypeptide chain generally create a high affinity for oxygen. The most prevalent

Haemoglobin disorder caused by an Hb variant is Haemoglobin S which causes the

potentially life threatening disorder known as sickle cell anaemia.

1.3.3 Haemoglobin S and Sickle cell anaemia

One clinical condition that can be caused by having mutations of the parts of haemoglobin

genes is sickle cell anaemia. It is one of the most common hereditary diseases in the world

and mainly affects people whose ancestry is from sub-Saharan Africa although it is also

known to affect Mediterranean, Middle Eastern and Asian populations (Cihan Öner et al.,

1992). The disease shows autosomal recessive inheritance so to have the condition you

6


must receive one recessive allele from both parents. The gene mutation causing the

formation of Hb S is: GAG GTG. This mutation results in substitution of the amino acid

valine (Val) for glutamic acid (Glu) in the sixth position of the β- Globin chain (α2 /β2 6val).

Despite being a minor change in the polypeptide sequence, it causes serious implications in

people with this mutation on their Hb gene cluster (Bunn, 1997). Sickle cell anaemia is the

most common haemoglobinopathy and usually occurs between various ethnicities in

populations that are exposed to falciparum malaria and the anopheles mosquito. The

disease was initially classified by Herrick et al in 1910 and Singer and Wells explained the

mutation causing Hb S in 1925.

Hb S in sickle cell patients manifests itself by causing sickling in red blood cells, causing them

to be rigid and take up a crescent shape. Hb S is insoluble and crystallises under low O2

partial pressure (Bunn., 1998, Lonergan et al., 2001, Higgs and Wood, 2008). Sickled Red blood

cells also interfere with oxygen transport as they are less elastic to movement inside

capillaries. Haemoglobin gives up oxygen more readily than normal haemoglobin and the

oxygen dissociation curve is shifted to the right.

Fig1.3 and fig1.4 below show the distortion of red blood cells with Hb S and the shifting of

the Oxygen Dissociation Curve among normal haemoglobins and SCA respectively.

7


Fig1.3 Appearance of normal and sickled red blood cells

8


Fig1.4 Oxygen Dissociation Curve for normal, sickle cell trait and sickle cell sufferers

1.3.3.2 Complications and clinical implications of sickle cell disease

Red blood cells exhibiting Hb S as explained before are sickled in shape and are inflexible

making them incapable of efficient circulation in small blood vessels, causing them to have a

life span of only 10-20 days as compared to normal healthy Red Blood Cells which live up to

120 days. Anaemia results because of this and other crises occur in sickle cell patients. Sickle

cell disease is a major public health problem in several countries particularly less

economically developed countries (LEDC’s) and gives significant morbidity and mortality in

particular with young children aged 1 to 3 years of age caused by cerebrovascular accidents

and viral infections (Leikin et al., 1989, Athale and Chintu, 1994). Blood transfusions in these

patients is sometimes necessary and can cause iron overload which damages vital organs

such as the heart, liver and spleen (Wood, 2008). Life expectancy in patients with Sickle Cell

9


Disease is greatly reduced and patients rarely live past the age of 35. Moreover quality of life

in SCD patients is low as they are constantly dealing with crises and the residual effects of

anaemia and other complications. The crises that manifest themselves in SCD patients

include haemolytic anaemia, Ischaemic pain, susceptibility to bacterial infections and severe

organ dysfunction (Vichinsky et al., 1998, Frempong et al .,1988, Serjeant et al.,). Clinical

complications of SCD occur among homozygous Hb SS, or in those heterozygous for Hb S and

another abnormal haemoglobin e.g. Hb C, β+ thalassaemia or. People with Sickle Cell disease

that are homozygous (Hb SS) exhibit 90-95% Hb S in their erythrocytes (Wood et al., 1980).

Disease severity is determined by the genotype exhibited by the patient and homozygous Hb

SS is the most clinically significant and crises of Sickle cell Disease are classified as being

haemolytic, aplastic or vasco-occlusive. Vasco-occlusive crises are the most common

complication of SCD and they arise from interaction of sickled erythrocytes with White Blood

Cells, Endothelial cells, Platelets and Plasma. Capillaries and microvascular beds become

obstructed and causes problems such as leg ulcers, neuropathic and chronic pain, renal

problems and in some extreme cases stroke (Yale et al., 2000). Ischaemia also results

causing an absolute reduction of oxygen supply to some organs, joints and bones. Ischaemic

injury is recurrent and produces a distinct chronic pain syndrome (McClish et al., 2005,

Shapiro., 1989).

Aplastic crisis may occur in patients with SCA due to parvovirus B19 (B19 virus). Parvovirus

B19 is a DNA virus that infects and destroys erythroid cell progenitors (Setubal et al., 2000).

This crisis is usually preceded by a febrile illness in hereditary haemolytic anaemia’s,

resulting in likely Bone Marrow failure. The crisis is characterised by low Hb concentrations

and a low reticulocyte count (Setubal et al., 2000, Pattison et al., 1981). Carriers, who are

heterozygote for the gene are known as having the sickle cell trait are usually healthy,

10


although they can exhibit some symptoms when there is reduced partial pressure of oxygen,

such as vaso-occlusive episodes.

In some sub-Saharan populations the number of people carrying the sickle cell trait can

reach levels of up to 20%. This is because there is some survival benefit because there is a

connection between being a SC carrier and malaria resistance, and in these populations

malaria is one of the biggest killers.

1.4 Malaria and sickle cell disease

Malaria is a disease caused by the parasite Plasmodium falciparum and the disease is

transmitted to people through the bite of the female anopheles mosquito which thrive in

the tropical conditions of sub-Saharan Africa. The mechanism by which HbAS genotype

protects against malaria has been the subject of debate for more than 50 years. While it is

thought that it relates to the physical characteristics of HbAS erythrocytes, a number of

studies (Aidoo et al., 2009, Williams et al., 2005) suggest that sickle cell carriers may also

enhance natural immunity to plasmodium.

Studies show that mortality rate of malaria in people with Sickle cell trait is conclusively

lower than in normal individuals. Experiments involving P.falciparum in vitro have been

conducted to show the growth of the parasite in sickled RBC’s at standard partial pressure of

oxygen and a low O2 atmosphere and at low concentrations an inhibition of plasmodium

growth is shown.(Friedman, 1978) Sickled RBC’s, and those of carriers(Hb AS) provide an

unsuitable environment for the developing life cycle of the malaria parasite and this gives

evidence of the high proportion of heterozygous Hb AS people in malaria endemic areas.

11


1.5 β-Globin cluster haplotypes

There are 5 different haplotypes of the βs gene (Hanchard et al., 2007, Nagel and Ranney,

1990) causing SCA and they are named after the geographical region where they were first

identified. They are Senegal, Benin, Bantu, Cameroon and Arab-Indian (Nagel and Ranney

1990). The first four mentioned are mostly found in African populations whereas the Arab-

Indian is found in the Middle East and Asia. The Arab-Indian Haplotype and Senegal

Haplotype exhibit less clinical symptoms than the other haplotypes found in Africa. This has

been reported in studies showing clinical severity among people with different haplotypes

explained by having the post natal expression of Hb F present in people expressing these

haplotypes . The different haplotypes causing SCA can be identified by amplification of their

restriction endonuclease sites on the β-Globin cluster by using RFLP and restriction enzyme

digestion. Approximately 5% to 10% of people exhibit what are referred to as atypical βs

haplotypes (Powers and Hiti, 1993., Rahimi et al., 2007).

Haplotypes for sickle cell anaemia can be studied using techniques that can amplify and

visualise DNA fragments such as southern blotting, polymerase chain reaction,

electrophoresis and restriction enzyme digestion.

1.6Restriction fragment length polymorphism analysis

PCR- RFLP analysis is at present the best method used in the analysis of the blood samples

and is also used for diagnosis of haemoglobinopathies. Polymerase Chain Reaction amplifies

individual alleles on the dried blood samples, and restriction enzyme digestion shows the

researcher which specific allele is present in each sample (Chang et al., 1981 ).

12


Restriction enzymes complimentary to the primers used in the amplification cut double

stranded DNA at specific SNP’s. Mutations destroy or alter restriction enzyme sites, allowing

polymorphisms from abnormal genes to be visualised (Sutton et al.,1989).

The Hb S gene is associated to certain DNA structures by specific restriction endonuclease

positions in the β-Globin cluster (Rahimi Z,Karimi M, Hagshenass M, Merat A 2003). PCR

products were treated by suitable enzymes and then Agarose gel electrophoresis will be

used to separate the fragments. The bands are stained with Ethidium bromide and can be

visualized by ultra violet (UV) light box ( Zago., 2001, Goncalves., 2003, Liu., 2009)

1.6 Management of Haemoglobinpathies in Ghana

Ghana is a country in West Africa spanning an area of 238,000 km and has a population of

approximately 22 million. There are over 100 ethnic groups that exist in the country and this

gives great variation in the genetic profiles. Approximately 2% of newborn babies born in

Ghana are diagnosed with sickle cell disease. Carriers of the sickle cell trait are high in

proportion as malaria is an epidemiological problem (Kleinschmidt et al.,2001).

Management of haemoglobinopathies, in particular Sickle Cell Disease is very important in

maintaining a healthy population because of its endemic status for the people of Ghana and

since sickle cell has no cure at the moment. There are different strategies that the Health

ministry in Ghana use to manage the sickle cell problem and these include public health

education, screening programs and increased monitoring of the SCD problem within the

country. However considering that Ghana is still a less economically developed country

these strategies would be met with some difficulty perhaps for lack of resources, funding

and infrastructure. (Modern Ghana 2009)

13


1.5. 1 Health education

Patients with haemoglobin disorders must be educated on how to manage their health since

they are life-long disorders where symptoms can manifest without warning. In the case of

SCD patients should be pro-active in conjunction with their physicians in matters of care,

wellbeing, diet and medication. Patients should be informed on details of the disease and be

aware of how they may avoid complications associated with it. Public health education is

also important among Ghanaian citizens concerning SCD and the health ministry have

through the years had different programs and showcases to educate people on SCD.

Genetic screening, counselling/education to young couples informing them on the

implications of having children with others who have SCD or sickle cell trait. This however

would cause some controversy as Ghana is a country of traditional values.

1.6.2 Screening programmes

People with SCD, carriers of the sickle cell trait and individuals planning on having children

with people that may have SCD or sickle cell trait should ideally go through screening

processes before having offspring. Screening should be run in all major hospitals as part of

pre-natal care and this would benefit the people of Ghana and future generations.

Screening of newborns for SCD allows for early initiation of prophylactic therapy, health

management and parental education and thus results in reduced mortality. Since 1993

screening has been done firstly through the sickle cell clinic at the Komfo Anokye Teaching

Hospital, Kumasi, Ghana (Ohene-Frempong., 1995)

1.6.3 Clinical treatment of sickle cell disease

although the above strategies are useful in getting people to be more knowledgeable about

sickle cell disease for those children and adults that suffer from the disease there must be

14


treatment available to improve quality of life of patients and reduce the symptoms of the

disease. Treatments usually centre around prevention of crises.

The first method of clinically treating sickle cell anaemia are blood transfusions. Transfusions

help to improve anaemia by increasing non-sickled red cells into the circulation of the

patient. Blood transfusions must be performed chronically to children with sickle cell disease

and this may cause iron overload or transmission of bacterial and viral diseases so care must

be taken when using this strategy.

Oral penicillin is given to children with sickle cell disease from the age of 2 months old to at

least five years old to provide prophylaxis to parvovirus infections, and 1mg of folic acid per

day.

The first effective drug treatment for adults with severe sickle cell is daily doses of the anti

cancer drug Hydroxyurea (National Heart, Lung and Blood Institute 1995) . the drug reduced

the frequency of crises, acute chest syndrome and patients required fewer blood

transfusions. The precise mechanism of action of Hydroxyurea causing it to reduce these

symptoms is unknown however the drug causes an increase in HbF levels in patients.

Mild pain can be treated with heat pads and over the counter medication but more painful

crises may have to be attended to in out-patient facilities. Treatments for acute pain crises

when a patient is admitted are fluids and pain killing medication. Fluids help to prevent

dehydration caused by the anaemia, and Non steroidal anti inflammatory drugs and opioids

such as morphine, Declophenac, Hydrocodone and others are used to treat the pain.

Oxygen therapy may also be required to get sufficient oxygen back into the circulation.

Bone marrow transplants are currently being studied as a treatment or cure for people with

significant symptoms and problems derived from being a patient of sickle cell anaemia. Bone

15


marrow from the patient is replaced with healthy bone marrow from a donor who does not

suffer from the disease. This procedure however is not conducted in Ghana as most people

do not have the money to try this strategy.

1.7 Objectives and hypothesis of study

The objectives of this study were to;

Purify dried blood samples on FTA cards and Amplify DNA SNP’S using RFLP with

different primers specific for Hb gene cluster

Run amplified samples on Agarose gel using electrophoresis

Conduct restriction enzyme digest on amplified samples and run the samples again

on Agarose gel

Create a Haplotype map of Ghanaian population

The hypothesis to be tested is “overall the Ghanaian population will exhibit a higher

percentage of Cameroon, Benin and Bantu haplotypes as opposed to Senegal and Arab-

Indian haplotypes”

16


2. Methods

2.1 Method optimisation

To perform analysis of Hb haplotypes it is necessary to amplify DNA from the blood samples

obtained. Different methods can be used to purify and store DNA from whole blood. In

mammals erythrocytes do not contain a nucleus and so the DNA is extracted from plasma

and other cell types in the blood. One method of DNA purification from whole blood is

known as the Buffy coat preparation.

2.1.2Buffy coat preparation

Buffy coat is defined as a clear section of liquid in an anti-coagulated blood sample after

centrifugation of whole blood that contains most of the platelets and white blood cells. The

buffy coat is normally white in color but can also exhibit a green hue if the blood sample

contains a large amount of neutrophils (reference)

When whole blood is centrifuged it separates into its various components according to their

respective densities inside the tube it is centrifuged in. Plasma settles at the top (approx.

50% of blood), red blood cells at the bottom of the tube (45% of blood) and a clear layer of

platelets and white blood cells. The buffy coat can be used to extract DNA from whole blood

as Red Blood Cells in mammals are anucleate. Other applications of the buffy coat

preparation are the QBC(quantitative buffy coat) which is a diagnostic test used to detect

blood parasites(e.g. malaria), and in cases of low white blood cell counts the buffy coat

preparation can be used to procure a more differential blood smear to count WBC’s. A

diagrammatic representation of centrifuged whole blood is shown in fig2.1 below.

17


Fig2.1 shows the separation of blood components after

centrifugation showing the Buffy coat

In this study the Buffy coat preparation was used as a method of control to check if the DNA

primers, thermal cycler and electrophoresis machine were working properly. A fresh blood

sample was obtained from a member of staff for this purpose. After the blood cell was

taken the Buffy coat preparation was conducted as per the guidelines of the QIAGEN spin

protocol for purification of DNA from blood or bodily fluids... The way the protocol was

conducted is described below in accordance with the QIAamp DNA mini and blood mini

handbook and it is described below.

2.1.3Buffy coat protocol

All centrifugation steps were carried out at room temperature, and the heating block oven

was switched on and set at 560C. Buffers and QIAGEN protease were prepared according to

instructions in the kit (QIAamp DNA mini and blood handbook pg 17).

The procedure was carried out as follows;

1. 20µl QIAGEN protease was pippeted into a 1.5 ml microcentrifuge tube

18


2. 200µl of sample was added to the microcentrifuge tube and the tube is then

vortexed to mix the constituents

3. 200µl of buffer AL is added to the sample and the tube is vortexed again to ensure

efficient cell lysis from a homogenius solution

4. Sample is then incubated at 56oC for 10 minutes

5. To remove drops from the inside of the lid of the microcentrifuge tube it is then

centrifuged briefly

6. 200µl of 100% ethanol was added to the sample, and mixed again by pulse

vortexing for 15 seconds.

7. The mixture from step 6 is then applied to a QIAamp mini spin column(in a 2ml

collection tube) without wetting the rim. The cap of the mini spin column is then

coveres and the solution centrifuged at 8000 RPM for 1 minute. The tube containing

the filtrate is then discarded and the pellet obtained. The pellet is what contains the

DNA

8. 500µl of buffer AW1 is then added to the QIAamp mini spin column, the lid of the

column is closed and the tube spun again at 8000 RPM and the filtrate is again

discarded.

the pellet obtained contains amplifiable DNA and RFLP analysis can be conducted on

the sample.

This was done in triplicate and all samples had a successful amplification showing

that the primers used, thermal cycler and electrophoresis machine were working

well. With this information the Ghanaian samples could now be done to see their

haplotype profile for the β globin gene cluster

19


Different βs haplotypes are differentiated in RFLP by providing different profiles with

restriction enzymes and this is shown in Table 1.

βs -Haplotype Result of the Restriction sites

Benin (----+)

Bantu (--+--)

Cameroon (--+++)

Senegal (-++-+)

Arab-Indian (+++-+)

Atypical (-----)(--+-+)(--- ++)

Table 1 . Details βs-haplotypes for the presence (+) or absence (-)

of restriction sites for restriction enzymes HindII ‘5 to ε, Xmn1 ´5 to Gγ, . HindIII within IVS II Gγ, HindIII within IVSII Aγ and HindII ´3 to

ψβ

2.2Materials and Method

2.2.1Subjects and sample collection

The study group consisted of adults from Ghana with unknown βs haplotypes. Ethical

approval was obtained for the project and written informed consent was given by each

participant prior to collection of the specimens. Transportation of fresh blood samples from

other countries is prohibited by UK customs and so Whatman FTA cards were utilised to

store the blood samples. FTA cards are useful as they are user-friendly (blood droplet is

simply blotted on FTA matrix and left to dry). They provide a means of storing whole blood

for long periods of time and can be kept at room temperature without the blood samples

20


going off. 30 samples were used for the analysis to give reasonable numbers for creating a

Haplotype map and statistical analysis of results obtained.

2.2.2DNA purification from FTA cards

The dried specimens are purified before amplification of DNA according to the instructions

given by Whatman and they are as follows:

Firstly, a micro-punch is used to punch a hole in the FTA filter paper to give a small circle 2

mm in diameter take from the dried blood. Each specimen is punched twice to obtain

sufficient DNA to amplify and these are placed in a PCR tube. Filter paper is used to clean

the micro-punch between samples to avoid cross contamination between the specimens.

Following this, 200µl of FTA purification reagent is added to the PCR tube and left to

incubate at room temperature for five minutes. The FTA purification reagent is then

removed taking care that all liquid is removed from the PCR tube. This step is repeated twice

to properly purify the DNA from the sample. In order to stabilize the DNA and remove any

unwanted metals ions (i.e. Fe2+ from erythrocytes), the filter paper is washed twice with

200µl of TE buffer for 5 minutes at room temperature. Finally, the cards are dried at 58 0C for

15 minutes to remove residual moisture. DNA amplification in a PCR is then performed.

FTA card sample collection is shown in the figure below

21


Figure 2.1 showing FTA cards and various micro-punches that can be

used to collect samples from FTA cards (taken from

http://www.genengnews.com/media/images/product/product_327

0.jpg)

Five regions in the β-gene cluster were to be amplified by PCR according to PCR protocol (see

fig 1.3); using five different published primers (forward and reverse) specific for the β cluster

that are listed in Table 2. Following amplification, samples were run on Agarose gel, and

restriction digestion was performed and fragments were analysed Agarose gel

electrophoresis.

22


Restriction

enzymes

Primers (´5 - 3')

F: Forward R:Reverse

Product

size, bp

Presence

of site, bp

1. HindII

´5 to ε

F: TCTCTGTTTGATGACAAATTC

R: AGTCATTGGTCAAGGCTGACC

760 314

446

2. Xmn1 ´5

to Gγ

F: AACTGTTGCTTTATAGGATTTT

R: AGGAGCTTATTGATAACCTCAGAC

650 450

200

3. HindIII

within IVS II Gγ

F: AGTGCTGCAAGAAGAACAACTACC

R:CTCTGCATCATGGGCAGTGAGCTC

323 235

98

4. HindIII

within IVSII Aγ

F: ATGCTGCTAATGCTTCATTAC

R: TCATGTGTGATCTCTCAGCAG

635 327

308

5. HindII ´3 to

ψβ

F: GTACTCATACTTTAAGTCCTAACT

R: TAAGCAAGATTATTTCTGGTCTCT

914 480

434

Table 2. details primers (forward and reverse), restriction enzymes and product sizes (both

before and after digestion) of the βs haplotypes (reference)

Key: F: Forward; R= reverse

2.2.3DNA amplification-PCR reaction conditions

The PCR reaction is prepared in a final volume of 50μl for each DNA sample as detailed

in Table 3.

These solutions were added to PCR tubes used for the PCR amplification.

23


Reagents Volume (μl)

Master Mix 25

Nuclease free water 23

Forward primer 1

Reverse primer 1

Cards as template 2discs

Total 50

Table 3. Master Mix is supplied as 2X dNTPs, MgCl2 and reaction buffer

([pH 8.5)

The labelled tubes are placed on ice before addition of the reagents (i.e. all the reagents

should be added on ice). Fresh pipette tips must be used for each component in order to

limit cross contamination. Following addition of all reagents the reaction mixture is

centrifuged in a micro-centrifuge for 13,000 rpm for a few seconds until it is seen all

reagents are mixed into the tube. At this point is where the samples can be placed in a

thermal cycler. The thermal cycler was then programmed as detailed in Table 4. 30 cycles

are normally sufficient for amplification of DNA samples, however where DNA is limited or

of poor quality, 36 cycles are required.

Temperature Time Steps (Cycles)

24


94°C 5min1. Initial Denaturing

(x1)

94°C 60s 2. Denaturing

55°C* or 65°C† 60s

3. Annealing (x30 or x38)

72°C 90s 3. Extension

72°C 3min 5. Final Extension (x1)

Table 4. PCR cycling parameters

2.2.4Restriction enzyme digestion

Restriction endonucleases recognise and cut the DNA wherever a specific sequence is found.

These enzymes cut double stranded DNA by the creation of two breaks, one on each of the

phosphate backbones of the double stranded DNA helix, resulting in destruction of DNA

nucleotides. The PCR products were treated with suitable enzymes. The restriction enzymes

to be used include HindII ´5 to ε-Globin (5´ ε-HindII), the Xmn1 ´5 to Gγ (Gγ- Xmn1), the

HindIII sites at intervening sequence II of Gγ-Globin (Gγ-IVS II Gγ) and Aγ-Globin (Aγ- HindIII

within IVSII), the HindII site 3´ to ψβ-Globin (3´ ψβ-HindII) HindII sites in IVS 11 β Globin (β -

AvaII within IVS 11) and were used to detect βs-haplotypes. Restriction digestion was

performed by addition of reagents as detailed in Table 4

25


The following volumes of reagents were used to make up a final volume of

20µl. BSA buffer (0.02 µg/ml) is usually added when using HindII and Xmn.

Reagent Volume (µl)

PCR product 10

Restriction enzyme 1

BSA(where applicable) 0.02 µg/ml

Buffer 2

Nuclease free water 6.8

Total 20

Table 5. Volume of reagents added to the PCR tube to perform the restriction

digestion

Restriction digestion is then performed at 37 °C for two hours. After digestion, the

temperature is increased to 65 °C for 10 min so as to denature the restriction enzymes.

Digestion products are then separated on a 2% Agarose gel.

2.2.5 Gel electrophoresis

Gel electrophoresis is the easiest and most convenient method of separating DNA fragments

according to size. After restriction enzyme digestion Agarose gel electrophoresis is used to

visualize DNA fragments. DNA nucleotides have a negative charge and so can move along a

circuit when electric current is applied. DNA molecules move along the gel, which is a

polysaccharide matrix that captures DNA molecules as they move through the electric

current. Smaller DNA fragments travel further along the gel as they can travel through the

mesh-like framework of the Agarose gel.

26


Different gel tanks can be utilised depending on the number of samples to be analysed, large

gels provide a better resolution of DNA fragments and it is possible to analyze more samples

on it however smaller gels run much faster.

When Ethidium bromide is added to the gel, it intercalates to the DNA fragments allowing

for UV visualization using a UV light box. DNA fragments when visualised give the

appearance as thick bands on the Agarose gel and the distance travelled gives an indication

of the size of the DNA fragment. A DNA ladder is placed in the first well of the gel to allow

sample’s DNA fragment size to be found. A visualisation of a hundred base pair and fifty

basepair ladders are shown below

figure 2.2 a 100 base pair ladder marker

Gel Electrophoresis is performed as follows:

Agarose powder is added to 1× TAE buffer to a final concentration of 2% inside a screw-top

glass conical flask. The solution is covered and then heated in the microwave, shaken every

27


so often so as to dissolve the Agarose powder, and heating is stopped when a transparent

solution with no granules is seen. Care should be taken during this step as the solution can

easily boil over in the microwave or indeed when shaking. The flask should be held at arm’s

length at all times to avoid any mishaps. To provide protection for the hands it is advised to

handle the flask with a cloth wrapped around it. The solution is left to cool in the fume

cupboard prior to addition of 1.25 µl of Ethidium Bromide. Ethidium bromide is a strong

mutagen and carcinogen and therefore must be added to the liquefied Agarose gel inside a

fume cupboard. Extra care must be taken not to inhale fumes of Ethidium Bromide or allow

it to make contact with skin. The gel is then placed in an oven for 20 minutes at 65°C to

ensure complete Agarose dissolution. The Agarose solution is then poured into a casting tray

containing a sample comb and left for half an hour to solidify at room temperature with the

cover left on. If any bubbles appear on the gel they must be pushed away or sucked out

using a disposable pipette tip. If bubbles are in the gel it will not run properly. The comb is

then removed and the gel completely immersed in 1X TAE buffer.

3µl of the DNA ladder is added to the outside well. 10ul of the sample is added to a 1.5ml

tube and mixed with 2µl loading dye. The mixture is spun briefly in a centrifuge to mix

samples and loading dye before loading into the sample wells. The lid and the power leads

are placed on the apparatus in the positive and negative terminals and the current is applied

at 50volts. Bubbling of the buffer solution is an indication that current it flowing. The gel is

left to run for approximately 40 minutes, or until the dye front had moved two thirds of the

length of the gel. Current applied may increase the temperature of the buffer and care must

be taken such that the temperature increase is not so much that the gel doesn’t run

properly. Once the gel has run the current is switched off and the gel is removed from the

28


apparatus and washed off to remove any buffer still on it. The bands are visualised on a UV

light box and photographed by Uvitec Gel Documentation System.

3. Results

29


Results were obtained from the PCR products with primer 1 to see if amplification of the ε

allele from any of the dried blood samples occurred. For the amplification of the DNA from

the Ghanaian blood samples to be to be successful the Agarose gel run on the electric

current would show dark bands corresponding to the 760 bp position on the 100 base pair

ladder added in the first well of each gel ran. An expected result is shown in the figure below

which is a gel image from electrophoresis showing what an expected result would look like

under UV light.

Fig 3.1 expected results for amplification with primer 1

60% of samples tested with primer 1 produced a positive DNA amplification of the region of

the β globin gene cluster before restriction enzyme digestion. Samples that did not produce

active PCR products, or did not show a positive amplification the process of FTA card

30


purification, addition of primers and PCR was repeated with a further 15% of samples

produced a band on Agarose gel after electrophoresis of the PCR products

25% of the samples produced unexpected results i.e those where the samples did not

produce an amplification of the βs gene cluster.

After electrophoresis the samples were then treated with the restriction enzyme digestion

HindII´5 to ε with the restriction enzyme and ran through PCR to see the ratio of samples

exhibiting wild-type alleles and mutant-type alleles. Blood samples that exhibit the wild-

type allele will produce the same result as when ran on Agarose gel before digestion with a

band being shown at 446 bp along the gel. However samples that have a mutation on the

DNA fragment will show 2 bands at the 446 bp position and at the 314 bp position as well.

Samples showing bands at unexpected position can also occur and is assumed to be due to

human error or contamination of the sample and repeated. Examples of these scenarios are

shown in the figures below

31


Figure 3.2 Wild type, mutant and erroneous results for restriction enzyme digestion

After digestion 82% of samples produced a negative result for presence of a mutant allele

and 18% of samples produced a positive result.

The overall results for each of the 30 samples amplification and restriction enzyme digest

was tabulated and plotted in a pie chart using Microsoft excel to show the overall ratios of

those samples which showed a (+/+), (+/-) and (-/-) results for RFLP analysis for the

32

Mutant

Wild type

erronous


restriction enzyme HindII´5 to ε and this is shown below

Fig 3.3 Overall results for RFLP with HindII ‘5 to ε

33


4. Discussion

Overall the amplification of the ε gene from the DNA of the

Ghanaian blood samples was successful and results for 30

individuals were obtained

the results produced were unexpected according to my

hypothesis as neither the Benin, Bantu or Cameroon haplotypes

normally exhibit a positive result with the restriction enzyme

HindII. 18% of samples however did have a positive result after

restriction enzyme digestion and it is assumed that these

samples either exhibited the Arab Indian haplotype, Atypical or

were of unknown haplotype.

Amplification and restriction enzyme digestion for the other

four primers on the dried blood samples was not completed as

the supply of FTA TAE purification buffer in the lab ran out. At

this point more TAE buffer was ordered from the lab. When the

new purification reagents arrived amplifications with the

remaining primers were performed. However when run under

electrophoresis none of the samples produced successful

amplification. Amplification was repeated with primer 1 and

fresh blood samples and still produced a negative amplification

as shown below, with no bands being produced. This is shown

in the gel image overleaf

34


The same situation occurred with my colleagues samples and so

we decided that there was a problem with the DNA purification

reagents and so more were ordered but by time of delivery

there was no more time available in the laboratory to finish

testing the rest of the restriction enzymes.

Because of the problem with the DNA purification reagents, not

all the objectives of the study be completed and thus giving us

inconclusive results for the diagnosis of the ghanaian

population. As a direct result of this a haplotype map could not

35


be created for the ghanaian population and statistical analysis

could not be completed.

4.2 limitations and improvements

Although the study was halted by the unavailability of DNA

purification reagents i believe that the main limitation in

completing the study and evaluating whether the hypothesis to

be studied was time available. RFLP is a very reliable technique

for amplifying DNA however it is time consuming especially

when combined with purification from FTA cards. DNA

purification with FTA cards may take up to an hour to complete,

PCR cycling takes up to 3 hours, electrophoresis up to 40

minutes and restriction enzyme digestion another 2 hours to

complete. This would not be that an issue but because only

microscopic volumes of reagents are used for amplification and

restriction enzyme digestion it is hard to speculate on whether

samples have mixed in with reagents efficiently, and this can

only be seen once electrophoresis has been performed.

Any samples where mistakes or errors occurred had to be

repeated from the first steps of purification. As i only have an

undergraduate understanding pharmacology and at the

beginning of the project had previously only ever attempted

amplification of a single gene minimal genetic engineering

knowledge and so human error also contributed to my inability

36


to complete the study. As the β cluster requires amplification of

all 5 subunits to give a proper representation of haplotype

exhibited it may have been ambitious to try and complete

testing all samples within the timetabled time given to the

project.

The limitations of the project however can be overcome in

various ways. I propose that if possible that fresh blood samples

be used instead of the dried samples. This could be done by

taking blood samples from students from the university that are

of ghanian descent provided ethical approval for the study

could be attained

Conclusion

After completion of the research, laboratory work and write-up

of this project, conclusions can be drawn about the β globin

gene, sickle cell disease and its management in Ghana.

Analysis of blood samples for mutations on the β globin gene

can give researchers and medical analysts a way to diagnose

patients for sickle cell disease, its severity, epidemiology, and

the pattern of inheritance of the Hb S allele over generations.

Further studies can be conducted to compare the existence of

the various sickle cell haplotypes in different countries, the

geographic variation of the haemoglobin S allele and its genetic

epidemiology in Africa.

37


RFLP is a reliable method in testing for the existence of sickle

cell haplotypes. Successful amplification of DNA from blood

samples can be conducted as can restriction enzyme digestion

and separation of DNA fragments on Agarose gel with sufficient

resolution of different DNA fragments. However it is a time

consuming method and requires sufficient time when studying

a population to create a haplotype map. If a method could be

developed where restriction enzyme digestion could be

conducted on multiple sites and sufficient resolution on

Agarose gel after electrophoresis it would prove to make

construction of a haplotype map much easier.

Sickle cell disease continues to be a serious health problem for

the Ghanaian people. The methods utilised to deal with this

problem by the health ministry in Ghana is sufficient for the

infrastructure that exists in the country and it can be said that

the country is doing as best as it can to address the problem.

Citizens are well educated about the disease and treatments for

people with sickle cell disease are available in sickle cell clinics

and hospitals. There may however be reduced treatment

options to people in rural or isolated areas who cannot afford

medication and other treatments.

The hypothesis that the Ghanaian population would show a

higher proportion of the Benin, Cameroon, and Bantu

haplotypes was inconclusive and no other studies dealing with

38


globin gene haplotypes has been done for a Ghanaian

population before. However information from other studies

shows that neighbouring countries show that there is a high

proportion of the Benin haplotype. Further studies for a

Ghanaian population would have to be done to test the

hypothesis and create a haplotype map of the population.

39


Bibliography

Aidoo M, Terlouw D J , Kolczak M S , Peter D McElroy, Feiko O Kariuki S, Nahlen B L et al

(2002 april); Protective effects of the sickle cell gene against malaria morbidity and

mortality; published online 15; cited 2009 December 08

Athale UH, Chintu C. (1994 June). Clinical analysis of mortality in hospitalized Zambian

children with sickle cell anaemia. East Afr Med J;71(6):388-91.

Bunn HF. (September 1997). Pathogenesis and treatment of sickle cell disease. N Engl J Med.

11;337(11):762-9.

Charache, S., et al (1995). Effect of hydroxyurea on the frequency of painful crises in sickle-

cell anemia. New England Journal of Medicine 332, 1317–1322

Eftychi , C., Joanna M, , Howson, M., et al (March 2004) Analysis of the Type 2 Diabetes-

Associated Single Nucleotide Polymorphisms in the Genes IRS1, KCNJ11, and PPARG2 in Type

1 Diabetes, Diabetes. 53 (3) 870-873

Flatz G (1967). Haemoglobin E; distribution and population dynamics; human genetik (3)

189-234

Friedman MJ. (1978 April) Erythrocytic mechanism of sickle cell resistance to malaria. Proc

Natl Acad Sci U S A;75(4):1994-7.

Fung EB, Harmatz P, Milet M, Ballas SK, De Castro L, et al (April 2007). Morbidity and

mortality in chronically transfused subjects with thalassemia and sickle cell disease: A report

from the multi-center study of iron overload. Am J Hematol;82(4):255-65.

Fung EB, Harmatz PR, Milet M, Coates TD, Thompson AA, Ranalli M, et al. (2008 July)

Fracture prevalence and relationship to endocrinopathy in iron overloaded patients with

sickle cell disease and thalassemia. Bone.;43(1):162-8.

40

http://diabetes.diabetesjournals.org/search?author1=Christina+Eftychi&sortspec=date&submit=Submit

http://diabetes.diabetesjournals.org/search?author1=Joanna+M.M.+Howson&sortspec=date&submit=Submit


Gabriel, A. & Przybylski, J. (2010) Sickle-cell anemia: A Look at Global Haplotype

Distribution. Nature Education 3(3):2

Hanchard N, Elzein A, Trafford C, Rockett K, Pinder M, Jallow M, et al (2007). Classical sickle

beta-globin haplotypes exhibit a high degree of long-range haplotype similarity in African

and Afro-Caribbean populations. BMC Genet.;8:52.

Herbert, A., Gerry, N, P., McQueen M, B., (N/A). A Common Genetic Variant Is Associated

with Adult and Childhood Obesity. Retrieved 22nd December 2009

Herrick JB (1910). Peculiar elongated and sickle-shaped red blood corpuscles in a case of

severe anemia.. Yale J Biol Med.;74(3):179-84.

http://www.ncbi.nlm.nih.gov/About/primer/snps.html

http://www.who.int/mediacentre/factsheets/fs308/en/index.html

Korf B R., Human genetics and genomics..: 3rd Edition (2007) pg 208-212

Kudzi W , Dodoo NO A, Mills JJ (2009). Characterisation of CYP2C8, CYP2C9 and CYP2C19

polymorphisms in a Ghanaian population BMC Medical Genetics, 10(124)1471-2350-10-124.

Kunkel HG, Wallenius G. New hemoglobin in normal adult blood. Science. 1955 Aug

12;122(3163):288.

Lawrence Bragg and M. F. Perutz (July 22nd 1952). The Structure of Haemoglobin

Leikin SL, Gallagher D, Kinney TR, Sloane D, Klug P, Rida W. (September 1989) Mortality in

children and adolescents with sickle cell disease. Cooperative Study of Sickle Cell Disease.

Pediatrics.;84(3):500-8.

lewis, M ., basic agarose gel electrophoresis method. Retrieved 11th December 2009

41

http://www.who.int/mediacentre/factsheets/fs308/en/index.html

http://www.ncbi.nlm.nih.gov/About/primer/snps.html


Manning LR, Russell JE, Padovan JC, Chait BT, Popowicz A, Manning RS, et al (Aug 2007).

Human embryonic, fetal, and adult hemoglobins have different subunit interface strengths.

Correlation with lifespan in the red cell. Protein Sci.;16(8):1641-58.

McClish DK, Penberthy LT, Bovbjerg VE, Roberts JD, et al (2005). Health related quality of life

in sickle cell patients: the PiSCES project. Health Qual Life Outcomes;3:50.

Modell B., Darlison M.(Jun 2008). Global epidemiology of haemoglobin disorders and

derived service indicators. Bull World Health Organ.;86(6):480-7.

Modern Ghana: Ghana: unknown; unknown; Sickle cell disease on the rise; 2007 February

27th 2009 November 30th; 1 screen; Available

from:http://www.modernghana.com/news/124664/1/sickle-cell-disease-on-the-rise.html

Nagel RL, Ranney HM. (October 1990). Genetic epidemiology of structural mutations of the

beta-globin gene. Semin Hematol;27(4):342-59.

Nagel RL, Ranney HM. (October 1990). Genetic epidemiology of structural mutations of the

beta-globin gene. Semin Hematol;27(4):342-59.

Ohene-Frempong K.,Weiner S.J., Sleeper L.A.,, Miller S.T., (N/A). Cerebrovascular Accidents

in Sickle Cell Disease: Rates and Risk Factors

Old JM HD. (1996). HemoglobinopathiesCommunity Clues to Mutation Detection; Method in

molecular medicine: molecular diagnosis of genetic disease. Totowa, NJ: Humana Press: In:

Elles R, ;. p. 169-83.

Oner C:, Dimovski A.J., Olivieri N.F., Schiliro G., Codrington J.F..:' et al, (1992). β s haplotypes

in various world populations; Human genetics 89:99-104

Pallister cJ. (2005).BMS EXPLAINED Haematology. London: Hodder Headline Group;.

Pattison JR, Jones SE, Hodgson J, Davis LR, White JM, Stroud CE, et al (Mar 1981). Parvovirus

infections and hypoplastic crisis in sickle-cell anaemia. Lancet. 21;1(8221):664-5.

42


Paul J., (September 1976). Haemoglobin synthesis and cell differentiation british medical

bulletin 32 (3).

Powars D, Hiti A. (November 1993) Sickle cell anemia. Beta s gene cluster haplotypes as

genetic markers for severe disease expression. Am J Dis Child;147(11):1197-202.

Proceedings of the Royal Society of London. Series A, Mathematical and Physical Sciences,

Vol. 213, No. 1115 pp. 425-435

Serjeant G. R.,. Mason K .,. Topley J. M., et al (September 1981). Outbreak of aplastic crises

in sickle cell anaemia associated with parvovirus-like agent; The lancet volume 318 issue

8247, 19, Pages 595-597

Setubal S, Gabriel AH, Nascimento JP, Oliveira SA (Sep-Oct 2000). Aplastic crisis caused by

parvovirus B19 in an adult patient with sickle-cell disease. Rev Soc Bras Med Trop;33(5):477-

81.

Shapiro BS. (August 1989). The management of pain in sickle cell disease. Pediatr Clin North

Am;36(4):1029-45.

Sutton M, Bouhassira EE, Nagel RL. (September 1989). Polymerase chain reaction

amplification applied to the determination of beta-like globin gene cluster haplotypes. Am J

Hematol.;32(1):66-9.

unkown, (N/A). Real time pcr protocol manual; Promega. Retrieved 11th December 2009

Vichinsky E.P., Styles L.A., Colangelo L.H., (1997). Acute Chest Syndrome in Sickle Cell

Disease:Clinical Presentation and Course; Blood 89 (5): 1787.

Wambua S, Mwangi TW, Kortok M, Uyoga SM, et al (May 2006). The effect of alpha+-

thalassaemia on the incidence of malaria and other diseases in children living on the coast of

Kenya. PLoS Med.;3(5):e158.

43


weatherall DJ. (2001). The thalassaemias syndromes. oxford: blackwell science;.

Williams T N et al. An immune basis for malaria protection by the sickle cell trait; Published

online 2005 May 31. doi: 10.1371/journal.pmed.0020128. Cited [2009 December 05]

Wood JC. (2008 December). Cardiac iron across different transfusion-dependent diseases.

Blood Rev.;22 Suppl 2:S14-21.

Wood WG, Pembrey ME, Serjeant GR, (1980). Hb F synthesis in sickle cell anaemia: a

comparison of Saudi Arab cases with those of African origin. Br J Haematol.

Yale SH, Nagib N, Guthrie T. (March 2000). Approach to the vaso-occlusive crisis in adults

with sickle cell disease. Am Fam Physician 1;61(5):1349-56, 63-4.

Z. Rahimi AV-R, A. Merat, M. Haghshenass, M. Rezaei. Level of Hemoglobin F and Gg Gene

Expression in Sickle Cell Disease and Their Association with Haplotype and XmnI

Polymorphic Site in sickle cell disease

44

globin gene analysis in a ghanaian population

Documents