genome-wide association study of leaf architecture in the ... › original › nature-assets › ng...

Supplementary information for:

Genome-wide association study of leaf architecture in the

maize nested association mapping population

Feng Tian,1,11

Peter J. Bradbury,1,2,11

Patrick J. Brown,1,3

Hsiaoyi Hung,4 Qi Sun,

5

Sherry Flint-Garcia,6,7

Torbert R. Rocheford,3,8

Michael D. McMullen,6,7

James B.

Holland,4,9

Edward S. Buckler1,2,10

1 Institute for Genomic Diversity, Cornell University, Ithaca, NY 14853, USA,

2U.S. Department of

Agriculture (USDA)–Agricultural Research Service (USDA-ARS), Ithaca, NY 14853, USA,3Department of

Crop Sciences, University of Illinois, Urbana, IL 61801, USA, 4Department of Crop Science, North

Carolina State University, Raleigh, NC 27695, USA, 5Computational Biology Service Unit, Cornell

University, Ithaca, NY 14853, USA, 6U.S. Department of Agriculture (USDA)–Agricultural Research

Service (USDA-ARS), Columbia, MO 65211, USA, 7Division of Plant Sciences, University of Missouri,

Columbia, MO 65211, USA,8Department of Agronomy, Purdue University, Urbana, IL 61801, USA,

,9U.S. Department of Agriculture (USDA)–Agricultural Research Service (USDA-ARS), Raleigh, NC

27695, USA, 10

Department of Plant Breeding and Genetics, Cornell University, Ithaca, NY 14853, USA,

11These authors contributed equally to the work. Correspondence should be addressed to E.S.B

([email protected]).

Nature Genetics: doi:10.1038/ng.746

a

b

c

Supplementary Figure 1: QTL allele effect size distribution for three leaf traits. a,

Upper leaf angle. 96% of significant alleles showed less than 2.5° effect. b, Leaf length.

93% of significant alleles showed less than 18mm effect. c, Leaf width, 95% of

significant alleles showed less than 3mm effect.


R² = 0.78

25

35

45

55

65

75

85

95

40 50 60 70 80 90

Ob

serv

ed

up

pe

r le

af a

ngl

e o

f fo

un

de

rs (

°)

Predicted upper leaf angle of founders from NAM QTL (°)

R² = 0.84

500

550

600

650

700

750

800

850

900

950

1000

650 700 750 800 850 900 950

Ob

serv

ed

leaf

le

ngt

h o

f fo

un

de

rs

(mm

)

Predicted leaf length of founders from NAM QTL (mm)

R² = 0.81

55

65

75

85

95

105

115

60 70 80 90 100 110

Ob

serv

ed

leaf

wid

th o

f fo

un

de

rs

(mm

)

Predicted leaf width of founders from NAM QTL (mm)

a

b

c

Supplementary Figure 2: Predicted phenotypes of NAM founders based on NAM

QTL models. a, Upper leaf angle. b, Leaf length. c, Leaf width. All significant allelic

effects (P<0.05) are added to the observed B73 phenotype to predict other NAM

founders phenotype.


Supplementary Figure 3: Overview of GWAS results for leaf length. The red dotted

lines represent the joint linkage QTL peaks in the scale of negative log10 of significance

of QTLs. The triangle boxes indicate the associations identified by GWAS in the scale

of BPP. The blue upward and green downward triangles indicate the associations

showing positive and negative effects relative to B73 allele, respectively. The lower part

of plot is the recombination rate along the chromosome expressed in cM/Mb.


Supplementary Figure 4: Overview of GWAS results for leaf width. The red dotted

lines represent the joint linkage QTL peaks in the scale of negative log10 of significance

of QTLs. The triangle boxes indicate the associations identified by GWAS in the scale

of BPP. The blue upward and green downward triangles indicate the associations

showing positive and negative effects relative to B73 allele, respectively. The lower part

of plot is the recombination rate along the chromosome expressed in cM/Mb.


0.0

0.2

0.4

0.6

0.8

1.0

BPP>=0.05 BPP>=0.10 BPP>=0.20 BPP>=0.30 BPP>=0.40 BPP>=0.50

Fre

qu

en

cyGWAS SNPs within QTL support interval

Random SNPs within QTL support inteval

0.0

0.2

0.4

0.6

0.8

1.0


Fre

qu

en

cy

GWAS SNPs within QTL support interval

Random SNPs within QTL support interval

0.0

0.2

0.4

0.6

0.8

1.0


Fre

qu

en

cy

GWAS SNPs within QTL support interval

Random SNPs within QTL support interval

b

a

c

1.1E-32 1.2E-20 1.7E-09 5.4E-07 6.4E-04 6.4E-04

2.1E-08 1.0E-06 1.1E-04 5.1E-03 6.5E-02 7.5E-02

1.4E-19 1.4E-13 6.4E-10 8.3E-07 1.4E-06 6.3E-04

Supplementary Figure 5: Overlap between associated SNPs and p<0.05 QTL support

region. a, Upper leaf angle. b, Leaf length. c, Leaf width. The proportion of associated

SNPs within QTL support regions was calculated under each BPP threshold. The

expected proportion by chance was obtained by calculating the proportion of the

number of HapMap SNPs within QTL support regions. The value under each BPP

threshold is the significance of each test for the overlap between GWAS results and

QTL support interval under each BPP threshold.


-15%

-10%

-5%

0%

5%

10%

15%

60000 75000 90000

Gra

in y

ield

re

lati

ve t

o n

orm

al

leaf

typ

e

Plant density/ha

lg1 lg2

Supplementary Figure 6: The yield response of lg1 and lg2 leaf type relative to normal

leaf type at three plant densities. Data is from the Table1 of Lambert and Johnson 1978.

The percentage of grain yield change of lg1 and lg2 leaf type relative to normal leaf

type was calculated and re-plotted.


b

0

0.2

0.4

0.6

0.8

1

0 0.2 0.4 0.6 0.8 1

Cum

mu

lati

ve P

Observed P

MLM(K)

GLM(Q)

GLM

MLM(QK)

0

0.2

0.4

0.6

0.8

1

0 0.2 0.4 0.6 0.8 1

Po

wer

Genetic effect (s.d.)

MLM(K)

GLM(Q)

GLM

MLM(QK)

0%

10%

20%

30%

40%

50%

60%

70%

0.05 0.1 0.15 0.2 0.25 0.3 0.35

Pro

po

rtio

n o

f alle

les

Allelic effect size (s.d.)

c

-1.19

-1.48

-0.80

-1.13

0

0.05

0.1

0.15

lg1 lg2

Effe

ct s

ize

(s.d

.)

QTL SNP

d

a

Supplementary Figure 7: Simulation results for upper leaf angle and the allelic effect

size in the scale of the phenotypic standard deviation (s.d.) in association panel (n=282).

a, Quantile-quantile plots of type I error (false positive) rate of association tests under

different models. b, The statistical power of different models under different effect

sizes. c, The significant QTL allelic effect size distribution expressed in the unit of

phenotypic s.d. in association panel. d, The average effect size of significant QTL

alleles and the identified SNPs by GWAS around lg1 and lg2 expressed in the unit of

phenotypic s.d. in association panel. The value next to each bar is the absolute leaf angle

effect in degree.


Supplementary Table 1 Joint QTL mapping summary and QTL by E interaction

for upper leaf angle Joint linkage mapping summary QTL by Environment interaction

QTL chr cM SS df MS F p Rsq Support interval(cM)a G_Compb GxE_Compc G/GxEd

m33 1 47.3 1.2E+15 26 4.8E+13 7.93 4.1E-29 0.0127 41.7 - 48.5

4.0E+08 3.7E+07 10.74

m82 1 94.9 6.1E+14 26 2.3E+13 3.92 9.0E-11 0.0063 89.7 - 96.6

1.6E+08 4.3E+07 3.81

m116 1 138 5.8E+14 26 2.2E+13 3.70 7.4E-10 0.0059 137.6 - 142.7

3.0E+08

m122 1 148 5.3E+14 26 2.0E+13 3.40 1.3E-08 0.0055 146 - 150.1

3.5E+08

m146 1 177 6.0E+14 26 2.3E+13 3.83 2.1E-10 0.0061 175 - 181.3

1.6E+08

m189 2 11.5 2.1E+15 26 8.2E+13 13.75 3.3E-57 0.0221 10.2 - 14

6.7E+08 5.0E+07 13.39

m200 2 38.6 9.7E+14 26 3.7E+13 6.21 5.1E-21 0.0100 36.7 - 43.9

3.7E+08

m260 2 91.5 4.4E+14 26 1.7E+13 2.80 3.1E-06 0.0045 90 - 96.1

1.3E+08

m318 3 52.1 1.0E+15 26 3.9E+13 6.44 4.2E-22 0.0103 48 - 55.1

4.2E+08 2.5E+07 16.82

m365 3 70.1 7.7E+14 26 3.0E+13 4.94 3.1E-15 0.0079 68.6 - 72

3.7E+08 7.8E+07 4.66

m381 3 84.6 2.5E+15 26 9.8E+13 16.36 8.0E-70 0.0263 84.2 - 85.7

1.1E+09 2.7E+08 3.99

m426 3 145 5.0E+14 26 1.9E+13 3.19 9.4E-08 0.0051 140.6 - 151.2

1.1E+08

m477 4 58.3 1.0E+15 26 3.9E+13 6.55 1.3E-22 0.0105 58 - 60.2

3.2E+08

m499 4 90.7 5.9E+14 26 2.3E+13 3.76 4.1E-10 0.0060 85.9 - 99.3

1.5E+08

m541 4 138 5.0E+14 26 1.9E+13 3.19 8.8E-08 0.0051 126.9 - 139.6

1.3E+08

m553 5 13.3 6.2E+14 26 2.4E+13 3.96 5.9E-11 0.0064 7.3 - 18.2

1.8E+08

m585 5 58 7.5E+14 26 2.9E+13 4.84 8.6E-15 0.0078 57.2 - 58.6

4.5E+08 2.3E+07 19.62

m604 5 65 6.2E+14 26 2.4E+13 3.97 5.7E-11 0.0064 63.5 - 67.5

3.9E+08 5.7E+07 6.96

m659 5 106 9.1E+14 26 3.5E+13 5.81 3.5E-19 0.0093 102.6 - 107.6

2.7E+08 3.7E+07 7.40

m703 6 18.6 9.7E+14 26 3.7E+13 6.20 5.5E-21 0.0100 17.5 - 21.3

3.0E+08 6.5E+07 4.63

m804 7 71.5 8.0E+14 26 3.1E+13 5.11 5.3E-16 0.0082 69.7 - 73.1

2.4E+08

m828 7 115 7.1E+14 26 2.7E+13 4.58 1.2E-13 0.0073 113.5 - 116.7

2.0E+08

m836 7 134 4.3E+14 26 1.6E+13 2.74 5.1E-06 0.0044 128 - 135

1.4E+08

m877 8 56 7.2E+14 26 2.8E+13 4.59 1.1E-13 0.0074 55.9 - 56.1

3.3E+08 3.4E+07 9.68

m899 8 68 5.2E+14 26 2.0E+13 3.35 2.1E-08 0.0054 66.3 - 68.1

2.4E+08 8.6E+07 2.85

m920 8 82.6 5.4E+14 26 2.1E+13 3.48 5.8E-09 0.0056 82 - 90.4

2.1E+08

m988 9 51.9 9.3E+14 26 3.6E+13 5.97 6.3E-20 0.0096 48.4 - 52.6

2.3E+08 4.4E+07 5.21

m1017 9 88.5 1.2E+15 26 4.5E+13 7.43 9.2E-27 0.0119 87.4 - 92.4

3.1E+08 6.5E+07 4.77

m1060 10 40.8 6.7E+14 26 2.6E+13 4.30 2.0E-12 0.0069 40 - 45.8

2.2E+08 4.9E+07 4.48

m1098 10 81.6 7.4E+14 26 2.9E+13 4.77 1.8E-14 0.0077 76.7 - 86.4

1.9E+08

Population

5.2E+14 25 2.1E+13 3.47 1.2E-08 0.0054

Model

7.3E+16 805 9.0E+13 15.06 0.0 0.7482

Error 2.4E+16 4079 6.0E+12 a, P<0.05 support interval for each QTL;

b, variance component due to QTL;

c, variance

component due to QTL by environment interaction; d, the ratio of variance component

between QTL and QTL by environment interaction.



for leaf length Joint linkage mapping summary QTL by Environment interaction


m31 1 39.7 9.1E+04 26 3485.0 3.2 1.1E-07 0.0047 39.1 - 43

12.73

m52 1 65.7 1.0E+05 26 3923.2 3.6 2.7E-09 0.0053 63 - 68.4

18.42

m69 1 84.9 1.8E+05 26 7065.7 6.4 5.2E-22 0.0095 83.1 - 86.8

30.00

m120 1 146 2.3E+05 26 8786.4 8.0 2.3E-29 0.0118 143.6 - 149.3

28.92

m155 1 181.3 8.5E+04 26 3253.9 3.0 7.4E-07 0.0044 173.7 - 186.5

10.81

m198 2 29.8 1.6E+05 26 6287.5 5.7 9.7E-19 0.0084 25.2 - 35.4

23.10

m217 2 61.8 9.0E+04 26 3475.7 3.2 1.2E-07 0.0047 58 - 65.5

15.71

m234 2 76.3 1.4E+05 26 5302.8 4.8 1.1E-14 0.0071 73.8 - 78.9

25.60

m280 2 117.5 1.2E+05 26 4477.7 4.1 2.0E-11 0.0060 110.5 - 122

16.52

m296 2 141.3 1.0E+05 26 3835.0 3.5 5.7E-09 0.0051 141.1 - 149.8

12.97

m310 3 25.4 1.0E+05 26 3977.7 3.6 1.7E-09 0.0053 20.8 - 33.1

13.35

m317 3 50.2 1.6E+05 26 6133.4 5.6 4.2E-18 0.0082 50.1 - 50.3

29.98

m362 3 67.2 1.1E+05 26 4410.2 4.0 3.7E-11 0.0059 64.7 - 68.2

19.88

m410 3 123.9 3.4E+05 26 12908.7 11.7 2.3E-47 0.0173 121.1 - 127.2

42.41

m436 4 12.2 1.5E+05 26 5859.5 5.3 5.7E-17 0.0079 0 - 14.8

19.88

m476 4 57.9 9.7E+04 26 3722.7 3.4 1.5E-08 0.0050 53.7 - 59.1

11.49

m510 4 105 9.8E+04 26 3786.8 3.4 8.6E-09 0.0051 103.8 - 106.4

15.57

m533 4 119.8 7.8E+04 26 3006.1 2.7 5.3E-06 0.0040 117.9 - 124

14.42

m551 5 10.1 1.1E+05 26 4152.3 3.8 3.6E-10 0.0056 6.5 - 18.3

13.15

m575 5 51.8 1.2E+05 26 4745.7 4.3 1.8E-12 0.0064 51.1 - 53.5

20.93

m605 5 65.4 1.6E+05 26 6255.8 5.7 1.3E-18 0.0084 64.1 - 66.5

30.47

m661 5 108.8 1.8E+05 26 6919.5 6.3 2.2E-21 0.0093 107.2 - 110.1

24.47

m683 6 0 1.0E+05 26 3861.7 3.5 4.5E-09 0.0052 0 - 8.4

13.03

m708 6 33.4 1.1E+05 26 4395.7 4.0 4.2E-11 0.0059 31.1 - 38.4

14.63

m766 7 39.9 1.1E+05 26 4081.8 3.7 6.7E-10 0.0055 34.8 - 45.3

14.08

m810 7 75.3 1.1E+05 26 4178.2 3.8 2.9E-10 0.0056 73.7 - 83.9

14.51

m831 7 117.8 1.0E+05 26 3902.4 3.5 3.2E-09 0.0052 114.4 - 121.9

12.49

m872 8 53.9 8.0E+04 26 3060.4 2.8 3.5E-06 0.0041 46.9 - 55.3

12.91

m903 8 69 1.7E+05 26 6540.3 5.9 8.5E-20 0.0088 66.1 - 69.8

27.85

m953 9 23.8 1.2E+05 26 4512.7 4.1 1.5E-11 0.0060 19.5 - 26.4

14.97 1.20 12.52

m988 9 51.9 1.0E+05 26 3951.4 3.6 2.1E-09 0.0053 49.2 - 56.7

16.42 8.65 1.90

m1007 9 67 1.6E+05 26 6229.9 5.7 1.7E-18 0.0083 64.6 - 73.3

30.24 0.14 211.59

m1044 10 33.3 9.7E+04 26 3727.3 3.4 1.4E-08 0.0050 30.9 - 36.2

18.82

m1078 10 48 7.7E+04 26 2973.2 2.7 6.9E-06 0.0040 45.4 - 50.4

20.17 3.00 6.71

m1086 10 61.6 7.8E+04 26 2991.6 2.7 5.9E-06 0.0040 58.3 - 61.6

13.43

m1106 10 101.9 7.5E+04 26 2885.3 2.6 1.4E-05 0.0039 89.3 - 101.9

11.82

Population

8.8E+04 25 3536.1 3.2 1.2E-07 0.0046

Model

1.5E+07 961 15697.2 14.3 0.0 0.7774

Error 4.3E+06 3928 1099.6 a, P<0.05 support interval for each QTL;


c, variance





for leaf width Joint linkage mapping summary QTL by Environment interaction


m23 1 33.1 3623.1 26 139.4 6.39 7.7E-22 0.0082 31.5 - 36.5

0.62

m33 1 47.3 1834.1 26 70.5 3.23 6.1E-08 0.0042 43.8 - 50.4

0.40

m56 1 69.6 2133.5 26 82.1 3.76 4.2E-10 0.0048 66.4 - 71.3

0.34

m80 1 91.4 2300.2 26 88.5 4.06 2.4E-11 0.0052 90.7 - 93.3

0.37

m89 1 110 1756.9 26 67.6 3.10 2.1E-07 0.0040 104.7 - 109.9

0.27

m117 1 140 1491.6 26 57.4 2.63 1.3E-05 0.0034 137.8 - 140.2

0.21

m139 1 168 4103.0 26 157.8 7.23 8.4E-26 0.0093 165.9 - 168.8

0.54 9.0E-02 5.98

m173 1 202 1853.7 26 71.3 3.27 4.4E-08 0.0042 198.1 - 202.4

0.22

m198 2 29.8 2104.0 26 80.9 3.71 6.9E-10 0.0048 23.3 - 34.2

0.23

m232 2 74.8 13392.4 26 515.1 23.61 2.9E-104 0.0303 74.2 - 75.8

1.67 6.7E-02 25.15

m275 2 114 2213.0 26 85.1 3.90 1.1E-10 0.0050 111.2 - 120

0.26

m309 3 22.5 2159.1 26 83.0 3.81 2.7E-10 0.0049 16 - 25

0.26

m322 3 54.8 4353.5 26 167.4 7.68 6.9E-28 0.0099 46.4 - 54.8

0.62

m374 3 79.3 4139.7 26 159.2 7.30 4.2E-26 0.0094 74.8 - 80.8

0.60

m397 3 101 2657.8 26 102.2 4.69 4.2E-14 0.0060 99 - 103.1

0.41

m410 3 124 2165.3 26 83.3 3.82 2.4E-10 0.0049 119.2 - 129.2

0.29

m488 4 69.8 3046.3 26 117.2 5.37 3.6E-17 0.0069 66 - 79.1

0.35

m511 4 105 2979.3 26 114.6 5.25 1.2E-16 0.0067 101.9 - 108.5

0.33

m554 5 22.1 4250.3 26 163.5 7.49 5.0E-27 0.0096 16.4 - 22.1

0.49

m579 5 56.2 2913.3 26 112.0 5.14 4.2E-16 0.0066 54.3 - 57.9

0.72

m602 5 64 1705.4 26 65.6 3.01 4.8E-07 0.0039 59.8 - 66.4

0.40

m679 5 138 2238.3 26 86.1 3.95 6.9E-11 0.0051 131.3 - 147.2

0.23

m706 6 27.8 1655.9 26 63.7 2.92 1.0E-06 0.0038 23.5 - 37.8

0.21

m725 6 50.7 7636.1 26 293.7 13.46 9.7E-56 0.0173 49.1 - 52.5

1.13

m756 6 101 1822.4 26 70.1 3.21 7.4E-08 0.0041 95.1 - 103.9

0.18

m762 7 7 2228.3 26 85.7 3.93 8.2E-11 0.0050 0 - 18.6

0.22

m794 7 61.4 2921.7 26 112.4 5.15 3.6E-16 0.0066 57 - 64.7

0.33

m831 7 118 1749.6 26 67.3 3.08 2.4E-07 0.0040 116.2 - 129.2

0.17

m861 8 50 2183.0 26 84.0 3.85 1.8E-10 0.0049 48.6 - 51.5

0.32

m894 8 64.2 2637.0 26 101.4 4.65 6.2E-14 0.0060 63.2 - 66.4

0.41 6.2E-02 6.65

m927 8 92.1 1704.6 26 65.6 3.01 4.8E-07 0.0039 80.8 - 99.4

0.19

m997 9 62 4618.4 26 177.6 8.14 4.2E-30 0.0105 58.7 - 63.7

0.46 1.0E-01 4.54

m1083 10 53.2 3101.7 26 119.3 5.47 1.3E-17 0.0070 49.2 - 57.3

0.35

m1105 10 93.7 2836.2 26 109.1 5.00 1.7E-15 0.0064 93.7 - 95.8

0.31

Population

1072.8 25 42.9 1.97 2.8E-03 0.0024

Model

354729.7 909 390.2 17.89 0.0 0.8034

Error 86813.7 3980 21.8 a, P<0.05 support interval for each QTL;


c, variance




Supplementary Table 4 Associations (BPP>=0.05) identified by GWAS for upper

leaf angle

SNP/indel AGP position chr BPP cM allele pvalue effect

PZE0126783951 26783951 1 0.05 44.116 T/C 6.4E-21 -0.61

PZE0126784152 26784152 1 0.11 44.116 -/A 1.7E-27 -0.67

PZE0127213695 27213695 1 0.29 44.901 T/C 7.1E-30 -0.75

PZE0127216774 27216774 1 0.1 44.907 A/G 4.3E-28 -0.71

PZE0130265021 30265021 1 0.3 49.165 ------/AGCGGC 1.3E-31 -0.88

PZE0134648362 34648362 1 0.12 54.104 A/G 7.6E-08 -0.66

PZE01114045567 114045567 1 0.17 89.088 A/G 1.3E-11 0.59

PZE01118507354 118507354 1 0.11 89.279 G/- 4.0E-13 0.70

PZE01148006384 148006384 1 0.22 89.595 T/C 2.1E-11 0.90

PZE01173899899 173899899 1 0.16 94.380 G/A 3.0E-17 0.69

PZE01179453637 179453637 1 0.06 96.353 C/T 6.8E-08 -1.10

PZE01180564236 180564236 1 0.08 96.837 C/T 2.0E-08 -0.69

PZE01234829807 234829807 1 0.05 139.094 ATT/--- 1.8E-07 1.06

PZE01237218411 237218411 1 0.15 140.034 ----/ATAT 9.1E-10 0.63

PZE01239773294 239773294 1 0.1 141.436 A/G 4.1E-15 0.91

PZE01244829848 244829848 1 0.63 144.101 --/CA 7.9E-21 0.61

PZE01247248533 247248533 1 0.21 145.351 A/G 1.7E-13 0.72

PZE01280647647 280647647 1 0.05 175.544 C/T 9.5E-09 -0.61

PZE01280662809 280662809 1 0.33 175.577 C/T 9.4E-13 1.17

PZE01281556608 281556608 1 0.26 176.614 A/G 2.7E-10 -0.47

PZE01281770712 281770712 1 0.1 176.848 G/A 7.2E-13 -0.60

PZE01297202076 297202076 1 0.1 201.754 T/G 3.7E-08 0.59

PZE01297469964 297469964 1 0.06 202.121 G/A 9.8E-10 0.95

PZE01297844846 297844846 1 0.05 202.415 G/A 9.0E-09 1.10

PZE01297853840 297853840 1 0.06 202.422 G/C 1.2E-08 0.90

PZE01298167977 298167977 1 0.06 202.668 -/G 8.6E-08 0.66

PZE01298168160 298168160 1 0.05 202.669 C/T 7.0E-09 1.10

PZE01298415141 298415141 1 0.16 202.862 G/A 9.1E-10 0.59

PZE0202024412 2024412 2 0.16 3.625 A/G 2.7E-12 -1.51

PZE0202524115 2524115 2 0.19 5.790 ---/TGT 1.0E-10 -1.35

PZE0202537667 2537667 2 0.35 5.820 ------/GGTCCG 1.2E-10 -1.11

PZE0204156598 4156598 2 0.72 11.447 A/G 1.6E-29 -0.76

PZE0204276758 4276758 2 0.27 11.878 A/G 4.4E-27 -0.78

PZE0204311517 4311517 2 0.06 12.011 A/C 2.9E-09 -0.88

PZE0205209256 5209256 2 0.1 15.424 C/A 2.0E-10 -0.94

PZE0214039765 14039765 2 0.1 39.135 T/C 1.9E-14 0.81

PZE0214061575 14061575 2 0.07 39.180 C/A 5.5E-12 0.82

PZE0214195012 14195012 2 0.1 39.455 T/C 1.6E-15 1.11

PZE0214640057 14640057 2 0.54 40.371 A/G 5.0E-17 0.82

PZE0214696322 14696322 2 0.12 40.487 A/C 2.6E-17 0.62

PZE0242355183 42355183 2 0.05 68.643 C/G 1.1E-07 -0.76

PZE02182110434 182110434 2 0.05 91.914 G/A 1.8E-08 -0.61

PZE02185991593 185991593 2 0.18 96.840 G/C 9.1E-09 -0.59

PZE02201253167 201253167 2 0.05 109.064 C/G 7.7E-08 0.75

PZE0321501733 21501733 3 0.08 50.464 A/C 2.0E-19 0.66

PZE0327827069 27827069 3 0.28 53.350 C/A 6.4E-22 0.82

PZE0327827070 27827070 3 0.06 53.350 A/T 1.9E-20 0.72

PZE0327827347 27827347 3 0.07 53.350 A/G 4.0E-26 0.80

PZE0327984422 27984422 3 0.06 53.402 A/C 3.0E-20 0.73

PZE0331062087 31062087 3 0.08 54.573 T/C 1.1E-15 0.57

PZE0339594986 39594986 3 0.07 55.663 A/C 3.3E-13 0.76



leaf angle (continued)


PZE03145181413 145181413 3 0.07 65.475 G/A 8.2E-10 -1.05

PZE03147514681 147514681 3 0.06 66.236 A/G 1.9E-11 -1.20

PZE03155576489 155576489 3 0.11 68.907 T/G 3.4E-09 -0.99

PZE03156233185 156233185 3 0.1 69.371 T/C 3.5E-14 -1.09

PZE03158480835 158480835 3 0.12 71.420 T/A 2.1E-25 -1.01

PZE03160304695 160304695 3 0.11 73.184 C/A 5.6E-16 -0.63

PZE03160700544 160700544 3 0.23 73.549 C/T 2.5E-17 -0.71

PZE03160701001 160701001 3 0.12 73.549 TG/-- 3.1E-17 -0.70

PZE03164583838 164583838 3 0.05 75.780 G/A 5.9E-15 -0.77

PZE03164630089 164630089 3 0.05 75.802 C/T 5.9E-09 -0.90

PZE03170869066 170869066 3 0.05 81.758 C/T 5.6E-13 -1.32

PZE03174221558 174221558 3 0.09 84.323 ---/TGG 2.4E-11 -1.50

PZE03174299355 174299355 3 0.1 84.388 A/G 5.6E-35 -0.88

PZE03174612178 174612178 3 0.22 84.690 C/T 4.4E-12 -1.24

PZE03174816519 174816519 3 0.17 84.990 T/C 1.4E-16 -0.92

PZE03175048356 175048356 3 0.07 85.331 T/G 1.3E-19 -0.96

PZE03175051393 175051393 3 0.19 85.335 T/A 8.0E-13 -1.34

PZE03175051481 175051481 3 0.07 85.335 G/A 5.3E-15 -1.26

PZE03175740254 175740254 3 0.82 86.346 AC/-- 5.1E-34 -0.97

PZE03210987881 210987881 3 0.06 121.731 -/A 7.3E-08 -1.16

PZE03215731028 215731028 3 0.17 129.641 ------/ACCGCA 1.7E-07 -1.04

PZE03215731660 215731660 3 0.1 129.642 -----/TAGAC 1.1E-07 -1.51

PZE03225397646 225397646 3 0.1 148.742 G/A 5.2E-08 1.08

PZE03227814881 227814881 3 0.09 152.727 G/C 1.8E-08 0.58

PZE03229224129 229224129 3 0.42 156.205 -/T 2.1E-08 0.62

PZE0410194486 10194486 4 0.06 27.546 T/C 1.2E-08 0.60

PZE0415631908 15631908 4 0.1 39.411 G/A 1.4E-09 0.44

PZE0416610495 16610495 4 0.05 39.989 T/C 3.4E-10 0.44

PZE0424017516 24017516 4 0.05 47.306 G/A 3.8E-10 0.57

PZE0426747205 26747205 4 0.05 48.586 G/T 2.0E-09 0.69

PZE0437188344 37188344 4 0.05 53.700 G/A 4.2E-09 0.51

PZE04137009299 137009299 4 0.07 59.378 T/C 1.6E-16 -1.27

PZE04138990471 138990471 4 0.27 59.727 C/T 1.9E-17 -0.89

PZE04152387529 152387529 4 0.19 64.001 -----/TTGCT 8.5E-16 -0.77

PZE04177555687 177555687 4 0.31 88.967 G/A 1.1E-12 1.87

PZE04177734471 177734471 4 0.36 89.451 A/G 5.4E-12 1.81

PZE04177908151 177908151 4 0.12 90.348 T/G 5.6E-12 1.81

PZE04178879786 178879786 4 0.08 91.714 T/C 1.5E-11 1.29

PZE04242747998 242747998 4 0.07 130.986 C/T 4.1E-10 0.71

PZE04242748096 242748096 4 0.12 130.986 T/G 3.1E-11 0.71

PZE04242758739 242758739 4 0.13 131.028 A/G 4.7E-10 0.49

PZE04243111036 243111036 4 0.05 132.395 T/C 6.8E-11 0.44

PZE04243111170 243111170 4 0.07 132.395 ACC/--- 8.0E-10 0.45

PZE04243111339 243111339 4 0.06 132.396 A/C 2.0E-10 0.43

PZE04243390427 243390427 4 0.07 133.478 C/A 8.7E-09 0.52

PZE04243737874 243737874 4 0.07 134.826 -/A 6.6E-10 1.23

PZE04244714463 244714463 4 0.09 138.084 T/G 1.4E-09 0.57

PZE0503544237 3544237 5 0.05 10.938 G/T 2.3E-14 -0.54

PZE0503728203 3728203 5 0.07 11.610 C/T 7.7E-13 -0.51

PZE0504005076 4005076 5 0.05 12.621 C/T 6.3E-12 -0.42

PZE0504939138 4939138 5 0.05 17.113 C/A 7.4E-13 -0.47



leaf angle (continued)


PZE0504939340 4939340 5 0.47 17.114 --/GG 9.2E-13 -0.47

PZE0535806901 35806901 5 0.18 58.150 A/G 2.1E-26 -0.71

PZE0538806404 38806404 5 0.8 58.463 A/C 1.3E-26 -0.74

PZE0559830227 59830227 5 0.08 63.137 C/T 3.4E-11 -0.80

PZE0562647295 62647295 5 0.05 63.847 G/A 4.5E-09 -0.87

PZE0564675306 64675306 5 0.05 64.216 G/A 5.4E-09 -1.05

PZE0574161617 74161617 5 0.11 66.496 T/C 2.9E-14 -0.69

PZE0574214726 74214726 5 0.18 66.511 -----/TGCGC 1.8E-12 -0.78

PZE0575406828 75406828 5 0.22 66.849 G/A 2.5E-13 -0.84

PZE05142696638 142696638 5 0.13 71.994 G/A 1.5E-11 -0.70

PZE05155648858 155648858 5 0.09 74.131 C/A 5.3E-09 -1.20

PZE05157519540 157519540 5 0.17 74.420 C/T 2.7E-08 -0.81

PZE05199130596 199130596 5 0.87 106.732 A/G 1.4E-22 -0.61

PZE05213249961 213249961 5 0.37 144.363 A/G 1.1E-08 0.53

PZE05213276958 213276958 5 0.14 144.489 C/G 5.5E-09 0.50

PZE05213916201 213916201 5 0.06 147.468 G/A 3.3E-08 0.49

PZE05214588331 214588331 5 0.05 150.600 G/A 1.6E-09 0.42

PZE0609184146 9184146 6 0.16 -0.429 C/T 2.6E-11 0.69

PZE0618804942 18804942 6 0.05 6.360 -/G 2.7E-12 0.42

PZE0618970069 18970069 6 0.08 6.404 T/A 9.6E-11 0.45

PZE0623274238 23274238 6 0.05 7.324 T/C 6.9E-13 0.45

PZE0628601861 28601861 6 0.13 7.982 T/C 1.1E-11 0.41

PZE0664380242 64380242 6 0.13 9.400 A/T 2.7E-14 0.54

PZE0690322878 90322878 6 0.05 17.330 G/T 2.1E-10 1.25

PZE0691703898 91703898 6 0.06 18.454 C/G 1.9E-11 1.40

PZE0692116596 92116596 6 0.33 18.809 C/G 6.7E-12 1.07

PZE0692209293 92209293 6 0.08 18.892 G/T 1.6E-10 0.77

PZE0696095112 96095112 6 0.07 22.358 G/A 5.5E-10 0.83

PZE0699933153 99933153 6 0.09 25.586 A/G 2.8E-11 0.45

PZE06151964905 151964905 6 0.06 66.250 T/A 3.6E-08 0.71

PZE06165670543 165670543 6 0.06 103.225 A/G 3.6E-07 0.63

PZE0721184259 21184259 7 0.06 45.289 G/A 7.0E-09 0.61

PZE07108772913 108772913 7 0.05 54.985 C/T 4.3E-08 -0.57

PZE07112920146 112920146 7 0.05 57.092 G/A 2.1E-11 1.12

PZE07120477089 120477089 7 0.16 60.931 ACTG/---- 3.2E-09 0.97

PZE07122629182 122629182 7 0.06 63.201 A/G 6.4E-10 0.75

PZE07122629825 122629825 7 0.28 63.202 A/G 1.0E-09 0.73

PZE07131379676 131379676 7 0.63 71.340 C/T 2.1E-12 -0.66

PZE07134166652 134166652 7 0.05 72.780 C/T 6.7E-08 -1.51

PZE07151441532 151441532 7 0.05 89.331 -------/AGTGTGC 8.3E-11 -0.55

PZE07154825170 154825170 7 0.09 95.680 TCCGT/----- 5.6E-09 -0.61

PZE07161745488 161745488 7 0.1 111.073 C/T 8.1E-10 -1.26

PZE07162260775 162260775 7 0.05 112.467 ---/CGC 4.7E-10 -1.25

PZE07162519460 162519460 7 0.22 113.346 C/T 5.6E-11 -0.83

PZE07163030789 163030789 7 0.15 114.757 C/T 1.7E-09 -1.75

PZE07169412182 169412182 7 0.16 134.402 A/C 1.7E-07 0.47

PZE0801163827 1163827 8 0.07 2.479 C/G 1.2E-08 -0.38

PZE0801507203 1507203 8 0.47 3.335 T/A 7.8E-10 -0.44

PZE0802788184 2788184 8 0.06 6.527 T/C 3.4E-09 -0.44

PZE0803858078 3858078 8 0.06 9.194 T/G 1.2E-10 -0.37

PZE0834454085 34454085 8 0.05 51.327 T/C 1.1E-15 -0.53



leaf angle (Continued)


PZE0891938969 91938969 8 0.24 56.181 G/A 7.1E-21 -0.62

PZE0892024733 92024733 8 0.14 56.195 ACC/--- 7.8E-21 -0.59

PZE0892749053 92749053 8 0.07 56.314 T/C 1.9E-22 -0.64

PZE0896147130 96147130 8 0.14 56.873 C/T 9.1E-23 -0.65

PZE08100144846 100144846 8 0.12 57.561 C/T 2.9E-17 -0.86

PZE08103460007 103460007 8 0.05 58.884 C/T 9.5E-23 -0.71

PZE08109038661 109038661 8 0.08 60.637 A/C 2.8E-17 -0.74

PZE08127496840 127496840 8 0.06 67.727 C/T 1.1E-08 0.50

PZE08128596188 128596188 8 0.13 67.996 G/A 5.9E-12 -1.41

PZE08152193202 152193202 8 0.11 80.812 A/- 3.2E-11 -1.34

PZE08158407823 158407823 8 0.08 86.419 A/G 1.3E-12 -0.52

PZE08162428416 162428416 8 0.08 92.086 C/A 3.0E-10 -1.29

PZE08162580642 162580642 8 0.06 92.533 A/G 1.1E-10 -1.06

PZE08164287510 164287510 8 0.24 98.743 G/C 1.1E-10 -1.31

PZE08166486198 166486198 8 0.12 105.543 G/A 7.1E-10 -0.40

PZE08167188301 167188301 8 0.07 107.770 T/C 2.5E-09 -0.36

PZE0928951074 28951074 9 0.07 44.533 T/G 8.6E-14 -0.49

PZE0942716233 42716233 9 0.15 45.297 A/T 9.7E-13 -0.60

PZE0945317104 45317104 9 0.09 45.366 G/A 1.8E-15 -0.58

PZE0945368873 45368873 9 0.07 45.367 A/C 3.2E-15 -0.63

PZE0945370643 45370643 9 0.26 45.367 C/T 3.7E-16 -0.70

PZE0945379786 45379786 9 0.09 45.368 T/C 7.8E-14 -0.56

PZE0989714365 89714365 9 0.05 47.139 T/C 6.2E-15 -0.58

PZE0996458809 96458809 9 0.06 48.974 T/A 4.8E-08 -0.82

PZE09104537089 104537089 9 0.33 51.900 G/C 6.8E-08 -1.13

PZE09105197539 105197539 9 0.05 52.208 A/C 4.8E-08 -0.74

PZE09140382910 140382910 9 0.27 84.168 A/T 8.8E-10 -0.81

PZE09140919003 140919003 9 0.05 85.580 A/G 1.4E-09 -1.70

PZE09142010824 142010824 9 0.08 87.250 -/A 2.4E-11 -1.35

PZE09142712793 142712793 9 0.12 88.927 T/C 5.5E-11 -0.40

PZE09142981494 142981494 9 0.05 89.497 A/- 3.9E-12 -0.43

PZE09143040479 143040479 9 0.06 89.671 T/C 2.5E-11 -1.37

PZE09143229028 143229028 9 0.33 90.127 T/G 4.6E-16 -0.58

PZE09143237879 143237879 9 0.24 90.147 ---/GCT 1.9E-14 -0.63

PZE09144169123 144169123 9 0.19 92.249 -----/CTGCA 1.8E-10 -1.11

PZE1013166652 13166652 10 0.23 30.695 G/A 8.8E-09 -0.93

PZE1013166653 13166653 10 0.07 30.695 T/C 9.6E-08 -0.87

PZE1030163508 30163508 10 0.28 35.973 T/C 1.3E-09 -0.70

PZE1085213439 85213439 10 0.14 40.360 C/T 9.5E-09 0.53

PZE1094511289 94511289 10 0.07 42.277 C/T 2.6E-09 -0.76

PZE10102485719 102485719 10 0.09 43.569 G/C 4.5E-08 0.39

PZE10119627163 119627163 10 0.05 47.395 -------/GCTCACT 5.0E-10 0.46

PZE10142425937 142425937 10 0.05 77.628 T/C 1.6E-14 -0.55

PZE10142507929 142507929 10 0.2 77.937 A/C 1.1E-14 -0.60

PZE10142565808 142565808 10 0.06 78.154 A/T 1.7E-13 -0.88

PZE10142986014 142986014 10 0.18 79.734 C/A 6.3E-13 -0.79

PZE10144241727 144241727 10 0.14 82.206 G/A 6.5E-14 -0.73

PZE10144241771 144241771 10 0.05 82.206 ------/TAGGAA 3.1E-14 -0.58

PZE10144490159 144490159 10 0.17 83.007 T/C 4.9E-14 -0.63

PZE10145190367 145190367 10 0.06 85.757 A/G 4.9E-12 -0.83


Supplementary Table 5 Associations (BPP>=0.05) identified by GWAS for leaf

length


PZE0102676874 2676874 1 0.22 0.679 A/T 3.3E-07 4.36

PZE0107308192 7308192 1 0.11 13.677 A/T 4.8E-07 6.76

PZE0107960174 7960174 1 0.05 14.862 G/C 4.6E-07 3.66

PZE0108600762 8600762 1 0.06 16.412 AC/-- 6.2E-07 5.10

PZE0115994040 15994040 1 0.05 32.166 C/T 1.6E-08 -10.83

PZE0121391313 21391313 1 0.09 37.739 G/A 9.0E-10 5.32

PZE0121391422 21391422 1 0.07 37.739 C/T 4.1E-11 5.49

PZE0121443991 21443991 1 0.13 37.788 G/A 6.5E-11 5.61

PZE0121455017 21455017 1 0.1 37.798 T/C 5.1E-14 6.27

PZE0122514001 22514001 1 0.07 39.418 G/T 3.5E-09 11.64

PZE0124142851 24142851 1 0.09 40.974 ---/CTG 7.2E-12 7.90

PZE0126804633 26804633 1 0.06 44.153 T/C 1.1E-07 6.53

PZE0130048459 30048459 1 0.05 48.933 T/A 2.6E-08 -9.09

PZE0130703759 30703759 1 0.05 49.636 --/CA 4.2E-08 -5.37

PZE0130703802 30703802 1 0.08 49.636 ---/CAG 4.0E-08 -4.99

PZE0137277884 37277884 1 0.05 55.695 C/T 2.0E-08 -5.88

PZE0147886273 47886273 1 0.06 63.376 G/A 6.7E-12 8.66

PZE0151026714 51026714 1 0.05 65.448 G/A 1.3E-08 10.58

PZE0151533532 51533532 1 0.09 66.023 G/T 5.4E-13 5.06

PZE0151575729 51575729 1 0.06 66.074 C/T 1.9E-12 5.65

PZE0152025282 52025282 1 0.26 66.624 G/C 4.5E-11 5.12

PZE0182570732 82570732 1 0.49 82.402 T/G 1.4E-19 5.78

PZE0182570902 82570902 1 0.11 82.402 ----/ACGT 3.4E-15 5.53

PZE0192531865 92531865 1 0.36 85.471 T/C 1.4E-24 6.69

PZE01101787357 101787357 1 0.07 87.956 C/T 5.0E-08 6.25

PZE01102256886 102256886 1 0.1 88.027 -/A 9.0E-08 7.06

PZE01136166765 136166765 1 0.09 89.474 T/C 1.1E-06 -7.58

PZE01180263149 180263149 1 0.28 96.695 G/C 6.2E-09 -7.09

PZE01188783420 188783420 1 0.14 103.068 ---/GTC 6.2E-09 -8.47

PZE01189462707 189462707 1 0.06 103.614 T/C 2.6E-08 -9.44

PZE01189469574 189469574 1 0.12 103.619 G/A 1.1E-08 -6.39

PZE01191247682 191247682 1 0.07 105.046 G/A 1.6E-09 -11.96

PZE01230301986 230301986 1 0.07 137.038 C/T 7.6E-10 -7.00

PZE01233382033 233382033 1 0.08 138.523 ------/GTACGT 1.9E-09 -9.88

PZE01233604901 233604901 1 0.07 138.611 G/A 1.7E-15 -6.48

PZE01243559141 243559141 1 0.26 143.444 C/T 9.0E-17 -7.81

PZE01244100665 244100665 1 0.14 143.724 A/T 1.2E-11 -9.15

PZE01244690676 244690676 1 0.17 144.029 --/AT 1.6E-12 -7.36

PZE01247682336 247682336 1 0.09 145.576 C/T 6.3E-15 -9.88

PZE01251138455 251138455 1 0.12 148.877 C/G 6.7E-14 -9.26

PZE01252372726 252372726 1 0.21 149.518 A/C 1.7E-11 -13.10

PZE01252588309 252588309 1 0.06 149.630 ---/AGT 8.2E-11 -5.75

PZE01252659108 252659108 1 0.08 149.667 C/T 9.6E-12 -12.85

PZE01256204947 256204947 1 0.17 152.376 C/G 6.5E-15 -6.11

PZE01278780984 278780984 1 0.23 171.589 -/G 1.4E-10 8.05

PZE01278781346 278781346 1 0.07 171.590 C/T 4.1E-11 6.96

PZE01281132907 281132907 1 0.35 176.152 G/A 9.2E-10 8.17

PZE01283982913 283982913 1 0.15 178.435 G/T 1.1E-09 9.37

PZE01284879328 284879328 1 0.06 179.666 G/A 1.4E-06 -4.16

PZE0202619222 2619222 2 0.19 6.004 C/T 2.0E-07 -9.85

PZE0202770247 2770247 2 0.07 6.344 C/A 8.9E-07 -7.53



length (Continued)


PZE0203178295 3178295 2 0.06 7.175 C/G 5.8E-08 -10.29

PZE0204088847 4088847 2 0.07 11.273 ---/ATA 9.6E-07 -9.59

PZE0209331344 9331344 2 0.24 27.420 A/C 4.8E-12 -5.59

PZE0209331550 9331550 2 0.15 27.421 A/G 6.3E-10 -5.11

PZE0211107313 11107313 2 0.2 31.851 T/C 7.4E-19 -5.41

PZE0211181706 11181706 2 0.21 32.077 T/C 2.3E-20 -5.50

PZE0211458953 11458953 2 0.14 32.916 A/C 2.5E-21 -7.55

PZE0214677600 14677600 2 0.2 40.448 C/- 9.6E-09 -4.92

PZE0217022051 17022051 2 0.12 45.072 C/T 2.0E-09 -6.11

PZE0236624010 36624010 2 0.18 65.142 C/T 3.1E-09 -7.59

PZE0242226576 42226576 2 0.11 68.581 --/TC 6.2E-08 -5.54

PZE0249949755 49949755 2 0.1 71.540 T/C 1.0E-07 -5.36

PZE0255749965 55749965 2 0.54 72.810 ---/CCG 2.9E-20 8.20

PZE0259584444 59584444 2 0.09 73.497 C/A 1.2E-10 9.20

PZE0260009367 60009367 2 0.09 73.559 T/C 5.9E-10 11.89

PZE0262708588 62708588 2 0.12 74.754 A/G 1.5E-18 7.48

PZE0280418341 80418341 2 0.18 75.789 G/A 4.7E-20 10.41

PZE02142036535 142036535 2 0.11 79.483 --/TC 4.8E-07 7.12

PZE02178773709 178773709 2 0.1 89.220 CC/-- 2.0E-05 4.72

PZE02201997342 201997342 2 0.05 109.787 C/G 9.6E-12 4.20

PZE02204290174 204290174 2 0.06 112.547 G/T 3.3E-12 5.47

PZE02204333968 204333968 2 0.09 112.600 G/T 2.0E-10 4.25

PZE02204511977 204511977 2 0.65 112.816 C/T 1.1E-12 5.61

PZE02227382668 227382668 2 0.11 142.187 A/G 2.3E-08 -4.52

PZE02229351216 229351216 2 0.24 146.593 C/T 2.0E-09 -7.80

PZE02229509763 229509763 2 0.1 147.025 T/C 1.7E-08 -5.89

PZE02229863864 229863864 2 0.15 147.988 G/T 2.8E-08 -6.54

PZE02233878739 233878739 2 0.11 156.258 G/C 8.2E-08 -5.35

PZE0302119822 2119822 3 0.07 4.552 G/A 8.9E-08 -5.89

PZE0303511207 3511207 3 0.2 11.752 T/G 9.1E-08 -9.09

PZE0304628412 4628412 3 0.11 17.283 --/GG 2.1E-09 -9.52

PZE0305602023 5602023 3 0.05 21.411 CA/-- 1.5E-09 4.92

PZE0306524279 6524279 3 0.44 25.317 ---/AAT 5.0E-09 -6.46

PZE0319652567 19652567 3 0.63 48.330 G/A 3.8E-12 -9.54

PZE0320156701 20156701 3 0.18 48.982 ------/GCCCTG 1.4E-08 9.34

PZE0320360840 20360840 3 0.33 49.246 G/C 6.0E-08 10.26

PZE0323491994 23491994 3 0.09 51.768 C/T 6.2E-18 -14.27

PZE0328560505 28560505 3 0.06 53.704 C/G 2.2E-09 -6.77

PZE0328560627 28560627 3 0.15 53.704 A/C 2.7E-11 -6.80

PZE0383801452 83801452 3 0.06 58.155 C/T 5.4E-07 -6.13

PZE03138974249 138974249 3 0.05 63.566 A/G 2.9E-10 -10.34

PZE03141373038 141373038 3 0.23 63.942 A/G 3.0E-11 -7.83

PZE03141919259 141919259 3 0.08 64.001 A/G 4.9E-10 -10.04

PZE03142545513 142545513 3 0.08 64.070 T/G 1.2E-09 -9.70

PZE03146176188 146176188 3 0.11 65.765 G/A 2.8E-09 -6.81

PZE03146404675 146404675 3 0.14 65.846 C/G 1.6E-07 -7.66

PZE03154828742 154828742 3 0.06 68.664 C/G 2.8E-10 -10.44

PZE03177565301 177565301 3 0.29 89.025 -----/ACGAC 7.2E-08 6.11

PZE03177565419 177565419 3 0.09 89.025 ---/GCG 1.3E-07 4.98

PZE03203573254 203573254 3 0.05 111.528 G/C 6.3E-08 4.13

PZE03203614245 203614245 3 0.07 111.581 G/C 1.6E-10 5.30



length (Continued)


PZE03209188847 209188847 3 0.1 119.571 -/T 1.1E-08 5.07

PZE03212055353 212055353 3 0.1 123.063 T/C 1.3E-18 5.90

PZE03212222860 212222860 3 0.18 123.272 GAC/--- 2.0E-19 6.47

PZE03213221621 213221621 3 0.14 125.117 G/A 1.6E-19 6.43

PZE03213221993 213221993 3 0.05 125.118 --/CA 8.2E-22 7.09

PZE03213226544 213226544 3 0.32 125.129 G/C 1.4E-18 6.67

PZE03213896658 213896658 3 0.09 126.775 C/T 3.3E-15 5.89

PZE03215430456 215430456 3 0.2 129.220 ----/ATTA 9.3E-07 4.72

PZE03215886038 215886038 3 0.15 130.163 T/C 1.7E-08 4.55

PZE0401110436 1110436 4 0.05 3.894 CTG/--- 3.7E-16 6.27

PZE0401683543 1683543 4 0.55 5.847 GCT/--- 8.5E-18 6.40

PZE0401987862 1987862 4 0.11 6.884 T/G 1.8E-19 7.57

PZE0402673941 2673941 4 0.21 9.222 --/TC 1.9E-18 7.66

PZE0493993996 93993996 4 0.79 57.704 C/T 8.2E-11 -5.81

PZE04137100670 137100670 4 0.08 59.395 T/G 1.3E-09 -5.54

PZE04165980653 165980653 4 0.08 75.285 G/A 1.9E-06 7.26

PZE04178854455 178854455 4 0.05 91.686 C/T 3.3E-08 4.73

PZE04181078341 181078341 4 0.06 94.295 A/G 1.3E-06 4.55

PZE04182132009 182132009 4 0.05 95.795 A/C 6.1E-09 7.97

PZE04196923128 196923128 4 0.08 104.537 C/T 1.6E-08 -8.82

PZE04197644834 197644834 4 0.06 105.100 G/A 3.0E-10 9.59

PZE04197993592 197993592 4 0.24 105.409 C/G 1.1E-07 -8.26

PZE04198336422 198336422 4 0.12 105.513 T/C 1.3E-12 6.76

PZE04210963124 210963124 4 0.07 109.632 G/A 2.6E-11 9.17

PZE04215951850 215951850 4 0.1 110.522 T/C 3.0E-10 9.55

PZE04217859661 217859661 4 0.1 111.127 A/G 1.6E-11 6.11

PZE04217862311 217862311 4 0.31 111.128 T/G 1.9E-12 7.81

PZE04239719191 239719191 4 0.07 120.748 G/C 2.8E-10 -8.60

PZE04240187351 240187351 4 0.09 122.421 T/C 3.1E-12 -5.94

PZE04242570680 242570680 4 0.19 130.298 G/A 3.1E-09 -6.63

PZE04242654252 242654252 4 0.05 130.622 C/T 9.2E-11 -5.20

PZE04242654617 242654617 4 0.08 130.624 A/G 5.7E-11 -5.41

PZE04242928025 242928025 4 0.05 131.685 T/A 9.0E-12 -5.57

PZE04243222340 243222340 4 0.21 132.826 T/C 3.8E-09 -4.70

PZE0503044987 3044987 5 0.19 8.758 G/C 2.3E-12 -5.26

PZE0503062680 3062680 5 0.55 8.836 A/C 4.5E-12 -4.97

PZE0503063332 3063332 5 0.05 8.839 A/C 5.0E-12 -4.95

PZE0503780639 3780639 5 0.12 11.801 T/G 4.4E-11 -6.31

PZE0514991933 14991933 5 0.11 45.238 C/T 1.2E-06 12.55

PZE0515440344 15440344 5 0.11 45.933 T/C 6.2E-07 10.05

PZE0518600731 18600731 5 0.09 49.351 ----/TGAT 3.1E-08 -4.66

PZE0519438083 19438083 5 0.08 50.166 C/A 1.4E-08 7.20

PZE0523522481 23522481 5 0.43 53.705 C/T 8.6E-12 -5.90

PZE0523522546 23522546 5 0.05 53.705 C/A 5.1E-13 -6.19

PZE0552714685 52714685 5 0.09 61.319 ---/CAG 2.2E-10 -5.92

PZE0557358664 57358664 5 0.07 62.269 G/A 8.5E-09 -8.94

PZE0557358684 57358684 5 0.08 62.269 G/A 2.2E-09 -9.24

PZE0575530450 75530450 5 0.54 66.885 G/A 1.0E-18 -9.95

PZE0575530467 75530467 5 0.45 66.885 TG/-- 7.9E-18 -10.78

PZE05167065386 167065386 5 0.1 78.951 G/T 2.5E-07 6.30

PZE05168079941 168079941 5 0.05 79.800 C/G 5.6E-08 4.87



length (Continued)


PZE05169853408 169853408 5 0.1 81.828 G/A 8.6E-07 6.58

PZE05201435101 201435101 5 0.22 109.314 G/A 5.7E-07 -4.72

PZE05201474301 201474301 5 0.15 109.356 G/C 1.9E-21 -5.38

PZE05201478270 201478270 5 0.05 109.360 G/A 1.0E-08 -5.02

PZE05203360858 203360858 5 0.73 112.775 A/C 6.3E-19 -6.18

PZE0601869098 1869098 6 0.12 -8.728 G/A 1.2E-07 6.01

PZE0606622251 6622251 6 0.15 -3.335 CGA/--- 1.0E-08 7.84

PZE0606622329 6622329 6 0.28 -3.335 C/G 7.5E-08 4.94

PZE0607252498 7252498 6 0.23 -2.620 C/T 5.4E-08 -9.95

PZE0624225938 24225938 6 0.08 7.569 G/A 4.4E-09 -10.66

PZE0685232157 85232157 6 0.06 13.187 ------/GCTGCA 3.1E-08 -10.05

PZE0687462752 87462752 6 0.1 15.002 G/A 1.5E-08 -10.70

PZE0687565234 87565234 6 0.12 15.086 A/G 1.4E-08 -6.79

PZE0688232928 88232928 6 0.06 15.629 G/C 1.2E-08 -9.12

PZE0695497242 95497242 6 0.1 21.839 C/G 1.2E-08 -6.11

PZE06106080018 106080018 6 0.36 31.898 G/T 1.1E-10 12.08

PZE06106217898 106217898 6 0.19 32.039 A/G 4.9E-10 9.57

PZE06106590937 106590937 6 0.09 32.421 C/A 8.4E-07 -9.34

PZE06108201695 108201695 6 0.08 34.217 T/G 5.7E-07 -6.84

PZE06109114975 109114975 6 0.05 35.358 G/T 5.2E-07 -8.30

PZE06123417525 123417525 6 0.05 45.507 G/A 4.7E-12 10.42

PZE06124561899 124561899 6 0.06 45.987 G/A 1.9E-06 5.30

PZE06130269280 130269280 6 0.24 48.420 G/A 6.0E-11 12.41

PZE06152684254 152684254 6 0.06 67.430 G/T 4.3E-11 -5.09

PZE06153351055 153351055 6 0.1 68.524 ----/ATGG 4.1E-08 -5.64

PZE06153406019 153406019 6 0.2 68.614 G/T 1.6E-08 -4.96

PZE06155163621 155163621 6 0.11 71.608 C/T 2.2E-08 -4.75

PZE06156548372 156548372 6 0.05 74.854 T/G 1.7E-11 -4.74

PZE06162747180 162747180 6 0.1 92.157 C/G 4.0E-07 5.65

PZE06167630356 167630356 6 0.29 108.327 G/A 4.9E-07 4.83

PZE0708309282 8309282 7 0.09 31.651 C/G 1.6E-07 -8.52

PZE0710856503 10856503 7 0.06 36.075 G/T 7.6E-07 -6.47

PZE0714520508 14520508 7 0.06 41.248 G/A 8.6E-07 -7.74

PZE0715033668 15033668 7 0.08 41.721 ---/GCT 7.9E-09 -6.57

PZE0715206455 15206455 7 0.07 41.880 T/C 7.7E-09 -9.05

PZE0719625362 19625362 7 0.05 44.527 A/G 1.7E-07 -4.98

PZE0726383076 26383076 7 0.14 46.606 -------/CGGCATG 1.7E-08 -6.86

PZE07118061458 118061458 7 0.19 59.704 T/C 2.8E-09 7.40

PZE07118061738 118061738 7 0.08 59.704 ----/ACGC 1.3E-07 7.20

PZE07120082843 120082843 7 0.1 60.730 T/C 1.2E-09 5.10

PZE07120083446 120083446 7 0.09 60.731 G/A 1.7E-08 5.17

PZE07122959485 122959485 7 0.1 63.334 T/- 6.4E-08 5.53

PZE07137444896 137444896 7 0.05 75.802 ---/AAA 6.5E-07 9.45

PZE07137535843 137535843 7 0.11 75.994 T/C 2.3E-07 -7.89

PZE07137842157 137842157 7 0.11 76.505 T/C 1.5E-09 7.30

PZE07139821603 139821603 7 0.08 78.200 A/G 7.2E-10 -5.38

PZE07139884818 139884818 7 0.05 78.260 T/C 1.7E-09 -5.23

PZE07146544366 146544366 7 0.12 84.449 G/A 1.6E-09 -5.55

PZE07150474124 150474124 7 0.14 88.367 C/A 2.9E-10 10.54

PZE07153255007 153255007 7 0.05 92.682 -----/GGGCT 7.3E-12 11.75

PZE07156518855 156518855 7 0.09 99.191 C/G 7.1E-10 10.41



length (Continued)


PZE07157183699 157183699 7 0.08 100.569 G/A 9.7E-13 7.41

PZE07157273443 157273443 7 0.21 100.755 C/T 1.3E-11 6.86

PZE07161047485 161047485 7 0.11 109.273 A/G 7.7E-10 6.49

PZE07163354415 163354415 7 0.19 115.352 A/C 1.6E-08 5.02

PZE07164536923 164536923 7 0.06 117.128 A/G 1.7E-07 5.05

PZE07164828188 164828188 7 0.08 117.563 G/A 1.3E-06 3.38

PZE07167723056 167723056 7 0.1 128.476 GCGGCG/------ 3.8E-07 5.19

PZE0802740685 2740685 8 0.08 6.409 -----/TGTAC 3.6E-08 -4.86

PZE0803423657 3423657 8 0.16 8.111 C/A 2.0E-09 -5.15

PZE0803753962 3753962 8 0.07 8.934 C/T 2.6E-09 -9.06

PZE0803754651 3754651 8 0.06 8.936 T/G 6.3E-10 -4.68

PZE0804186292 4186292 8 0.45 10.244 T/C 2.0E-09 -7.05

PZE0817287929 17287929 8 0.05 40.105 G/C 6.2E-06 6.01

PZE0879021438 79021438 8 0.37 54.427 C/T 4.8E-11 -4.53

PZE0881283185 81283185 8 0.08 54.619 C/A 2.3E-10 -6.79

PZE0893848290 93848290 8 0.06 56.495 T/G 4.1E-12 -5.54

PZE08109146304 109146304 8 0.17 60.668 -------/CAGCCCG 6.1E-08 -6.40

PZE08109146320 109146320 8 0.09 60.668 ----/AACG 3.2E-09 -6.71

PZE08123813482 123813482 8 0.07 67.137 G/T 3.1E-10 7.39

PZE08123814030 123814030 8 0.1 67.137 -/G 9.3E-10 7.57

PZE08128513015 128513015 8 0.05 67.975 G/C 7.8E-10 8.26

PZE08129435712 129435712 8 0.06 68.278 G/A 5.4E-11 -9.39

PZE08132101241 132101241 8 0.22 69.193 T/C 4.5E-07 -5.74

PZE08135060401 135060401 8 0.07 70.078 A/T 5.2E-09 8.75

PZE08135859725 135859725 8 0.08 70.250 T/C 2.0E-09 10.92

PZE08136896381 136896381 8 0.05 70.474 C/T 9.1E-10 -4.81

PZE08138073362 138073362 8 0.05 70.817 ---/TCT 1.2E-08 7.61

PZE08140557955 140557955 8 0.08 71.820 C/T 1.7E-08 7.55

PZE08141578344 141578344 8 0.38 72.472 A/G 1.6E-12 -11.42

PZE08141605417 141605417 8 0.09 72.489 C/T 1.1E-14 -8.44

PZE08141607764 141607764 8 0.24 72.490 G/- 7.2E-11 -10.40

PZE08145171505 145171505 8 0.05 74.990 --/TA 1.5E-13 -7.04

PZE08163937638 163937638 8 0.14 96.496 C/A 6.9E-08 6.20

PZE08163937650 163937650 8 0.34 96.496 C/T 5.7E-08 6.31

PZE08163937835 163937835 8 0.05 96.497 AAAA/---- 1.4E-07 6.71

PZE08163944273 163944273 8 0.05 96.549 T/G 2.3E-07 6.11

PZE0903526984 3526984 9 0.1 -1.158 T/C 2.9E-06 3.99

PZE0903773633 3773633 9 0.3 -0.492 C/T 3.5E-07 4.46

PZE0907573970 7573970 9 0.06 9.773 --/TC 1.3E-06 3.61

PZE0908351758 8351758 9 0.09 11.874 ------/CCTTCG 3.6E-06 -7.26

PZE0912875882 12875882 9 0.28 22.281 T/C 1.6E-10 4.90

PZE0913377697 13377697 9 0.05 23.252 G/C 4.3E-06 9.17

PZE0916221990 16221990 9 0.07 28.482 C/A 3.6E-08 3.47

PZE0916222157 16222157 9 0.23 28.483 C/T 4.4E-09 3.88

PZE0923683224 23683224 9 0.05 41.033 C/T 5.0E-11 6.74



length (Continued)


PZE0978508511 78508511 9 0.11 46.132 G/A 4.6E-10 8.29

PZE0994428669 94428669 9 0.12 48.376 A/C 3.2E-07 5.86

PZE0999395993 99395993 9 0.09 49.855 C/T 5.6E-08 8.52

PZE09104036294 104036294 9 0.05 51.701 A/G 2.9E-09 4.27

PZE09104339779 104339779 9 0.07 51.821 G/A 1.4E-08 5.89

PZE09131059548 131059548 9 0.22 65.710 -------/CGTAGAG 2.2E-23 5.91

PZE09131459406 131459406 9 0.48 66.197 C/T 1.1E-17 5.85

PZE09132415201 132415201 9 0.16 67.533 A/G 6.4E-19 5.52

PZE09135981098 135981098 9 0.06 73.345 C/A 1.5E-06 3.42

PZE09145266992 145266992 9 0.3 95.106 T/C 4.0E-08 4.61

PZE09145267057 145267057 9 0.51 95.106 C/A 2.7E-08 5.56

PZE1002587329 2587329 10 0.07 2.408 GGCC/---- 2.1E-08 3.44

PZE1004052235 4052235 10 0.17 8.193 T/C 3.9E-09 7.64

PZE1004191616 4191616 10 0.11 8.896 G/A 1.7E-09 3.74

PZE1004192090 4192090 10 0.11 8.899 G/C 2.1E-08 6.41

PZE1004212872 4212872 10 0.08 9.039 G/C 3.6E-08 4.47

PZE1005384136 5384136 10 0.07 16.815 G/A 8.9E-08 6.99

PZE1021755947 21755947 10 0.07 34.667 C/T 5.4E-10 -8.56

PZE1052115644 52115644 10 0.06 36.324 G/A 2.1E-11 -5.13

PZE1062160021 62160021 10 0.22 36.524 G/A 3.0E-11 -7.59

PZE1080075506 80075506 10 0.05 39.195 G/A 2.2E-06 -8.86

PZE1088191117 88191117 10 0.11 41.264 A/G 8.1E-14 -6.73

PZE1091593039 91593039 10 0.06 41.825 A/G 8.1E-08 7.30

PZE1094615759 94615759 10 0.14 42.293 T/C 3.9E-12 -6.76

PZE1098682513 98682513 10 0.09 42.935 -/C 4.8E-09 5.72

PZE1098682591 98682591 10 0.16 42.935 T/C 5.6E-14 -5.24

PZE1099012843 99012843 10 0.09 43.097 G/A 1.9E-07 6.90

PZE10121476956 121476956 10 0.05 47.994 A/G 6.6E-09 4.73

PZE10132458620 132458620 10 0.45 56.361 CGTAC/----- 8.2E-14 -10.61

PZE10133295258 133295258 10 0.09 57.444 A/T 5.2E-11 -6.10

PZE10134035419 134035419 10 0.08 58.402 C/T 1.8E-07 -5.70

PZE10136794609 136794609 10 0.11 63.657 C/G 1.7E-09 -6.12

PZE10137720242 137720242 10 0.05 65.005 A/G 4.0E-09 -4.71

PZE10138954601 138954601 10 0.09 67.735 T/C 7.8E-06 -3.86

PZE10147490897 147490897 10 0.32 96.451 G/T 5.3E-10 -6.40

PZE10149139260 149139260 10 0.06 105.691 -------/TTCATAT 4.3E-10 -5.67

PZE10149139875 149139875 10 0.16 105.694 GAC/--- 2.2E-10 -5.79

PZE10149658992 149658992 10 0.09 108.604 T/C 3.6E-09 -5.51



width


PZE0104222883 4222883 1 0.12 4.622 A/G 7.1E-07 -1.11

PZE0116727928 16727928 1 0.06 33.248 G/A 2.0E-08 0.86

PZE0117454689 17454689 1 0.1 33.794 A/G 7.2E-10 0.98

PZE0118576091 18576091 1 0.49 35.130 C/A 1.1E-10 1.44

PZE0118921290 18921290 1 0.16 35.450 G/A 1.2E-17 0.98

PZE0119040669 19040669 1 0.31 35.560 ---/TGC 1.5E-22 0.97

PZE0119040713 19040713 1 0.38 35.561 G/A 1.6E-22 1.07

PZE0119834561 19834561 1 0.05 36.296 A/C 2.7E-07 0.81

PZE0125269921 25269921 1 0.15 42.146 G/T 6.5E-11 1.91

PZE0126409049 26409049 1 0.5 43.430 A/T 7.2E-12 -1.15

PZE0127229560 27229560 1 0.06 44.930 --/TA 7.7E-11 1.20

PZE0127410756 27410756 1 0.15 45.261 C/T 2.7E-11 -1.26

PZE0130048683 30048683 1 0.07 48.933 -------/CTTATGC 8.9E-10 0.95

PZE0136256771 36256771 1 0.06 55.077 T/G 5.9E-08 1.30

PZE0136262739 36262739 1 0.11 55.081 C/A 2.8E-08 1.16

PZE0152655271 52655271 1 0.55 67.395 G/C 1.9E-14 1.29

PZE0153509826 53509826 1 0.05 68.440 G/A 6.6E-08 0.59

PZE0159424192 59424192 1 0.08 71.602 C/G 4.9E-09 0.95

PZE01109523099 109523099 1 0.06 88.813 T/C 9.1E-08 0.96

PZE01139538038 139538038 1 0.07 89.509 A/C 6.1E-12 1.05

PZE01146105232 146105232 1 0.21 89.575 C/A 2.2E-08 -1.25

PZE01148471044 148471044 1 0.2 89.599 T/C 8.1E-10 -1.07

PZE01150965828 150965828 1 0.16 90.012 G/C 3.7E-13 1.72

PZE01153739401 153739401 1 0.09 90.393 A/G 8.1E-17 1.95

PZE01181371459 181371459 1 0.16 97.219 C/T 8.7E-13 1.43

PZE01183153866 183153866 1 0.05 98.126 G/A 5.9E-08 -0.88

PZE01187409324 187409324 1 0.09 101.965 C/T 6.3E-09 -1.08

PZE01187491009 187491009 1 0.28 102.031 T/A 8.6E-14 1.80

PZE01193319129 193319129 1 0.31 106.709 G/A 1.3E-11 1.38

PZE01197123617 197123617 1 0.05 110.128 G/T 1.5E-06 0.88

PZE01206693655 206693655 1 0.08 118.903 G/A 2.1E-07 -0.81

PZE01212501852 212501852 1 0.12 124.111 C/T 5.2E-08 -0.94

PZE01214251068 214251068 1 0.06 125.516 C/T 3.1E-08 -1.01

PZE01239672229 239672229 1 0.05 141.378 A/C 4.3E-09 0.80

PZE01242422189 242422189 1 0.09 142.856 T/A 4.1E-10 1.82

PZE01248378119 248378119 1 0.66 145.935 G/A 1.2E-11 1.58

PZE01255431263 255431263 1 0.05 151.882 G/C 1.1E-07 -0.96

PZE01255726685 255726685 1 0.06 152.089 A/- 1.5E-07 -1.03

PZE01274776029 274776029 1 0.19 167.451 G/C 2.9E-17 0.78

PZE01276154239 276154239 1 0.11 169.126 A/T 9.5E-24 0.92

PZE01276159655 276159655 1 0.06 169.127 T/C 2.8E-09 0.69

PZE01277068783 277068783 1 0.32 169.656 C/T 2.3E-12 1.14

PZE01279234716 279234716 1 0.21 172.542 A/G 1.0E-26 1.01

PZE01281494010 281494010 1 0.07 176.546 G/A 8.1E-09 0.69

PZE01285904571 285904571 1 0.05 180.959 C/T 3.4E-09 0.70

PZE01285905987 285905987 1 0.06 180.965 G/A 8.6E-11 0.90

PZE01294378606 294378606 1 0.05 196.832 T/C 4.8E-07 0.75

PZE01294674853 294674853 1 0.19 197.288 G/C 3.0E-07 1.04

PZE01297704118 297704118 1 0.17 202.305 C/T 4.3E-08 -0.95

PZE01298013554 298013554 1 0.05 202.547 G/C 2.8E-07 -1.40

PZE01298357581 298357581 1 0.33 202.817 T/C 2.9E-10 -1.46



width (Continued)


PZE0201639448 1639448 2 0.17 1.887 ---/GAC 1.0E-06 0.92

PZE0201961798 1961798 2 0.17 3.342 C/T 4.9E-07 0.70

PZE0201961865 1961865 2 0.32 3.343 C/G 2.0E-07 1.00

PZE0205500090 5500090 2 0.22 16.529 T/C 2.0E-08 -0.96

PZE0206345334 6345334 2 0.05 19.226 C/A 1.8E-09 -1.01

PZE0210485443 10485443 2 0.08 29.969 T/G 1.2E-10 -0.82

PZE0211912615 11912615 2 0.05 34.290 G/C 6.7E-08 1.03

PZE0213243369 13243369 2 0.29 37.559 T/G 3.7E-10 -0.86

PZE0214462318 14462318 2 0.25 40.005 G/A 6.2E-08 0.83

PZE0214463045 14463045 2 0.15 40.007 A/G 3.4E-08 0.93

PZE0216287235 16287235 2 0.11 43.088 C/T 5.0E-08 0.80

PZE0233823880 33823880 2 0.07 63.473 T/C 7.8E-07 0.64

PZE0253729474 53729474 2 0.18 72.448 --/TG 2.0E-09 1.03

PZE0253759996 53759996 2 0.05 72.454 C/A 1.7E-08 0.77

PZE0254249813 54249813 2 0.25 72.541 C/G 1.7E-15 2.30

PZE0254757989 54757989 2 0.22 72.633 G/C 1.4E-11 1.63

PZE0254758243 54758243 2 0.09 72.633 G/C 7.5E-12 1.29

PZE0255010757 55010757 2 0.05 72.678 -------/ATGAGAA 8.2E-09 0.87

PZE0264936113 64936113 2 0.05 74.920 A/G 5.5E-27 1.19

PZE0270630228 70630228 2 0.07 75.239 C/T 1.0E-07 0.77

PZE0277581006 77581006 2 0.85 75.630 T/C 3.0E-30 1.15

PZE02149540657 149540657 2 0.07 80.736 A/G 6.8E-09 0.67

PZE02165924911 165924911 2 0.06 83.121 C/T 1.8E-08 1.18

PZE02169723332 169723332 2 0.2 84.085 C/T 1.6E-09 0.90

PZE02172095345 172095345 2 0.13 84.742 G/A 2.0E-08 0.81

PZE02182315368 182315368 2 0.08 92.174 C/T 5.3E-09 0.76

PZE02188445728 188445728 2 0.07 99.990 C/G 1.0E-06 -0.60

PZE02201500659 201500659 2 0.08 109.305 T/C 1.1E-06 -0.87

PZE02206977936 206977936 2 0.27 115.825 GTT/--- 6.8E-12 0.68

PZE02207384104 207384104 2 0.06 116.349 G/A 4.6E-14 0.84

PZE02207626800 207626800 2 0.13 116.662 G/A 2.7E-11 0.69

PZE02210414113 210414113 2 0.09 121.525 C/G 1.4E-10 0.64

PZE02210414304 210414304 2 0.05 121.525 A/C 1.9E-10 0.73

PZE02212400091 212400091 2 0.12 124.304 C/T 2.4E-12 0.65

PZE02219222503 219222503 2 0.1 132.769 C/T 2.6E-07 0.88

PZE0303506286 3506286 3 0.08 11.727 -------/CTTTTGC 3.8E-08 1.59

PZE0304837256 4837256 3 0.08 18.257 A/G 3.1E-07 -0.96

PZE0305392939 5392939 3 0.4 20.359 T/C 8.4E-08 1.03

PZE0305631317 5631317 3 0.05 21.629 A/G 9.6E-07 -0.72

PZE0305633671 5633671 3 0.28 21.647 G/A 4.4E-08 -0.82

PZE0310246703 10246703 3 0.08 34.997 C/G 7.4E-10 1.03

PZE0311299834 11299834 3 0.1 37.107 C/T 1.9E-08 1.00

PZE0312296552 12296552 3 0.06 38.819 A/G 6.5E-08 1.16

PZE0314728771 14728771 3 0.06 41.964 C/T 1.1E-11 1.06

PZE0314797647 14797647 3 0.35 42.053 G/- 1.4E-13 1.08

PZE0314801028 14801028 3 0.06 42.057 A/C 3.1E-11 1.08

PZE0314803252 14803252 3 0.05 42.060 C/A 8.4E-12 1.10

PZE0316220765 16220765 3 0.11 43.893 ----/GGCA 4.6E-15 0.89

PZE0324863644 24863644 3 0.08 52.382 C/G 3.1E-14 0.84

PZE0324867998 24867998 3 0.78 52.384 ------/GCCATG 6.2E-21 1.03

PZE0345775548 45775548 3 0.06 56.156 G/C 3.0E-10 0.76



width (Continued)


PZE03163889968 163889968 3 0.06 75.445 T/G 8.5E-09 -0.67

PZE03164635039 164635039 3 0.2 75.804 --/TT 5.0E-13 -0.81

PZE03167071326 167071326 3 0.07 78.274 G/A 2.1E-09 -0.85

PZE03167278885 167278885 3 0.11 78.429 --/TG 4.9E-20 -1.06

PZE03167279023 167279023 3 0.26 78.430 G/A 1.8E-20 -1.10

PZE03173899795 173899795 3 0.34 84.051 C/T 6.3E-07 -0.61

PZE03176565456 176565456 3 0.06 87.557 C/G 7.6E-10 -1.06

PZE03177753057 177753057 3 0.06 89.300 G/T 3.6E-14 -0.92

PZE03177909378 177909378 3 0.77 89.530 T/- 7.0E-14 -1.17

PZE03185851305 185851305 3 0.13 97.457 G/A 2.7E-07 1.11

PZE03186019308 186019308 3 0.06 97.633 -----/AGCCC 2.2E-07 1.12

PZE03197743903 197743903 3 0.45 104.942 C/G 8.0E-11 -1.47

PZE03199238519 199238519 3 0.05 106.270 ATGC/---- 5.7E-12 -1.64

PZE03199426920 199426920 3 0.05 106.653 A/G 5.2E-11 -1.08

PZE03207556982 207556982 3 0.06 117.144 C/T 1.2E-09 -0.76

PZE03209426299 209426299 3 0.09 119.847 C/G 1.3E-09 1.64

PZE03210124833 210124833 3 0.12 120.657 A/C 8.4E-09 -0.64

PZE03210530420 210530420 3 0.1 121.160 --/AA 1.1E-09 1.65

PZE03212245518 212245518 3 0.08 123.300 C/G 7.8E-12 1.56

PZE03212247142 212247142 3 0.12 123.302 -----/CGGCC 1.5E-09 1.38

PZE03213897442 213897442 3 0.12 126.777 G/T 7.4E-10 1.37

PZE03214371259 214371259 3 0.11 127.820 G/A 4.0E-10 1.66

PZE03215783204 215783204 3 0.05 129.714 C/T 1.3E-10 0.98

PZE03220825723 220825723 3 0.09 138.962 C/G 8.4E-07 -0.65

PZE0423025057 23025057 4 0.05 46.451 A/G 1.7E-07 1.15

PZE0463721606 63721606 4 0.07 55.625 T/A 1.2E-07 0.87

PZE0470166640 70166640 4 0.07 55.913 G/A 2.6E-08 0.85

PZE0480109872 80109872 4 0.17 56.550 G/A 1.5E-08 0.76

PZE04120150772 120150772 4 0.15 58.243 G/A 7.0E-08 0.76

PZE04150470982 150470982 4 0.09 62.630 G/T 2.2E-08 1.05

PZE04156002632 156002632 4 0.34 67.113 C/A 4.1E-12 -1.18

PZE04162282437 162282437 4 0.63 72.702 G/C 1.6E-10 -0.83

PZE04172091208 172091208 4 0.08 81.295 C/G 4.6E-08 -1.44

PZE04172284599 172284599 4 0.05 81.576 T/G 1.6E-06 -1.05

PZE04172653714 172653714 4 0.14 82.317 C/G 1.4E-07 -0.76

PZE04173999531 173999531 4 0.06 84.503 G/A 6.4E-09 -1.00

PZE04183923865 183923865 4 0.05 98.064 A/T 1.4E-08 -1.27

PZE04197891975 197891975 4 0.07 105.332 T/C 2.2E-12 -0.73

PZE04198335081 198335081 4 0.07 105.513 G/A 3.3E-07 0.80

PZE04198335681 198335681 4 0.07 105.513 C/A 7.5E-07 0.84

PZE04199269291 199269291 4 0.23 105.796 C/A 7.6E-11 -1.23

PZE04201526067 201526067 4 0.18 106.481 -/A 3.0E-12 -1.05

PZE04202772685 202772685 4 0.06 106.948 A/G 2.9E-12 -0.74

PZE04207537138 207537138 4 0.09 108.802 A/G 2.0E-15 -0.73

PZE04209759725 209759725 4 0.07 109.341 G/A 1.7E-10 -0.79

PZE0504931655 4931655 5 0.06 17.075 CCTGGGAG/-------- 1.4E-06 0.80

PZE0504939138 4939138 5 0.84 17.113 C/A 2.9E-22 -0.87

PZE0504939477 4939477 5 0.07 17.115 A/T 1.4E-19 -0.86

PZE0512974225 12974225 5 0.06 40.016 C/G 1.1E-08 -0.55

PZE0514503359 14503359 5 0.05 44.010 A/G 1.2E-08 -0.61

PZE0514920359 14920359 5 0.1 45.058 C/T 5.4E-07 -0.87



width (Continued)


PZE0515332051 15332051 5 0.08 45.783 T/- 6.5E-09 -0.59

PZE0515332592 15332592 5 0.06 45.783 T/C 8.6E-08 -0.75

PZE0516592424 16592424 5 0.05 47.378 A/G 2.4E-07 -0.59

PZE0518569452 18569452 5 0.1 49.320 A/C 1.9E-08 -0.62

PZE0530071423 30071423 5 0.07 56.104 T/G 6.9E-11 -0.68

PZE0530965217 30965217 5 0.26 56.820 C/A 6.0E-21 -0.89

PZE0531404017 31404017 5 0.24 57.194 C/T 4.7E-22 -0.94

PZE0531404388 31404388 5 0.14 57.194 A/G 2.9E-25 -0.98

PZE0531564092 31564092 5 0.05 57.309 C/G 1.2E-16 -0.89

PZE0562968130 62968130 5 0.15 63.911 C/A 2.8E-11 -0.72

PZE0563406894 63406894 5 0.09 63.998 A/G 8.8E-10 -0.82

PZE0564062722 64062722 5 0.17 64.111 T/A 3.1E-09 -1.17

PZE0569971940 69971940 5 0.06 65.636 C/A 8.6E-08 -0.69

PZE05106449213 106449213 5 0.08 70.267 C/G 8.8E-08 -1.19

PZE05169125923 169125923 5 0.05 80.953 C/T 7.5E-07 0.49

PZE05205811864 205811864 5 0.39 120.334 A/G 1.4E-07 1.47

PZE05209875967 209875967 5 0.26 130.732 C/G 3.4E-10 0.98

PZE05213344009 213344009 5 0.28 144.802 C/T 7.8E-11 0.58

PZE05213362996 213362996 5 0.23 144.890 A/G 1.1E-09 1.16

PZE05213364600 213364600 5 0.07 144.898 C/T 1.8E-10 0.75

PZE05213629385 213629385 5 0.07 146.131 -/A 1.3E-06 0.53

PZE0603992382 3992382 6 0.08 -6.319 G/C 3.9E-07 1.09

PZE0603992964 3992964 6 0.1 -6.318 G/C 2.1E-06 1.39

PZE0606899499 6899499 6 0.18 -3.021 G/A 4.3E-07 1.14

PZE0665632790 65632790 6 0.06 9.527 C/T 4.2E-06 -1.01

PZE0695494993 95494993 6 0.05 21.837 A/- 5.9E-06 -0.48

PZE06103863139 103863139 6 0.05 29.630 C/T 4.3E-08 -1.47

PZE06108644445 108644445 6 0.44 34.770 A/C 2.1E-11 -0.89

PZE06111526259 111526259 6 0.11 38.370 G/C 1.5E-11 -1.10

PZE06117216107 117216107 6 0.12 42.096 A/G 3.5E-15 -0.86

PZE06121805093 121805093 6 0.33 44.973 C/T 1.9E-13 -1.09

PZE06132255965 132255965 6 0.05 50.653 T/C 7.7E-17 -0.85

PZE06132448070 132448070 6 0.09 50.802 A/C 7.9E-15 -0.81

PZE06132490627 132490627 6 0.27 50.834 A/T 2.4E-11 -0.69

PZE06132512305 132512305 6 0.08 50.851 G/A 1.2E-14 -0.77

PZE06133853239 133853239 6 0.22 51.887 A/G 2.1E-19 -0.93

PZE06133972983 133972983 6 0.19 51.979 T/C 3.1E-18 -0.90

PZE06144138980 144138980 6 0.08 56.391 T/C 5.6E-08 -0.65

PZE06148136855 148136855 6 0.09 60.114 G/A 1.3E-08 -0.78

PZE06149950255 149950255 6 0.17 62.947 T/A 3.7E-09 -0.72

PZE06150914816 150914816 6 0.09 64.528 A/T 1.2E-11 -0.88

PZE06154310016 154310016 6 0.06 70.096 C/A 3.3E-08 -0.70

PZE06154310026 154310026 6 0.08 70.096 G/T 2.3E-08 -0.69

PZE06158077299 158077299 6 0.05 77.881 C/G 8.1E-07 0.86

PZE06165248915 165248915 6 0.09 101.827 --/GT 1.7E-09 -0.66

PZE06165338444 165338444 6 0.09 102.124 C/T 4.0E-09 -0.92

PZE06165344235 165344235 6 0.09 102.143 G/A 2.8E-09 -0.80

PZE06165590696 165590696 6 0.06 102.961 C/T 3.2E-08 -0.81

PZE06165591611 165591611 6 0.11 102.964 G/C 1.1E-09 -0.64

PZE06167017453 167017453 6 0.16 107.745 T/C 4.3E-09 -0.60

PZE06168899285 168899285 6 0.06 108.662 T/C 2.0E-07 -0.90



width (Continued)


PZE0701956532 1956532 7 0.07 4.629 A/T 4.2E-11 0.89

PZE0702314523 2314523 7 0.07 5.979 T/C 1.4E-06 1.13

PZE0702588100 2588100 7 0.05 7.017 A/T 6.8E-07 1.35

PZE0702784316 2784316 7 0.09 8.171 C/T 9.6E-08 1.17

PZE0703162614 3162614 7 0.1 10.396 --/AA 1.4E-07 0.56

PZE0703162633 3162633 7 0.59 10.396 C/T 4.1E-12 0.65

PZE0703206661 3206661 7 0.17 10.655 A/C 4.4E-10 1.41

PZE0721493881 21493881 7 0.14 45.483 A/G 1.3E-08 0.76

PZE0721496389 21496389 7 0.25 45.484 TAG/--- 8.0E-11 0.69

PZE0726114751 26114751 7 0.05 46.556 G/A 1.5E-07 0.52

PZE0729153461 29153461 7 0.09 47.115 C/G 1.3E-06 0.76

PZE0787664952 87664952 7 0.06 50.038 C/T 2.5E-08 0.70

PZE0798132136 98132136 7 0.07 50.709 T/C 1.1E-09 0.71

PZE07112123494 112123494 7 0.06 56.687 A/- 8.6E-08 -0.80

PZE07117359935 117359935 7 0.47 59.347 C/T 1.3E-10 1.09

PZE07119298317 119298317 7 0.11 60.332 C/G 2.1E-13 1.11

PZE07119298325 119298325 7 0.22 60.332 T/C 3.1E-09 0.87

PZE07123103852 123103852 7 0.17 63.392 A/G 3.9E-08 -0.65

PZE07124224234 124224234 7 0.06 64.449 G/- 6.1E-08 -1.02

PZE07154265985 154265985 7 0.11 94.583 G/C 4.0E-07 -0.85

PZE07164319883 164319883 7 0.09 116.803 C/A 2.8E-08 0.93

PZE07164933902 164933902 7 0.1 117.782 G/A 6.0E-10 0.70

PZE07165093616 165093616 7 0.07 118.484 C/T 4.2E-09 1.52

PZE07165920367 165920367 7 0.17 120.955 A/G 3.6E-10 0.72

PZE07166020355 166020355 7 0.12 121.092 C/T 5.1E-09 0.65

PZE07167060533 167060533 7 0.05 125.597 G/T 1.2E-09 1.71

PZE07167223322 167223322 7 0.15 126.304 T/- 9.4E-10 0.79

PZE07168767246 168767246 7 0.05 133.014 G/C 1.0E-07 1.01

PZE07168767839 168767839 7 0.12 133.017 G/T 2.2E-06 1.03

PZE07168772244 168772244 7 0.08 133.036 A/T 3.4E-06 1.24

PZE0802739222 2739222 8 0.16 6.405 T/A 1.8E-07 -0.62

PZE0803142581 3142581 8 0.1 7.411 C/T 1.1E-07 -0.58

PZE0804385443 4385443 8 0.13 11.236 C/T 1.4E-08 -0.47

PZE0804976376 4976376 8 0.21 14.133 T/C 4.3E-08 -0.49

PZE0814999477 14999477 8 0.27 37.396 C/G 2.3E-07 0.89

PZE0821894797 21894797 8 0.05 47.474 A/G 1.6E-08 -0.87

PZE0822170317 22170317 8 0.12 48.062 C/A 4.3E-11 -0.73

PZE0826515497 26515497 8 0.15 50.732 C/A 7.8E-08 -0.86

PZE0833542013 33542013 8 0.09 51.259 A/G 1.9E-09 -1.35

PZE0834038802 34038802 8 0.25 51.296 C/T 1.7E-09 -1.13

PZE0861979992 61979992 8 0.05 52.653 G/A 1.1E-07 -0.74

PZE0888949251 88949251 8 0.05 55.721 A/G 7.0E-11 1.25

PZE08121054808 121054808 8 0.08 65.599 C/T 7.9E-20 1.17

PZE08121109988 121109988 8 0.6 65.631 C/T 5.7E-22 1.08

PZE08123265181 123265181 8 0.07 66.895 C/T 9.4E-10 -0.80

PZE08123759388 123759388 8 0.1 67.128 A/G 2.5E-10 1.20

PZE08132684954 132684954 8 0.08 69.405 C/G 9.5E-08 -1.20

PZE08133766952 133766952 8 0.05 69.797 G/A 5.3E-07 -0.78

PZE08138140680 138140680 8 0.07 70.842 C/T 1.0E-08 -0.70

PZE08141034520 141034520 8 0.13 72.125 C/T 1.5E-08 -0.99

PZE08160101294 160101294 8 0.33 88.818 T/C 5.6E-09 -0.58



width (Continued)


PZE08160611171 160611171 8 0.06 89.646 G/C 2.5E-08 -0.62

PZE08162380809 162380809 8 0.09 92.047 C/A 2.9E-10 -1.16

PZE08163255634 163255634 8 0.06 94.668 T/A 1.2E-07 -0.59

PZE08163887739 163887739 8 0.07 96.376 C/G 1.0E-07 -0.89

PZE08166987149 166987149 8 0.07 106.913 CCC/--- 4.9E-07 -0.71

PZE08167188101 167188101 8 0.1 107.769 G/T 2.0E-07 -0.77

PZE08167206493 167206493 8 0.05 107.847 A/T 3.8E-06 -1.34

PZE0901076880 1076880 9 0.09 -7.776 C/A 2.3E-06 -0.62

PZE09100450862 100450862 9 0.07 50.275 T/G 6.2E-07 1.09

PZE09101810646 101810646 9 0.09 50.815 G/A 1.2E-07 1.18

PZE09102012884 102012884 9 0.09 50.896 T/C 2.0E-07 0.74

PZE09102013060 102013060 9 0.1 50.896 ------/GCAGGA 8.4E-08 0.94

PZE09104756213 104756213 9 0.08 52.002 C/G 1.4E-07 1.00

PZE09107509287 107509287 9 0.15 53.229 ------/GTATGA 7.2E-08 0.70

PZE09116755266 116755266 9 0.36 57.297 T/C 9.8E-16 0.99

PZE09121382512 121382512 9 0.41 60.099 T/C 1.4E-15 0.85

PZE09121384357 121384357 9 0.16 60.100 C/T 1.8E-12 0.78

PZE09147333148 147333148 9 0.17 102.653 A/G 3.7E-07 0.44

PZE09147333575 147333575 9 0.54 102.656 C/T 2.2E-07 0.55

PZE09147333636 147333636 9 0.1 102.656 C/A 4.4E-07 0.54

PZE09148162149 148162149 9 0.06 105.957 ------/GCCCAT 8.6E-07 0.77

PZE1022441211 22441211 10 0.05 34.852 C/T 1.3E-07 -0.90

PZE1084337670 84337670 10 0.2 40.172 C/G 9.8E-12 1.85

PZE1085544229 85544229 10 0.05 40.432 C/T 1.2E-06 0.89

PZE1085545202 85545202 10 0.14 40.432 C/T 3.2E-07 0.84

PZE1087723252 87723252 10 0.18 41.187 C/A 8.7E-12 1.49

PZE1092158267 92158267 10 0.11 41.917 C/T 1.0E-06 0.62

PZE1094269306 94269306 10 0.06 42.240 T/G 3.7E-13 1.91

PZE10117661813 117661813 10 0.05 46.824 C/T 3.7E-12 1.81

PZE10128613442 128613442 10 0.06 51.535 G/T 3.0E-13 2.78

PZE10129584033 129584033 10 0.07 52.113 G/A 4.7E-15 2.99

PZE10132179849 132179849 10 0.05 55.977 G/C 5.4E-12 -0.76

PZE10132181770 132181770 10 0.08 55.980 T/A 2.5E-08 -0.86

PZE10134466526 134466526 10 0.1 59.130 C/T 1.9E-10 -0.68

PZE10135453624 135453624 10 0.08 60.798 C/G 1.9E-10 -0.65

PZE10135453649 135453649 10 0.07 60.798 C/A 6.4E-10 -0.65

PZE10136252598 136252598 10 0.07 62.353 -/G 3.7E-10 -0.69

PZE10146680433 146680433 10 0.29 91.908 T/C 4.3E-16 -0.76

PZE10147266040 147266040 10 0.28 95.190 A/G 1.6E-16 -0.66

PZE10147266926 147266926 10 0.19 95.195 G/A 6.7E-18 -0.70


Supplementary Table 7 Overlap between candidate genes affecting leaf shape and

associations for leaf length and width

Arabidopsis Maize

gene gene identifier

gene chr gene identifier start end strand length BPPa

width BPPb

Leaf initiation

knox11 1 GRMZM2G159431 4982265 4986903 1 0 0.12

knox31 1 GRMZM2G000743 270659926 270661282 -1 0 0

knox81 1 GRMZM2G135447 280753178 280760163 1 0.35 0.07

knox71 4 GRMZM2G433591 240814237 240817691 1 0.09 0

knox101 5 GRMZM2G303381 13867196 13867989 1 0 0.11

knox61 5 GRMZM2G370332 93741063 93744769 -1 0 0

knox21 9 GRMZM2G055243 89916356 89924753 1 0 0

gn1 2 GRMZM2G452178 234053940 234060209 -1 0.11 0

rs12 7 GRMZM2G028041 3670339 3676532 1 0 0.95

kn13 1 GRMZM2G017087 270429924 270431507 1 0 0

kip4 1 GRMZM2G163761 255577747 255579428 1 0.17 0.11

ns15 2 GRMZM2G069028 139751687 139753040 1 0 0

SE6 AT2G27100 6 GRMZM2G156099 86670540 86677519 1 0.22 0

PKL7 AT2G25170

PIN18 AT1G73590

ZmPIN1a9 9 GRMZM2G098643 3596244 3599652 1 0.4 0

ZmPIN1b9 5 GRMZM2G074267 205646415 205649831 1 0 0.39

4 GRMZM2G149184 181077955 181081071 -1 0.06 0

STM10 AT1G62360

AS111 AT2G37630 RS212 1 GRMZM2G403620 154995050 154999516 -1 0 0

HIRA13 1 GRMZM2G079823 26277800 26284102 1 0.06 0.56

AS214 AT1G65620 ig115 3 GRMZM2G118250 167578136 167581368 -1 0 0.44

BOP116 AT3G57130

BOP216 AT2G41370 8 GRMZM2G060723 157700199 157703436 1 0 0

Establishment of dorsoventrality

AGO117 AT1G48410

2 GRMZM2G039455 16859320 16869175 1 0.12 0.11

6 GRMZM2G441583 35694408 35702858 1 0 0

10 AC209206.3_FG011 137113643 137120181 1 0.16 0.07

PHB18 AT2G34710 3 GRMZM2G178102 119446822 119453639 -1 0 0

1 GRMZM2G003509 173100920 173106336 -1 0 0

PHV18 AT1G30490 3 GRMZM2G178102 119446822 119453639 -1 0 0

1 GRMZM2G003509 173100920 173106336 -1 0 0

REV19 AT5G60690 rld120 9 GRMZM2G109987 150318075 150326340 -1 0 0

1 GRMZM2G042250 2778780 2785468 1 0.22 0

YAB121 AT2G45190

zyb922 5 GRMZM2G074543 23436467 23440756 1 0.48 0

zyb1522 5 GRMZM2G079293 188555552 188558478 1 0 0

zyb1422 10 GRMZM2G005353 132731925 132734559 -1 0.54 0.13

zyb1022 1 GRMZM2G167824 224417173 224422391 -1 0 0

KAN123 AT5G16560 mwp124 7 GRMZM2G082264 101800494 101807121 -1 0 0

ZmKAN124 1 GRMZM2G056400 215011612 215017010 -1 0 0.06

KAN223 AT1G32240

ZmKAN225 4 GRMZM2G070865 157039247 157044328 1 0 0

10 GRMZM2G123308 77152537 77154552 -1 0 0

4 GRMZM2G315506 31180673 31184454 -1 0 0

KAN323 AT4G17695 ZmKAN324 4 GRMZM2G175827 87406263 87410716 1 0 0

DRL126 AT1G13870 7 GRMZM2G019200 1949934 1957911 -1 0 0.28

PNH27 AT5G43810

6 GRMZM2G079080 103247900 103254864 -1 0 0.05

9 GRMZM2G108281 83492450 83504282 1 0 0

9 AC189879.3_FG003 83498070 83503971 1 0 0

lbl128 6 GRMZM2G020187 46282514 46288945 1 0 0


Supplementary Table 7 Overlap between candidate genes affecting leaf shape and

associations for leaf length and width (Continued)

Arabidopsis Maize

gene gene identifier

gene chr gene identifier start end strand length BPPa

width BPPb

leaf expansion processes (cell division and cell elongation)

cdc2aAt29 AT3G48750

4 GRMZM2G174596 244037619 244042478 1 0.21 0

1 GRMZM2G008327 3851308 3856895 1 0 0.12

9 GRMZM2G143213 149765761 149769168 -1 0 0

CycB130 AT4G37490

8 GRMZM2G310115 170127680 170141899 1 0 0

3 GRMZM2G073003 185750236 185753603 1 0 0.19

8 GRMZM2G034647 118667997 118670845 -1 0 0

CycD331 AT4G34160

CycD131 AT1G70210 7 GRMZM2G476685 99929088 99933905 -1 0 0

ICK232 AT3G50630

ANT33 AT4G37750 1 GRMZM2G028151 280642957 280646745 1 0.35 0.07

CLF34 AT2G23380

PFL235 AT4G00100

4 GRMZM2G158034 37430364 37433141 1 0 0

4 GRMZM2G112050 37599211 37600452 -1 0 0

6 AC205677.3_FG002 4898960 4899653 -1 0 0.18

ROT436 AT2G36985

ARGOS37 AT3G59900

JAG38 AT1G68480 8 GRMZM2G088112 11685004 11687066 1 0 0

3 GRMZM2G067205 22854217 22856194 -1 0.09 0

PPD139 AT4G14713

PPD239 AT4G14720

SWP40 AT3G04740 2 GRMZM2G446872 168944646 168957680 -1 0 0.2

AN341 AT5G28640 1 GRMZM2G180246 272339923 272343578 -1 0 0

ARL42 AT2G44080

AN43 AT1G01510 1 GRMZM2G476107 5417486 5423932 -1 0 0

1 GRMZM2G022966 6342520 6348581 -1 0.11 0

ROT344 AT4G36380

LNG145 AT5G15580

LNG245 AT3G02170 a Cumulative BPP of SNP associations for leaf length;

b Cumulative BPP of SNP

associations for leaf width


Supplementary Table 8 Overlap between microRNAs and associations for leaf

length and width

miRNA family

miRNA name chr start end strand length BPPa width BPPb

miR166 zma-MIR166a 6 83064618 83064824 -1 0 0

zma-MIR166b 1 222884234 222884350 1 0 0

zma-MIR166c 4 149531059 149531151 1 0 0.09

zma-MIR166d 5 21811795 21811901 -1 0 0

zma-MIR166g 1 13498009 13498135 1 0 0

zma-MIR166h 1 273716856 273716932 -1 0 0

zma-MIR166i 1 240574337 240574420 1 0 0.05

zma-MIR166j 7 119086851 119086966 1 0.19 0.33

zma-MIR166k 5 209830443 209830572 -1 0 0.26

zma-MIR166l 3 89667412 89667508 -1 0 0

zma-MIR166m 5 209830714 209830831 -1 0 0.26

zma-MIR166n 4 177224263 177224359 1 0 0

miR164 zma-MIR164a 2 213615191 213615311 1 0 0

zma-MIR164b 6 141804685 141804779 1 0 0

zma-MIR164c 6 153498572 153498812 -1 0.36 0.14

zma-MIR164d 7 167014750 167014929 -1 0.1 0.32

zma-MIR164e 1 46979603 46979719 1 0.06 0

zma-MIR164f 4 175585200 175585308 1 0 0

zma-MIR164g 6 138481060 138481231 -1 0 0

zma-MIR164h 8 117400781 117401000 1 0 0

miR319 zma-MIR319a 3 210557873 210558045 1 0 0.22

zma-MIR319b 3 2764410 2764586 1 0.27 0.08

zma-MIR319c 8 146886263 146886440 -1 0 0

zma-MIR319d 8 31728688 31728859 -1 0 0

miR159 zma-MIR159a 8 10508801 10509008 1 0 0

zma-MIR159b 8 10705144 10705326 1 0 0

zma-MIR159c 3 2710787 2710965 -1 0.27 0.08

zma-MIR159d 8 31783351 31783551 1 0 0

zma-MIR159e 1 245137115 245137242 -1 0.17 0

zma-MIR159f 3 25136695 25136910 -1 0 0.86*

zma-MIR159g 4 25585804 25586056 1 0 0

zma-MIR159h 8 10645067 10645267 1 0 0

zma-MIR159i 8 10648910 10649162 1 0 0

zma-MIR159j 8 10660875 10661127 1 0 0

zma-MIR159k 8 10701248 10701448 1 0 0

miR160 zma-MIR160a 4 242019451 242019554 -1 0.37 0

zma-MIR160b 5 42359029 42359114 -1 0 0

zma-MIR160c 6 9243585 9243677 1 0 0

zma-MIR160d 1 282533931 282534038 -1 0 0

zma-MIR160f 2 234574901 234574982 -1 0.11 0

zma-MIR160g 6 90346957 90347043 1 0 0

zma-MIR160h 9 55325143 55325228 1 0 0


Supplementary Table 8 Overlap between microRNAs and associations for leaf

length and width (Continued)

miRNA family

miRNA name chr start end strand length BPPa width BPPb

miR167 zma-MIR167a 3 115392919 115393077 1 0 0

zma-MIR167b 5 7648848 7648942 1 0 0

zma-MIR167c 5 4293574 4293674 1 0.12 0.97**

zma-MIR167d 1 286642587 286642688 -1 0 0.11

zma-MIR167e 7 9698743 9698827 -1 0 0

zma-MIR167f 3 190318430 190318514 1 0 0

zma-MIR167g 3 115394886 115395094 1 0 0

zma-MIR167h 6 92212951 92213057 -1 0 0

zma-MIR167i 9 107222251 107222344 -1 0 0.15

zma-MIR167j 1 12555014 12555123 1 0 0

miR393 zma-MIR393 2 736535 736626 1 0 0.17

zma-MIR393b 3 18361798 18361906 1 0 0

zma-MIR393c 10 148231076 148231173 -1 0.54** 0.47

* significant at P<0.10; ** significant at P<0.05; a Cumulative BPP of SNP associations

for leaf length; b Cumulative BPP of SNP associations for leaf width


Supplementary Table 9 Overlap between microRNA target genes and associations

for leaf length and width

miRNA family target gene_id chr start end strand

length BPPa

width BPPb

miR164 GRMZM2G471904 1 42333102 42349254 1 0 0

GRMZM2G010545 1 46971438 46974965 -1 0.06 0

GRMZM2G001361 1 64693971 64695663 -1 0 0

GRMZM2G003769 2 22874296 22875256 -1 0 0

GRMZM2G009892 2 42350633 42352536 -1 0.11 0

GRMZM2G011553 3 1634439 1635632 1 0.07 0

GRMZM2G162709 3 23329064 23330804 1 0.09 0

GRMZM2G163975 3 31122470 31127740 -1 0 0

GRMZM2G114850 3 118291252 118295581 1 0 0

GRMZM2G139700 3 133824688 133826888 1 0 0

GRMZM2G072808 3 178907264 178910110 1 0 0.77

GRMZM2G339122 3 182652061 182654418 -1 0 0

GRMZM2G055585 3 209957398 209960792 1 0.1 0.31

GRMZM2G397675 3 213461466 213462821 1 0.6 0.23

GRMZM2G008819 4 178879058 178880132 -1 0.05 0

GRMZM2G057749 4 187890216 187891984 1 0 0

GRMZM2G063522 5 42754069 42758440 1 0 0

GRMZM2G146380 5 176172472 176173575 -1 0 0

GRMZM2G045927 5 208085786 208086926 -1 0 0

GRMZM2G305856 6 24328022 24329384 -1 0.08 0

GRMZM2G393433 6 45408314 45410466 -1 0 0

GRMZM2G162336 6 78532297 78533470 -1 0 0

GRMZM2G174766 7 7804374 7805671 -1 0.09 0

GRMZM2G003342 7 113216618 113222185 1 0 0

GRMZM2G095556 7 152631269 152634451 1 0.05 0

GRMZM2G096358 8 11600992 11602825 -1 0 0

GRMZM2G168681 8 59749588 59753865 -1 0 0

GRMZM2G439337 9 57537400 57539050 -1 0 0

GRMZM2G345493 9 89387678 89394680 1 0 0

AC196090.3_FG006 9 149691827 149694073 1 0 0

GRMZM2G117836 10 37563054 37566937 1 0 0

GRMZM2G167018 10 60800053 60802701 1 0 0

GRMZM2G063322 10 79917087 79928102 -1 0.05 0

miR166 GRMZM2G003509 1 173100920 173106336 -1 0 0

GRMZM2G469551 1 229873807 229885785 -1 0.07 0

GRMZM2G178102 3 119446822 119453639 -1 0 0

AC206425.3_FG004 3 128157367 128158855 1 0 0

GRMZM2G114888 5 66131284 66135062 -1 0 0

GRMZM2G135175 5 194809559 194811657 1 0 0

GRMZM2G029692 7 6039350 6044553 -1 0 0

AC187157.4_FG005 8 22630079 22634496 1 0 0.17

GRMZM2G109987 9 150318075 150326340 -1 0 0

miR319 GRMZM2G180979 1 262843718 262847244 1 0 0

GRMZM2G115516 1 284243813 284248357 -1 0.21 0

GRMZM2G412073 3 2764181 2765535 1 0.27 0.08

GRMZM2G139688 3 185287382 185291404 -1 0 0.19

GRMZM2G001279 5 12337044 12340545 1 0 0.06

GRMZM2G388987 6 95621694 95632640 1 0.1 0.05

GRMZM2G028054 8 169910047 169913878 -1 0 0


Supplementary Table 9 Overlap between microRNA target genes and associations

for leaf length and width (Continued)

miRNA family target gene_id chr start end strand

length BPPa

width BPPb

miR159 GRMZM2G046443 1 190192537 190193788 1 0.18 0

AC217264.3_FG005 1 245136067 245138533 1 0.17 0

GRMZM2G041312 2 62041921 62056757 -1 0.12 0

GRMZM2G027100 3 2710473 2711063 -1 0.27 0.08

GRMZM2G085550 3 3512715 3515197 1 0.2 0.08

GRMZM2G139688 3 185287382 185291404 -1 0 0.19

GRMZM2G064501 4 35387691 35389893 -1 0 0

GRMZM2G038195 4 236159467 236172430 1 0 0

GRMZM2G070523 5 20088036 20090973 -1 0.08 0

GRMZM2G423833 6 88018957 88021941 -1 0.28 0

GRMZM2G093789 6 88121462 88134582 -1 0.28 0

GRMZM2G376684 6 102467657 102470010 -1 0 0

GRMZM2G075064 6 102472006 102474348 -1 0 0

AC209015.3_FG004 6 102477936 102478472 -1 0 0

AC204352.3_FG012 6 156977854 156979243 -1 0.05 0

GRMZM2G457339 8 10644378 10645355 1 0 0

GRMZM2G457377 8 10648273 10649249 1 0 0

GRMZM2G451605 8 10660238 10661213 1 0 0

GRMZM2G386944 8 10700559 10701534 1 0 0

GRMZM2G028054 8 169910047 169913878 -1 0 0

GRMZM2G416652 9 87110682 87113834 -1 0 0

GRMZM2G167088 9 87117239 87124241 -1 0 0

GRMZM2G061972 9 87155343 87164464 -1 0 0

GRMZM2G113073 10 5230144 5235000 1 0.07 0

GRMZM2G311059 10 139506579 139507590 1 0.09 0

miR160 GRMZM2G153233 1 230050442 230054463 -1 0.07 0

GRMZM2G369356 2 25343713 25348635 -1 0 0

GRMZM2G081406 4 142909402 142912192 1 0 0

GRMZM2G159399 5 27804742 27809156 -1 0 0

AC207656.3_FG002 5 48559282 48561684 1 0 0

GRMZM2G390641 6 88003120 88006321 -1 0.28 0

GRMZM2G036837 8 4869595 4878444 1 0.45 0.34

GRMZM2G005284 10 130593134 130595559 -1 0 0

miR167 GRMZM2G081158 1 173287530 173295525 -1 0 0

GRMZM2G068328 1 239313338 239316442 -1 0 0.05

GRMZM2G078274 2 2254112 2262068 1 0.32 0.66

GRMZM2G073750 3 120045821 120052020 -1 0 0

GRMZM2G028980 4 242084265 242090213 -1 0.37 0

GRMZM2G035405 5 41635411 41641630 1 0 0

GRMZM2G089640 6 90218376 90221330 -1 0 0

GRMZM2G475882 10 147258507 147267504 -1 0.32 0.76**

miR393 GRMZM2G135978 8 125784836 125790371 -1 0 0

** significant at P<0.05; a Cumulative BPP of SNP associations for leaf length;

b

Cumulative BPP of SNP associations for leaf width


Supplementary Table10 Overlap between candidate genes affecting leaf blade-

sheath boundary and associations for upper leaf angle

gene annotation chr gene identifier start end strand cumulative

BPP

lg146 liguleless1 2 GRMZM2G036297 4209163 4212840 1 1.15***

lg347 liguleless3 3 GRMZM2G087741 53539642 53549481 1 0

lg248 liguleless2 3 GRMZM2G060216 175046193 175054867 1 1.73***

lg447 liguleless4 8 GRMZM2G094241 129504353 129509919 1 0.13

*** significant at P<0.01


Supplementary Table 11 Association tests for SNPs around lg1, lg2 and lg4

identified by GWAS for upper leaf angle in association panel (n=282)

BPP P effect Note MAF GLM GLM(Q) MLM(QK) MLM(K)

m189 liguleless 1 PZE0204156598 2 4156598 A/G 0.72 1.6E-29 -0.76 53kb upstream of lg1 0.22 0.032 0.083 0.083 0.078

PZE0204276758 2 4276758 A/G 0.27 4.4E-27 -0.78 64kb downstream of lg1

PZE0204311517 2 4311517 A/C 0.06 2.9E-09 -0.88 98kb upstream of lg1

m381 liguleless2 PZE03174221558 3 174221558 ---/TGG 0.09 2.4E-11 -1.50 825kb upstream of lg2

PZE03174299355 3 174299355 A/G 0.1 5.6E-35 -0.88 747kb upstream of lg2 0.21 0.306 0.201 0.931 0.838

PZE03174612178 3 174612178 C/T 0.22 4.4E-12 -1.24 434kb upstream of lg2 0.29 0.063 0.389 0.326 0.218

PZE03174816519 3 174816519 T/C 0.17 1.4E-16 -0.92 230kb upstream of lg2

PZE03175048356 3 175048356 T/G 0.07 1.3E-19 -0.96 in the intron 1 of lg2 0.31 0.858 0.884 0.385 0.349

PZE03175051393 3 175051393 T/A 0.19 8.0E-13 -1.34 in the intron 8 of lg2 0.14 0.001 0.006 0.030 0.019

PZE03175051481 3 175051481 G/A 0.07 5.3E-15 -1.26 in the intron 8 of lg2 0.19 0.025 0.078 0.195 0.161

PZE03175740254 3 175740254 AC/-- 0.82 5.1E-34 -0.97 685kb downstream of lg2

m899 liguleless4 PZE08128596188 8 128596188 G/A 0.13 5.9E-12 -1.41 900kb upstream of lg4 0.05 0.007 0.007 0.034 0.038

Association in 282 panelQTL gene SNP chr pos (bp) allele

NAM-GWAS

MAF, Minor Allele Frequency; GLM, Generalized Linear Model; GLM(Q), GLM

including population structure (Q) as fixed effect; MLM(K), Mixed Linear Model

including relative kinship matrix (K) as random effect; MLM(QK), Mixed Linear

Model including Q and K as fixed and random effect, respectively.


Supplementary Table 12 The summary of subsampling SNP models near lg1 and

lg2

Region Number of SNPs fitted in model Number of models

lg1 0 1

1 93

2 6

3 0

lg2 0 2

1 24

2 73

3 1

4 0

5 0

6 0

7 0

8 0


Supplementary Table 13 KASPAR primers used in genotyping SNPs at lg1, lg2

and lg4 in association panel (n=282)

SNP primer primer sequence

PZE0204156598 PZE0204156598_ALA GAAGGTGACCAAGTTCATGCTAATATGCTTTTGCAGAGAAGCATGAGT

PZE0204156598_ALG GAAGGTCGGAGTCAACGGATTATGCTTTTGCAGAGAAGCATGAGC

PZE0204156598_C2 CGTACAGGACTTCTTAATATTTCTGCAGAA

PZE03174299355 PZE03174299355_ALA GAAGGTGACCAAGTTCATGCTCGCACGGCACGCCGTGCT

PZE03174299355_ALG GAAGGTCGGAGTCAACGGATTGCACGGCACGCCGTGCC

PZE03174299355_C2 TGCTCATCGACTACGCCGCGTA

PZE03174612178 PZE03174612178_ALC GAAGGTGACCAAGTTCATGCTGCGTCGTAGGACCTTGC

PZE03174612178_ALT GAAGGTCGGAGTCAACGGATTCGCTGCGTCGTAGGACCTTGT

PZE03174612178_C2 CCGAAACCTTCGCGGTGAAAAACAA

PZE03175048356 PZE03175048356_ALT GAAGGTGACCAAGTTCATGCTGGCGGGCGATGACTGATGGT

PZE03175048356_ALG GAAGGTCGGAGTCAACGGATTGCGGGCGATGACTGATGGG

PZE03175048356_C1 TGCCCAAGCAGTAGCGCACAGA

PZE03175051393 PZE03175051393_ALT GAAGGTGACCAAGTTCATGCTCAGTGGTACTGCGAATGAATGGA

PZE03175051393_ALA GAAGGTCGGAGTCAACGGATTCAGTGGTACTGCGAATGAATGGT

PZE03175051393_C1 CCGGGGACATGAGCTCTGGTAA

PZE03175051481 PZE03175051481_ALG GAAGGTGACCAAGTTCATGCTAGCTTAGCTGCCGCAGCCG

PZE03175051481_ALA GAAGGTCGGAGTCAACGGATTCAGCTTAGCTGCCGCAGCCA

PZE03175051481_C2 GCCGGCCATGCATCTCGGTAA

PZE08128596188 PZE08128596188_ALG GAAGGTGACCAAGTTCATGCTCTATTGTCTCTGTCACACTACGC

PZE08128596188_ALA GAAGGTCGGAGTCAACGGATTCTCTATTGTCTCTGTCACACTACGT

PZE08128596188_C2 GCGGCCACGAGAGGTGGGT


Supplementary Table 14 Genotypes of 27 NAM founders that showed significant

associations around liguleless genes

QTL gene SNP

B7

3

B9

7

CM

L10

3

CM

L22

8

CM

L24

7

CM

L27

7

CM

L32

2

CM

L33

3

CM

L52

CM

L69

HP

30

1

IL1

4H

KI1

1

KI3

KY2

1

M1

62

W

M3

7W

MO

17

MO

18

W

MS7

1

NC

35

0

NC

35

8

OH

43

OH

7B

P3

9

TX3

03

TZI8

m189 liguleless 1 PZE0204156598 0 1 1 1 1 1 0 0 1 1 1 1 1 1 1 0 1 1 0 1 1 0 1 1 1 0 1

PZE0204276758 0 1 1 1 1 0 0 0 1 1 1 1 1 0 0 1 1 1 1 1 0 0 1 1 1 0 1

PZE0204311517 0 1 1 0 0 0 0 0 0 0 0 1 0 0 1 0 0 0 0 1 0 0 0 0 0 0 0

m381 liguleless2 PZE03174221558 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 1 0 0 0 0

PZE03174299355 0 1 1 1 1 1 1 1 1 0 1 1 1 1 1 1 1 0 1 1 1 1 1 1 1 1 1

PZE03174612178 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 1 0 0 0 0

PZE03174816519 0 0 0 1 0 1 0 0 0 0 1 1 1 1 0 1 0 0 1 1 1 1 1 0 0 1 0

PZE03175048356 0 0 1 1 1 1 1 1 0 1 1 1 0 1 0 1 1 0 1 1 1 1 1 1 0 1 1

PZE03175051393 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 1 1 0 0 0 0

PZE03175051481 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 0 1 1 0 0 0 0

PZE03175740254 0 1 1 1 1 1 1 1 0 0 1 1 1 1 1 1 1 0 0 1 1 1 1 0 1 0 1

m899 liguleless4 PZE08128596188 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0


Supplementary Notes:

Joint linkage analysis

We fit a joint linkage model using stepwise regression as previously described49

to

identify joint QTL for leaf length, leaf width and upper leaf angle. Briefly, an

appropriate p-value cutoff was first determined by 1000 permutation tests for each leaf

trait for use in subsequent joint stepwise regression. To perform joint stepwise

regression, a family main effect was fit first, and then marker effects nested within

families were selected to enter or leave the model using a partial F-test. Once a model

was determined using stepwise regression, a refitting procedure dropped markers from

the model one at a time then reselected a single best marker. This step checked the fit of

each marker against the full model and improved the overall fit of the model. A

threshold of α=0.05 was used to declare significant allele effects across founders within

each QTL identified by stepwise regression49

.

QTL by Environment interaction and epistasis

QTL by Environment interaction was investigated using the same strategy previously

described49

. Based on the general linear model including all joint additive QTLs as

cofactors, we tested every possible pairwise marker interaction between each joint QTL

and all other markers across the NAM panel. Significant interaction pairs were

identified using a sequential Bonferroni50

corrected α=0.05. In addition, all possible

pairs of markers were tested for interaction within each population individually. For

each population, a forward regression model was fit for marker main effects using a

significance level of 0.001 to allow markers to enter the model. Following that each pair

of markers and their interaction was added to that main effects model and the effect of


adding the interaction term after accounting for main effects was tested. A sequential

Bonferroni test (α=0.05) was used to determine significance for each population

individually. We note the power to detect epistasis is low because most of the

phenotypic variation was explained by additive effects of the QTLs, leaving relatively

little variation that could be explained by epistasis. In addition, the number of tests

conducted is high; after correcting for multiple testing, epistatic effects would need to

be large to be detected.

QTL support interval

To compensate for the impact of unevenly distributed markers genotyped in RILs, we

imputed markers at a 0.1cM of interval onto RILs based on the known genotypes of

flanking markers that were genotyped in RILs. By adding a single flanking marker for

the QTL at a step of 0.1cM to the full model, the QTL support interval was calculated.

If the p-value of the marginal F-test of the QTL was not significant at the 0.05 level, the

lack of significance indicated that the new flanking marker explained the QTL as well

as the original marker and that flanking marker should be in the support interval for the

QTL. If the p-value for the test of original QTL was significant, then the flanking

marker was not considered to be in the support interval.

HapMap SNP imputation

We used the program fastPHASE version 1.351

, a haplotype clustering algorithm, to

impute the missing genotypes. fastPHASE assumes that haplotypes cluster into groups

over short regions. Cluster memberships are allowed to change continuously along a

chromosome according to a hidden Markov model51

. Using the built-in cross-validation

procedure, haplotype cluster number was varied from 1 to 27 to test imputation


accuracy by masking known genotypes. The final cluster number was set to 10 because

it had imputation accuracy of 90% and acceptable computation time. Higher cluster

numbers has slightly better accuracy but required much more time.

The overlap between candidate genes and associations

The proximity of associations identified by GWAS for leaf length, leaf width and upper

leaf angle to known candidate genes in maize and Arabidopsis was evaluated. The

Supplementary Table 8 lists the candidate genes for leaf length and width. The 27 maize

candidate genes were compiled based on publications (see associated references in

Supplementary Information). The 38 Arabidopsis candidate genes were mainly from

Table 1 in a previous review paper52

. The INPARANOID algorithm53

was used to

determine the orthology between maize and Arabidopsis (Pankaj Jaiswal, personal

communication). Multiple maize genes orthologous to a single Arabidopsis gene were

considered as paralogs. Both orthologs and paralogs were included in the analysis.

Candidate genes were divided into three groups (leaf initiation, leaf dorsoventrality and

leaf expansion) based on their biological function52

. Recent literature has suggested that

miRNA families miR165/166, miR164a, miR319/JAW, miR159, miR160, miR167 and

miR393 are also involved in regulating leaf development54

. The association support for

these miRNA genes as well as their corresponding targets was tested. The physical

positions of the miRNA genes and miRNA targets were obtained from a previous

study55

. For leaf angle, four liguleless genes (lg1, lg2, lg3 and lg4)46-48

were considered

to be the candidates. Any SNP within 1Mb of a candidate gene was considered to be

overlapping. The 1Mb window size used to test enrichment with candidate genes was

based on the below considerations. 1) Massive variation of LD exists in maize. On

average, the LD decays very quickly56

, but long-range LD is also observed such as at y1


locus, where the LD as well as the significant phenotype-genotype association extends

more than 600kb of physical region57

. 2) Active regulatory elements can be located as

far as more than 1 Mb from the genes that they control and they may also be

incorporated into neighboring genes58,59

. 3) If the SNP set does not contain the causal

polymorphism then a nearby SNP that is in LD may be selected by the model. To

evaluate the degree of enrichment of associations around these genes, a cumulative BPP

was calculated for each gene by summing the BPPs of all the SNPs associated with the

trait under investigation and within 1Mb of each of the genes. The cumulative BPPs

were also calculated for n random genes (n= number of genes within each group or

miRNA family) sampled from maize genome filtered gene set60

or miRNA gene set55

.

For each set of random genes, the maximum of the cumulative BPPs was calculated.

1000 replications were performed to produce a null distribution for each group or

miRNA family. The significance of the cumulative BPP for each of candidate genes was

evaluated based on the null distribution.

Association tests in association panel

The association panel was included in the NAM field experiments described previously

and scored for the three leaf traits. For each line, BLUPs across 9 trials were calculated

for the three traits using the analysis described previously. The Box-Cox transformation

family61

was used to transform the upper leaf angle data as before. For correcting

population sub-structure and relatedness among lines, we used population structure (Q)

and relative kinship (K) matrices that had been calculated based on 89 microsatellites

and 553 random SNPs, respectively62

. Four different models as described below were

used to test the associations between the seven SNPs and upper leaf angle. 1) Simple

model: a general linear model (GLM) containing only the SNP being tested as a fixed


effect was used to test the associations. 2) GLM(Q): The Q matrix was included in the

GLM as fixed effects to control population structure. 3) MLM(QK): A mixed model

was constructed to test the associations, where Q and K are treated as fixed and random

effects, respectively. 4) MLM(K): A mixed model was used that included K alone as a

random effect.

Simulation in association panel

The association panel63

used above has been genotyped by 553 random SNPs and used

for simulation studies62

. A previously described simulation procedure62

was applied to

our dataset. In our simulation, the transformed upper leaf angle was used as the

phenotype. The four models described above were tested. Since these 553 SNPs were

selected from 413 random genes62

, it is expected that these SNP are unlikely to be

linked to causative polymorphisms for upper leaf angle. The associations between

observed phenotype and observed markers were used to evaluate the type I error control

for different models. The approaches that appropriately control type I error should

produce a uniform distribution of P values. To evaluate the statistical power of different

models under given effect size, a series of simulated phenotypes was produced by

adding 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9 and 1 times the phenotypic standard

deviation to each SNP. The statistical power for each effect size under each model was

calculated as previously described62

.


Associated references in Supplementary Table 7, Supplementary Table 10 and Supplementary

Notes:

1. Kerstetter, R. et al. Sequence analysis and expression patterns divide the maize knotted1-like homeobox genes into two classes. Plant Cell 6, 1877-87 (1994).

2. Schneeberger, R.G., Becraft, P.W., Hake, S. & Freeling, M. Ectopic expression of the knox homeo box gene rough sheath1 alters cell fate in the maize leaf. Genes Dev 9, 2292-304 (1995).

3. Inada, D.C. et al. Conserved noncoding sequences in the grasses. Genome Res 13, 2030-41 (2003).

4. Smith, H.M., Boschke, I. & Hake, S. Selective interaction of plant homeodomain proteins mediates high DNA-binding affinity. Proc Natl Acad Sci U S A 99, 9579-84 (2002).

5. Nardmann, J., Ji, J., Werr, W. & Scanlon, M.J. The maize duplicate genes narrow sheath1 and narrow sheath2 encode a conserved homeobox gene function in a lateral domain of shoot apical meristems. Development 131, 2827-39 (2004).

6. Prigge, M.J. & Wagner, D.R. The arabidopsis serrate gene encodes a zinc-finger protein required for normal shoot development. Plant Cell 13, 1263-79 (2001).

7. Rider, S.D., Jr. et al. Metabolic profiling of the Arabidopsis pkl mutant reveals selective derepression of embryonic traits. Planta 219, 489-99 (2004).

8. Hay, A., Barkoulas, M. & Tsiantis, M. PINning down the connections: transcription factors and hormones in leaf morphogenesis. Curr Opin Plant Biol 7, 575-81 (2004).

9. Carraro, N., Forestan, C., Canova, S., Traas, J. & Varotto, S. ZmPIN1a and ZmPIN1b encode two novel putative candidates for polar auxin transport and plant architecture determination of maize. Plant Physiol 142, 254-64 (2006).

10. Long, J.A., Moan, E.I., Medford, J.I. & Barton, M.K. A member of the KNOTTED class of homeodomain proteins encoded by the STM gene of Arabidopsis. Nature 379, 66-9 (1996).

11. Byrne, M.E. et al. Asymmetric leaves1 mediates leaf patterning and stem cell function in Arabidopsis. Nature 408, 967-71 (2000).

12. Tsiantis, M., Schneeberger, R., Golz, J.F., Freeling, M. & Langdale, J.A. The maize rough sheath2 gene and leaf development programs in monocot and dicot plants. Science 284, 154-6 (1999).

13. Phelps-Durr, T.L., Thomas, J., Vahab, P. & Timmermans, M.C. Maize rough sheath2 and its Arabidopsis orthologue ASYMMETRIC LEAVES1 interact with HIRA, a predicted histone chaperone, to maintain knox gene silencing and determinacy during organogenesis. Plant Cell 17, 2886-98 (2005).

14. Semiarti, E. et al. The ASYMMETRIC LEAVES2 gene of Arabidopsis thaliana regulates formation of a symmetric lamina, establishment of venation and repression of meristem-related homeobox genes in leaves. Development 128, 1771-83 (2001).

15. Evans, M.M. The indeterminate gametophyte1 gene of maize encodes a LOB domain protein required for embryo Sac and leaf development. Plant Cell 19, 46-62 (2007).

16. Ha, C.M. et al. The BLADE-ON-PETIOLE 1 gene controls leaf pattern formation through the modulation of meristematic activity in Arabidopsis. Development 130, 161-72 (2003).

17. Bohmert, K. et al. ACO1 defines a novel locus of Arabidopsis controlling leaf development. EMBO J 17, 170-180 (1998).


18. McConnell, J.R. et al. Role of PHABULOSA and PHAVOLUTA in determining radial patterning in shoots. Nature 411, 709-13 (2001).

19. Otsuga, D., DeGuzman, B., Prigge, M.J., Drews, G.N. & Clark, S.E. REVOLUTA regulates meristem initiation at lateral positions. Plant J 25, 223-36 (2001).

20. Juarez, M.T., Kui, J.S., Thomas, J., Heller, B.A. & Timmermans, M.C. microRNA-mediated repression of rolled leaf1 specifies maize leaf polarity. Nature 428, 84-8 (2004).

21. Sawa, S. et al. FILAMENTOUS FLOWER, a meristem and organ identity gene of Arabidopsis, encodes a protein with a zinc finger and HMG-related domains. Genes Dev 13, 1079-88 (1999).

22. Houston, N.L. et al. Phylogenetic analyses identify 10 classes of the protein disulfide isomerase family in plants, including single-domain protein disulfide isomerase-related proteins. Plant Physiol 137, 762-78 (2005).

23. Kerstetter, R.A., Bollman, K., Taylor, R.A., Bomblies, K. & Poethig, R.S. KANADI regulates organ polarity in Arabidopsis. Nature 411, 706-9 (2001).

24. Candela, H., Johnston, R., Gerhold, A., Foster, T. & Hake, S. The milkweed pod1 gene encodes a KANADI protein that is required for abaxial/adaxial patterning in maize leaves. Plant Cell 20, 2073-87 (2008).

25. Henderson, D.C., Zhang, X., Brooks, L., 3rd & Scanlon, M.J. RAGGED SEEDLING2 is required for expression of KANADI2 and REVOLUTA homologues in the maize shoot apex. Genesis 44, 372-82 (2006).

26. Nelissen, H. et al. DRL1, a homolog of the yeast TOT4/KTI12 protein, has a function in meristem activity and organ growth in plants. Plant Cell 15, 639-54 (2003).

27. Newman, K.L., Fernandez, A.G. & Barton, M.K. Regulation of axis determinacy by the Arabidopsis PINHEAD gene. Plant Cell 14, 3029-42 (2002).

28. Nogueira, F.T., Madi, S., Chitwood, D.H., Juarez, M.T. & Timmermans, M.C. Two small regulatory RNAs establish opposing fates of a developmental axis. Genes Dev 21, 750-5 (2007).

29. Hemerly, A. et al. Dominant negative mutants of the Cdc2 kinase uncouple cell division from iterative plant development. EMBO J 14, 3925-36 (1995).

30. Donnelly, P.M., Bonetta, D., Tsukaya, H., Dengler, R.E. & Dengler, N.G. Cell cycling and cell enlargement in developing leaves of Arabidopsis. Dev Biol 215, 407-19 (1999).

31. Dewitte, W. et al. Altered cell cycle distribution, hyperplasia, and inhibited differentiation in Arabidopsis caused by the D-type cyclin CYCD3. Plant Cell 15, 79-92 (2003).

32. Wang, H., Zhou, Y., Gilmer, S., Whitwill, S. & Fowke, L.C. Expression of the plant cyclin-dependent kinase inhibitor ICK1 affects cell division, plant growth and morphology. Plant J 24, 613-23 (2000).

33. Mizukami, Y. & Fischer, R.L. Plant organ size control: AINTEGUMENTA regulates growth and cell numbers during organogenesis. Proc Natl Acad Sci U S A 97, 942-7 (2000).

34. Kim, G.T., Tsukaya, H. & Uchimiya, H. The CURLY LEAF gene controls both division and elongation of cells during the expansion of the leaf blade in Arabidopsis thaliana. Planta 206, 175-83 (1998).

35. Ito, T., Kim, G.T. & Shinozaki, K. Disruption of an Arabidopsis cytoplasmic ribosomal protein S13-homologous gene by transposon-mediated mutagenesis causes aberrant growth and development. Plant J 22, 257-64 (2000).

36. Narita, N.N. et al. Overexpression of a novel small peptide ROTUNDIFOLIA4 decreases cell proliferation and alters leaf shape in Arabidopsis thaliana. Plant J 38, 699-713 (2004).


37. Hu, Y., Xie, Q. & Chua, N.H. The Arabidopsis auxin-inducible gene ARGOS controls lateral organ size. Plant Cell 15, 1951-61 (2003).

38. Ohno, C.K., Reddy, G.V., Heisler, M.G. & Meyerowitz, E.M. The Arabidopsis JAGGED gene encodes a zinc finger protein that promotes leaf tissue development. Development 131, 1111-22 (2004).

39. White, D.W. PEAPOD regulates lamina size and curvature in Arabidopsis. Proc Natl Acad Sci U S A 103, 13238-43 (2006).

40. Autran, D. et al. Cell numbers and leaf development in Arabidopsis: a functional analysis of the STRUWWELPETER gene. EMBO J 21, 6036-49 (2002).

41. Horiguchi, G., Kim, G.T. & Tsukaya, H. The transcription factor AtGRF5 and the transcription coactivator AN3 regulate cell proliferation in leaf primordia of Arabidopsis thaliana. Plant J 43, 68-78 (2005).

42. Hu, Y., Poh, H.M. & Chua, N.H. The Arabidopsis ARGOS-LIKE gene regulates cell expansion during organ growth. Plant J 47, 1-9 (2006).

43. Kim, G.T. et al. The ANGUSTIFOLIA gene of Arabidopsis, a plant CtBP gene, regulates leaf-cell expansion, the arrangement of cortical microtubules in leaf cells and expression of a gene involved in cell-wall formation. EMBO J 21, 1267-79 (2002).

44. Kim, G.T. et al. CYP90C1 and CYP90D1 are involved in different steps in the brassinosteroid biosynthesis pathway in Arabidopsis thaliana. Plant J 41, 710-21 (2005).

45. Lee, Y.K. et al. LONGIFOLIA1 and LONGIFOLIA2, two homologous genes, regulate longitudinal cell elongation in Arabidopsis. Development 133, 4305-14 (2006).

46. Moreno, M.A., Harper, L.C., Krueger, R.W., Dellaporta, S.L. & Freeling, M. liguleless1 encodes a nuclear-localized protein required for induction of ligules and auricles during maize leaf organogenesis. Genes Dev 11, 616-28 (1997).

47. Bauer, P. et al. Regulation and a conserved intron sequence of liguleless3/4 knox class-I homeobox genes in grasses. Planta 219, 359-68 (2004).

48. Walsh, J., Waters, C.A. & Freeling, M. The maize gene liguleless2 encodes a basic leucine zipper protein involved in the establishment of the leaf blade-sheath boundary. Genes Dev 12, 208-18 (1998).

49. Buckler, E.S. et al. The genetic architecture of maize flowering time. Science 325, 714-8 (2009).

50. Rice, W.R. Analyzing tables of statistical tests. Evolution 43, 223-225 (1989). 51. Scheet, P. & Stephens, M. A fast and flexible statistical model for large-scale

population genotype data: applications to inferring missing genotypes and haplotypic phase. Am J Hum Genet 78, 629-44 (2006).

52. Cho, K.H., Jun, S.E., Lee, Y.K., Jeong, S.J. & Kim, G.T. Developmental processes of leaf morphogenesis in Arabidopsis. Journal of Plant Biology 50, 282-290 (2007).

53. Remm, M., Storm, C.E. & Sonnhammer, E.L. Automatic clustering of orthologs and in-paralogs from pairwise species comparisons. J Mol Biol 314, 1041-52 (2001).

54. Kidner, C.A. & Martienssen, R.A. The developmental role of microRNA in plants. Curr Opin Plant Biol 8, 38-44 (2005).

55. Zhang, L. et al. A genome-wide characterization of microRNA genes in maize. PLoS Genet 5, e1000716 (2009).

56. Gore, M.A. et al. A first-generation haplotype map of maize. Science 326, 1115-7 (2009).

57. Palaisa, K., Morgante, M., Tingey, S. & Rafalski, A. Long-range patterns of diversity and linkage disequilibrium surrounding the maize Y1 gene are indicative of an asymmetric selective sweep. Proc Natl Acad Sci U S A 101, 9885-90 (2004).


58. Benko, S. et al. Highly conserved non-coding elements on either side of SOX9 associated with Pierre Robin sequence. Nat Genet 41, 359-64 (2009).

59. Lettice, L.A. et al. A long-range Shh enhancer regulates expression in the developing limb and fin and is associated with preaxial polydactyly. Hum Mol Genet 12, 1725-35 (2003).

60. Schnable, P.S. et al. The B73 maize genome: complexity, diversity, and dynamics. Science 326, 1112-5 (2009).

61. Box, G.E.P. & Cox, D.R. An analysis of transformations. Journal of the Royal Statistical Society Series B 26, 211-252 (1964).

62. Yu, J. et al. A unified mixed-model method for association mapping that accounts for multiple levels of relatedness. Nat Genet 38, 203-8 (2006).

63. Flint-Garcia, S.A. et al. Maize association population: a high-resolution platform for quantitative trait locus dissection. Plant J 44, 1054-64 (2005).


genome-wide association study of leaf architecture in the ... › original › nature-assets › ng...

Documents