genome sequencing and assembly mayo/uiuc summer course in computational biology
TRANSCRIPT
GENOME SEQUENCING AND ASSEMBLY
Mayo/UIUC Summer Course in Computational Biology
Session Outline
Planning a genome sequencing project
Assembly strategies and algorithms
Assessing the quality of the assembly
Assessing the quality of the assemblers
Genome annotation
Genome sequencing
Schematic overview of genome assembly. (a) DNA is collected from the biological sample and sequenced. (b) The output from the sequencer consists of many billions of short, unordered DNA fragments from random positions in the genome. (c) The short fragments are compared with each other to discover how they overlap. (d) The overlap relationships are captured in a large assembly graph shown as nodes representing kmers or reads, with edges drawn between overlapping kmers or reads. (e) The assembly graph is refined to correct errors and simplify into the initial set of contigs, shown as large ovals connected by edges. (f) Finally, mates, markers and other long-range information are used to order and orient the initial contigs into large scaffolds, as shown as thin black lines connecting the initial contigs.Schatz et al. Genome Biology 2012 13:243
Planning a genome sequencing project
How large is my genome?How much of it is repetitive, and what is the repeat size distribution?Is a good quality genome of a related species available?What will be my strategy for performing the assembly?
How large is my genome?
The size of the genome can be estimated from the ploidy of the organism and the DNA content per cellThis will affect:
» How many reads will be required to attain sufficient coverage (typically 10x to 100x)
»What sequencing technology to use»What computational resources will be needed
Repetitive sequences
Most common source of assembly errorsIf sequencing technology produces reads > repeat size, impact is much smallerMost common solution: generate reads or mate pairs with spacing > largest known repeat
Assemblies can collapse around repetitive sequences.
Salzberg S L , and Yorke J A Bioinformatics 2005;21:4320-4321
© The Author 2005. Published by Oxford University Press. All rights reserved. For Permissions, please email: [email protected]
Genome(s) from related species
Preferably of good quality, with large reliable scaffoldsHelp guiding the assembly of the target speciesHelp verifying the completeness of the assemblyCan themselves be improved in some casesBut to be used with caution – can cause errors when architectures are different!
Strategies for assembly
The sequencing approaches and assembly strategies are interdependent!
» E.g., for bacterial genome assembly, can generate PacBio reads and assemble with Celera Assembler, or generate Illumina reads and assemble with Velvet or SPAdes
» Optimal sequencing strategies very different for a SOAPdenovo or an ALLPATHS-LG assembly
Typical sequencing strategies
Bacterial genome:» 2x300 overlapping paired-end reads from Illumina MiSeq machine,
assembly with SPAdes» PacBio CLR sequences at 200x coverage, self-correction and/or hybrid
correction and assembly using Celera Assembler or PBJelly
Vertebrate genome:» Combination paired-end (2x250 nt overlapping fragments) and mate-pair
(1, 3 and 10 kb libraries) 100 nt reads from Illumina machine at 100x coverage (~1B reads for 1 GB genome), assembly with ALLPATHS-LG
Illumina paired end and mate pair sequencing
Additional useful data
Fosmid libraries» End sequencing adds long-range contiguity information» Pooled fosmids (~5000) can often be assembled more efficiently
Moleculo (Illumina TSLR) libraries» Technology acquired by Illumina, allows generation of fully assembled 10
kb sequences
Pacbio reads» Provide 5-8 kb reads, but in most cases need parallel coverage by
Illumina data for error correction
Assembly strategies and algorithms
In all cases, start with cleanup and error correction of raw readsFor long reads (>500 nt), Overlap/Layout/Consensus (OLC) algorithms work bestFor short reads, De Bruijn graph-based assemblers are most widely used
Cleaning up the data
Trim reads with low quality callsRemove short readsCorrect errors:
» Find all distinct k-mers (typically k=15) in input data
» Plot coverage distribution» Correct low-coverage k-mers to match high-
coverage» Part of several assemblers, also stand-alone
Quake or khmer programs
Overlap-layout-consensus
23
Main entity: readRelationship between reads: overlap
12
3
45
6
78
9
1 2 3 4 5 6 7 8 9
1 2 3
1 2 3
1 2 3 12
3
1 3
2
13
2
ACCTGAACCTGAAGCTGAACCAGA
OLC assembly steps
Calculate overlays» Can use BLAST-like method, but finding common k-
mers more efficient
Assemble layout graph, try to simplify graph and remove nodes (reads) – find Hamiltonian pathGenerate consensus from the alignments between reads (overlays)
Some OLC-based assemblers
Celera Assembler with the Best Overlap Graph (CABOG)
» Designed for Sanger sequences, but works with 454 and PacBio reads (with or without error correction)
Newbler, a.k.a. GS de novo Assembler» Designed for 454 sequences, but works with Sanger
reads
De Bruijn graphs - concept
Converting reads to a De Bruijn graph
Reads are 7 nt long
Graph with k=3
Deduced sequence (main branch)
DBG implementation in the Velvet assembler
Examples of DBG-based assemblers
EULER (P. Pevzner), the first assembler to use DBGVelvet (D. Zerbino), a popular choice for small genomesSOAPdenovo (BGI), widely used by BGI, best for relatively unstructured assembliesALLPATHS-LG, probably the most reliable assembler for large genomes (but with strict input requirements)
Repeats often split genome into contigs
Contig derived from unique sequencesReads from multiple repeatscollapse into artefactual contig
Consensus (15- 30Kbp)
Reads
ContigAssembly without pairs results in contigs whose order and orientation are not known.
?
Pairs, especially groups of corroborating ones, link the contigs into scaffolds where the size of gaps is well characterized.
2-pair
Mean & Std.Dev.is known
Scaffold
Pairs Give Order & Orientation
ChromosomeSTS
STS-mapped Scaffolds
Contig
Gap (mean & std. dev. Known)Read pair (mates)
Consensus
Reads (of several haplotypes)
SNPsExternal “Reads”
Anatomy of a WGS Assembly
Assembly gaps
37
sequencing gap - we know the order and orientation of the contigs and have at least one clone spanning the gap
physical gap - no information known about the adjacent contigs, nor about the DNA spanning the gap
Sequencing gaps
Physical gaps
38
Handling repeats
1. Repeat detection» pre-assembly: find fragments that belong to repeats
• statistically (most existing assemblers)• repeat database (RepeatMasker)
» during assembly: detect "tangles" indicative of repeats (Pevzner, Tang, Waterman 2001)
» post-assembly: find repetitive regions and potential mis-assemblies. • Reputer, RepeatMasker• "unhappy" mate-pairs (too close, too far, mis-oriented)
2. Repeat resolution» find DNA fragments belonging to the repeat» determine correct tiling across the repeat» Obtain long reads spanning repeats
How good is my assembly?
How much total sequence is in the assembly relative to estimated genome size?How many pieces, and what is their size distribution?Are the contigs assembled correctly?Are the scaffolds connected in the right order / orientation?How were the repeats handled?Are all the genes I expected in the assembly?
N50: the most common measure of assembly quality
N50 = length of the shortestcontig in a set making up 50%of the total assembly length
Order and orientation of contigs – more errors in one assembly than in another
REAPR overview
REAPR Summary
REAPR is a toolkit that assesses the quality of a genome assembly independently of the assembler, and without needing a “gold” reference assemblyREAPR is not a variant calling tool; it examines the consistency of a genome assembly with the same data that were used to assemble itREAPR output can be visualized in many ways, and helps genome finishing projectsEvery genome assembly project should use REAPR or a similar toolkit to perform quality checks on the assemblies being produced
BUSCO and CEGMA: conserved gene sets
From Ian Korf’s group, UC DavisMapping Core Eukaryotic Genes
From Evgeny Zdobnov’s group,University of Geneva
Coverage is indicative of qualityand completeness of assembly
Even the best genomes are not perfect
There is no such thing as a “perfect” assembler (results from GAGE competition)
The computational demands and effectiveness of assemblers are very different
Assessing assembly strategies
Assemblathon (UC Davis and UC Santa Cruz)» Provide challenging datasets to assemble in open competition (synthetic for
edition 1, real for edition 2)» Assess competitor assemblies by many different metrics» Publish extensive reports
GAGE (U. of Maryland and Johns Hopkins)» Select datasets associated with known high-quality genomes» Run a set of open source assemblers with parameter sweeps on these datasets» Compare the results, publish in scholarly Journals with complete documentation
of parameters
Some advice on running assemblies
Perform parameter sweeps» Use many different values of key parameters, especially k-mer size for DBG
assemblers, and evaluate the output (some assemblers can do this automatically)
Try different subsets of the data» Sometimes libraries are of poor quality and degrade the quality of the assembly» Artefacts in the data (e.g. PCR duplicates, homopolymer runs, …) can also badly
affect output quality
Try more than one assembler» There is no such thing as “the best” assembler
Genome annotation
A genome sequence is useless without annotationThree steps in genome annotation:
» Find features not associated with protein-coding genes (e.g. tRNA, rRNA, snRNA, SINE/LINE, miRNA precursors)
» Build models for protein-coding genes, including exons, coding regions, regulatory regions
» Associate biologically relevant information with the genome features and genes
Methods for genome annotation
Ab initio, i.e. based on sequence alone» INFERNAL/rFAM (RNA genes), miRBase (miRNAs), RepeatMasker
(repeat families), many gene prediction algorithms (e.g. AUGUSTUS, Glimmer, GeneMark, …)
Evidence-based» Require transcriptome data for the target organism (the more the
better)» Align cDNA sequences to assembled genome and generate gene
models: TopHat/Cufflinks, Scripture
Methods for biological annotation
BLAST of gene models against protein databases» Sequence similarity to known proteins
InterProScan of predicted proteins against databases of protein domains (Pfam, Prosite, HAMAP, PANTHER, …)Mapping against Gene Ontology terms (BLAST2GO)
MAKER, integration framework for genome annotation
MAKER runs many software tools on the assembled genome and collates the outputsSee http://gmod.org/wiki/MAKER
Acknowledgements
For this slide deck I “borrowed” figures and slides from many publications, Web pages and presentations by
»M. Schatz, S. Salzberg, K. Bradnam, K. Krampis, D. Zerbino, J. J. Cook, M. Pop, G. Sutton, T. Seemann
Thank you!