fv - the am law daily

I

2

3

4

5

6

7

8

9

10

1l

T2

l3

l4

15

t6

I7

18

t9

20

2t

22

23

24

25

26

21

FVDURIE TANGRI LLPDARALYN J. DURrE (SBN 169825)ddurie @ durietangri. comMARK A. LEMLEY (SBN 155830)mlemley @ durietangri. com2I7 Leidesdorff StreetSan Francisco, CA 94lIlTelephone: 415-362-6666Facsimile: 415-236-6300

Attorneys for PlaintiffsGENENTECH, INC. and CITY OF HOPE

GENENTECH, INC. and CITY OFHOPE,

Plaintiffs,

V.

GLAXO GROUP LIMITED,GLAXOSMITHKLINE LLC, HUMANGENOME SCIENCES, INC.,LONZA BIOLOGICS PLC, andLONZA BIOLOGICS INC.,

Defendants.

APR I 2 20ll

UNITED STATES DISTRICT COURT

CENTRAL DISTRICT OF CALIFORNIA

WESTERN DIVISION

."ff,WÃl ffi306SSVW wÞs

COMPLAINT FOR PATENTINFRINGEMENT ANDDECLARATORY JTJDGMENT OFPATENT INFRINGEMENT

JURY TRIAL DEMAND

COMPL. FOR PATENT INFRINGEMENT AND DECL. J. OF PATENT INFRINCEMENT / Case No.

Case 2:11-cv-03065-SVW -FMO Document 1 Filed 04/12/11 of 81 Page ID #:2

I

2

3

4

5

6

7

8

9

10

l1

t2

13

t4

l5

I6

I7

l8

t9

20

2l

22

23

24

25

26

2l

28

COMPLAINT FOR PATENT INFRINGEMENT

For their Complaint against Defendants Glaxo Group Limited and

GlaxoSmithKline LLC (collectively, "GSK"), Human Genome Sciences, Inc. ("HGS"),

Lonza Biologics plc, and LonzaBiologics Inc. (collectively, "Defendants"), plaintiffs

Genentech, Inc. and City of Hope allege as follows:

PARTIES

1. Plaintiff Genentech, Inc. is a corporation organized under the laws of

Delaware, with its principal place of business in South San Francisco, California.

2. Plaintiff City of Hope is a California not-for-profït organization with its

principal place of business in Duarte, California.

3. Defendant Glaxo Group Limited does business as GlaxoSmithKline, and is

an English corporation having a principal place of business at Glaxo Wellcome House,

Berkley Avenue, Greenford, Middlesex, uB6 ONN, united Kingdom.

4. Defendant GlaxoSmithKline LLC is a Delaware limited liability company

having a principal place of business at One Franklin Plaza, Philadelphia, Pennsylvania

t9102.

5. Defendant Human Genome Sciences, Inc., is a Delaware Corporation

having a principal place of business at 14200 Shady Grove Rd., Rockville, MD.

6. DefendantLonza Biologics plc is a public limited company organized under

the laws of Great Britain having a principal place of busine ss at 228 Bath Road, in

Slough, Berkshire, SLI 4DX, United Kingdom.

7. DefendantLonza Biologics Inc. is a Delaware corporation having a

principal place of business at l0l International Drive in Portsmouth, New Hampshire.

JURISDICTION AND VENUE

8. This action arises under the patent laws of the United States of Americ a,35

U.S.C. $$ I er seq. and under the Declaratory Judgment Act,28 U.S.C. g$ 2201 et seq.

Subject matter jurisdiction is proper pursuant to Title 35 of the United States Code, ç 27l

and ritle 28 of the united states code, gg 1338(a),220lr(a) and 2202.

COMPL. FOR PATENT TNFRINGEMENT AND DECL. I. OP PETPIVTM


I

2

3

4

5

6

7

8

9

10

ilt2

I3

l4

15

1,6

l7

18

t9

20

2I

22

23

24

25

26

27

28

9. This Court has personal jurisdiction over Glaxo Group Limited by virtue of,

inter alia, its having conducted business inside the State of California, including in the

Central District of California, having availed itself of the rights and benefits of California

law, and having systematic and continuous contacts with the State of California,

including with the Central District of California.

10. This Court has personal jurisdiction over GlaxoSmithKline LLC by virtue

of, inter alia,its having conducted business inside the State of California, including the

Central District of California, having availed itself of the rights and benefits of California

law, and, on information and belief, having systematic and continuous contacts with the

State of Califomia, including with the Central District of California.

I l. GSK continuously and systematically markets and sells its products in the

State and in this District.

12. HGS and GSK entered into a co-development and commercialization

agreement for the development, manufacturing, and sale of Benlysta@ lbelimumab). On

information and belief, pursuant to GSK's request and direction, HGS has manufactured

and is currently manufacturing Benlysta@ for GSK in Rockville, MD, for commercial sal

by GSK throughout the United States, including in the State of California and the Central

District of California. On information and belief, on March 9,2011, the U.S. Food and

Drug Administration ("FDA") approved the Biologics License Application for Benlysta@

and GSK and HGS began selling Benlysta@ throughout the United States, including the

State of California and the Central District of California, that is supplied by HGS. On

information and belief, HGS introduces Benlystat into the stream of commerce in the

United States knowing that Benlysta@ will be sold in the State of California, including in

the Central District of California. By virtue of these activities, this Court has personal

jurisdiction over HGS.

13. Lonza Biologics plc and/or one or more of its affiliated companies

developed a commercial process for manufacturing ofatumumab. Pursuant to an

agreement between Lonza Biologics plc (or an affiliated company of Lonza Biologics

2COMPL. FOR PATENT INFRINGEMENT AND DECL. J. OF PATENT INFRINGEMENT / Case No.


I

2

3

4

5

6

7

8

9

l0

1l

I2

l3

I4

t5

l6

17

l8

t9

20

2l

22

23

24

25

26

27

28

ll

plc manufactures ofatumumab in the united Kingdom I

il

il

llOt., and GSK,Lonza Biologics plc manufactures ofatumumab in the United Kingdc

llanO supplies said ofatumumab to GSK, and introduces ofatumumab into the stream of

I

f l.o--ttce while knowing that GSK will and does incorporate ofatumumab inro the final I

ll ntoOu.t ArzerrarM, import Arzenar[ into the United States, and markets, distributes, un¿ I

f f t.ilt ArzerrarM throughout the United States, including in the State of Catifornia and

I

ll witfrin the Central District of California. By virtue of these activities, this Court has I

llp"rronul jurisdiction over LonzaBiologics plc. Iil

ll tO. On information and belief, LonzaBiologics Inc. has imporred cells from I

f f

t-onza Biologics plc and supplied cells to LonzaBiologics plc for use in manufacruring I

llerzerrarM for

luppty to GSK while knowing that GSK will and does imporr ArzerrarM

I

ll,"to the United States, and markets, distributes, and sells ArzerrarM throughout the Unitedl

ll States, including in the State of California and the Central Disrrict of Califo rnia. Lonza

I

I niotoeics Inc. has entered into and performed under contracts with entities in the State of

I

lCumo-ia and, on information and belief, engages in business activities in California, I

lincluding the Central District of California, with and./or through one or more of its I

laffiliated comnanies doing business in California, including the Central District of Il^

I California. By virn¡e of these activities, this Court has personal jurisdiction over Lonza

I

lniotogi.slnc. r J

I

I tt. Venue is proper in this District pursuant ro Tirle 28, United Stares Code, I

lss trnl and 14oo(b). II

I THE CABILLY ilI PATENT I

I tU. On April 12,2011, U.S. Patent No. 7,923 ,2) .l ("theCabilly III parent") *u.

I

I

issued by the PTO, entitled "Methods of Making Antibody Heavy and Light Chains I

Having Specificity for a Desired Antigen." A true and correcr copy of the Cabilly III I

patent is attached herero as Exhibit A. I17. Genentech and COH are the co-own€rs by assignment of the right, title, and I

interest in the Cabilly III parenr I18. GSK has known of the Cabilly III patent and/or its imminenr issue as a I


I

2

3

4

5

6

7

I9

l0

1l

T2

l3

l4

15

16

I7

18

l9

20

2L

22

23

24

25

26

27

28

patent from U.S. Patent Application No. 08/422,187 since at least January 28,201I,

when Genentech and COH filed a Notice of the Notice of Allowance and Fee(s) Due wi

respect to the Cabilly III application in litigation currently pending before this court,

Glaxo Group Ltd. and Glaxosmithklíne LLC v. Genentech, Inc. and City of Hope, Case

No. CV- 10-2764 MRP (FMOx) (the "GSK action").

19. On information and belief, HGS has known of the Cabilly III patent and/or

its imminent issue as a patent from U.S. Patent Application No. 08/422,187 since at least

January 28,2011, by virtue of its monitoring the pleadings in the GSK action, as

evidenced by its reference to the GSK action in pleadings filed in actions in Delaware

related to the Cabilly II patent.

20. On information and belief, LonzaBiologics plc and LonzaBiologics Inc.

have known of the Cabilly III patent and/or its imminent issue as a patent from U.S.

Patent Application No. 081422,187 since at least January 28,2011, when Genentech and

COH moved to add Lonza Biologics plc and LonzaBiologics Inc. as Counter-Defendants

in the G.SK action.

BELIMUMAB, NW ABENLYSTA@

21. Benlysta@ (belimumab) is a recombinantly engineered monoclonal antibody

that purportedly aims to target BlyS. BlyS is a naturally occurring protein required for

the survival and development of B-lymphocyte cells into mature plasma B cells that is

believed to be involved in the mediation of systemic lupus erythematosus. Benlysta@

(belimumab) is indicated for the treatment of adult patients with active autoantibody-

positive, systemic lupus erythematosus who are receiving standard therapy.

22. On information and belief, GSK and HGS began marketing, distributing, a

selling Benlysta@ in the United States, including in the State of California, on or about

March 9,2011, the date that the FDA approved the Biologics License Application for

Benlysta@. On information and belief, GSK began offering for sale and selling Benlysta@

made by HGS for GSK in the United States, including in the State of California.

23. On information and belief, HGS has made and makes and/or has used and/1r

COMPL. FOR PATENT INFRINGEMENT AND DECL. J. OF PATENT INFRINGEMENT / Case No.


I

2

3

4

5

6

1

8

9

l0

11

t2

I3

t4

15

16

17

18

t9

20

2t

22

23

24

25

26

27

28

uses recombinant host cells for use in manufacturing Benlysta@ (belimumab) and has

supplied or supplies Benlystat lbelimumab) to GSK for commercial sale.

24. On information and belief, GSK and HGS offer for sale and sell Benlysta@

in the United States, including in the State of California, that is made by HGS.

OFATUMUMAB, NW A ARZERRATM

25. GSK is marketing and selling a human monoclonal antibody, ofatumumab,

under the name ArzerrarM. ArzenarM purportedly aims to target CD20, a naturally

occurring protein present on B- lymphocytes, which is believed to be involved in the

mediation of lymphoproliferative and autoimmune diseases.

26. On information and belief, ArzerrarM is the 2F2 monoclonal antibody

produced in a recombinant murine cell line that is described in the World Intellectual

Property Organization patent application publication number WO 2004/035607.

27. On October 26,2009, the United States Food & Drug Administration issued

Department of Health and Human Services U.S. License No. 1809 to GSK, authorizing

GSK to market fuzerrarM with an indication for the treatment of chronic lymphocytic

leukemia refractory to fludarabine and alemtuzumab, allowing GSK to manufacture

ArzerrarM, market it in the United States, and introduce it into interstate commerce inside

the United States.

28. GSK is actively marketing ArzerrarM in the United States.

29. GSK or its agents have and/or are importing ArzerrarM into the United

States from the United Kingdom, where ofatumumab is manufactured by Lonza

Biologics plc for GSK and where the final ArzerrarM product is manufactured, fTlled,

labeled, and packaged by a GSK affiliate.

30. GSK is selling and offering for sale ArzerrarM in the United States.

31. Lonza Biologics plc supplies ofatumumab to GSK knowing that GSK will

and does import ArzerrarM containingLonza Biologics plc-made ofatumumab into the

United States and GSK will and does market, distribute, and sell ArzenarM throughout



I

2

3

4

5

6

7

8

9

l0

llt2

13

t4

l5

t6

t7

18

l9

20

2t

22

23

24

25

26

27

28

the United States, including in the State of California.

32. On information and belief, Lonza Biologics plc supplies cells from Lonza

Biologics plc's working cell bank to its affiliate Lonza Biologics Inc., located in

Portsmouth, New Hampshire, where Lonza Biologics Inc. maintains such cells and

supplies LonzaBiologics plc with cells for making ofatumumab for GSK.

COUNT I(Infringement and Declaratory Judgment of Infringement of

The Cabilly III Patent by GSK and HGS)

33. Genentech and COH incorporate the allegations in Paragraphs I - 32 as iffully set forth herein.

34. By manufacturing Benlysta@ in the United States to offer for sale and sell,

and offering for sale and selling Benlysta@ throughout the United States, HGS has

infringed, is infringing, and/or will infringe, one or more claims of the Cabilly III patent,

literally and/or under the doctrine of equivalents.

35. By causing HGS to manufacture Benlysta@, including manufacturing and/or

using the cells used to manufacture Benlysta@, for supply to GSK for commercial sale

throughout the United States, and by offering to sell and selling Benlysta@ throughout the

United States, GSK has actively induced, is actively inducing, and/or will actively induce

the infringement of, and infringes and will infringe, one or more claims of the Cabilly III

patent, literally and/or under the doctrine of equivalents.

36. GSK and HGS' infringement and active inducement of infringement have

caused and will cause damage to Genentech and COH, and Genentech and COH are

entitled to recover from GSK and HGS the damages sustained by Genentech and COH as

a result of GSK and HGS' wrongful acts in an amount subject to proof at trial, but not

less than a reasonable royalty.

37. GSK and HGS' infringement and active inducement of infringement have

caused Genentech and COH to suffer irreparable harm for which there is no adequate

remedy at law. This harm will continue unless and until GSK and HGS' infringement

6



I

2

3

4

5

6

7

8

9

10

llt2

l3

I4

15

16

t7

18

t9

20

2l

22

23

24

25

26

27

28

and active inducement of infringement are enjoined by this Court.

COUNT II(Infringement and Declaratory Judgment of Infringement of The Cabilly III Patent

by GSK, Lonza Biologics Inc., and Lonza Biologics plc)

38. Genentech and COH incorporate the allegations in Paragraphs I - 37 as iffully set forth herein.

39. By making, having made, marketing, preparing to sell, offering to sell, and

selling fu'zerrarM in the United States, importing ArzerrarM into the United States, and

contracting with Lonza Biologics plc and/or one or more of its affiliated companies, to

manufacture and supply ofatumumab intended for sale in and/or importation into the

United States as the ArzenarM product, GSK has infringed, is infringing, and/or will

infringe one or more claims of the Cabilly III patent, literally and/or under the doctrine

equivalents.

40. By manufacturing and supplying ofatumumab to GSK in the United

Kingdom, knowing that GSK will and does imporr ArzenarM into the United States and

will and does market, distribute, and sell ArzerrarM throughout the United States, Lonza

Biologics plc has actively induced, is actively inducing, and/or will actively induce the

infringement of one or more claims of the Cabilly III patent, literally and/or under the

doctrine of equivalents.

41. By supplying cells capable of producing ArzerrarM to its affîliate in the

United States, Lonza Biologics Inc., Lonza Biologics plc has actively induced, is actively

inducing, and/or will actively induce the infringement of one or more claims of the

Cabilly III patent, literally and/or under the doctrine of equivalents.

42. By maintaining cells in Portsmouth, New Hampshire, capable of making the

ofatumumab contained in ArzenarM, and thereby using and/or making such cells, and

supplying said cells toLonza Biologics plc, Lonza Biologics Inc. has infringed, is

infringing, and/or will infringe, and has actively induced, is actively inducing, and/or will

actively induce the infringement of one or more claims of the Cabilly III patent, literally7


I

2

3

4

5

6

7

I9

10

llI2

13

l4

15

I6

r7

l8

t9

20

2l

22

23

24

25

26

27

28

and/or under the doctrine of equivalents.

43. GSK's, Lonza Biologics plc's and Lonza Biologics Inc.'s infringement and

active inducement of infringement have caused damage to Genentech and COH, and

Genentech and COH are entitled to recover from GSK, Lonza Biologics plc and Lonza

Biologics Inc. the damages sustained by Genentech and COH as a result of GSK's, Lon

Biologics plc's and Lonza Biologics Inc.'s wrongful acts in an amount subject to proof at

trial, but not less than a reasonable royalty.

44. GSK's, Lonza Biologics plc's and Lonza Biologics Inc.'s infringement and

active inducement of infringement have caused Genentech and COH to suffer irreparable

harm for which there is no adequate remedy at law. This harm will continue unless and

until GSK's, Lonza Biologics plc's andLonza Biologics Inc.'s infringement and active

inducement of infringement are enjoined by this Court.

PRAYER FOR RELIEF

WHEREFORE, Genentech and COH request that judgment be entered in favor of

Genentech and COH on Counts I and II and against Defendants GSK, HGS, Lonza

Biologics plc and Lonza Biologics Inc.:

1. Finding GSK has infringed and actively induced the infringement of the

Cabilly III patent;

2. Finding HGS has infringed the Cabilly III patent;

3. Finding Lonza Biologics plc has actively induced the infringement of the

Cabilly III patent;

4. Finding Lonza Biologics Inc. has infringed and actively induced the

infringement of the Cabilly III patent;

5. Finding Defendants will in the future infringe and actively induce the

infringement of the Cabilly III patent;

6. Ordering Defendants to account for and pay to Genentech and COH all

damages caused by their infringement and active inducement of infringement of the



I

)

3

4

5

6

7

8

9

l0

llT2

t3

T4

15

16

T7

18

r9

20

2t

22

23

24

25

26

2l

28

Cabilly III patent;

7 . Ordering an award of Genentech and COH's costs and expenses for this

action, pre- and post-judgment interest on any money damages award, and other charges

to the maximum extent permitted;

8. If appropriate, taking into account the interests of patients, ordering a

perrnanent injunction, prohibiting Defendants, their officers, agents, servants, employees,

attorneys, all parent, subsidiary and affiliate corporations and other business entities, and

all other persons or entities acting in concert, participation or in privity with them, and

their successors and assigns from infringing, and actively inducing the infringement of,

the Cabilly III patent; and

9. Ordering such other future relief as the Court deems just and proper under

the circumstances.

JURY TRIAL DEMAND

Pursuant to Federal Rule of Civil Procedure 38, Genentech and COH demand trial

by jury of all issues so triable.

Dated: April l2,20tt Respectfully S ubmitted,

DURIE TANGRI LLP

Ða.,ìddurie @ durietangri.com

DURIE TANGRI LLP217 Leidesdorff StreetSan Francisco, CA 94lllTelephone: 415-362-6666Facsimile: 415-236-6300

Attorneys for PlaintiffsGENENTECH, INC. and CITY OF HOPE



I

2

3

4

5

6

7

8

9

l0

lll2

l3

I4

l5

T6

t7

l8

t9

20

2t

22

23

24

25

26

27

28

Of Counsel:

PAUL, WEISS, RIFKIND, WHARTON& GARRISON LLP

KENNETH A. [email protected]. Street, NV/Washington, DC 20006Telephone: 202-223-7300Facsimile: 202-223-7 420

JOHN E. NATHANjnathan @ paulweiss.com1285 Avenue of the AmericasNew York, NY 10019-6064Telephone: 212-373-3000Facsimile: 212-7 57 -3990

l0COMPL. FOR PATENT INFRINGEMENT AND DECL. J. OF PATENT INFRINGEMENT / Case Nò.


(rÐ United States PatentCabilly et al.

ffil| illlllt lil lllll llll lllll lllll ilil| llll lllll lllll lilll llll llll llllus00792322181

qro; Patent No.: AS7r923,22lBlqa¡ Date of Patenü *Apr. l2,20tl

(54) METHODS OF MÁ,KINGAÀITIBODY HEAVYAI\D LIGHT CHAINS IIÁVING SPECIFTCTTYFORA DESIRED.AI\TIGEN

(75) laventors: Shmuel Cabilly, Monrovia, CA (US);Herbert L. Heyneker, Burlingame, CA(lJS); William E. Holmes, Pacifica, CA(JS); Arthur D.Riggs, LaVerne, CA(JS); Ronald B. Wetzel, San Francisco,cA (us)

(73) Assignees: Genentech, Inc, South San Francisco,CA (US); City of Hope, Duarte, CA(US)

( * ) Notice: Subject to any disclaimer, the term of thispatent is extended or adjusted under 35U.S.C. ls4(b) by 0 days.

This patent is subject to a terminal dis-claimer.

(21) Appl. No.: 081422,187

(22) Filed: Apr.13,1995

Related U.S.,A,pplication Data

(63) Continuation ofapplication No. 07i205,419, filed onJun. 10, 1988, now Pat. No. 6,331,415, which is acontinuation of application No. 06/483,457, ûled onApr. 8, 1983, now Pat. No. 4,816,567.

(51) tnt. cl.c12N 15/13c12N 15/00cI2N 15/63

(2006.0r)(2006.01)(2006.01)

(s2) U.S. Cl. 435t69.6;435/252.1;4351252.3;435/252.33; 435/254.11; 4351254.21.; 4351 69.1 ;

435169.7 ; 43517 o.7 ; 435/7 0.21.; 435/7 l.l;4351320.1; 435/455; 4351 483; 4351 485; 4351 440;

4351433;4351438

(58) Field of Classification Search 435169.6,435/ 69.1, 325, 252.3; 530/387 .3

See application file for complete search history.

(56) References Cited

U.S. PATENTDOCUMENTS

4,179,337 A. l2ll979 Davis4,224,4M A 9/1980 Vizaetal.4,237,224 L l2l1980 Cohen4,33E,397 A 7/1982 Gilb€rt4,342,832 A, 8/1982 Goeddeletal.4,348,376 A 9/1982 Goldenberg4,366,246 A l2l1982 Riggs4,370,417 A l/1983 Hung4,399,216 A 8/1983 Axeletal.4,403,036 A 9/1983 llartley4,418,149 A, ll/1983 Ptashneetal.4,419,446 A l2l1983 Howleyetal.4,431,740 A 2i1984 Belletal.4,440,859

^ 4/1984 Rutter et al.

4,44,818 A 4/1984 Paulusetal.4,495,280 A, l/1985 Bujardetal.4,500,637 A 21985 Neville, J¡. et aI.4,510,244 A 411985 Parksetal,4,511,502 A 4/1985 Builde¡etal.

4,512,922 A 4/1985 Jonesetal.4,518,584 A 5/1985 Ma¡k4,565,785 A l/1986 Gilbertetal.4,599,197 A 711986 Weirzel4,634,665 A l/1987 Axeletal.4,642,334 A 2/1987 Moo¡eetal.4,668,629 A 5/1987 Kaplan4,7M362 A I l/198? Itakura et al.4,713,339 A l2il1987 Levinson et al.4,766,075 A 8/1988 Goeddeletal.4,792,447 A l2l1988 Ub¡etal.4,816,397 A * 3/1989 BossetaL ...................... 435/684,816,567 A 3/1989 Cabillyetal.4,965,196 A 10/1990 Lwinsonetal.5,081,235 A lll992 Shivelyetal.5,098,833 A 31t992 Laslcyetal.5,116,964 A 5/1992 Capotetal5,131,721 A 8/1992 Dallas5,149,636

^ 9/1992 Axeletal.

5,179,017 A l/1993 Axeletal.5,225,538 A 711993 Capond.al.5,225,539 A 7/1993 Wìnter5,336,603 .4, 8/1994 Caponetal.5,420,020 A 5/1995 Riggs5,428,130 A 6/1995 Caponetal.5,455,165 A 10/1995 Caponetal.5,500,362 L 3/1996 Robinsonetal.5,514,582 A 5/1996 Caponetal.5,545,403 A, 8/1996 Page5,545,4M A 8/1996 Page

(Continued)

FOREIGN PATENT DOCUMENTS

AU 194982 2/1983

(Continued)

OTHER PIJBLICATIONS

Gillis, S.D. & J.S. Wesolowski 1990 Hum. Antibod, HþridomasI(l):47-54.*Owens, R.J. & R.J.Young 1994 Journal of Immunological Methods

168:149-165.tSker¡a et al 1988 Science 240: I038-lMl.*Better et al. 1989 Methods EnrBol178:476496.+Taylor et al 1988 Mol Cell Biol 8(10):41974203.4Letïerbar¡ow 1985 Midec. Immuno (22(4): 4O1-415.rRaghunathan et al 1996 Prog. Biophy. &Mol. Biol. 65(5): 143.*Wright et al 1991 EMBO J. 10(10):2717-2723.4Bucbner et al l99l Bio/Technology9:t57-162.*Mo¡¡ison et al Adv. lmmunol. (1989).*Horowitz et al. PNAS, (1988).+

Sker¡s et al Protein Engineering, (1991).8

(Continued)

Prímary Examiner -Ph)lhp

Gambel

Q4) Àttorney, Agent, or Firm - SidleyAustin LLP

(s7) ABSTRACT

The invention relates to processes for producing ¿¡ immrrns-globulin or an immunologically functional immunoglobulinfragment çe¡¿ining at least the variable domains of theimmunoglobulin heavy and light chains. The processes canuse one or more vectors which p¡oduce both the heavy andlight chains or fiagments thereef i¡ ¿ single cell. The inven-tion also relates to the vecton used to produce the immuno-globulin or fiãgment, and to cells tnnsformed with the vec-tors.

47 Claims, 1.9 Drawing Sheets


as7,923,221BlPage2

AUAUAUAUEPEPEP'EPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPGBGBGBGBGBJPwowo

U.S. PATENT DOCUMENTS

5,545,405 A 8/1996 Page5,561,053 A 10i1996 Crowþ5,583,013 A 1211996 Itaku¡aetal.5,585,089 A l2il996 Queenetal.5,605,689 A 211997 Ammznn5,612,185 A 3/1997 lJtuetal5,648,237

^ 'l/1997 C¿rtet

5,686,072 A 1lll997 l-Ituetal.5,721,108 A 2/1998 Robi¡sonetal.5,'136,137

^ 4/1998 Andersonetal.

5,807,715 A 9/1998 Mor¡isonetal.5,840,545 A 1ll1998 Moore et al.5,846,818 A l2l1998 Robinsonetal.5,877,293 A 3/1999 Adair et al.5,965,405 A 10/1999 Winteretal.5,997,867 A l2l1999 Waldmmet¿I.6,054,297 A 4/2000 Cafer et al.6,054,561 A 4i2000 Ring6,120,767 A 9i2000 Robi¡sonetal.6,204,023 Bl 3i2001 Robi¡sonetal.6,331,415 Bl4 12/2001 Cabillyetal.6,455,275 Bl 912002 Axeletal6,548,640 Bl 4/2003 Winte¡6,979,556 B2 12i2005 Simmonsetal.

FOREIGN PATENT DOCUMENTS

124t7/83 9/1983B-26429/U 10/1984

46556185 3/19866s98V86 5/1987

37123 10/1981037723 10/1981041313 l2ll98l41313 tzlßAl4l't67 r2/r981

041't67 l2lßa1044722 l/t98255945 71t982s'n07 8/1982

057107 811982060057 9/1982068763 l/198368763 l/1983

073656 3/198373656 3/t98375444 3/t983

075444 3/t983A.073656 3/t983

88994 9/1983093619 ltl1983102634 3lr98/.

0 t20694 tlltgu120694 10/1984

0 125 023 Bl tt/tg8r'.t25023 Bt llllg8r'.

0L7t 496 2/1986t'73494 3/1986t77343 4/1986194276 9/1986196864 10/1986234592 9/1987255694 2/t98836776 5/1988

324t62 7/1989il4506 il/1989

0365997 5n990088994 6lt99l550400 7/1993481790 Br 211999

2068969 8/19818308235 3/19838422238 9/19849022543 1l/1990

08235 s/200062201 58r 9/t987

woSl/02426 9lt98lwo 8203088 911982

wowowowowowowowowowowoZA

wo 83/00164 l/1983wo 86/01533 3/t986wo87102671 5/1987wo 89i00999 2/1989wo 89/01783 3/1989wo 9216553 r0ll992wo 93/07899 41t993wo 93/10817 611993wo 93/21319 l0ll993

9429351 4 t2/1994wo 97130087 811997

8809711 6/1988

OTHERPIJBLICATIONS"lmrnunoglobulin molecules and genes" Microbiologt IncludingImmunologt and Molecølar Genetics, Third edition, Ha4rer lnterna-tional Editio¡ vol. Chapter l7:338-379.Accollaet al., "Monoclonal antibodies speciûc for carcinoembryonica-ntigen and produced by two hybrid celllnes" Proc. Natl. Acad. Sci.USA 7 7 (I): 563 -566 ( 1980).Ad¿ms et a.1., "Molecular cloning of mouse immunoglobulin heavychain messenger ribonucleic acids co¡ling for ¡¿ o, yl, '¡2a, an,d'¡3

chains" Biochemistry 19 :27 ll-27 19 (1980).

Amster et al., "Synthesis of part of a mouse immunoglobulin lightchain in ¿ bacteri zl clone" Nucl. Acrds Res. 8(10):2055-2065 (1980).

Boss.a¡d Emtage, "Expression of an immunoglobulin light chaingeae in Escherichia coli" Gene Expression-Proc. Cetus-UCLA

Symposium pp. 513-522 (Maî 26, 1983).

Boss md Wood, "Genetically engineered aúibodies" ImmunologtToday 6 (L): l2-r3 (r98s).Colmm md Morser, "Export of proteins ûom oæytes of XenopusIaevis" Cell l7:517 -526 (1979).

Colmaa et al., "lnte¡actions of mouse immunoglobuli¡ chains withinXenopus oocytes" J. Mol. Biol. 16O:459474 (1982).

Cowan et al., "I¡tracellular immunoglobulin chail syntlesis in non-secreting va¡ia¡ts of a nouse myeloma: detection of inactive light-chain nessenger RNA" I Mol. Biol.90:691-701 (1974\.De Boer et al ., "Construction of a tandem þ-lac promoter and a

hybrid þ-lac promoter fo¡ efficient and contolled er<pression of thehuman growth hormone gene ia Escherichia coli " Promoters, Struc-Íure and Futtction (Praeger Pr¡blishe¡s, R. Rodriguez and M.Chamberline, eds .) pp. a62481 (1982).Deacon and Eb¡inger, "Atrtibody syntleús in Xenopus oocytes wirimessenger ribonucleic acid from immunizødrats" Biochem. SocietyTransectiotts 4(4):8 l8-820 (1976).Dolby et al., "Cloning and partial ¡ucleotide sequence of humanimmunoglobulin p chain cDNA from B cells a¡d mouse-hum¿¡hybridomas" Proc. Natl. Acad. Sci. USA 77 (10):6027 -6031 (1980).Eisen, "Antibody Structu¡e: The immunoglobulins" lmmønologt, AnIntrodrction lo Molecular and Cellular Principles of the ImmuneResponses, Second edition, Harper & Roq Publishers, Inc. pp. 415nd427436 (1974).Falkne¡ a¡dZachau, "Expression of mouse immunoglobulin gones inmonkey cells" try'ature 298:286-288 (1982).Fujisawa etal., "Direct expression ofhepatitis B surface antigen gene

in E. coli" Nucl. Acids Res. ll(ll):3581-3591 (1983).Glen-nie and Stwenson, *Univalent antibodies kill tumour cells invitro and in vivo" (1982) Nature 295:7 l2-7 14 (1982).

Gough et aI., "Molecular cloning of seven mouse im¡nunoglobulin rchain messenger ¡ibonucleic ¿cids" Biochemistry 19:.2702-2710(1e80).Gough, N., '"The rearrangements of immunoglobulil genes" 77BS

6(8):203-20s (1981),Haley et al., "Porcine Relaxin: Molecular Cloning and cDNA Struc-Erre" DNA l(2):155-162 (1982).Hawley et al., "Mutant immunoglohrlin genes bave repetitive DNAelements i¡sertedinto thei¡ i¡terveniug sequences"Proc. Natl. Acad.Sci. USA 7 9 :7 42s -7 429 (1982).HiEema¡ et al., "Secretion of human interferons by ya,sf' Science2r9:620-625 (1983).Hozumi et al., "Characterization of amouse DNA clone containingan immunoglobuli¡ va¡iable region gene".iVøcl. Acids Res. (\/Ian-maliar BiocTem (89:87928t) ( 1978)) 5(6):1779 -1799.


as7,923,221BlPage 3

Iserentant and Fiers, "Secondary st¡ucture of nRNA a.od efficiencyof translation i¡itiation" Gene 9:1 -12 (198O).

Kadonaga et al., "The role oftle Blactamase signal sequence in tlesecrdion of proteins by Escherichia coli" Journal of BiologicalC h e m i sIry 259 (4):2 149 -2 I s4 (t984).Kemp and Cowma¡, "Di¡ect Immunoassay for detecting Escherichiacoü colonies tlat s6¡t¡in polypetides encoded by cloned DNA seg-

ments" Proc. Natl. Acad. Sci.78Q):A5204524 (1981).

Kemp et al., "Processing of immunoglobulin heavy chain gene tral-scipts" Manipulation and Expression of Genes in Eukøryotes (Pro-ceedilgs ofan lnternational Co¡fe¡ence, held in conjunction with the12th ) pp. 33-39 (1983).Keshet et al., "Cloning of Bovine G¡owtl Ho¡mone Gene a¡d ItsExpression in Bacteria" Nucleic Acids Research 9(l): l9-30 (198 1).

Klein et al., "Expression of biological effector fi¡nctiors byimmunoglobulin G molecules lacking the hinge rcgìon" Proc. Natl.Acad. Sci. USA 7 8(l):524 -528 ( 198 l).Kohler et al., "Fusio¡ between immunoglobulin-secreting aodnonsecreting myeloma cell lnes" European Journ al of Immunologt6:292-29s (1976).Kohler, G., "Immunoglobulin chain loss in hybridorna lines" Proc.Natl. Acad. Sci. USA17(4):2197-2199 (1980).

Levy and Dilley, "Rescue of immunoglobin secretion f¡om huma¡neoplastic lymphoid cells by somatic cell hybrid¡nation" Proc. Natl'Acad. Sci. USA 75(5):2411-2415 (1978).Lewin, 8., "The extraordilary power of DNA tæhnologf' Genes,

Third edition, John Wiley & Sons pp. 359-360 (1987).Ma¡iatis, T., 'Molecular Cloning" ,4 Laboratory Manual pp.433(Cold Sprirg Harbor L l9E2).Mercereau-Puijalon et al., "Expression of cloned eukaryotic genes inmicroorga::isms" Expression of Euløryotic Wral & Cellulat Genes,

Patterson et al. (eds.) pp 295-303 (1980).Mo¡rison and Scharff, "Heavy chain-producing variants of a mousemyeloma cell lin€' J. Immunol. I 14(2):655-659 (1975).

Morrison, J., "sequentially derivedmul¡¡ts of the consønt region ofthe heavy chain of murine irnmunoglobuli¡s" J- of Immunologtr23 (2):7 93 -8oo (r97 9).Mosma¡n and Baumal, "Synthesis but not sec¡etion of J chain byvariant mouse myeloma cells which lose cr-chain-synthesizing abil-itf' J. Immunol. 115(4):955-962 (1975).Mosma¡n and Williamson, "Structu¡al mutations in a mouseimmunoglobulin light chain resulting in failure to be særcte{' Cell20:283-292 (1980).Nisonoffand Rivers; "Recombination of a mixtu¡e of univalent a¡ti-body fragrnerts of different specificir$' Archives of Biochemislry &B iop hys i cs 93 :460 462 (19 6 l).Ochi et al., "Transfer of a cloned immunoglobulin light-chai¡ gene tomutant hybridoma cells restores specific antibody production"Nature 302:340 -342 (1983).Ohsuye et al., "Expression of chemically synthesized d-neo-endorphin genefused to E. coli alkaline phosphatase" Nucl. AcidsRes. I l(5): I 283-1294 (1983).Oi et al . , "lmmunoglobulin gene exprossion in t¡ansformed lymphoidcells" Proc. Natl. Acad. Sci. USA 80:825-829 (1983).

Pica¡d and Sch¡fÊre¡, "Co¡rect tramcription of a cloned mouseimmunoglobulin gene in vivo" Proc. Nø|. Acad. Sci. USA 80:41?-421 (1983).R¿so and Griffir, 'Hybrid antibodies with dual specificity for thedelivery of ricin to immunoglobulin-bearing targel cells" CancerResearch 4 I :2O73-2078 (1981).Rice and Baltimore, "Regulated expression of a¡ immunoglobulin xgene introduced into a mouse lymphoid cell line" Proc. Natl. Acad-Sci. USA 79:7862-186s (1982).Roberts, TM, "A lac Promoter Systern for tle Overo<pression ofProkaryotic and Eukaryotic Ge¡es in -8. coli" Promoters: Stntclureand Function,Rodriguez & Chamberlin (eds.), Praeger Scientiûc pp.4s246t (1982).Robertson, M., 'Chopping and changing in immunoglobuli-n genes"Neare 287 :390 -392 ( I 980).Seidma¡ et al., "Immunoglohrlin light-chain stuchual gene

sequences cloned in a bacterial plasmit' Nature27 1i582-585 (1978).Sker¡a and Pluclcthun, "Assemby of a ñrnctional immunoglobuli¡ F"fragmert in.Esclrerichia coli" Science 240: l038-l04l (1998).

Stevens a¡d Williamson, "T¡anslational Control of ImmunoglobulinSynthesis; IL Cell-free i¡teraction of myeloma immunoglobulin withmRNA" J Mol. Biol. 78:5t7 -525 (t973).Tagunichi et al., "Expression ofthe human frbroblast interferon gene

ir Escherichia coli" Proc. Natl. Acad. Sci. USA 77 (9) :5230'5233(1e80).

V¿lle et al., "Anti-ovalbumi¡ monoclonal antibodies inte¡act withtleir antigen in intem¿l metnbtanes of Xenopus oocytes" Natwe300:7 t-'14 (t982).Valle èt al., "synthesis and secretion of mouse immunoglobulinchainsftomXmopus oocytes" Nat u'e 291 :338-340 (1981).

Wetzel et al., "Expression in Eschqichia coli of a chemically syn-

thesized gene for a 'lnini-C" analog of human proinzulin" Geze

l6:63-71 (1981).

Wilde and Milstein, "A¡alysis of immunoglobulin, ch¡in sec¡etion

using hybrid myelomas" European Journal of Immwtologt I0 :462'467 (1980).

Williams et al., "Cytoplasmic inclusion bodies in Escherichia coliproducing biosynthetic huma¡ insr¡li¡ proteins" Science 215:687-68e (re82).Adelman et at., "l¡ viEo deletional mutagenesis forbacterial p¡oduc-

tion oftle 20,000dalton fo¡m ofhuma¡ pihritary gror+th hormone"DNA 2 (3) : I 83-193 (1983).Adetugbo, K., "Sp,onta¡eous somâtic Mutations" Jø¡rnal ofB iologi-cal Chemistry253 (17) :6-76-6080 (1978).

Alt et al., 'Activity of Multiple Light Chain Genes in Mu¡ineMyeloma Cells Producing a Single, Function¿l Li$t Chatf' Cell2l :i-12 (Aug. 1980)..Alt et al., "Joining of immunoglobulin heavy cbain gene segments:Implications from a cb¡omosome with er¡ide¡ce of ttrree D-J¡tfllsions" Pro¿. Natl. Acad. Sci. USA 79 :41184122 (Jul. 1982).

Alt et al., "Multiple Immounoglobulin Heavy-Chain Gene Tran-scrþts in Abelson Murine Leukemia Virus-Transformed L¡'nT.phoid

Cell Lines" Molecular & Cellular Biologt 2 (a) :386a00 (Apr.1982).Att et al., "Orgarization and Reorganization of lmmunoglobulinGenes i¡ A-MulV-T¡ansfonned Cells: Rearrangement of Heavy butNot Light Chain Genes" Cell27 :381-390 (Dec' l98l).Altenburger et aI ., "Fr¡nction and non-fu¡ctional joining inimrnunoglobulin light chail genes of a mouse myelomi' Nature287:603-607 (Oct. 16, 1980).Amzel and Poljak, "Three-dimensional structure ofimmunoglobulins" Ann. Reu Biochem' 48 :961-967 (1979)'Astaldi et al., "lnc¡ease of hybridom¿ form¿tion by human lympho-cles after stimulation in vibo; effect ofantigen, endotheüal cells,

a¡d PWM" I 1¡¡¿ munol. 12\6) :2539-2542 (1982).

August, "MonoclonalAntibodies-I: Discussion" Cel/ Fusion : Gene

Transfer and Transformation, Beers et al. pp. 345-351 (19&l).Bamett-Foste¡ and Painte¡, "The inte¡action ofthe Facb fragrrentwith ¡abbit a¡ti-sheep red cell IgGwith guineapigrnacrophages, andhumaû monocytes ald granulocytes" Molecular Immunologt 19

(2) :247 -2s2 (1982).Bernard and Gough, "1.{ucleotide sequence of immunoglobulinheavy chain joining segments between tlanslocated Vr and p con-5r¡nt ¡sgi6¡ geres" Proc. Natl. Acad. Sci. USA 77(6) :3630'3634(1e80).Bernard et al., "Plasmac¡rtornas with more tha¡ one immunoglobulinK nRNA: Implications for allelic exclusion" Proc. Nail. Åcad. Sci.USA 18(9) :5812-58 16 (Sep. l98l).Bemstein et al., "Monoclon¡l Antibody Therapy of Mouse Leuke-mja" Monoclonal Antibodies, Kennett et al., Plenum Press prp. 275-2el (1e80).Better et al.,"Escherichia coli secretion of an active chime¡ic anti-body fragnenf'Science 240 : l04t-1043 (198E).

Beva¡ et al., "Biosynthesis of immuloglobulits" Progress in Bio-physics and Molecular Biologt, Butle¡ and Noble, Pergamon Press

pp. 133-162 (1972).Bi¡shtei¡ et al., "Effects of immunoglobulin structure on Fc receptorbi¡.ling: a mouse myeloma variant irnmunoglobulin with al2b-l2ahybrid heavy chain having a complete y2a Fc region fails to bind to

12a Fc teceptors on mouse macrophages" J. Immunol.129(2) :610'614 (1982).


us7,923,221BlPage 4

Blyúrm¿n et al., "Immunotoxins: hybrid molecules of monoclonala¡tibodies and ¿ toxin subulit specifically kill tumou cells" ¡ú¿ltire

290 :t45-r46 (1981).

Bobrzeck¿ et al., "The method ofcontrolled rearrangement ofproteindisulphides ald its us for synthesis of chimeric immuoglobulin G"Immunologt Letters 2 : l5l-155 (1980).

Bock et al., "Cloning and expression of the cDNA fo¡ huma¡a¡tith¡ombi¡ III' Nucleic Acids Research l0Q4) :8t13-81 25 (1982).

Bock et ¿1., "Hybridization-selected Ea¡slâtion of Bombyx morihigh-cysteine chorion proteins h Xenopus laevis ooqttes" Proc.

Natl. Acad. Sci. USA 79 :1032-1036 (1982).

Boss et al., 'Assembly of frrnctional a¡tibodies fromimmunoglobulin heavy and light chains synthesised in E. coli"Nucleic Acids Research 12(9):3791 -3806 ( 1984).Boss et al., "P¡oduction of immunoglobulinmolecul es in Escherichiacoli" J. Cell. Biochem. (Abstract Only) Supplement 7A:140 (0364)(re83).Bothwell et al., "Dual expression of À genes in the MOPC-315plasmacytoma" ly'a ture 290:65-61 (1981).

Bothwell et al., "Heavy chain variable region contribution to the NPðfamily of antibodies: somatic mutation evident in a 12a variable

rcgion" Cell 24 :625-637 (1981).Bothwell et al., "Somatic variants ofmurine immunoglobulin a lightchatns" Nature 298 :380-382 (Jul. 22, 1982).

S6¡li¡nn6 sf al., "Theproduction ofchimeric mouse/human antibod-ies" Abstracts ofpaperc presanled at the meeting on Cellular andMolecular Biologt ofNeoplasia (Abstract only) pp. #25 (1983).

Bouli¡nne et al ., "P¡oduction of functio¡¿l chim¿e¡ic mouse{huma¡antibody" Nature 312 :643-646 (1984).Boyd et al., ' Human monoclonal antibodies--aroduction and poten-tial Tiends in Biotechnolog)2(3):70-71 Q98\.Boylston et al., "Production ofhuman IgM anti-D in tissue cultue byEB-virus-transformed lymphorytes" Scand. J. Immunol. 12:355-358(1e80).Bruggemann et al., 'lmmuoglobulinV region variants in hybridomacells. I. Isolation of a va¡ia¡t with altered idiotypic and antigenbirding specificity" EMBO Journel l(5):629-6u (1982).

Burrows et al., "Evidence that mu¡ine pre-B cells synthesise o heavychains but no light chai¡s" Nature 280:838-84 I (Aug. 30, 1979).Cabilly et al., "Generation ofantibodyactivþ from immunoglobulinpolypeptide chains produced in Escåerichia coli" Proc- Natl. Acad.Sci. USA 8l:3273-3277 (1984).Chaag et al., "Construction a¡d characteriz¿rjon of amplifiablemulticopy DNA cloning vehicles derived from the Pl5A crpticmi-niplasmid' J B acte r iol. 134(3 ): I 14 t - I I 56 ( I 978).Choi et ¿1., 'RNA splicing generates a va¡iant light chain from araberraatly rearrangedr gene" Nature 286:776-179 (Aug. 2 l, 1980).Coffino and Laskov, "Immunoglobulin production: method for quan-titatively detecthg vadant myeloma cells'' Science 167:186-188(re70).Coffi¡o et al., "Suppression of Immunoglobtrlin S¡mthesis by Cellu-lar Hþridization" Nature New Biologt 23I:87-90 (May 19, l97l).Cook and Scharff, "4¡¡t"o-binding muta¡ts of mouse myelonÍIcells" Proc. Natl. Acad. Sci. USA 7(12):5687 -5691 (1977).

Cook et al., "Somatic mut¿tion in a culhued mouse myeloma cellaffects antigen bindhg" Proc. Natl. Acad. Sci. USA79:1240-1244(re82).Cotton and Milstei¡, "Fusio¡ of two immunoglobulin-producingmyeloma cells" ly'a ture 24 4 :42- 43 (Jul. 6, I 973).Croce et aI., "P¡oduction ofhunran hþridomas secreting antibodiesto measles virus" Nature 288:488489 (1980).

Dangl, "Rapid isolation ofcloned isot¡pe switch variaats using fluo-rescence activated cell sorting' Cytometry ,2(6):395-,101 (1982).

Dangl et al., "Segmental flexibility and complement fixation ofgenetically engineered chimeric human, ¡abbit and mouse antibod-ies" The EMBO Jownal TQ):1989-199a (1988).De Berna¡dez-ClarkandGeorgiou, "lnclusionbodies andrecovery ofprotein from the ag Eregated st^te" Protein Refolding Chapter l: I-20(leel).Dildrop et al., "Imnnrnoglobulin V region variants in hþridomacells. II. Recombi¡ation betweenV genes" EMBO Journal l(5) :635-640 (te82).

Duyvesteyn and De Waa¡d, 'i{. new sequence-specific endonuclease

from a Thermophilic cyanobacterium masligocladus laminosus"FEBS Lenqs lll(Ð:an426 (1980).

Duyvesteyn et al ., "sequence-sp€cific endonucleases in s¡ains ofanabaena and nostoc" Arch. Miuobiol. 134 :276-281 (1983).

Early a¡dHoo{ "Mouse immunoglobulin genes" Genetic Engineer-

ing, Principles and Methods, Setlow a¡d Hollaender' N Y and Lon-

don, UK: Plenun Press vol. 3 :157-188 (1981)'

Early et a1., "Allelic Exclusion and Nonproductive ImmunoglobulinGene Rearrangements" Cell 24 : I-3 (Apr. 198I).Earty.et al ., "An immunoglobulin heavy chain variable region gene

is generated from three segments of DNA: Vr D and J¿ ' Cell 19 :

981-e92 (r980).Edelman, G., "Antibody struchrre a¡d molecula¡ immunolog/'Ann'als of the New York Academy ofsciences !90 :5-25 (197 l).Erlwa¡ds et at., 'A hum¿n-human hybridoma system based on a

fast-grov/ing mutant of tüe ARH-7? plasma cell leukemia'de¡ivedline" European J. Immunol. 12:641-648 (1982)'

Ellison et al., "The nucleotide sequence of a humaa immunoglobulinC,, gen€' Nucleic Acids Research 70(13) :40714079 (1982).

Eilison et al., "Nucleotide sequence of ahu¡nan immunoglobulin Ct+

gene" DNA l(l):ll-18 (1981).Eshhar et al., "lnduction of secretion oflgM from cells ofthe B cellline 38C-13 by somatic cell hybridization" J. Immunol. 122 (6):2430-2434 (t979).Feiss et at., "separate sites for binding and nicking ofbacteriophagei'DNA bytermin ase" Proc. Natl. Acad. Sci. USA 80 ;955-959 (t 983).

Gillies €t al., "A tissue-specific transcription enha¡cer element islocated in tle m4io¡ i¡tron of a rear¡anged immunoglobulin heavy

chain gene" Cell 33 :7 11 -728 (1983).Givol et al., "Diversity of germJine imrnunoglobulin Vr genes"

Nature 292 :426430 (1981).Goldsby et al., "Hybrid cell lines with T-cell cha¡acteristics" Nature267 :7 07 -7 08 (Jw. 23, 1977).G¡itz and D¿vies, "Plasmid-encoded hygrorrycin B resista¡ce: the

sequence ofhygromycin B Phosphoha.nsferase gene and its o<pres'

sion't¡ Escherichia coli and Saccharomyces cerevisiae" Gene

25:179-188 (1983).Herlyn et al., "I-nhibition of Growth of Colo¡ectal Carcinoma inNudeMice by Monoclonal Artibody'' Can cq Research 40 :717 '721 (Matre80).Herzenberg et al,, "HþridomaVariants Affecting Isot)?€, Antig€nBinding, and ldiotype" Bub technologt in Diagnostics, Koprowski et

al. vo[. 2l :3-16 (1985).Herzenberg, L. NIH Granß CA 04681-24, CA M68I-25, andProgres s Reports (1984).Herzenberg, L., "Genetic studies with mamm¿lian cells (mice)'Grant ID R0ICÁ04681 as entered into the crisp dataåcse (Abstactonly) (Sep, 3,1992).Herzenberg, L., "Immunoglobulins: genetics and tegalafiof' GranlApplications AICA 089 1 7- 1 5, 1 6, 1 7, 1 8, I 9 (1978).

Hieter et al., "Cloned human and rnouse kappa immunoglobulinconst¿nt and J region genes conserve homology in fulctional seg-

meús" Cell 2À(Patt l) : 197-207 (1980)'Honjo et al., 'Cloning and complete nucleotide sequence of mouseimrnunoglobulin 1l Chain Gene" Cel/ 18 :559-568 (1979).

Honjo et aI., "Rearrangements of Immunoglobulin Genes duriagDifferentiation and Evolution' Immtmological Rev, 59 :3347(1e8r).Hood et al., "A¡tibodies" /¡nmurologt, Forkrer and Moore, Philip-pines:The BenjamidCummirgs Publishing Co., Inc., Chapter 3, pp199-22t (1978).Horwitz et al., "Sec¡etion offunctional antibody and Fab fragrnent

ûom yeast cells" Proc. Nail. Acad. Sci. USA 85 :8678-8682 (1988)'Houghton et al., "Detection of cell surface a¡d intracelluar antigensby human mo¡oclonal antibodies" ./orzrzal of Experimental Medi-cine 158:53-65 (1983).Howard et al., "Long-tem culture ofnormal mouse B lumphocytes"Proc. Natl. Acad. Sci. USA 78(9):5788-5792 (Sep. l98l).Howa¡d et al., 'A Rapid Method fo¡ the Detection of A¡tibodies toCell Surface A¡tigens: A Solid Phase RadioimmunoassayUsing CellMemb¡anes" .-/o¡zrz al of Immunological Methods 38 :?5-84 (1980).


as7,923,221BlPage 5

Hughes ald Murray, "The nucleotide sequences recopized byendonucleases AvaI a¡dAv¿II from Anabaena variabilis " Biochemi-cal Journal 185 :65-75 (I980).Isenma¡ et al,, "The struchre a¡d fuction of immunoglobuli-ndomains" I Immunol. I 14(6) : 17 26-1929 (197 5).Itakura and Riggs, "Chemical DNA synthesis and recombinant DNAshtdies" Science 209 : 140 l-1405 (1980).Jaton et al., "Conform¿tional changes induced in a homogeneousa¡ti-type III pneumococcal antibody by oligosaccharides of incre¿s-ng size" B iochemßW 14(24) :53 12-53 t 5 (1975).

Jones et al., "Replacing tle complementarity-determining regions ina human antibody witl those from a mouse" N¿ture 321 :522-525(May 1986).Kabat et al., "Sequences of Proteins of Immunological Interesf'(National Institute of He¿ltT) (1983).Kabat,E., 'âctivation of tle complement system and its effects oncells" Stt'uctural Concepts in Immunologt and Immunochemistry,Second edition, Holt, Rineha¡ta¡d Wi¡ston vol. Chapter 13:413435(te76).Kaiva¡ainen et aI., "Hapten-induced chalges in pig anti-Dansyl anti-bodies revealed by EPR sp€ctra of spin-labelled antibodies"Immunol. Letters 3 : 5-l I (1981)Kalderon et al., 'Deletion loop mutagenesis: a novel metlod fo¡ theconstruction ofpoint mutations using deletion mutaats" Nucl. AcidsRes. l0 :5161-5168 (1982).Kitai et al., "Extracellular producüon of human immunoglobulin GFC region" Microbiol. Biotechnol. (Abstract only) 28(f) :52-56(1e88).Kohl and Moore, "Humzn antibody-dependent cellular cytotoxicitya¡d natu¡al killer clotoúcity to herpes simplex virus-infectedautologous aad allogeneic cells" /m munologt 48 : I 87-193 (1983).Kohler and Milstei¡, 'Conti¡uous culures of fused cells secretingantibody ofpredefined specificity'' Nature 256 :495497 (1975).Kohle¡ and Milstein, "Derivation ofspecific antibody-producing tis-sue culhre and hrmo¡ lines by cell fitsiot" European Jounal ofImmunologt 6 :51 l-519 (f976).Konieczny et aI., "The combin¿tion oflgM subunits ald proteolyticIgG fragments by controlled fo¡mation of interchai¡ disulphides"Haematologia la(l) :95-99 (1981).Koskimies, S., 'Hurnan lymphoblastoid cell line produci.ng speciûcantibodyagainst Rh-aútgenD" Scand. J. Immunol. II:13-77 (1980).Kuehl, W.M., 'Light chain fragments: aberrant expression ofimmunoglobulin genes" ZBS pp. 206-208 (Aug. l98l),Kwan, "Two Kappa Lnmunoglobulin Genes Are Expressed i-n theMyeloma 5107" Cel/ 26:57-66 (Oct. 1981).I-a¡son et aI ., ",Saccharomyces cerevisiae actin-Escherichia coli lzcZgene fusions: synthetic-oligonucleotide-mediated deletion of the 309base pair intervening sequence in the actj¡ gen€' Gene 22:31-39(re83).Laskov and Scharff, "Synthesis, assembly, and secretion of gammaglobulin by mouse myeloma cells" Journal of Experimental Medi-cine l3l(3) :5 15-541 (1970).

Laskov et al., "Iaduction ofamplified synthesis and secretion ofIgMby fusion of mu¡i¡e B Lymphoma with myeloma cells" Proc Natl.Acad. Sci. USA76(2):915-919 (Feb. 1979).l¿u a¡d Doolittle, 'Aqu I: a more easily puriûed isoschizomer ofAYAI" FEBS Letters l2I(2):2O0-2O2 (1980).Leder, P., "The genetics of antibody diversity" Scientifc America246:72-83 (1982).Levy and Mille¡ "Tumor tlerapy with monoclo¡al ¿¡tibodies" Fed.Proc. 42 :2650-2656 (1983).Liu et a1., "Chimeric mouse-human IgGl antibody tlat can mediatelysis ofcancercells" Proc. Natl. Acad. Sci. USA M :3439 -3443 (May1987).Maniatis, T., "Recombin¡nt DNA procedures in the study ofeukaryotic genes" CeIIBiol.3 :563-608 (1980).Margulies et a1., "Regulation of immunoglobulin expression inmouse myoloma cells" Immunoglobulin Expression pp. 7 8l-79 L

Margulies et al., "Somatic Cell Hybridization of Mouse Myeloma"Cell I :405415 (Jul. 1976).Martinis et al.,'Monoclonal antibodies with dual antigen specifici!y''Oncologt pp.3ll-316.

Marle¡ et al., "Transcriptional regulation of immunoglotulin Vgenes" Nucleic Acìds Research 9 (2a) :6855-6867 (1981).

Matsuuchi ald Morrison, *A-ntigen bilding variants of mouseplasmacytoma J558" Fed. Proc.(Abstrast only) 37 :t763 (2703)(1e78).Max et aI., "Variation in tìe Crossover Point of KappaImmunoglobulin Gene V-J Recombinatio¡: Evidence from a CrypticGete" Cell 2l :793-799 (Oct. 1980).Melchers, F., "Biosynthesis of the carbohydrate portion ofimmunoglobulin radiochemical a¡d chsmiçal ¡n¡lysis of the ca¡bo-hydrate moieties of two myeloma proteins puriûed from diffe¡entsubcellula¡ ftactions of plasma cells" Brbchemistry l0(4) :653-659(1e71).Messing et al ., "A System or Shotgun DNA Sequencing" ifircler'cAcids Research 9 (2) :309-321 (1981).Milstei¡ et al , 'Clonal Va¡ia¡ts of Myeloma Cells" Prcgræs inImmunologt II I :157 -168 (1974).Mohit and Fan, "Hybrid Cell Line ûom a Cloned Immunoglobulia-Producing Mouse Myeloma and a Nonproducing .Mouse

Lymphorn)'Science 11I:75-77 (Jan 8, 1971).Mo¡rison, "T¡ansfectomas Provide Novel Chime¡ic A¡tibodies" Sci-enc e 229 : 1202- 1207 (1985).Mor¡ison and Oi, "Transfer and expression of immunoglobulingenes" Annual Review oflmmunologt 2 :239-256 (1984).

Mo¡rison and Scharf, "Mutational events in mouse myeloma cells"Critical Reviews in Immunologt3(I) :l-22 (1981).Mo¡¡ison, S. L. et al., 'Chimeric human antibody molecules: mousealtigen-binding domai¡s with huma¡ constant region domains"Proc. Natl. Acad. Sci. USA 8l (2 t) :685 I-6855 (Nov. 1984).Nakabayashi et al., '"The transforming fu¡ction of bovine papil-lomavirus DNA" Proc. Natl. Acad. Sci. USA 80 :5832-5836 (1983)..Neuberger, "Switch from hapten-specific imrnunoglobulin M toimmunoglobulil D secretion in a hybrid mouse cell ljne" Proc.National. Acad. Sci USA 78Q):1138-1142 (1981).

Neuberger et al., "Recombi¡ant a¡tibodies possessing novel effecto¡û¡nctions" N¿l¡zre 312 (5995) :604608 @ec. 1984).Neuberge¡ M. S. et al., 'A hapten-specific chimae¡ic IgE antibodywith huma¡ physiological efecto¡ fu¡ction" Nature 314 :268-270(Mar. 1985).Ochi et ¿1., "Functional immunoglobulin M production afterha¡sfection of cloned immunoglobulin heavy and ligbt chain genes

into lymphoidcells" Proc Natl Acad. Scl. USI 80 :6351-6355 (1983).Oi et al., "Cor¡elation between segmental flexibility and efecto¡function of antib odtes" Nature 307 : f 36- 140 ( 1984).Oi et al., "Localizafio¡ of Mu¡i¡e lgbl" Allotypic Determinants byUsing a Panel of Mouse MyelomaVariant Immunoglobulits" Jour-nal of Immunol ogt I 30(4) : I 967-1 969 (Apr 1983).Oi et al., 'lyrnphocyte membrane IgG and secroted IgG are struchrf-ally and allotypically disti¡ct" Journal of Eryerimental MedicinetsI :t260-t214 (1980).Olsson and Kaplan, "Humal-humal hybridomas producingmonoclonal altibodies of predefned antigenic specifcity" Proc.Natl Acad. Sci. USA 77(9) :5429-5a31 Q980).Orna Zemel-Dreasen et al., "Secretion and processing of alimmunoglobulin light chain in Escherichia coli" Gene 27(3) :315-322 (1984).Parha:n et al., "Isolation ofHeavy Chain Class Switch Va¡iants ofaMonoclonal A¡ti-DCl Hþridoma Cell Li¡e: Eflective Conversionof Noncytotoxic IgGt Antibodies to Cytotoxic IgG2 A-ntibodies"Human Immunologt 8 : l4l-l5l (f983).Peden a¡d Natlans, "Local mutagenesis within deletion.loops ofDNA heteroduple¡<es" Proc. Natl. Acad. Scí. USA 79 :7214-7211(re82).Pe¡iman, "IgG Synthesis in Hybrid Cells from an Antibody-produc-ing Mouse Myeloma and an L Cell Substain" Nature 228 :1086-1087 (Dec. 12,1970).Perry et al ., "Transcri¡:tion ofmouse x chain genes; implications forallelic exclusion' Proc. Natl. Acad. Sci. USA 77 (4) :1937-1941(re80).Plaut et al., 'ïmmunoglotulin M: Fixation of hum¿n complement bytle Fc Fragnrenf' Science 176 :55-56 (1972).Ponte et al ., "Traascription of immunoglobutin heavy-cbainsequences from the excluded zllele" Nature 29 I :594-596 (1981).


as7,92322lB[Page 6

R¿schke et al., 'Assembly and secretion of pentameric IgM in a

fusio¡ between a nonsecreting B cell lynphorna ald an lgG-secret-ing plasmacfoma" Proc. NatL Acad. Sci. USA 76(7) :3469-3473(te7e).Recb¿vi et al., "Evolutionary aspects of immunoglobulin heavy chai-n

variable region (V¡¿ gene subgroups" Prac. Netl. Acad. ^Scr.

t/Sl 80 :

8s5-E59 (1983).Reth et al., "Analysis of the repertoire of a¡ti-NP a¡tibodies inC51BL|6 miceby cell fusion" European Journal oflmmunologt S :

393400 (1978).Riley etal., "lnduction oflight chainexpression in apre-B cell linebyfirsion to myeloma cells" Nature 289:804-806 (1981).

Robins et al., 'Regulated Expression of Huma¡ Growth Ho¡moneGenes in Mouse Cells" Cell29 :623-631(1982).Roizes, 'A new specitc endonuclease fuom Anabaena variabilìs"FEBS Letters 104 (l) 39aa $979).Rþarska et al., "The Hemolytic Activity of (Fab-Fc) Recombina¡tImmunoglobulins with SpeciÊcity for the Sheep Red Blood Cells"Immunologt Letters 4 :279-284 (1982).Sak¿no et al., "Dom¿i¡s and tle hinge region of al immunoglobulinheavy chain a¡e encoded in separate DNA segrnents" Nafwe 277 :

621 -633 (t979).Schlom et al., "Gene¡ation ofhuman monoclonal antibodies reactivewith human mammary ca¡cinom¿ cells" Proc. Natl. Acad. Sci. USA

7 7 (I t) :684 t-6&45 (1980).Schroder et al., "Flo¡escence-activated cell sortilg ofmouse-hum¿¡hþrid cells aids in locaflng the gene for the Leu 7 (HNK-I) antigento human cb¡omo sn.me ll" Proc. Natl. Acad. Sci. USA80 :3421-3424(Jun. 1983).Schwaber and Cohen, 'Huma¡ x mouse somatic cell hybrid clonesecreting immunoglobulins of both parental types"Naîure 244 :444-447 (te73).Schwaber aûd Cohen, 'Pattern of Immunoglobulil synthesis andassembly in a huma¡-mouse somatic cell hybrid clone" Proc. Natl.Acad. Sci. USA 7t (6) :2203-2207 (1974).Schwabel J., "lmmunoglobulin production by a human-mousesomatic cell hþrid" Experimental Cell Research 93 :343-354(re75).SchwarE et al., "Multiple o<pression of Ig l-chain encoding RNAspecies ir murine plasmarytom¿ cells" I Immunol. 126 (6) :2lM-2108 (1981).Sears et al., "Phase-I clinical trial of monoclonal antibody in teat-meût of gasEointestinal tumòu¡s" lancet pp. 7 62-7 65 (1982).

Seche¡ et al ,, "Som¿tic muta¡ts and antibody dlercit/' Immuno-logical Rev.36 :51-72 (1977 .

Seidman and Leder, "The arrangement and rearrangernent of anti-body genes" Nature 276 :790-795 (1978).Seidman and Lede¡ "Arnutqnt immunoglobulin light chain is formedby abenant DNA- a¡d RNA-splicing evetts" Nature 286 :'779-783(1e80).Seidman et al., "Multþle related irnmunoglobulin variable-regiongenes identited by clonhg and sequence analysis" Proc. Nall. Acad.Sci. USA 75 (8):3881-3885 (1978).Seidman et al., 'A r-immunoglobulin gene is formed by site-specific¡ecombination without frutler som¿tic mutation" Nature 280 :370-37s (te7e).Sharon et al., "Expression of a Vr -C-* chim¿e¡ic protein mousemyeloma cells" ilature 309 :364-367 (I9M).Shine et al., "Expression ofcloned p-endorphin gene sequetrces byEscherichia coli" Nature 285 :456461 (1980).Shulman 91h Annuel Meaing of the Clinicøl Ligand Assay Society(Alleged oral prese¡tafion Mar. 13-17, 1983, Philadeþhia, Pennsyl-vania) (1983).Shul¡nan and Kobler, "Fusion of Immuloglobulin Secreti-ug Cells"Cells of Immunoglobulin Synthesis, Pemis a¡d Vogel, AcademicPress pp. 275-293 <1979).Siddiqui, M., 'Recombinant DNA technology and its application todwelopmental biologf' J. Craniofacial Genetics and Del,elopmen-tal Biolog) Z :7 5-92 (1982).Sninsþ et al., "Consüuction and chúz'cterizalion of a novel two-plasmid rystem for accomplishing temperaû¡re-rq+fated. amplifiedo<pression of cloned adventitious genes n Escherichia coli " Gene

16 :275-286 (t98t).

Sonenshein et al.. "Cont¡ol of immunoglobulin secretion in the

murine plasmacytoma line MOPC 315" Journal of ExperimentalMedicine 148 :301-312 (1978).

Sta¡k èt al., "Site-directed mutageaesis of ribosomal RNA ' J M¿l.B iol. 159 :4 17 439 (1982).

SteinmeE et al., "Cloning of V region fragÍients ûom mouse live¡DNA a¡d localization ofrepetitive DNA sequences in the vicinity ofimmunoglobulin gene segrnents" iÍtrcleic Acids Research I :1709-

r72o (1e80).Ta¡aka et al., 'Isolation and ch¿racte¡ization of polyoma virusmutaats which grow in mwine embryonal ca¡cinoma and trophoblastcells" EMBO Journal | (12):1521-1527 (1982).

Tao et al., "Role ofCarbohydrate in the Shucture and EffectorFunc-tions Mediatedby the Human IgGConstant Region"l Immunol. 143

(8) :2s9s-2601 (1989).

Teng et al., "Const¡uction and testing of mouse-human

heteromyelomas for hum¿n monoclonal antibody production" Pro¿.

Natl. Acad. Sci U$d 80 :7308-7312 (1983).

Tonegawa et al., "Cloni¡g of an immuloglobulin variable regiongene from mouse embtyo" Proc. Natl. Acad. Sci. USA74 (8):3518'3s22 (re77).Tonegawaet al., 'Sequence ofa mouse gennJine gene for ava¡iableregion of an immunoglobulin light chajn" Proc. Natl. Acad- Sci USA

75(3): l48s-1489 (1978).

Tucke¡ et al ., "Structure ofthe constant and 3'untranslatedregions ofthe muri¡e ^¡2bheavy chain messenger RNA" Sciø¡ce 2O6:1299-

r303 (1979).

Underbrink-Lyon et ¿1., 'Characterization of a yeast Mitochondrial,locrzs necessa¡y for tRNA biosynthæis" MoL Gen. Gena. l9l:512-518 (1983).U¡acz et al . , '"The use of Fab-Fc ¡ecombinant antibodies for studyingthe mechanism of triggering the effector activities ofirnmunoglobulins" Immunologt Letters 7 :21 5-220 (1984).

Wageúer et al., "Monoclonal antibodies for carcinoernbryo¡ic anti-gen andrelated antigens as a model system: a systematic approach forthe dete¡mi¡ation of çitope specificities ofmonoclonal a¡tibodies"J Immunol. 130(5):2308-23 l5 (1983).

Wall, R. and Kuehl, M., "Biosynthesis and regulation ofimmunoglobulins" Annual Review of Immunologt I :393422(1e83).W¿llace et al., "Di¡ecteddeletionof ayeasttansferRNA iateweningsequence" Sclørce 209:1396-1400 (1980).Wallach et al., "Amlysis of immunoglobulin nRNA in murinemyeloma cell varia¡ts defective in the synthesis ofthe light or heavypolypeptide chains" J. Immunol.128(2) :684-689 (1982).

Wafso¡ et al., "ln vito growtl of B lymphocytes infiltrating human

melanoma tissue by tra¡sformatio¡ with EBV: evidence fo¡ secretionof anti-melanoma antibodies by some t¿nsformed cells" IIm munoll3Ù (5) :2442-2447 (1983).Weathe¡all a¡d Clegg, "Recent developments inthemolecular genet-ics ofhuman hemoglobin" Cell 16:467479 (1979).

Weck et al., "Antivi¡al activities of hybrids of two major humanleukocyte inte¡ferons" Nucleic Acids Research 9 (22) :6L53-6166(1e81).Weiss andGreen, "Human-mouse hybrid çell li¡s5 ç6¡raining partialcomplements of human chromosomes and fi¡nctioning human genes"

Proc. Natl. Assoc. Sci. USA 58: I 104-l I I I (1967).Wetzel, R., "Active immunoglobulin fragments synthesized il Ecol¡:f¡om Fab to Sca¡tibodies"Protein Engineering 2 (3) :169-176(1e88).Whitlock a¡d Witte, "Long-term cultue of B lyrnphorytes ald theirprecrusors from murine bone ma¡¡of'Proc. Netl. Acad. Sci. USA

79 :3608-3612 (1982).Winberry et al., "Irnrnunoglobulin production and secretion by vari-a:rt clo¡es of the MOPC 315 mouse myelomacelll¡n€' J. Immunol .

t24(3) : t 17 4 - t 182 ( 1980).Wood et al., 'The synthesis and i¡ vivo assembly of fr¡¡ctionalantibodies in yeast" Nature 3 14 :446-449 (1985).

Wo¡d et al., 'Expression of surface and secreted IgG2, by ¿ mu¡¡neBJymphoma befo¡e and after hþridization to myeloma cells"Molecular Immunologt l8{4):3Il-322 (f 98l).


us7,923,221B1PageT

Yanawaki-Kataok4 'Complete nucleotide sequence ofimmunoglobulin y2b chain gene cloned ùom newbo¡n nouse DNA"Nature 283 :786-789 ( 1980).Yam¿waki-K¿taoka et al., "The complete nucleotide sequence ofmouse immunoglobulinl2a gene and evolution of heavy chail genes:

fl¡rhter evidence for htewening sequence-mediated domain trans-

fer" NucleicAcids Research 9(6) :1365-1381 (1981).

Yam¿waki-K¿taoka et al., "Nucleotide sequences ofgene segments

encoding membra¡e domains of immunoglobulin 1 chains" Prac.

Natl- Acad. Sci. USA79 :2623-2627 (1982).

Z,aktt et al., "Cloning and sequence of the cDNA corresponding tothevariable region of immunoglobulin heavychain MPCll" NrcleicAcids Research 8 (16):3591-360t (1980).

7-av'yalov el al.,"Correspondence between sfucture andfunction ofimmunoglobulin G subclasses" I1¿em atologia 14 (I):85-94 (1981).

"Affid¿vit of Allan Robert dated Aug. ll, 1994, witl enclosures"(ree4)."Decla¡ation of Alla¡ E. Connor dated May 16, 1996, with enclo-

sures" (1996)."Decla¡ation ofChristoph H. Heusser dated May 21, 1996" (1996).

"Decla¡ation of J. Steve¡ Whitake¡ dated Jur. 23, 1994 with enclo-sures" (1994)."Declaration of La¡s Abrahmsen d¿tedMay 23, 1996" (1996)."Decla¡alion of Leon R. Lyle dated Aug. 9, 1994, wittr enclosures"(ree4)."Decla¡ation ofMarch J. Schulma¡ datedMay I5, 1996, with enclo-sures" (1996)."Decla¡ation of Robert G. Hamilton dated May 16, 1996" (1996).

"Decla¡alion ofTheodoreT. Herhold datdJun.23, 1994, witì enclo-sures" (1994)."Decla¡ation of Theophil Staehelin dat ed May 22, 1996" ( 1 996).

"Declaration ofVernon T. Oi ofMay 1995, with enclosures" (1995).Ullen et al., "Ge¡e fusion vectors basedon tlegene for staphylococ-cal protein A' Gene 23 :369-378 (1983).Elliso¡ et al., '.Lirrkage and seçence homology of two huma¡immunoglobulin gamma heavy chain constant region genes" Prac.Nail. Acad. Sci. USA 79 :1984-1988 (Mar. 1982).Fie¡s et al., "Complete Nucleotide Sequence of SV40 DNA" 1V¿¡¿re

273 :ll3-120 Çrfzy I l, 1978).Gluzman, Yakov, "SV40-Tra:rsformed Simian Cells Support theReplication ofEarly SV40 Mutants" Cell23:175-182 (Jan. l98l).G¡aham et al., 'A New Technique for the Assay of lnfectivþ ofHuman Adenovi¡us 5 DNN' Virologt 52 :456467 (1973).Hedi¡ et al., "Specificities and Bindiag Properties of EightMonoclonal A¡tibodies Ag¡in51 çrt"¡ooernbryonic Antigen"Molecular Immunologt 19 : 164l-1648 ( 1982).

Inouye et al., "Signal Sequence of Alkaline Phosphatase ofEscherichia coli " J. Bacteriol. l49 :434 (1982).

Kipps et al., "Allotype Switch Variants in Cultu¡ed Monoclonal ho-ducing Hybridomas" Jownal of Cellular Biochenistry (abstracto¡ly) pp. 163 (-1984).Kupchik et al., 'Monoclonal A¡tibodies to Ca¡ci¡oembryonic Anti-gen Produced by Som¿tic Cell Fusiot" Cancer Research 4l :3306-3310 (Sep. l98l).Lee et al., "Characterization ofthe Gene Encoding Heat-Stable ToxinII and helimina¡y Molecule Epidemiological Sh¡dies ofEnterotoxigenic Escherichia coli Heat-St¿ble Toxin tr P¡oduce¡s"Infection and Immunity 42 1264 -268 (Oct. 1983).Liu, PinghuiV, "Pseudomonas Toxins" J. Inþct. D¡'s. 130 :S94-S99(re74).McCutchan et¿l., "Enhancementoftle hfectivity of SimianVirus 40Deoxyribonucleic Acid with Dietllamiloethyl-Dextran" J. Natl.cancer Institure 4l :35 l-3 56 (1968).Mertz et al., "Defective Simian Vi¡us 40 Genomes: Isolation andG¡owth of l¡dividu¿l Clones" Itìrologt 62 :lI2-124 (197 4).Mowa et al., "Amino Acid Sequence of the Sigaal Peptide of ompAProtein, a Major Outer Membra¡e P¡otein of Eschericha coli" TheJournal ofÙiological Chemiry 255 :27 -29 (Jan. 10, 1980).Oi et al., "HybridomaAntibody-Producing Switch Variant as AVa¡i-ant Lacking the CHI Domain' Cell Fusion: Gene Transþr andTransformation, R. F. Beers, Jr. and E.G. Bassett, Raven Press, NewYorkpp. 28t-287 (lg84).

Palva et al., "Sec¡etion ofinterferotby Bacillus subtilis" Gane 22 :

229-235 (1983).Picken et al., '1.{ucleotide sequence of the gene for heat-stable

enterotoxin It of Escherichia coli" Infection and Immunity 42 (l) :

269-27s (1e83) .

Watson, Marion E.8., "Compilation of published signal sequences"

Nucleic Acids Research 12:5145-5 164 (1984).

Wigler et al., "Transfo¡mation of Mammalian Cells with Genes fromProcaryotes and Eueatyotes" Cell 16 :77'l -785 (Apr. 1979).

"Fund¿mental lmmunology, 2nd Edition, William E. Paul, M.D.,Editor" pp. 209 (1989).

"Fundamental Immunology, 3rd edition, WilliamE. Paul, M.D., Edi-tor" pp. 285-286 (1993)."Fu¡damental L¡nmunology, lst Edition, William E. P¿ul, M'D. Edi-tor" pp. 137 (t984).Abbas et al . , "Cellula¡ a¡d Molecular Immunolory, Second Edition"pp. 38-39 (1994).Ad¿ir et ¿1., "Engineering Antibodies for Therapy" ImmunologicalReviews l3O:5 40 (1992).Boyden, Alan, "Homology and Aaal ogf' Science 164:455 456 (Apr'r969).Dove¡ Gabby, 'Nonhomologous Vews of a Te¡minology Muddle"CelI 5l:515-516 (Nov. 20, 1987).Gupta et al., "General Orientation of Huma¡ Lynphoc¡eSubpopulations" Clinical Immunobiol., Bash and Good, AcademicPress vol.4 :l-18 (1980).Hunkapiller et al., "The growing immunoglotulin gene superfamily''Nature 323 : 15 -16 (1986).Lewin, Roger, "lWhen Does Homology Mean Something Else?" Sci-ence 237:1570 (1987).Reeck et al., "Homolory in Proteins a¡dNucleicAcids:ATerminol'ory Muddle and aWay out of if' Cell 5O (Artg.28, 1987).Strominger et al., "An Ev¿Iuation of the Significance ofAmino AcidSequence Homologies i¡ Hum¿n Histocompatibility Altigens(HLA-A and HLA-B) with lmmunoglobulins and Other P¡otei¡s,Usirg Relatively Short Sequences" Scand. J. Immutol . lt :573'592(re80).Takah¿shi et al., 'Structure of Human Immunoglobulin Gamrna

Genes: lmplications fo¡ Evolution of a Gene Family'' Cell 29 :671-679 (t982).French deposition transcript (Feb. 27 ,2002).Expert Reportof JayUnkeless, Ph.D., witl ExhibitA (Dec.6,2001).Declaration ofJayU¡keless, Ph.D. in Support ofGenentech's ClaimCoístruction B¡ief, with Exhibit A (Jan.22,2002).Unkèlèss deposition tanscript @eb. 21,2002).Expert Rçort of Gerald H. Bjorge, Esq, wittr Exhibits A-D (Dec. 7,2001).Expert Rçort of Jeftey P Kushan, with Exhibits A and B (Dec. 7,

2001).Decla¡ation ofJeffiey Kushal in suppo¡t ofGenentech's claim con-

struction brief, with Exhibit A (Jan.22,2002).Kushan deposition transcript (Feb. 21,2002).Rebuttal Expert Report of John Robert Ad¿ír, Ph.D.' with ExhibitsA-P (Jan. 25,2002).Adair deposition transcript (Feb. 19,2002).Rebuttal Expert Report oflewis L. Lanier Ph.D (Jan. 28, 2002)' witlExhibitA.Rebuttal Expert Rçort of William J. Har¡is Ph.D (Jan. 27,2002),with ExhibitA.Supplemental Exp€rt Report of Williarn J. Hanis, Ph.D (Jun' 28,

2002).I-arrick de,position hanscript (Nov. 20, 2001).Memo¡a¡dum of Poi¡ts and Authorities in Support of Ge¡e¡tech'sMotion for Summary Judgment re Invalidity for A-uticipation andLack of hiority, with Separate Stajement of Undisputed Facts insupport thereof (lvfay 6, 2002>.

Defenda¡t Genentech lncs.'s Opposition to Chi¡on's Motion fo¡Summa¡y Judgnent re Priority and Defenses and Counterclaimsunde¡ 35 USC $$ l12, l0l, a¡d Cross Motion fo¡ Summary Judg-ment, with Response to Chi¡on's Sepa¡ate Statemetrt of Undisputed

Facts (May 20,2002).Genentech's Oppositions to Chi¡on's Motions in Limine (Phase I)(Jul.26,2002).


as7,923,221BlPage 8

Cetus Internal Memo (May 26, 1982).Cetus lnternal Memo (Mar. 2'l, lg8r'.).Ceh¡s Internal Memo (Jul, 17, l9U).Cetus Internal Memo (Mar. 27, lg8r'.).

Cetus Internal Memo (Aug. 8, l9E3).Cetus Internal Memo (May 26, 1982).

Cetus Internal Memo (Aug. 17, 1983).Project Proposal-{RÁC Meetirg (Nov. 10, 1983) (from Cetus).

Genentech's Claim Construction Brief (Jzn. 22, 2002), withGenentech's Claim Construction Statement (Dec. 21, 200 1).

Decision on Petition, Interference No. 102,572, filed Apr. 4, 2003

(Paper No. 85).Decision on Petition, Interference No. 102,572, ñled Apr. 4, 2003

(Paper No. 86).

Celltech Limited's Notice of Opposition, filed Apr. 19, 1994 .

Medlmmune, Inc.'s Dema¡d for Jury Trial, Case No. CV-O3-2567,

datedApr. 11,2003.Grounds ofOpposition filed on BehalfofGenentech, lnc. in Respect

of Their Opposition to EP-B-0120694 (U301996.9) in the Name ofCelltech Limited and entitled'Processes for the Production ofMultichain Pol)¡peptides or Proteins', filedApr 19, 1994.

Tralscript of hoceedi-ngs Before the Honorable Gregory G. HollowsUnited States Magistrate Judge Hearin g Marhnan Heating (Mar. 6,

2002).Tralscript of Proceedings Before the Honorable Gregory G. HollowsUnited States lvfagisbate Judge HearilgMarkman Hearing (Mar. 7,

2002).Reporter's Daily Transcript Jury Trial (Aug. 6, 2002).Reporter's Daily Transcript Jury Trial (Aug. 8,2002).Reporter's Daily Traascript Jury Trial (Aug. 9,2002).Repofer's Daily Transcript Jury Trial (Aug. 12,2@2),Reporter's Daily Transcript Jury Trial (Aug. 13, 2002).Reporter's Daily Transcript Jury Trial (Aug. 14,2002).Repofer's Daily Transcript Jury Trial (Aug. 16,2@2).Reporter's Daily Transcript Jury Trial (Aug. 20,2@2).Reporter's Daily Transcript Jury Trial (Aug. 21,2@2).Reporter's Daily Transcript Jury Trial (Aug. 22, 2@2).Reporter's Daily Transcript, Jury Trial (Sep. 3,2002).Reporter's Daily Transcrþt, Jury Trial (Sep. 4,2002).Expert Report of Debo¡ah L. French,. Ph.D., with Exhibits A, B, C

@ec.6, 2001).Rebuttal Expert Report ofDeborah L. French, Ph.D (Jan. 25,2002).Supplemental Export Repoft of Debo¡ah L. French Ph.D. (Jul. 3,

2002).Declaration of Lewis L. Laniet Ph.D. with Exhibits A-B (Jan. I,2002).Decla¡alion of Lewis L. Lanier, Ph.D. In Support of Chiron's Oppo-

sitions to Genentech's Motions for Surnrna¡y Judgrnent (May 20,2002).Lanier deposition nanscrþt (Feb. 14,2002).Harris deposition transcrþ (Feb. 27,2002).Decla¡ation of Mlliam J. Hanis, Ph.D. in Support of Chiron'sReplies to Summary Judgnrent Oppositions, witÏ ExhibitsA-D (May27,2002).Magisbate's Findings and Recommendations (Marhnan Hearing)

Qt12r.20,2002).Genentech's PosÞHearingMarknan Submission (Mar. 12, 2002).Genentech's Objections to Magistrate's Findings & Recommend¿-tions (Markman Hearhg) (fur. t, 2ffi2).Genentech's Response to Chiron's Objection andMagistrate's Find-ings & Recommendations lMarknan Hea¡i¡gl(Apr. 8, 2@2), withattached Exhibits.Memorandum a¡d Order (Maúnan) (Apr. 22, 2002).Genentech's Rçly in Support of its Motion fo¡ Summary Judgmentre lnvalidity for Anticipation and Lack of Priority (lvlay 28,2002).Reporter's Tra¡script, Motion to PrecludeAdnission of UndisclosedLicense Ageements and Cross Motions for Summary Judgment(Monday, Jun.3, 2002).Memo¡andum and O¡der re: Priority, Aaticipation, Written Descrip-tion, Enablernent, Best Mode, Utility (Jun. 24,2002).

Chi¡on's Motion forClariûcation regardhg Memorandum and Order

re: Priority, Anticipation, Written Description, En¿blemen[ Best

Mode, Utility, or, in the alte¡native, Motio¡-for Reconsideration (Jul.

3,2002).Gene¡tech's Second Supplemental Response to Chiron's Interroga'toryNo. 25 (lvfay 13, 2002).

Genentech lnc.'s Proposed Jury Instn¡ctions (Phase I) (Jul. 26,2ffi2).Genentech Inc.'s Roryonsive Trial Brief(Jul. 26,2002).Genentech's Objections to Chiron's Proposed Jury Instructions(Phase I) (Aug. 16,2002),Genentech' Inc.'s Memora¡dumof Points andAuthorities in Support

of Objections to Chiron's Proposed Limiting Instruction (Aug' 9,

2oo2).Genentech Inc.'s Request for a Remedial Jury Instnrction, withExhibitsA-C (Aug. 12, 2002).Memor¿ndum of Points and Authorities Supporting Genentech's

Motion for Judgment as a M¿tter of Law Under Fed. R. Civ. P 50(A)(Sep.3, 2002).Genentech's Opposition to Chiron's Motion for Judgment as a Mat-ter of Law Under Fed. R. Civ. P.50(Ä), witl attached testimony citedto therein (Aug. 16,2002).Memorandum a¡d O¡de¡ Re: Rule 50 Motions (Sep. I l, 2002).Genentech's Opposition to Chi¡on's Rule 50/59 Motion, rvithAttached Appendix of lranscript aad trial transcrþt pages cited totherein (Oct.7, 2002).Memorandumand Order Re: RenewedMotion for JMOL; Motion forNew Trial (Oct. 22, 2002}B¡ief of Defend¿nt-Cross-Appellanl Genentech, Inc. (May 12,

2003).Reporter's Trarscrip! Motion to Dismiss, Monday (May 21, 2001).

Memora¡dum a¡d Order (May 22, 2001).Fleischma¡, J. BioScience Reports 5:893-899 (1985).

Kohler, G. Bjo.Science ReporTs 5:533-549 (1985).

Marx, I. Science 229 :455456 (1985).Neube¡ger, M. TIBS347-349 (1985).Oi & Mo¡rison-Bio Techniques 4(3):214-2ll (1986).

Taked.z et al. Nature 314:452454 (1985).

Mo¡rison, S. Hospital Practice 24(10):65-80 (1989).Monison et al. Clin. Chem. 3419: 1668-1 675 (1988).Tan et al. I Immunol.135(5):3564-3567 (1985).

Slide entitled "18 Publicafions Discussing Chimeric MonoclonalArtibodies Before the 1986 Application", presented at Jury ûial(2002).Cheng et al., "Effect of deglycosylation on tle biading andirnmunoreactivity ofhuman thyroxine-binding glotulin", Joumal ofBiological Chemistry, 2 5a( I 8): 8830-8835 (Sep. 25, 197 9).DeBoer et al., "Construction of ¿ Tandem tp-lac Promoter a.nd a

Hybrid Ep-tac P¡omoter for Efficient and Conholled Expression ofthe Hu¡nan Growth Hormone Gene in Escherichia colf', Promoters:St¡ucture and Fu¡ction, NewYo¡k, Praege4 pp. 462481 (1982).

"Decision ofthe Tech¡ical Board ofAppeal 3.3.4 ofMay 14, 2001"(Regarding EP-B 125,023, Sep. I?, 2001) co¡rection to the decisio¡is attached.)."Decision on preliminary and othe¡ motions and fnal judgrnenf',

Glaxo'Wellcome, Inc. v. Shmuel Cabilly, Herberl L. Heynekea Wll-iam E. Holmes, and Ronald B. Wetzel (Patent Interference No.l0a,s32) (Sep. 4, 2002)."Final O¡der After Distict Cou¡t Judgmeat' Cabilly a al. v. Boss etc/. (Patent Interference 102,572) (Jvl. 25, 20Ol).Office Action dateóMay 27,1999 ûom Cabilly's patent applicationU.S: Appl. No. 08/909,611 (Paper l4).Decla¡ation of John Ridgway dated Jun. 17, 1999 (with attachedÞúibit A) ûom Cabilly's U.S. Appl. No. 08/909,61 I (Paper 15).

lnterviev/ Summ¿ry dated Jun.22,1999 Aom Cabilly's U.S. Appl,No. 08/909,611 (Paper 16).

lnterview Summary dated Jul. 12, 1999 from Cabilly's U.S. Àppl.No. 08/909,611 (Paper r7).Office Action d¿ted Ma¡. 2, 2000 fiom Cabilly's U.S. Appl. No.08i909,611 (Paper t8).Cabilly U.S. Appl. No. 06/483157 as originally filed Apr. 8' 1983.

Estabrook, A. a¡d J. A. K. Patterson. 1983. lmmunotherapy using

monoclonal antibodies. J of Cutaneous Patlolory I 0: 5 59-66.


as7,923,221BlPage 9

Ma¡iatis, T., E.F. Fritsch, and J. Sarnb¡ook. 1982. Table ofContents;"Ext¡action, Purification, and Aralysis of MRNA from Euka¡yoticCells", I 87-209; "synthesis and Cloning of CDNA', 2 I l-246; a¡d"Construction of Genomic Lib¡aries", 269-307.In Molecular Clon-ing A Laboratory Manual,.New York Cold Sprilg Harbor Labora-tory.Maniatis, T., E.F. Fritsch, and J. Sambrook. 1989. Table ofContents;"Expression of Cloned Genes in Cultu¡ed Mammalian Cells", 16 l'16.8 l; "Expression ofCloned Genes ín Escherichia coli", l'7.1-17.44. ln Molecula¡ Cloning A Laboratory M¿¡uâI. 2 ed. New York:Cold Spring Harbor LaboratoryHeadings in the Cabilly Application.Curriculum Vitae of Dr. RicbardYoule.Decla¡afion I of Dr. Richa¡dYoule.Hale et al. 1988. Remissio¡ i¡duction ir norHodgkin lymphomawith reshaped human monoclonal antibody CAMPATH-I H. La¡cet2 (8625):1394-1399.Kipriyaaov et aI. 1999. Gene¡ation of recombi¡ant antibodies.

Molecula¡ Biotechrclogy 12:173-20 l.CD Molecules printout ("Humal cell su¡face molecule recognized

by the lntemational Workshops on Human Leukocyte Diffe¡entiationAntigens").Renner et al. 1997. Monoclonal a¡tibodies in the t¡e¿trnent ofnon-Hodgkin's lymphoma: recent ¡esults and future prosPects. LeukemiaI r(2):S55-Ss9.Greipp, P 1992. Adva¡ces in the diagnosis and management ofmyeloma. Semina¡s in Hematology 29(3: Suppi. 2):2445.Leattre¡b¿¡row et al. 1985. Efector functions of ¿ monoclonalaglycosylated mouse IgG2a: binding and activation of cornplement

compo.nent C I and i¡teraction with huma¡ mo¡ocyte Fc receptor'

Molecula¡ Immunology 22(4):407 -415.

Nose, M. and H. Wigzell. 1983. Biological signifcance of carbohy-

d¡ate chains o¡ monoclonal antibodies. Proc. Natl. Acad. ScL USA80:6632-6636.Geochee, C. F., and T. Monica. 1990. Envi¡onmental effects onprotein glycosylation. BiolTech¡olo gy 8:421-427.Van Brunt, J. 1986. There's ¡othing (quite) like the real thing.BiolTecb-nolory 4 :835 -839.Geisse et al. 1996. Eukaryotic expression systems: a comparison.Protein Expression and Pu¡iûcation 8:21 l-242.Dean, C.J. 1994. Preparation and cha¡¿cte¡ization ofmonoclonalantibodies to proteins ¿nd othe¡ cellular components. Methods inMolecular Biology 32:3 6 t -379.Raju et al. 2000. Species-specific va¡iatio¡ in glycosylation ofIgG:evidence for tle species-speciûc sialylation a::d branch-specifcgalactosylation and importa.nce for engineering recombinantglycoproteir therapantics..Glycobiolory 10(51:417 486.Vitett¿ Declaration I @r. Ellen Vitetta),Alberts et al. Molecular Biology of the Cell, pp. 285 and 375. Ga¡landPublishing, hc., (1983).U¡laub, G. and L. A. Ch¿si¡. I 980. Isolation of Chinese hamster cellmutants deficient in dihydrofolate ¡eductase activity. Proc. NatLAcad Sci. USA 77:4216422O.Hodge, J.W. 1996. carcinoembryonic antigen as a target fo¡ ca¡ce¡vaccines. Cance¡ lmmu¡ol a¡d lmmunothet 43:127 -134.Lifely Declaration þr. 6, 1994.Wickens et al. 1978. Synthesis ofdouble-strandedDNAcomplemen-tary to l''soz'¡rie, ovomucoi4 andovalbumin mRNAs' Optirnizationfor fnll length second strand synthesis by Escherichia coli DNApolymerase l. Jour¡al ofbiological Chemistry 253Q):2483 -95.

Goeddel et al. 1979. Direct e.xpressionin Escherichia cofi of a DNAsequence coding forhuman growth ho¡mone. Natu¡e 281(5732):544-8.

Andrews, D.W. and J.D. Capra, 1980. Clinical Immunobiology. pp.

l-18, W.B. Sanders.

Takei et aI. 1980. Monoclonal antibody H9l25 reacts with functionalsubsets of T a¡d B cells: killer, killer precursor and plaque-formingcells. European Joum¿l of Immunology I 0(7): 503-9.van Nagell et al. 1980. Radioimmunodetection of primary andmeta-static ova¡ia¡ cancer using radiolabeled antibodies tocarcinoembryonic antigen. Cance¡ Resea¡ch 40(3):502-6.

Minuies ofthe public oral proceedinç before the Techlical Board ofAppeal 3.3.4 of May 22,May 26,2000, in theEuropean PalentOffice

concerning Cabilly's corresponding Europeaa Patent.

Riechm¿nn et al. 1988. Reshaping human a¡tibodies for tlerapy.

Nature322:323-327 .

Hale et al., 1990. The Campath- I antigen (cDw52). Tissue Antigens

35:I18-127.Huyn-h et al, 1984. Cons¡ucting and screening CDNAlibraries inþtIO and kgtl l. DNA Cloning, vol. I- A practical Approach 49'78.

Glov.e¡ D(Editor), IRL Press, Oxford,Medline Abshacts regarding rat anti-CDw52 therapeutic antibodies.

FileWrapperof Page U.S. Appl. No. 071717,73l,Ãledoct. 16, 1991.

Curriculum vit¿e of Dr. Ellen Vitetta.Malsuuchi et al. 1981. An analysis ofheavy chain glycopeptides ofhybridoma antibodies: correlation befween antibody specificity mdsial ic acid content. Journal ofrmmunology I 27(5): 2 I E8'90'Medline Abshacts regarding murine anti-CDt therapzutic antibod-ies.

Cobbold, S.P. and H. Waldma¡.D. 1984. Therapeutic potential ofmonovalent monoclonal antibodies. Nature 308(5958):46O-62'Neuberger et al. 1984. Recombi¡ant antibodies possessing novelefecto¡ fi:nctions. Nature 3 l2(5995):604-8.Bindon et al. 1985. Therapeutic potential ofmonoclonal ¿ntibodiestothe leukocfe-co¡nmotr altigen. Synergy and interfe¡ence i¡ comple'ment-mediated lysis. Trarsplantation 40(5):53844.Cabilly, S. andA.D. Riggs. 1985. Immunoglobulin transcripts and

molecula¡ history of a hybridoma that produces antibody to

carcinoembryonic antigen. Gene 40(I): 157-6 1.

Hale et al. 1985. Reactivity of ¡at monoclonal a¡tibody CAMPATH'I witl hum¿n leukemia cells md its possible application forautologous bone m¿¡row kansplantation. British Jou¡nal ofHaeniatology 60(l):4 1 -8.Kaufrnan et al. 1987. Coampliûcation and coexpression of human

tissûe-type plasminogen activator and mu¡ine dihydrofolatereductisã seqiences in Chi¡ese hamste¡ ovary cells. Molecular and

Cellular Biology 5:17 50-17 59..

Neubergeret al. 1985. Ahapten-specific chimae¡ic IgE antibodywithhuman physiological effector fi¡nction. Nahue 314(60081:268-70.Tan et al. 1985. Ahuma¡-mousechime¡ic inimunoglobulin genewithahum¿n va¡iable region is o<pressed in mouse myeloma cells. Jou¡-

nal ofrmmunolory 135(5):3 564 -7 .

Bruggemann et al. 1987. Comparison of the effector functions ofhumal immunoglobuli.ususing amatched set of chimeric antibodies,

Journal of Experimental Medicine 166(5): l35l6l,Sun et al. 1987. Chirne¡ic antibody with human constant regions and

mouse variable regions directed against ca¡cinoma'associated a¡ti-gen l7IA. Proc. NatL Ac¿d. Sci. 84(l):214-8.Weidle et aI. 1987. Reconstitution of frmctionally active antibodydiréèted agai-nst creatine kinase from separately expressed heavy and

light chains in nonJynphoid cells. Gene 5l(I):21-9.Weidle et Ll. 1987. Expression of antibody CDNA in mu¡inemyeloma cells: possible i¡volvement ofddditional regulatory ele'ments in tanscription ofiluaunqglobulin genes. Gene 60 (2-3):205-2t6.Zettlmeissl et al. 1987. Expression of biologically active hurnan

antith¡ombi¡ III i¡ chinese hamster ovary cells. BiolTecbaolory5:720-5.Dangl et al. 1988. Segrnental ûexibility and complement fxation ofgenetically engineered chimeric human, rabbit and mouse antibod-ies. EMBO Journ al 7 (7 ) :1989 -9 4.Monison et al. 1988. Genetically engheered antibody molecules:

new tools for ca¡cer therapy. Calcer Iwestigation 6(2): lE5-92.Morrison et al. 1988. P¡oduction and cha¡acterization of geneticallyengineered antibody molecules. Clinicat Chemisbry 34(9 l): l66E-75'Riechlnann et al. 1988. Expression ofan artibody Fv fragment inmyêlòma cells. Joumal of Molecular Biology 203(3):825-8.Jamès Scott C¡owe Decla¡ation dated Nov. 2, 1994.

Verhoeyen et al, 1988. Reshaphg human antibodies: grafting aa

antilysozyme activity. Science 239(4847):1534'6.Wallick et al. I 988. Glycosylation of a VH residue of ¿ monoclo¡alartibody agai-nst alpha (t+6) do<ba.n increases its âffinity for arti.gen. Journal of Experimental Medicine 168(3):lD9-109'


us7,92322lBlPage l0

Tsuchiya et al. 1989. Effects ofgalactose depletion from oligosac-cha¡ide chai¡s on immunological activities of huma¡ IgG. Journal

ofrheumatology l6:285-90.Baldwil, R.W. et ¿1. 1990. Monoclonal A¡tibodies and

Immunoconjugates. The Pa¡thenon Publishing Group.

Grossba¡{ M.L. 1998. Monoclonal AntibodyBased Therapy of Can-

cer. lvfarcel Del:ker.Jefferis et al. 1998. IgG-Fc-mediated effector fu¡ctions: moleculardeûnitio¡ of interaction sites for effector ligands and the role ofglycosylation. immunological Reviews 163:59-7 6.Cabilly Claims Coresponding to the Count.Availability of CEA.66-83.Declaration 2 of Dr. Richa¡dYoule.Sidman, C. 1981. Differing requirements for glycosylation in the

sec¡dion of related glycoproteins is determined neither by the pro-ducing cell nor by the ¡elative number of oligosaccharide units.

Journal ofbiochemistry 256(18):937 4 -931 6.

Blatt, C. andJ. Haimovich. 1981. The selective effect of tunicamyciaon tie sec¡etion oflgM and IgG produced by the same cells. Eu¡o-pean Journal of Immunology 1l :65-66.Cabilly U.S. Appl. No. 071205,419, ûled Jun. 10, 1988.

Cabilly U.S. Appl No. 08/909,61l, ûled Aug. 12, 1997.Trill et at. 1995. Production of monoclonal antibodies in COS andCHO cells. Cunent Opinion in Biotechnology 6: 553-560.De Waele et al. 1988, Expression in non-tymphoid cells of mouserecombinant immunoglobulin directed against the tumor ma¡ke¡human placental alkaline phosphatase. Europeal Joum¿l of Bio-chemistry 17 6:287 -295.Jun. 2, l9&7 Communication from EPO Examiner during prosecu-

tion ofCabilly et al. European appl. No. 84302368.0-2105.Jan. 29, 1987 r€sponse of Cabilly et al. tled before EPO duringprosecution ofCabilly et al. European appl. No. 84302368.0-2105.Feb. 9, 1988 response of Cabilly et al. filed before EPO duringprosecution of Cabilly et al. European appl. No. 84302368.0-2105.Se¿¡ch results ofÄTCC product listing ofdeposited cell lines.Tarenti¡o et al. 1974. The ¡ele¿se of intact oligosaccharides ftomspeciûc gþoproteins by Endo-o-N-acetylglucosaminidase H. Jou¡'nal of Biological Chemistry 249:8 18-824.Morell et al. 197 l. The role of sialic acid in dete¡mining the *uvivalof gþoproteins in the circulation. J BioL Chem. 246:1461-1467.Achord et al. 1978, Human O-glucu¡onidase: invivo clea¡a¡ce a¡d invitro uptake by a gþoprotein recognition system onreticuloendothelial cells. Cell 15:269-278.Oldha¡¡u R. 1983. Monoclonal ¿¡tibodies i¡ cancer therapy. Journalof Clinical Oncolory I :582-590.Rosen et al. 1983. Applicatìon ofmonoclon¿l a¡tibodies to tumordiagnosis and therapy. A¡nals of Clinical and Laboratory Sciencel3:173-184.Levy', R. and R,A. Miller. 1983. Biological and clinical implicationsof lynphocyte h1ôridom¿s: tumor the¡apy with monoclonal antibod-ies. A¡¡. Rev. Med-34:107-l16.Krolick et al. 1982. ln vivo therapy of a Murine B cell tumor (BCL I)using antibody-ricin a chain ir¡imunotoxins. J Exp. Med. 155:1797 -1809.Fre¡kel et al. 1980. A-nalysis and detection of B cell neoplasms.Blood Cells 6:783-793.Amendment filed in Cabilly U.S. Appl. No. 08/909,611 on Aug. 12,

t997.Amendment filed in Cabilly U.S. Appl. No. 08/909'61I on Feb. 22,1999.Legal Analysis Concerning Written Description.Decla¡alion 4 of Dr. Richa¡dYoule.Preliminary Amendment of Ma¡. 30, 1994 submitted in tle '403patent.Examiner's lnterview Summary Reco¡d issuedon Jun. 6, 1995 in the'403 patent.Amendment of May 8, 1995 submitted in the '404 patent.

Amendment of May I I, 1995 submitted in the '405 patent.Gold et al. 1978. Ca¡ci¡oembryonic antigen (CEA) in clinical medi-cine. Cance¡ 42: 1399-1405.Interference I¡itial Memora¡dum.Genentech, lnc. released product sales for Rituxan.Genentech, lnc. P¡ess release ofOct. ll, 2000.

Genentech, I-nc. Press ¡elease of 1999 yearendresults issued Jan' 20'

2000.C¿nce¡.l,ta sheet from the National Ca¡ce¡ Institute'CancerNef'internet site.FDA P¡oduct Description Sheet.

Grillo-Lopez et al. Overview of the clinical development ofrituxim¿b: fi¡st monoclonat antibody üealment approved for the

beatnent of lymphom¿. Seminars i¡ Oncology 26:66-73 .

M¿, S. atrdW Nashabeh. 1999. Carbohydrate a.nalysis of achimericrecombina¡t monoclonal by capillary electrophoresis with laser-in'duced fluo¡escence detection. A¡allical Chernisry 7 I:5L85'5192.Datasheet on CD52 ûom Workshop on Leukocyte Antigens'Lingappa et al. 1980. Signal sequences for early events in protein

sec¡etion aud rnernb¡a¡e A¡n. NYAcad. Sci. 343:356-61 'Decla¡ation 3 ofD¡. Richa¡dYoule.File Wrapper of Page U.S. Appl. No. 07 /943,146, fr\eÅ Sep l0' 1 992

File Wrapper ofPage U.S. Appl. No. 08/046,893' filedApr. 15' 1993.

Daf¿sheet on çDt from Workshop on Leukocyte Aatigeirs.Kaetzel et â1. 1985. Expression ofbiologically active bovi¡e lutein'izing honnone il Chi¡ese hamste¡ ova¡y cells. P¡oc. Natl. Acad Sci.

USA82:7280-7283.Robinson U.S. Appl. No. 071016,202, filed Prelimin¿¡y Jan. 8' 1987.

RobinsonU.S. Aþ. No.08/471,984, filed Ju¡.6, P¡eliminary 1995.

Request for Admissions l-l l-Rih¡xan.Hercqrtin--description sheets (4 pages)'Vitetta Declaration 2.Youle Decla¡ation 5.

Mark Sydenham Decla¡ation.Declaration 2 ofJ. Scott Crowe.Robinson U.S. Appl. No.09/02 1,934, ûledFeb. 12, 1998 and selectedpapers from the ûle wrapper.File Wrapper of USP 5,545,404.File Wrapper of USP 5,545,405.Rademacher et al.(1984¡ 4-. Rw. Biochem. 57:7E5-838.

HaIe Declaratio¡.Youle Decla¡ation 6.Deposition Transcript of Ellen Vitetta, Jan. 8, 200 l.Deposition Transcript of James S. Croure Dec. 14, 2000.VS Fo¡m l6-64-U.S Veterinary Permit for lmportation and Trans-portation of Controlled Materials and Organisms and Vectors-Per-mit No. 2?899-Date Issued: Nov. 8, l99l-Re: Campath lHMoriòclonal Aatibody.Intemal Notice of Shipment of Carryattr lH May 10, 1990'

Deftsition Transcript of Stephen Deside¡io Dec. 28,2000'Deþsition Transcript of RichørdYoule Jal. 3, 2001.Deþsition Transcript of Sharon Krag Ja¡. 5' [email protected]¡bsition Transcript of Mark Robert Lifely Jan. 9, 2001 'Deposition Transcript ofJoha Shively Jan. 12,2001'Stevenson et aI., 1989, A Chimeric AntibodyWith Dual Fc Regions(blsFabFc) Prepared by Manipulations atthe IgG Hinge, A¡ti'Ca¡ce¡Drug Design 3,219-230.Cobbold et al., Bone Manow Purging and Processing, Ja¡' I, 1990.

Cabilly Claims 53-67.Potamia¡os et al. 2000, R¿dioimmunoscintigræhy and Radioim-munotlerapy i¡ Cancer: Princþles and Application, Antica¡cerResea¡ch 20, 925-948,Wright and Mor¡ison, 1994 Effect of Alte¡ed CH2'associated Ca¡'bohy&ate Strucûre 6¡ úe functi¡nal Properties and In Vivo Fate ofChime¡ic Mouse-Huma-n Immunoglobulin GI, J E><p. Med 180' 1087-

1096.Goochee et al. 1991, "The Oligosaccha¡ides of Glycoproteins:

BioP¡ocess Factors Affecting Oligosaccharide Structue and Thei¡Effect on Glycoprotein Properties", BiolTecbnology 9 , 1347 '1355.Ashfo¡d et al. 1993 "Site-speciûc Gþosylation ofRecombinant Rat

and Human Soluble CD4 Variants Expressed i¡ Chinese Hamster

Ova¡y Cells", J BioL Chem,, 268,3260-3267.Davis ef al . 1 990, "High Level Expression in Chinese Hamster OvaryCells of Soluble Forrns of Clt T Lymphocyte Glycoprotein Includ-ing Gþosylation Variants." J BioL Chem. 265, 10410-10418.Ma¡. 28, 1989-I¿b Meetilg-haldwritten notes-First Mentio¡ ofCampath-lH,3 pages.

Ma¡. 6, 1989 Memo¡andum from Jeftey M. Johnston, M.D. Re:

CAMPATH and R¡eumafoid Arthritis Overview Medical Position.


as7,923,221ßlPage ll

Jul. 13, I989-handwdtte¡ trotes--4 pages.

Jun. 1 t, 1990-LaboratoryNotebook90/O522,IodinaTion of C- I H.CV oflind¿ Thurmond.CV of Mark Sydenharn.l3l Decla¡ation of Rapson.L.aborafory Notebook (Glaxo EyJ. 2212).Laboratory Notebook (Glaxo Exh. 2213).Laboratory Notebook (Gla:<o Ezú. 2214).I-aboratory Notebook (Glaxo Eyú,. 2215).I-aboratory Notebook-Feb. 25-Sç. 3, 1992.I-aboratory Notebook (Glaxo EvJ,. 2217).CV of James S. Crowe.Page et al., Biotech, 9:64-68 (1991),Vitetta Declaration 3.Jul. 13, 1989 Memo¡andum from Jeffrey M. Job¡sto¡ to ResearchCommittee RE: Campath-lH: A Huma¡ized A.ntiJynphocfiemonoclonal antibody.Joziasse, et al., 2000 "aj-Galactosfated gþoproteins ca¡ bind tothe hepatic asialogþoprotein recçtor" Eur. J Biochem. 267:6501-6508.Clynes et aI., 2000 "lnhibitory Fc receptorsmodulateinvivo cloxic-ity against hrmor antigens" Natùe Med 6: 443446.Thurmond Pe¡sonal Notebook Entry for Oct. 17, 1944.Whittle et al. Expression in COS cells of a mouse-hum¿n chimaeric872,3 artibody, 1987, pp. 499-505, vol. I, No.6.Thurmond 13 I Decla¡ation.Crowe Decla¡ation wlth Exhibits.Lifely Declaration with Exhibits dated Apr. 6, 1994.Youle Declaration 7.

Herceptin description sheets from Genentech web site (16 pages).

Rituan description sheets from Genentech web site (l I pages).Historical Product Sales (from Genentech web site 3 pages).

Genentech Re,ports 1999 Year-End Results (fiom Genentech website).Genentech Reports 25 Percent I¡c¡ease in Product Sales for ThirdQuarter (from Genentech web site).Hale, "Effects of Monoclonal AntiJymphocyte Antibodies inVivo inMonkeys and Humans", Mol Biol Med (1983) 1, 321-334.Reuters news a¡ticle and San F¡ancisco Chronicle News a¡ticle.Results of Medline search of'therapeutic antibodies" years 1966-1990.Vitetta Decla¡ation 4 position.Ce¡titcate of Conect lnventorship USP 5,545,4U, Í¡n. l7, 1997 .

Certificate ofCorrect Inventorship USP 5,545,405, Iun. 17, 1997.J. Baselga et ¿1., "Recombinant Hurm¡ized Anti-HER2 Altibody(Herceptinru) Enhances the A¡titumor Activity of Paclitaxel andDoxorubicin against HER2/¿ø¿ Overexpressilg Fluman Breast Can-ccr Xenografts", Ca¡cer Res. (1988) 58: 2825-2831.T.E. Hotaling et al., "The humanized anti-HER2 artibody rhuMAbHER2 medietes antibody dependent cell-medi¿ted cytotoxicþ viaFcyR III", hoc. Am. Assoc. Ca.ncer Res., 1996,37:471(#3215).M.D. Pegram et al., "Antibodydependent cell-mediated cytotoxicityin breast cancer patients in Phase Itr clinical trials of a humanizedanti-HER2 antibody'', Proc Am. Assoc. Cancer Res., 1997, 38:602(#4044).Declaration of lvfary A.me Armshong.Declaration of Jeftey J. Ber¡s.Library of Congress Onliae Caølogrecord for Cabilly Exhibit 1074.

Deposition ofVitetta M¿¡. 19, 2001.Glaxo Weilcome Inc. Objection to Admissibility of Evidence, Dec.20,2000.Glaxo Wellcome Inc. Objection to Admissibility of Evidence, Jan.23,200t.Glaxo Wellcome lnc. Objection to Admissibility of Evidence, Feb. 9,2001.Glaxo Wellcome Inc. Objection to Admissibilify of Evidence, Apr. 3,2001.Transcript ofteleconfe¡ence witl APJ on Apr. 5, 200 l.Order autlorizing Glaxo Supplemental Oppositions.Code of Medical Ethics ând Curent Opinions, o(cerpts from pp.339-379.Excerpts from 2l C.F.R.Vitetta Decla¡ation 5.

Supplernental [3 I Decla¡ation of Thurmond.Horne v. Potton.Office Action in U.S. Appl. No. 08/046,893 to Page dated Jun. 23,

1993.

Amendment in Page U.S. Appl. No. 08/155,864 dâted Feb. 28, 1995.

Cabilly Objection to Evidence, Nov. 13, 2000.

Letter dated Apr. 20,2001f¡om Jean Hamey to Jerry Murphy.Excerpts from Lifely Lab notebook ZEIA,/90/17.National Library of Medicine PubMed MEDLINE recordforCabillyExhibit 1074,

Oct: 17, 1994 Teleconference on Campath Long Term Follow Up(handwritten sheet and tra¡slation page).

Declaration 3 of Crowe.Declaration 2 of Jeffiey J. Berns.Library ofCongress Online Catalog record for Cabilly Exhibit f 073.

Keshet etal, "Cloningofbovine growth hormone geneandits er<pres-

sion in bacte¡ia'' Nucleic Acids Resea¡ch, 9: f9-30 (1981).

Rice et al., "Me¿surement of tra¡sient cDNA expression in mamma-

lian cells using flow cfomefic cell a-nalysis and soÍing', Cytometry,12:22r-233 (199r).Taniguchi et al., "Expression oftle Human Fibroblast InterferonGenein Escherichia colf',Proc. Natl. Acad. Sci. USA,77(9):5230-s233 (sep. 1980).Wi¡kelhake et al., "Effects of pH hea.trnents and deglycosylation ofrabbit immunoglobuli¡ G on tle binding of Clq" Journal of Biologi-cal Chemistry, 255Q):2822-2828 (Apr. I 0, I 980).NoticeofAllowability, Paper No. 2l d¿ted Ju¡. 13, 1995 in the '864application.Notice of Allowability, Paper No. 9 d¿ted Jun. 7, 1995 in the '400application.Notice of Allowabiliry Paper No. 9 d¿ted Jr¡n. 8, 1995 in the '401application.Beatty et al., Cancer Research 49 : 1587 -l 59 4 (Mar. I 5, 1989).Beatty et al., Ca¡cer Resea¡ch (Sup,pl.) 50:922s-926s @eb. I, 190).Williams et al., Cancer Resea¡ch (Suppl.) 50:1029s-1030s (Feb. I,r990).Neumaier et al., Cancer Resea¡ch 50:2128-2134 (Apr.1, 1990).Dud¿ et al., J. Surgical Oncology 44:73-77 (Jun. 1990).Riechma¡¡ et al, Natu¡e 332:323 (Mar. 1988).Friend et al., T¡a¡splantation 48:248-253 (Aug. I, 1989).Hale et a1., The La¡cet, Dec. f7, 1988, pp. 1394-t399.Dyer et al., Blood 73: 143 l-1439 QtIay l, 1989).Stevenson et al., BloodTT:1071-1079 (N,far. t, 1991).Cobold et al., Bone Marrow Ruging and Processing, pp. 139-154(Jan. I,1990).Declaration of Stephen V Desiderio, M.D., Ph.D.Decla¡ation ofSharon S. Krag, Ph.D.Decla¡alion of Jobn E, Shivel¡ Ph.D.Kaufman et al., Molecular and Cellula¡ Biology 5:1750-1759 (Jul.

1985).Neuhaus et a1., JACC 14:1566-1569 (Nov. 15, 1989).Activase@ (Alteplase) pacløge insert dated Jun. 1988.

Declaration of James Scott Crowe, zubmiüed in the '864 application,dated Nov. 17, 1994.Decla¡ation ofRobert Lifely, submitted in the '864 applicalion, datedJu¡.4,1994.Declaration of Geoftey Hale, submitted in the '864 application,dafed Nov. 16,1994.Joziasie et al., Subcell Biochem.32:2548 (1999).Peakma¡ et a1., Hum. Antibod. Hybridom¿s 5:65-74 (1994).Cur¡iculum vitae of Jobn E. Shively, Ph.D.Cuniculum vitae of StephenV Deside¡io, M.D., Ph.D.Cuniculum vitae of Sharon S. Krag, Ph.D.Krag, J. Biol. Chem.254:9167-9177 (1979).

Rlodes, Adv. A¡im. Cell. Biol. Technol. Bioprocess., 472-1 4 (1988).Rlodes and Bi¡ch Biotechnology 6:518, 521, 523 (1988).Colche¡ et al., Ca¡ce¡ Res. 49:1138-1745 (1989).Citation of l¡for¡¡ation, dated Sep. 6, 1995 in tle '400 applicæion.Citatio¡ ofl¡form¿tion, PaperNo. 14 dated Sep. 6, 1995 in tle '401application.Examiner Communication, PaperNo.30 dated May 16, 1996 in '864aprplication.


as7,923,221BlPage 12

Examiner Communication, Paper No. 17 dated Dec. 29, 1995 i¡ the

'400 application.Examiner Cornmunicatio¡, Paper No. 15 d¿ted Jan. 5, 1996 i¡ fle'401 application.Bym, et al., Natu¡e 344:667{70 (Apr. 12, 1990).Sekigawa et al., J. Virolory 64:5 I 94-5 I 98 (Oct. I 990).Offce Action dated Mar. lO, 1992, Paper No. 5 in U.S. Appl. No.07/770,73O,Ãled Oct. 16, 1991.Preliminary Amendment, Paper No. 9 ir U.S. Appl. No. 08/ I 5 5,864,filedNov. 23, 1993 in U.S. Appl.No.08/155,864, frledNov.23, 1993

DeclarationofRobert Lifely, Paper No. 10, ¡eceived in e,xecuted fo¡min Group 1800 on Apr. 12, 1994 in tle '864 application,Prelimi¡ary Communication, Paper No. 15, ¡eceived in G¡oup 1800

on Nov. 17, 1994 in tle '864 application.Declaration of Ja¡nes Scott Crowe, Paper No. 16, received ino<ecuted form in Group I 800 on Nov 17 , 1994 in the '864 applica-tion.Decla¡ation of Geoftey Hale, Paper No. 16, received in executedform in Group 1800 on Nov. 17, 1994 in the '864 application.Amendment, PaperNo. 18, received in Group 1800 o¡ Feb. 28, 1995

in the '864 application.Office Action d¿ted Jan. 6, 1995, Paper No. 4 in U.S. Appl. No.08/335,400, ûled Nov. 3, 1994.Amendment d¿ted May 8, 1995, Paper No. 7 i¡ tle '400.

Ofrce Action dated Jan. I l, 1995, Paper No. 4 itr U.S. Appl. No.08/335,401, ûled Nov. 3, 1994.Amendment dated May I t, 1995, Paper No. 7 in the '400.Routledge et al., Etu. J. Immunol. 199 l, 2l :27 l7 -27 25.Finnegan et al., J. Rheumatology 1997 ,24:7 , 1448-1449.Crowe, et al., "Cli¡ical Experimental lrnmunolog/', 1992, 8?, p.105-l 10.

Second Decla¡ation of Sharon S. Krag, Ph.D.Hale, Progress Report (Ir4ay 1990-Dec. 31, 1990), MRC WellcomeTherapeutic Antibody Center.Hanis, et al,, hoceedings of the 34'å Oholo Conference, Eilat, Israel(lee0).K.hazaeli, et al., Ca.ncer Research, 5I, 5461-5466 (1991).

Thi¡d Declaration of Sharon S. Krag, Ph.D.Zettlmeissl, et al., Bio/Iechnoloqy, 5:7 2O-7 25 (1987).

Goeddel, Methods in Enz¡rmology, vol. 185, "Ge¡e Expression Tech-nology''(1990).U.S. Appl. No. 08/909,61 I application.205,419 application.483,457 application.Amendment filed concurrently herewith in the '61I application.Interference lnitial Memorand¡rm (Form 850), dated signed by the

Examiner on Apr. 12, 2000.Meredith, et al., Hum. Antibod. Hybridomas, 1993,4:190-19'l.Decla¡ation of Steven B. Kelbe¡.Emery & Adair, Erp. Opin. lnvest. Drugs (199$ 3(3):241-251.Begent et al., Br J. Cancer, 62:487 (1990).Woodetal., J. Immunol., vol. 145:3011-3016, No.9, Nov. I, 1990.

Protocol UAC 180 ofthe University ofAlabam¿'s ComprehensiveCance¡ Center, describing Clinical Phase I ûials conducted over theperiod Nov. 1989 tlrough Oct. 1990. (See in particular, $5. I, p. 9.).

Dala Report for Protocol UAC 180 datedAug. 24, 1990: Patient dqte

collected after administration of c872.3 monoclonal antibody.Status RepoÍ: Phase I Contract Cancer Therapy Evaluation ProgramNo. l-CM-9761I d¿tedFeb.4, 1992(¡tp. l-12).Meredith et al, J. Nucl. Med Jal 1992,33:23-29 (pp. 13-19).K\rzzeli et al., Ma.nuscrþt-Frequent A-nti-V Region lmmu¡eResponse to Mouse 872.3 Monoclo¡al Antibody (pp. 25-63).Me¡edith et al., J. NTucl. Med., vol. 33, No. 9: 1648-1653, Sep. 1992.

Sheeley et al., Aaal¡ical Biochemistry 247 , l02-ll0 (1997).

Amendment filed Feb. 25, 1999 ir '61I application.File History U.S. Appl. No. 08/909,611.James Scott C¡owe Deposition Transcript.Methods inE¡z]¡molory, vol. I0l, PartC, Table ofContents, p. v-viii.Chang et al., Proc. Natl. Acad. Sci. USA, vol. 84, pp, 5&0-5644(1e87).Haynes a.nd Weissman¡, Nucl. Acid. Res., vol. I t No. 3 (1983),Hutchins et aI., hoc. Nad. Acad. Sci. USA, vol. 92, (1995).

Reffet al., Blood, vol. 83, No. 2, pp.435445 Q99\.

Yarring¡on Deposition Transcript and Supporting Exhibits.Second Declaration of Stephen V Desiderio, M.D., Ph.D.

LoBuglio Deposition Transcript.Krag et al., J. Biological Chemistry, vol. 257, No, I 4, p. 8424 (1983)'

Berman et al, Science, Nov 4,1983;222(4623):524-7.Fou¡th,Decla¡ation ofSharon S. Krag, Ph.D.Deposìtion Transcript of EllenVitett4 Ph.D'Deposition Transcrþt of RichardYoule, Ph.D.Thi¡d Declaralion of StephenV. Desiderio, M'D , Ph.D.

Deposition Transcript of Sharon S. Krag, Ph.D.

Deposition Transcript of Robert Lifely, Ph.D.' Jaa 9, 200 1'

Deposition Transcript of StephenV Deside¡io, M.D., Ph.D.

AICC deposit veriûcation for CEA.66-E3 .

ChaÍ Entitled "Human Leucocyte Surface lvfarkers" by

Lnmunotech.Ettinger, et al. Ca¡cer T¡eatnent Reports vol. 83, No' l, pp 13 I - 134'

Ja¡. 1979.

Spellman et at, 1989, J. Bio. Chem. 264:14100-141 I l.T¿keuchi et aI., J. Biol. Chem.,263:3657-3663'KagawaY; J Biol Chem Nov 25, 1988;263(33):17508-15.Excerpts from '403 P¡osecution File History ('864 applicatiol) (notentire frle history).Excerpts from '404 P¡osecution File History ('400 applicatior) (notentire ûle history).A¡th¡itis& Rheum¿tism, Abstract Suppl. vol. 39, No' 9, Sep. 1996' p.

s244.Science, vol. 232, Jun. 1986-Arathoon, et al.-Large'Scale CellCultwe in Biotechnology pp. 1390-1395.LoBuglio a¡d Saleh, Am. J. Medical Sciences, Sep. 1992 vol.304'No.3, pp. 214-224.Primus et al., Cancer Immunol. Immunotlerapy ( 1990) 3 f : 349-357.

Transcript from Second Deposition ofRobert Lifely, Ph.D.Transcript from Deposition of Nicholas Rapson, Ph.D.TranscriS from Second Deposition ofJames Scott Crowe, Ph.D'Transcript from Second Deposition ofRichardYoule' Ph D.Transcript ftom Second Deposition ofEllenVitetta, Ph.D.

Lifety et al., Glycobiology, vol. 5 No. 8;8I3-822, 1995.TrÉuiscript from Second Deposition ofSha¡on Krag, Ph.D.

Deposition Transcript of Mark Sydenham.Excerpts from the '405 hosecution File History ('401 application).Decla¡ation of Vladimi¡ D¡ozdoff, Ph.D.Ve¡dict-United States Disbict Court, Disbict of Delawa¡e.Ellen Vitetta Deposition Transcript, May 21, 2001.Abshact, Journal of Nuclear Medicine' May 1990, No. 613.

Absbact, Wo¡ld Federation of Nuclear Medicine & Biology, AbsEactsubtritted Jan. 15, 1990.Li¡daThurmond Deposition Transcnpt, Ùfay 18, 2001

I990 Abst¿ct Fo¡m fo¡ Scientific Papers by M. B. Khazaeli, Ph.D.

Cancer Principles & Practice ofOncolory, 5'å Edition, vol. l, Chapter

18, pp. 360-372.Abstract 76, Antibody Immunoconjugates and

Radiopharmaceuticals, I 990.Notice Declaring lnterferetrce, May 15' 2000.

Notice of ReaI Pa4y-in-lnterest, May 25'2000'Glaxo Wellcome lnc. Notice of Re¿l Party in Interest, May 26,2000Glaxo Wellcome Notice of lntent to File helimi¡ary Motions, Jul.r0, 2000.Cabilly List of Preliminary Motions, Jul. I l, 2000.

Cabilly Notice, 37 C.F.R. $1.660(d), Jul. t 1, 2000.Glaxo Wellcome lnc.'sList of P¡elimi¡aryMotions It lntendsto File,Jul. I l, 2000.Glaxo Wellcome Inc. Notice of Related Litigation, Jd. I f , 2000.

Glaxo Wellcome Inc.'s Miscellaneous Motion I (with attachments),Sep. 28,2000,Cabilly Opposition to Miscellaneous Motion t, Oct. 5, 2000.

Glaxo Wellcome Reply to Opposition to Miscellaneous Motion I,Oct. 10,2000.Order Denying Glaxo rüellcome Inc. Miscellaneous Motion I, Oct.18,2000.OrdelRegardhg Discovery Oct, 26, 2000.Cabilly Preliminary Statement, Nov. l, 2000.Cabllly Preliminary Motion l, Nov. 1, 2000.Cabilty Preliminary Motion 2, Nov. l, 2000.


us7,92322lB[Page 13

Cabilly Preliminary Motion 3, Nov. 1, 2000.Cabilly Preliminary Motion 4, Nov. l, 2000.

Cabilly Preliminary Motion 5, Nov. 1, 2000.Cabilly Preliminary Motion 6, Nov. 1, 2000.

Glaxo Wellcome, lnc.'s Preliminary Motion l, Nov. l, 2000.Glaxo Wellcome, lnc.'s P¡elirninary Motion 2, Nov. l, 2000.

Glaxo Wellcome, lnc.'s P¡elimi¡ary Motion 3, Nov. l, 2000.Glaxo Wellcome, lnc.'s P¡eliminary Motion 4, Nov. l, 2000.

Glaxo Wellcome, Inc.'s Prelimina¡y Motion 5, Nov. 1, 2000.Glaxo Wellcome, lnc.'s P¡elimi¡ary Motion 6, Nov. l, 2000 .

Glaxo Wellcome, Inc.'s Preliminary Motion 7, Nov. l, 2000.


Glaxo Wellcome, Inc.'s Prelimina¡y Motion 9, Nov. l, 2000.Glaxo Wellcome, Inc.'s Preliminary Motion 10, Nov. 1, 2000.

Glaxo Wellcome, lnc .'s P¡elimi¡ary Motion I I , Nov. I , 2000 .


Glaxo Wellcome, lnc.'s Preliminary Motion 13, Nov. l, 2000.Glaxo Wellcome, Inc.'s Preliminary Motion 14, Nov. l, 2000.

Letter Regarding Er¡or in Notice Declaring lnterference, Nov. l,2000.Glaxo Wellcome lnc. Preliminary St¿tement, Nov. 8, 2000.Glaxo Wellcome Objection to Admissibility of Evidence, Nov 8,

2000.Cabilly Prelininary Motion 7, Nov. 13,2000.Cabilly Preliminary Motion 8, Nov. t3, 2000.Cabilly Preliminary Motion 9, Nov. 13, 2000.Cabilly Miscella.neous Motion I (Motion for Permission to Issue aSubpoe¡¿. 35 U.S.C. $24), Dec. 8,2000.Opposition to Cabilly Miscellaneous Motion I, Dec. 15, 2000.Cabilly Replyto Opposition to Cabilly Miscellaneous Motion l, Dec.20,2000.Decision G¡anting Cabilly Miscellaneous Motion I, Dec. 20, 2000.Cabilly Responseto Objections to Admissiblity ofEvidence. Jan. 16,

2001.Glaxo Response to Cabilly's Objection to Evidencg Jan. 16, 2001.Glaxo Wellcome Miscellaneous Motio¡ 2, Ja:n. 16, 2001.Glaxo Wellcome Miscellaneous Motio¡ 3, Ja¡. i6, 2001.Order Denying Glaxo Motions Miscellaneous Motions I and 2, Ja¡.29,2001.Cabilly Opposition l, Feb. 2, 2001.Cabilly Opposition 2, Feb. 2, 200 L

Cabilly Opposition 3, Feb. 2, 2001.Cabilly Opposition 4, Feb. 2, 200 L

Cabilly Opposition 5, Feb. 2, 2001.Cabilly Opposition 6, Feb. 2, 200LCabilly Opposition 7, Feb. 2, 200 1.

Cabilly Opposition 8, Feb. 2, 2001.Cabilly Opposition 9, Feb. 2, 2001.Cabilly Opposition 10, Feb, 2, 2001.Cabilly Opposition I I, Feb. 2, 2001.Cabilly Opposition 12, Feb. 2, 2001.Cabilly Opposition 13, Feb. 2, 2001.Cabilly Opposition 14, Feb. 2, 2001.Glaxo Op,position to Motion l, Feb. 2, 2001.Glaxo Oprposition to Motion 2, Feb. 2, 2001.Glaxo Opposition to Motion 3, Feb. 2, 2001.Glaxo Opposition to Motion 4, Feb. 2, 2001.Glaxo Oprposition to Motion 5, Feb. 2, 2001.Glaxo Opposition to Motion 6, Feb. 2, [email protected] Opposition to Motion 7, Feb. 2,2(Ð1.Glaxo Opposition to Motion 8, Feb. 2, [email protected] Oprposition to Motion 9, Feb. 2,2ffi1.Glaxo Miscella¡eous Motion 4, Fú.2,[email protected] Miscella¡eous Motion 5, Feb. 2,[email protected] Response to Glaxo Miscellaneous Motion 4, Feb. 8, 2001.Order Grarting Glaxo Miscellaneous Motion 4, Feb. I 3 , 200 I .

Cabilly Responseto Objection to Admissibilityof Evidence, Feb. 22,2001.GlaxoWellcome Miscellaneous Motion 6 (Corect Opp. No. 3), Mar.9,2001.GlaxoWellcomeMiscellaneous Motion 7 (Correct Opp. No. 5), Mar.9,2001.

Glaxo Wellcome Miscellaneous Motion 8 (Conect Oprp. No. 6), Mar.9,2001.Glaxo Wellcome lnc.'s Miscellaneous Motio¡ No. 9, Mar' 16, 2001.

Cabilly Reply I, INlar 27, 2001.Cabilly Reply 2, Mal27,2OOl.Cabilly Reply 3, Mar 27,2OOl.Cabilly Reply 4, Ma¡.27,2O01.Cabilly Reply 5, Mal27,2O0LCabilly Reply 6, M ar. 27 ,2O0l.Cabilly Reply 7, Mar.21,2001.Cabilly Reply 8, Mat. 27 ,2001.Cabilly Reply 9, M at 27 , 2001.Glaxo Reply 1, M^r. 27, 200 L

Glaxo Reply 2, Mz-r. 27 , 2001.Glaxo Reply 3, Mar. 27, 2001.Glaxo Reply 4, M^l 27 ,2001.Glaxo Reply 5 , Mati 27 , 2001 .

Glaxo Reply 6, Mar. 27 ,2001.Glaxo Reply 7, Mar. 27, 2001.Glaxo Rçly I, Mzl 27, 2001.Glaxo,Reply 9, MÂr. 27, 2001.Glaxo Reply 11, Ma¡. 27, 2001.Glaxo Reply 14, INla¡. 27, 200l-OrderGranting GlaxoWellcomelnc. Miscellaneous Motions,Apr 2,

200t.Order Authorizing Glaxo Supplemental Opposition 6, Apr 6' 2001.

Cabilly Motion to Suppress,3T C.F.R. $1.656(h), Apr. 18, 2001.Glaxo Wellcome Inc.'s Request forDefe¡Decision on Motions UntilFinal Hearing or to Pennit the Filing ofBriefs, Apr. 18' 2001.

Glaxo Wellcome lnc.'s Obsewations, Apr. 18, 2001.Glaxo Wellcome lnc.'s Miscellaneous Motion l0*(Suppress NewEvidence Supporting Cabilly Rçly 6), Apr. 18, 2001.Glaxo Wellcome lnc.'s Miscellaneous Motion 1l(Supression ofCertain Deposition Exhibits and Deposition Testimony), Apr. 18,

2001.Glaxo Wellcome lnc.'s Miscellaneous Motion 12 (Suppression ofDeposition Testimony), Apr. 18, 2001.Glaxo Wellcome Inc.'s Notice of Change of Real Party i¡ Interest,Apr. 19, 2001,Petition from the Apr. 6, 2001 Order of the APJ Under 37 C.F.R'1.6.{4(a)(l), Apr. 20, 2001.Memorandum Opinion and Order, Apr. 30, 2001.Order Regardi-ng Glaxo Wellcome Inc. Motions, May 2,2001.Cabilly's Opposition to Glaxo Wellcome Misc. Motion 10, May 2,2001.Cabilly's Opposition to Glaxo Wellcome Misc. Motio¡ I l, May 2,200r.Cabilly's Opposition to Glaxo Wellcome Misc. Motion l2,May 2,

2001iGlaxo Wellcome lnc.'s Opposition to Cabilly Motio¡ to Suppress(With exhibits attached), N.dzy 2, 200 L

Glaxô Wellcome's Supplemental Opposition to Cabilly's P¡elimi-'na¡y Motion 6, Mzy 4,2001.Cab.illy's Reply to Glaxo's Supplemeltal Opposition to PreliminaryMotion 6, Jun. l, 2001.Glaxo Wellcome Objection to Admissibilty of Evidence, Jun. 8,2001.Cabilly Replyto the Opposition to lt's Motion to Suppress Evidence,Jul.2,2001.Glaxo Wellcome's Reply to Cabilly's Opposition to Misc. Motion10, Jul.2, 2001.Glaxo Wellcome's Rçly to Cabilly's Oppositions to Misc. Motion11, Jul.2,2001.Glaxo Wellcome's Reply to Cabilly's Oppositions to Misc. Motion12, Jt¡J-.2,2001.Order Regarding Filirg of Glaxo Supplemental Evidence, Nov. 13,

2001.Glaxo Wellcome I¡c's Submission of Late Evidence, Nov. I 5, 200 l.Cabilly Motio¡ to Sup'p¡ess, Nov. 20,2001.Glaxo Wellcome lnc's Opposition to Cabilly Motion to Sullpress,Nov.2l,2001.Cur¡iculumVitae of Af Riggs.Proposal to Ge¡entech re: fil¡rl¡ng for IgG (Bates Nos. 0921-0926).


as7,923,221B1Page 14

Cu¡riculumVitae of Jack Shively.Wagene¡ Shiveþ publication (Bates Nos. 09214934).CurriculumVitae of Ron WeEel.Wetzel Nbk #1432 (Bates Nes. 0O34-OM4,0047, 0049-0050, 0053,

006 I -0064, 0077-008 1, 0087-0088).CurriculumVitae of Jeanne Perry.

Perry Nbk #1290 (Bates Nos. 0136a-0136b, 0 142-0147, 0149-0 154,

0156-0158, 0160-0t61, 0 r&-0173, 018 l, 0187{188, 0190-0 192,

0 t97-02 I 8, 0223, 0237, 0244426 l, 0304-0307).Holmes Nbk #1446 (Bates Nos. 094 I-0943,0946494'1,0950, 0954-

09s7).Holmes Spiral fÍ4 (Bates Nos. 0825, 0830, 0837-0838, 0840-0843,

0845-0846, 0848-0849, 08s2-0853, 0855, 0858).Holmes Spiral #5 (Bates Nos. 0876, 0881-0882, 0885-0887, 0889).

CuniculurnVitae of Michael Rey.

Rey lsbk #l173 (Bares Nos. 0502, 0504, 0509-0516, 052l-0522,0525-0528, 0530-053 t, 0533 -0537, 054r ,0s43-0544).CurriculumVitae of Michael Mumfo¡d.Mumfo¡d Nbk #1247 (Bates Nos. 0615, 0617, C626-0627,0645).Cur¡iculumVitae of Schmuel Cabilly.Cabilly Nbk (Bates Nos. 0970-0976, 0982-0987, 0989, 0991-0992,0994-01001, 0toI3-orol4).Decla¡ation oflnterference, Feb. 28, 1991.

Summary of Times Run-ning, Feb. 28, 1991.

Designation of LeadAttomey (Cabilly), Mar. 14, 1991.Appointrnent ofAssociate Àttorney, Ma¡. 25, l99l .

Submission ofAssociate Attomeys, Apr. 8, 1991.

Revocation a¡d Power ofAttomey, Apr. 15, l99l.Boss et al. Substitution of Lead Attorney, Apr. 19, 199 I.Associate Powe¡ ofAttorney, Apr. 19, 1991.Cabilly et al. Motio¡ for Extension of Time, Nlay 28,1991.Cabilly et al. Extension ofTime-Approved, Jun. 3, 1991.

Certifrc¿te of Service and List ofDocuments Filed, Jun .4, 1991.Cabilly et al. Request for the Exe¡cise ofDiscretion Pu¡suant to 37CFR $1.642, Jun. 4, 1991.The Preliminary St¿tement of the Party Cabilly et al., Jun. 4, 1991.

Cabillyetal. Notice of Filing of helimimry Statement, Jun.4, 1991.

Tra¡smitøl of Prelimilary Statement of Boss et al. and Notice toOpposing Party, Jun. 4, 1991.

Boss et al. Motion fo¡ Benefit of 'ts PCT Application (Boss Motionl),Jun.4,1991.Boss etal. Motion forBeneût of its BritishApplication (Boss Motion2), Jun. 4, 1991.Declaration of Timotþ John Roy Harris in Support of Boss Motionfo¡ Beneût of its British Application (Boss Motion 2), Jur. 4, 1991.

Boss et al. Motion for Judgment ofUnpatentability ofCabilly Claims

@oss Motion 3), Jun. 4, 1991.

Boss et al, Opposition to Cabilly et al. Request Pusuant to 37CFR $1.642, Iun. 24, lÐ1.Opposition to Boss et al. Motion fü Judgment of Unpatentability ofCabilly et al. Claims (Boss Motion 3), Jun. 24, l99LDeclaration of Paul Ca¡ter in Support of Cabilly et al Opposition toBoss et al Motion For Judgment of Unpatentability of Cabilly et alClaims l0l-120 (Boss Motion 3), Jun. 24, 1991.Boss et aI Reply to Oprposition to Boss et al Motion for Judgrnent ofUnpatentability of Cabilly Claims, Jul. 9, 1991.Decision on Motions, Jul. 26, 1991.Order Regarding Testimony, Jul. 26, 1991.Service of Boss et al. Preliminary Statement; Boss et al. PreliminaryStatement, Jul. 3 l, 1991.Service of Cabilly et aI. Preliminary Statement, Aug. 13, 1991."Communication" to PTO ûom Cabilly et al. (Paper #28); I¡forma-tion Disclosure Statement, Sep. 20, 1991.

Cabilly et al. Motion for Extension ofTime, Sep. 25, 1991.Decision-dismissal of "Communication" paper, Sep. 26, t991.Tra¡smittal Lette¡ ¡e: Decla¡ations of Riggs, Shively, Wetzel, Perry,Holmes, Rey, Mumfo¡d, Cabilly and Exbibits l-20, Notice Pu¡suantto 37 CFR 1.671(e), Oct. 28, 1991.Proposed Rwision to Schedule for Reco¡ds and Briefs, Dec . 3 , I 99 I .

Cabilly et al. Notiçs 6f F iling Record, l a¡. I, 1992.Cabilly et al. Record Jan. 8, 1992.

Motion be the Party Cabilly et al Pursuant to 37 CFR $1.635 toReplace Exhibits l-20 Filed on Jan. 8, 1992 Witì a Co¡rected Set ofExhibits and for the Retu¡n of Exhibits l-20 Filed l-20 on Ja¡. 8.

1992, Ian.22, 1992.Cor¡ected Submission of Stipulation Concemi.ng Testimon¡ Feb. 5,

1992.Cabilly et al. Motion for Extension of Time, Feb. 10, 1992.

Mai¡ Brief at Fin¡l lle¿¡i¡g of Junior Pafy Cabilly et al., Feb. 18,

t992.Tra¡smittal ofB¡ieffo¡ the Parg Boss et al., À,far. 18, 1992.

B¡iefat Final Hearing for Senior Party Boss et al., Mar. 18, 1992.

Cabilly et al. Supplemental Briefat Fi¡al Hearing, Ãpt. 5, L992.

Reply Brief at Final Hearing of Ju¡ior Party Cabilly et al., Apr. 7,

1992.Cabillyetal Motion Pu¡suantto 37 C.F. R. $ 1.635 to Ente¡AdditionalPages Into the Cabilly et aI Record, Apr. 14, 1992.Opposition to Cabilly et al Motion Purzuant to 37 C.F. R $1.635 to

Ente¡ Àddition¿I Pages Into the Cabilly et al Record' Apr . 22, 1992 'Cabilly et at Reply to Boss et al Opposition to Cabilly et al MotionPusua¡t to 37 C.F. R- $1.635 to Enter Additio¡al Pages Into tleCabilly et al Record,MayT, 1992.Cabilly et al. Notice of Submission of Replacement Set of F,¡<hibits

l-20,Møy7,1992.Notice of Filing Substjtute ExÏibits 8 ¿nd 20 fo¡ the Cabilly et al.

Record, May 7, 1992.Notice ofFin¿l Hearing for Mar. 29, 1994 (paper #54), Feb. 4, 1992Final Decision (Priority awarded to Boss et al.) (paper #57), Aug. I 3'1998.Tr¿¡smittal and Filing of Agreements Under 35 USC $ 135(c); Agee-rnents, Aug. 25, 1998.Communication form BPAI re: Filing of agreements and request tokeep ircparate from Interference file acknowledged (paper #59), Oct.10, 1998.Notice From PTO Requesting Communication Regarding Appeal,Nov,9; 1998.Belàteil Response to Communication Regarding Appeal, Dec. I,1998.Bosi et al. Power to lnspect and Make Copies, Dec. 9, 1998.Decisiol Granting Petition to Co¡rectthe Assignee on the Cover Page

of U.S. Appl. No. 07l205,4f 9, May 7,2002.Petition Pu¡suant to 37 C.F.R. $1.666(b) fo¡ Access to SettlementAgreement (ûled by Medlmmune) , Mzy 8,2O02.O¡der o¡ Petition fo¡ Access Pwsuant to 35 U.S.C. $165(c) and 37

C.F.R. $1.666(b), Jun. 19,2002.Cabilly et aI. Objection to Petition for Access to Settlement Agfee-ment, Jul.22,2002.Celltech's Objectionto Petition fo¡Access to Settlement Agr€ement,1u1.22,2002-Reply to Objections of Celltech R&D Ltd. and Cabilly et al. toMedlmmune's Petition forAccess to SettlementAgleement, Aug. I,2002.Alberts, B. Molelalarbiologie der Zelle, Wei¡heim:VCH pp. 1075(1e87).'Appeal No. T400/97-334, Appellant: Ge¡entech, lnc., EuropeaaPatent No. 120694 (Celltech), European Patent Application No.84301996.9, G¡ounds of,A.ppeal" (Apr. I, 1997 Notice ofAppealattached) (Jrn 13, 1997)."Appeal T l2I2l97 -334 ln Re Genentech EP-B-125023 Substa¡tia-tion ofthe hoprietor's Appeal" (Feb 26, 1998).Bagdasarian et al., 'Activity of the hybrid ûp-lac (tac) promoter ofEs cherichia coli in Pseudomonasputid¿. Construction of b¡oad-host-range, contolled-er<pression vectors" Gene 26(2-3):273-282 (Dæ,r983).Cabilly, S. (Letter from Shmuel Cabillyto ArtÏur D. Riggs) (Aug 5,

r98o).Cabilly, Shmuel, 'G¡o*'tl at sub-optimal temper¿tues allows theproduclion of frrnctional, antigen-binding Fab fragnents inEscherichia coli" Gene 85:553-557 (1989).Carfer et al., 'High LevelEscherichiacoli Expression and P¡oductionof a Bivale¡t Huma¡ized Antibody Fragrnent." Biollechnologt.10(2):163-167 (Feb 1992).DeBoe¡ "The tac promoter: A functional lybrid derived from the tpand lac Promoters" Proc. Natl. Acad. Sci USA 80 :21-25 (1983).


rJS 7,923,221B[Page 15

Decision of PCR EP 0200362 and decision of PCR EP 0201 184

Sections 5 only. Submittedby PDL onMat27,1997. (Dec 14, 1995).

"Decision of theTechdcal Board ofAppeal 3.3.4 of May 14'2001"

@egarding EP-B -125,023. Sep. 27, 2001 conection to the decision

attached.)."Decision Rer¡oking the European Patent (Aficle 102(l) EPC)" (EP

125,023 with Minutes auached) (Oct 16, 1997)."Decision to Maintai¡ the European Pa-tent in Amended Form

(Article 102(3) EPC)" (Regarding EP 120694) (Mar 14,2002).

"Decla¡ation ofAtsuo Ochi" (CV atøched. Regarding EP 120694

andEP 125023 oppositions.) (May 17,1996)."Decla¡ation of Gabrielle L. Boulia¡ne" (Exhibits A-C att¿ched.

Regarding EP I 20694 and EP I 25023 oppositions.) (May I 5, 1996)

"Declaration ofPaul J. CarterdatedApr. 20, 2000 with ExhibitA a¡dAICC lette¡".Documents from EP 120694 file. Namely Aug. 30, 1988 Celltech's

request to amend the application and Ju¡. 15, 1990 Mi¡utes oftheOral hoceedilgs.EP 120,694, Decla¡alion of Michael F¡arcis Tuite with CV attached

(May26,I99s).EP 125,023, Documents submitted by Genentech prior to oral pro-ceedings (Mar. 27, 1997).

EP 125,023, Genentech's oposition to PDL's request to admit the

enti¡e Boss file as document¿tiotr at the oral procee¡lings (Mff. t8,1997).EP 125,023, Genentech's request for Opponent IV to provide thesubj ect matter to be presented by DL Shulman at the oral proceedings(Mar.3, 1997)."European Patent EP-B-125023 (Genentech, I¡c.) Decla¡atio¡ ofDr.Richa¡d Axel dated Apr. I 8, 2000 with Exìibit Ä'.Europem P¿tent Office communication with copy of EP 120694maintained patent i¡ amended fo¡m (Oct. 17, 2001)."FOI Advisory 76-7, P¡oceó¡¡e fo¡ Requests for Grant Applicationsand Progress Reports" (May 1 9, 1 976 Memo f¡orn the NIH F¡eedomoflnformation C66¡¡lin¿f6¡ ¿l tls IJS Departnent ofHealth, Educa-tion, and Welfare, and May I 0, I 976 letter accompa.nying the memo)(May 1997).Genentech's submissions in response to Board ofAppeals' Feb. 2,

2000 communication. fuchardAxel's Apr. 18, 2000 Declaration withExhibitA, Paul J. Ca¡ter'sApr.20,2000 Decla¡ation witù ExhibitA,AICC letter, Walter Moo¡e's Apr. 21, 2000 Statement a¡d claimfequests.Glaser et ¿1., "Functional interrelationship between two tandem Ecoli ribosomal RNA promoters" Nelilre 302(5903):74-76 (Mzr.3,r983).Goeddel et al., "Synthesis of Human Fib¡oblast lnterferon by -ð.

coli" Nucleic Acids Research 8(18):4057407a (1980).

Goodman a¡d MacDonald, "Cloning of hormone genes from a mix-Þ¡e of cDNA molecúes" Methods in Enrymologt 6S :75-90 (1979)Hamilton, R,, "Application of engileered chimeric antibodies to thecalibration of hum¿n aatibody standards" Annales de BiologieClinique 49 (4) :242-248 (1991).Hanis, "Expression of Euk¿ryotic Genes in E.coli" Genetic Engi-neering,R.Wrlli,-son, 4tl edition pp 127-185 (1983).

"Interlocutory Decisio¡ in Opposition hoceædings (Article106(3)EPC)" (EP 120694) (Feb. 14, 1997).K.abat et al. Sequences of Proteins of Immmological Interest,

Bethesda, MD:National l¡stitute of Health pp. i, xxi, ro<ii (t983).Klausner, ,A'., "Genentech makes mo¡oclonal precursors fiomE. coli " B io/Iechnolog l(5):396-397 (1983).Liu et al., "Expression of mouse::human immunoglobulin heavy-chain cDNA in lymphoid cells" Gene 54(l):334O (1987).Minutes from tie EP 120694 oral proceedings (Aug. 13, 1996).

"Minutes oftle public oral proceedings before tle Technical Boa¡dofAppeal 3.3.4 ofMay 14, 2001" (EP 0125023)."Minutes ofthe public oral proceerlings before the Technical Boa¡dof Appeal 3. 3.4 o f Mray 22, 2000" (Regarding EP 120694).Mo¡rison, S., "1¡ vibo antibodies: stategies forproúrction andappli-cafion" Annual Review of Immwologt l0 :239-265 (1992).

Munro, "Uses ofchimaeric antibodies" N¿f¿re 312:597 (1984)."Opposition to EP 125023 B ofGenentech, Patentee's Responsetothe Oppoaerts' Arg¡¡ments" (Feb.22, 1993).

"Opposition to Ewopean Patent No. EP-84125023 (84302368.0-

2106)" (Genentech's subrnission prio¡ to the oral proceedings with

¿ffidavit from Cb¡istopher Denison datedApr. 19, 2000 and exhibits

attached) (Apr. 20, 2000).

Papers releva.nt to the hterpretation ofEllison et al. PNAS 79:1984-

l98S (1932), Fig.2 from Ellison paper aúpp'203 &21I f¡omNewEngland Biolabs Catalog with Ellison paper aftached'

"Plai¡tif Me.dlmmune, lnc.'s Fi¡st Amended Complaint' Dem¿nd

for Jury Trial" (J.S. District Court, Case No. 03' 2567 MRP (CTX)Mdlmmune, Inc. vs. Genentech, Inc', City of Hope, and Celltech

R&.D Ltd.) (Aug. 13,2003).Public Inþrmation Rqulation (Paragraphs 5.71(c) and 5.72(e)

only), U.S. Deparhnent of Health, Education, and Welfare (Aug.

1974).

Queen and Baltimore, "Immunogtobulin gene transcriptlon is acti-

vated by downstream sequence elem ents" Cell33 (l) :741-748 (1u1.

r983).

Queen, C., "Comparison of huma-n and mouse VH domains" (Sub-

mitted by PDL onMat 27, 1997).

Queen, C., "Comparison of mouse and human V-kappa domaim"(Submitted by PDL Mar. 27, l9D'7).

Reasons fo¡ the Decision of T612/92 andT694l92. Subnnitted byPDtonMa¡.27,199'7.Regarding EP 125023. Genentech's suggestions o¡the time frameofthe oral proceedings Q.[ov. 18, 1999).

"Response on behalfofthe Patentees to the Fu¡ther Submissions ûledon bèhatf of opponents I a¡d IV in connection witl oppositionProceedings to EP-B-0r26023 (84302368.0)'(Aug. 9, 1994 Decla'ration ofleon R. Lyle witl ExhibitsA-B andAug. I l' 1994 Afrd¿vitof Allan Robert Adler with E:<hibits A-E) (Oct. 31, 1995).

Schein et al., "Formation of Soluble Recombinant Proteins inEscherichia coü is Favored by Lower Growtl TeÍperature" 8¿'ol

Technol ogt 6:29 l-294 ( 1988).

Schein, Catherine H., "P¡oduction of soluble recombinant proteins inbacte¡i¿l' B io/Technologt 7 :l I4l-1149 (1989).

Stafford and Queen, '.'Cell-type speciûc expression of a transfected

immqnoglobulin Eeîe" Natt4re 306(5938) :77-79 (Nov. 3' 1983).

"statement by Walter Moore" @egardhg the non-availabilþ of the

Herzenberg gtant application) (Apr. 2 I, 2000)'Taniguchi et al., "Expression oftle Human Fibroblast InterferonGen'e i¡ Escherichia coli" Proc. Natl. Acad. Sci. USA 77(9):6230'5233 (Sep. 1980).Plaintiffs' Joi¡t Co$entions on lnv¿lidity Due to Non-St¿tutoryDouble Patenting with Exhibits l-2, U.S. Dishict Cou¡t for the Dis-hict of Massachusetts, MDL No. 1592 (MLV/).Expert Rçort of Dr. Rodaey E. Kellems, U.S. Dishict Cou¡t fo¡theDisüict of Massachusetts, MDL No. 1592 (MLW)'Rebuttal ExpertReportofDr. RodneyE. Kellems, U.S. Dist¡ictCourtfor tle Disnict of Massachusetts, MDL No. 1592 (MLW).Deposition Transcript of Rodney E. Kellems, Oct. 2, 20M, U'S'Distict Couf for the Distict of Massachusetts, MDL No. 1592

(MLw).Decision--Priority-Bd.R. 125(a). Hudziekv. Ring, Paper No. 32,

Sep. 30, 2005 (Interference No, 105,267).Decision-Prio¡ity-Bd. R. 125(z)' Hudziekv. Rrzg, Paper No. 39'

Sep. 30, 2005 (I-nterference No. 105,266).Decision on Motions, Genqtechv. Chiron,PapetNo' 258, Nov 30'

2004 (Interference No. 105,048).Decision dated Ma¡. 30,2Q04, Chironv. Genentech,CAFCCase Nos.

03-1158 aud03-1159.Final Decision (Prio¡þ awa¡ded to Boss et al.), Paper No. 57' Aug.

t3, 1998 (Interference No. 102,512).Decision on heliminary and Other Motions and Final Judgrnent'Sep. 4, 2002 (Interference No. 104,532).Decision, U.S. Court of Appeals for the Federal Circuit, Case Nos.

04-1300 & 04-1384, Oct. 18, 2005.Alt et al. "Immu¡oglotulin heavy-cha in ø(pression and class switch-ing in a murine leukaemia cell line," Nature, vol. 296, p.325'31'(Mar;25, 1982).Banerji et al.,'A Lynphocyte-Specific Cellula¡Enhance¡ Is Located

Downst¡e¿m of the Joining Region in lmmunoglobulin Heavy Chain

ceneb,;' Cel/, vol . 33,729-740 (Jul. l9E3).


as7,92322lBlPage 16

Benoist, C., et al., "ln vivo sequence requirements ofthe SV40 earlypromoter region," Nature, 290: 304-3 10 (l 98 I ).Be¡grnan, Y, et al., "Iwo regulatory elements for immunoglobulin rtight chain gene expression," Proc. Natl. Acad. Sci.,8l :704145(1e84).Bernier, "Proliferative Disorders of the Immune System," Chafier 21

$p. 622-643) inBellafü, Immuologt II (1978).

Bl¿ir, DG, etal.,'Activation ofthe transformingpotental of anormalcell sequence: a molecula¡ model for oncogenesis," Science,2l2'.94143 (1981).Breath¡ach, R., et al. "Correct splicing ofa chicken ovalbumin gene

transcrþ in mou seL cells:' Proc. Natl. Acad Sci., 71 : 7 4044 (1980).

Chalg, E., et al,, "Transformation by cloned Haweymurine sa¡com¿vi¡us DNA: efrciency increased by long termilal rçeat DNA,".Sct-ence, 210: 1249-51 (1980).Davies, J., et al., 'i{ new selective agent for eukaryotic cloniagvecto¡sl' Am J. Trop. Med. Hyg.,29 (5 Suppl): 1089-92 (1980).Fittle¡ et a1., "Localization in Mouse-L-Cell Ch¡omosomal Sites ofTra¡sfer¡ed lmrnunoglohrlin Genesi' Chromosome (Berl.) 84,7l7 -

727 (1982).Fuldenberg a¡d Koistinen, "Humaa Allotype Detection by Passive

Hemagglutination, with Special Refe¡ence to Immunoglobulin AAlloqpes" Chapter 103 tpp. 767-77Q in Rose a¡d F¡iedman,Manual of Clinical Immunologt, Second Edition (1980).

Gillies et al., "Expression of cloned immunoglobulin genes inho-duced into mouse L cells," Nzcl. Acids Res., vol. ll, No. 22, pp.

7982-7997 (1983).Gruss, P., et al., "Simia¡ virus 40 tandem repeated sequences as an

element of the early promoter," Proc. Natl. Acad. Sci.,78:94347(le8r).Habara et al. "R¿usche¡ Murine Leukemia Virus: Molecular Cloningof Infectious Intqilated Proviral DNA,'7 of Virologt, vol. 44, No. 2,pp. 73 I -735 (l.Iov. 1982).Jackson ¿nd Davis, "Quantitation of Immunoglobulils," Chapter 14

þp. 109- 120) in Rose and F¡iedman , Manual of Clinical Immunol-ogy, Second Edition (1980).Köhle¡ G., et al., "Immunoglobulin chain loss in hybridoma lines,"Proc. Natl Acad. Sci.,77:2197-99 (98Ð.Kyle, '.Classiñcation a¡d Dias¡osis of Monoclonal Gammopathies,"Chapter 16 þp. 135-150) in Rose and F¡iedma¡, Manual of ClinicalImmunologt, Second Edition (1980).Linscott's Directory (formerþ Catalog) of Immunological and Bio-logical Reagents, second edition 1982-83, pp. l-57.Me¡cola et al., "Tra.nscriptional Enlance¡ Elements in the Mouselmmunoglobulin Heavy Ch¡in Locus,".Sc¡er¡ce, vol, 221, No.4611,p.663-65 (Aug. 12, 1983).

Miles Biochemicals 1979-80, p. 140-142.Miller et al, "Transfection of human lymphoblastoid cells withhe.rpes simplex vi¡al DNA," Proc. Nat l. Ac ad. Sci., vol. 76, No. 2, pp.9a9-9s3 (Feb. 1979).Morrison SL, et aI., "A mouse myeloma va¡iant with a defect in ligbtchain synthesis," Eur. J. Immunol-,9:461-65 (1979).Mulligan, RC, et al., "Selection for animal cells that o<press theEscherichia coli gene codilg fo¡ xantline-guaninephosphoribosyltra¡sfe¡ase," Proc. Natl Acad. Sci., 18 :2072-76(1e81).Orfila et al., "Immu¡ofluorescetrce study of "non-idiopathic" renalamyloido sis," f/z m. Pat h o l I 4 (4):3 62 -7 ( 1983).

Tomino et al., "Speciûcity of eluted antibody ftorn renal tissues ofpatients with IgA nephropatly," Am. J. Kidney Dis. I(5):276-80(1e82).Solomon, "Bence Jones P¡otei¡s and Light Chains ofImmuno globulin sl' S cand. J. Immun ol., vol. 5, 68 5{95 ( 197Q.Southern, PJ et al. "Transformåtior of mammalian cells to antibioticresistance with a bacte¡ial gene under co¡trol of the SV40 earlyregion promote¡" J. Molec. Appl. Genet., I:32741 (1982).Summe¡s et al., "Stable e4pression in mouse cells of nuclea¡neoantigen afte¡ hansfe¡ of a3. -me?adzlton cloned fragment ofEpstein-Ban virus DNA," Proc.. Natl. Acad. ,Scf ., vol. 79, pp. 5688-5692 (Sep. 1982).Villiers, J., et â1., '"Transcriptional 'enlancers' from SV40 a¡dpolyoma vinrs show a cell t]?e prefercrce," Nucleic Acids Research,t0:7965-76 (1982).

Wold et al.,'l¡t¡oduction andexpression ofa rabbit p-globil gene tn

mouse ûb¡oblasts i' Proc. Natl. Acad. Scj., vol. 76, No. ll p' 5694-

5788 OIov. 1979).Abreau S.L. etal. Biochem. Biophys. Res. Comm.82(4): 1300-1305'

Jun. 1978. InEacellular location ofhuman ûb¡oblast i¡terferon mes-

senger RNA.Ad¿ms J.M. et al. Biochem.55: 147-155,1966. N-formylmetlionyl-IRNA as the idtiator of protein s¡rnthesis.

Alberts B. et al. Molecular Biology ofthe Cell. I 07- 108, 92 l, 1983.

Alt F. et aI. Ce I t 2'7 : 38 I -39O, Dec. 198 I . Organiz¡tion and reorgani'zation of immunoglobulin genes in A-MuLv-t¡¿¡sformedcells: rear-

rangcment ofheavy but not light chain genes.

Applebaum S.W. etal. Biochem. J. 193:209-216, 1981. The prepa-

ration and characterization of locust vitellogenin messenger RNA

ardthe rynthesis of its complementary DNA.Athertôn K.T. et al. J. Gen. Yirol.29: 297-304, 1975. Interferoninductidn by vinrses and pollmucleotides: a diffe¡ential efect ofcamptothecin.Aviv H. et al. Proc. Nat. Acad. Sci. U'9.{ 68(9): 2303-23O1,Sep.l97lkotein synthesis directed þ encephalomyocarditis virus RNA:properties of a transfer RNA-dep€ndent system.Aviv H. et al. Proc. Nat. Acad. Sci. USÁ 69(6): 1408-1412' Í,n. 1972'huifrcation ofbiologically active globin rnessenger RNA by chro-

matography on oligothymidylic acid-cellulose.Ba-llantine J.E.M . etal. J. Embryol. Exp. Morph. 5l: 137-153,1979.Changes in protein synthesis during the dwelopment of Xenopusleevis.Banerji J. et al. Cell 33:729-740, 1983. A lymphocyte-specifc cel'Iul¿r enha¡ce¡ is located downstream of the joining region inimmunoglobulin heavy ch¡in genes.

Ba¡tle J.A. et aI.,4 nalyl ic al B io chem. 7 2: 413 427, I 976. Specifi cityof oligo (dT)-cellulose chromârography in the isolation ofpolyadenylated RNA.Beato M. etal.FEBS Leu.59(2)t305-309, Nov. 1975. Translatio¡ ofthe messenger RNA for rabbit uterglohäninXenoptts oocytes'

Bergma.n W. d. al. J. Biol- Chem.254(13): 5690-5694,1979. Form¿-tion of intermolecular disulfide bonds on nascent immunoglobulinpolypeptides.Benidge MV. et al. Cell 8: 283-297, Jun. 1976. Tra¡slation ofXenopuslner messenger RNA inXezolrus oocytes: vitellogenin syn-thesis and co¡version to platelet proteins.Beva¡ M.J. Biochem. J. 122: 5-ll,1971. The vectoral release ofnascent immunoglobulin peptides.Blobcl G. FEBS Gøe Expression, 1977. Mechenisms for the

inhacellulu comparhnentaion an of newly synthesized protei.us.

Blobél c. et al. I Cell Biol. 67: 835-85 I, 1975. Transfer ofproteinsacross membra¡es.Bolè D.G. et aI."/ Cell. Biol. 102: 1558-1566, 1986. PostEanslationalassòciation of Immunoglobulin heavy che¡n þi¡fi¡g protein withnascent heavy chails in nonsecreting ald secreting hybridomas.Boss M. et al. Nz clAcids. Res. l2(9): 3791-3806, 1984. Assenbly offunctional antibodies from immunoglobulin heavy and ligbt châ¡ns

synthesised in ð. coli.B¡ackC. etal. Cell 15: l-14, Sep. 1978. A complete immunoglobulingené is created by sorratic recombiaation.B¡inster R.L. et al. Nature 306: 332-336, 1983. Expression of amicroinjectedimmunoglotulin gene inthe spleen oftransgenic mice.

BrittenR.J. Sc¡er¡¿e 142: 963-965,Nov. 1963. Complementarystrandassociation between nucleic acids a¡d nucleic acid gels.

Browne C.L. Science203:182-1E3, Jan. 1979. Oocyte-follicle cellgap jtrnctions n Xeopts laevis and the effects of gonadotopin on

ttreii permeability.Bu¡ke D. et al. rYa ture27 l: l0-l l, Jan. 1978. T¡anslation ofi¡terfe¡onrressenger RNA in vivo a¡d in vito.Calos M.P. etal. Proc. NetL Acad. Sci. USA 80: 3015-3019, 1983.

High mutation ûequency in DNA haasfected i¡to m¿mmalian cells.

Campbell P.N. et al. FEBS Lett.72(2):215-226, Dec. 1976. The¡oleof organelles in tle chemic¿l modification of the primary úanslationproducts of secretory proteins.Cattaneo A. et al. EMBO J. 6(9): 2753-2758, 1987. Polymericimmunoglobulin M is secreted by tansfecta¡ts of non-l1,nr.phoid

cells in tle absence of immunoglobulin J chain.


us7,923A2181Page 17

Cavalieri R.L. et al. Proc. Natl. Acad. Sci. USA 14(10): 441544f9.Oct. 1977. Induction and decay of human fibroblast interfe¡onmRNA.Chan L. et al. I Clin. hwest. 5'7: 576-585, Mar, 1976. T¡anslation ofovalbumi¡ nRNA inXenopus laevis oocytes.Chen T.T. et al. J. Biol. Chem.253(15):5325-5331, 1978. Vittellina-nd vitellogenin from loctusts (Locasta migratoria).Coffin P. et al. Pro c. Narl. Acad. Sc¡. USA 68(l): 219-223, Jam. 197 L

Rate of som¿tic mutation in immunoglobulin production by mousemyeloma cells.CohnM. Nucleic Acids in Immunologt,6T l-? 15,1968. The molecu-lar biology of expectation.Colman A. Tianscript. Tianslat.2: 49-69,1984. Expression ofexogenous DNA inXenopus oocytes.Colman A. Transcription a¡d Translation, a practical approach,edited by B.D. Jamesaad S. J. I{iggins,27l-302,1984.Translationofeukaryotic messe¡ger RNA inXezoprrs oocytes.Colma¡ A. et al. Ciba Fowd. Symp. 98: 249-67, 1983.T\e oocyte as

a secretory cell.Colma¡ A. et al. Cell l7: 517-526,1979. Export ofproteins fromoocytæ of Xenopus laevis.Cobrran A. ú al. Eur. J. B iochem. 113:339-348, 198 l. The influenceoftopolory and glycosylation on the f¿te ofheterologous secretoryproteins made in Xenopus oocytes.Colman A. t ú. J. Cell Biol.9L: 770-780, Dec. 1981. Fate of sec¡e-

tory proteins happed in oocytes of Xenopus /aøvts by disruption ofthe cytoskeleton or by imbalanced subunit synthesis.Colma¡ A. et al. J. Mol. Biol. 160: 459474, 1982. Inter¿ction ofMouse immunoglobulin ðhai¡s within Xenopus oocyles.Craig R.K. et ú. Biochem. J. lñ: 57-74, 1976. Guinea-pig milk-protein synthesis.Craig R.K. e.t al. Biochem. J. 173: 613441, 1978. Separation andpartial characterization of gu.inea-pig casei-ns.

D¿¡nell J.E. etal. Proc. NaL Acad. Sci. USA 68(6): 1321-1325, Jun.

l97l, An adenylic acid-rich sequence in messenger RNA of HeLacells and its possible relationship to ¡eiterated sites in DNA.Damell J.E. et al. Sci ence I74:5O7 -510, Oct. 1971. Polyadenylic acidsequences: ¡ole in conversion ofnucle¿r RNA i¡to messenger RNA.De Robertis E.M. etzl. Sci. Amer.75-82, Oct. 1979. Gene transplaa-t¿tion and the analysis ofdevelopment.Deacon N. J. et al. FEBS Lefi.79(l): l9l-194, Jul. 1977. Fucosei.ncorporation into ooryte-synthesized rat immunoglobulins.Deacon N. J. et¡l. ImmunoL 3S(l): 137-1,{4, Sep. 1979. Post-trans-lational modiûcation of râl immunoglobulils rynthesized in tÍeXe n opu s oocyte tr znslaton system.DeshpandeA. K. et zl.J. Biol. Chen.254(18):8937-8942, Sep. 1979.

Translation and stability ofrat livermessenger RNA forar-globulinin Xenopus oocyle.Dicou E. et al. FEBS Lett. fM(2): 275-218, Aug. 1979. Synthesis ofDyctyosleium discoideum secretory proteins in Xenopus laevisoocfes.Doel M.T. Cell 8: 5l-58, N.{ay 1976. The ta¡slatio¡ål capacity ofdeadenylated ovalbumin messenger RNA.Dryer W.J. ü al. Proc. Natl. Acad. Sci. USA 54:864-E69,1965. Themolecular basis for antibody formation: a paradox.Dulis B. J. Biol. Chen.258(4): 2t8l-2187, 1983. Regulation ofprotein expression i¡ diffe¡entiation by subunit assembly.Dumont J.N. et à1. J. Morph. 155(l): 73-98, 1978. Oogenesis inXenopu s laevis (Daudin).Edmonds M. et al . P roc. Nat I. A cad.,Sci USI 68(6): I 336- I 340, Jun.

1971. Polyadenylic acid sequences in the heterogeneous nuclearRNA a¡d rapidly-labeled pollribosornl RNA of HeL¿ Cells: pos-sible evidence for a precursor relationship.Eppig J.J. eT al. Deu. Biol.28:531-536, 1972. Amino acid pools indevelopirg oocytes of Xøtopus laevis.European Palent Office, Case No. T 0400/97 (Celltech TherapanticsLtd.), Decision ofthe Technical Board ofAppeal, Mzy 24,2000.Falcotr E. et al. Virol.75:3M-393, 1976. Intacellular location ofnewly synthesized interferon in human FS4 cells.Falkner G.F. d aJ. Nature 298(5871): 286-288, 1982. Expression ofmouse irnrnunoglobulin genes in monkey cells.FeitH. etal. J. Neurochem-28(4): 697 -706,1977- Comparison oftheisoelect¡ic and ¡nolecula¡ weight prope.rties of tubulin subunits.

Fo¡dC.C. et al. "/Er¡ bryol. Exp. Morph,37 : 203-209, 1977. Amethodfor enucleating oo cyles of Xenopus laevis.

FraserT. H. etal.Proc. Nat. Acad. Sci. USA75(12):5936-5940, Dec.

1978. Chicken ovalbumin is synthesize.d and sec¡eted by ovalbuminis synthesize.d and secretedby Escherichia coli.Futuichi Y. et al. Nature 266: 235-239, Ma¡. 1977. s'-terminal sÍuc-ture and nRNA søbility.cally J.A. et al. Nature 227 : 34 L -348, Jul. I 970. Somatic hansloca-

tion ofantibody genes.

Gillies S.D. et zl. Cell 33: 7!7-728, Jul. 1983. A tissue-specifctraascription enha¡cer element is locate in the major intron of a

rearranged immunoglobulin heavy chain gene.

Gillies S.D. et al. Nucl. Acids Res. 1l(22):7981-7997, 1983. Expres-

sion ofcloned immunoglobulin genes intoduced i¡to mouse L cells.

Goldman B.M. Proc. Nat. Acad. Sci. USA 75(10): 5066-5070, Oct.

1978. Biogenesis of peroxisomes: int¡acellula¡ site of slmthesis fcatalase and uricase.Goodridge A. d. a!. Eur J. Biochem.98(l): 1-8, 1979. Synthesis ofalbumin a¡dmalic enzyme inwheat-germlysates and Xenopus laevis

oocytes prograrnmed with chicken-liver rnessenger RNA.Grässm¿n A. d. ú. Hoppe-Sqler's Z Physiol. Chem. 352:. 527 -532,

Apr. 1971. Über die bild¡'ng uoo melanin in muskelzellen nach derdi¡elden überüagung von RNA aus Hardilg-Passey-melamnomzellen.Gray W.R. et al.,Screr ce 46 5 467, J at I 967. Mechanism of antibodysynthesis: size diffe¡ences between mouse kappa chains.Gu¡do¡ J.B. J. Embryol. øtp. Morph.20(3): 401414, Nov. 1968.Changes in somafic cell nuclei inse¡ted into growing and maturiagamphibian oocles.Gurdon J.B. et al . Ann. Rev. Genet- 15:189-218, l98l. Gene t¡ansfe¡in amphibiar eggs ând oocytes.Gu¡don J.B. et al . J. Mol. Biol.80: 539-55 t, 1973. Message stabilityin injected frog oocfes: long life of mammalian ct and p globinmessllges.Gu¡don J.B. et al . Nature 233: 177-182, Sep. 197I. Use offtog eggs

and oocytes for the study of messenger RNA and its translation inIivirg cells.Gu¡don J.B. et al. Tianscript Transl¿f. , xvii-xviii, 1984. A practicala¡proach.Haas LG. et al. Nature 306(24): 387-389, 1983. Immunoglobulinheavy chain bindhg protein.Ha¡ks J.H. et al. Proc. Soc. Exp. Biol. Med.7l: 196-20O, 1949.Relation of oxygen and terperatu¡e in tle presewation oftissues byrefrigeration.Harry P. et al. Comp. Biochem. Physiol.638(2):28'l-293,1979.Changes in the pattern of sec¡etion of locust female diglyceride-carrying lipoprotein andvitellogenin by tle år body in viûo dwingooc¡e development.Hendershot L. et al. J. Cell Biochen. 104: 761-767, 19E7. Assemblya¡d secretion ofheavychains tbat do not associate posttranslationallywith imnnrnoglobulil heavy chain-bindirg protein.HendershotL. etal. MoL Cell. Biol.8(10):42504256, 19E8. Id€ntityof the immunoglobulin heavy-chain protein with the 78,000{altonglucose-regulated protein a.nd the role of postEaaslational modiûca-tions in its bi¡ding furction.HewC:L. etal..Biochem. Biophys. Res. Comm.7 1(3), 845-850, 1976.The sþthesis of freezing-point-depressiag protein of the winterfowider P s eudopl anron ec tus amer ic anus n Xøtopus laevß oocytes.Higgins S.J. et al. Biochem. J. 158:271-282,1976. Androgen-depen-dent synthesis ofbasic secretory proteins by the rat seminal vesicle.Higgins S.J. d aI. Biochem. J. 174: 543-551, 1978. Effects oftestosterone on messenger ribonucleic acid and protein synthesis iar¿t seminal vesicle.Hood L. et ú. Science 168: 325-3431979. Mechanism of antibodydiversity: germ line basis for variability.Hood L.E. Fed. Proc. 3l(1): 177-187, 1972. Two ge¡es! onepolypeptide chain-åct o¡ fiction?.Housman D. et ¿1. Natwe 227: 913-918, 1970. Initiation ofHaemoglobin synthesis by methionyl-tRNA.Huez G. et al. lf¿ture 27 l: 572-513,Feb. 1978. Fu¡ctio¡al stabilisa-tion of HeLa cell histone messeng€r RNAs injected tnto Xenopusoocy.tes by 3'-OH polyadenylation.


us7,92322lBlPage l8

Huez G. et al. Proc. Nat Acad. Sci. USA 7l(8):3143-3246, Aag.1974. Role ofthe polyadneylate segrnent i¡ the tanslation ofglobinmessenger RNA in Xeilopus oocyt6.Jackson R. C. et al. Proc. Natl. Acd. Sci. 74(12): 5598-5602, Dec.1977. Post-tra¡slational cleavage of presecretory proteins with an

extract of rough microsomes from dog parcreas containing signalpeptirlese activity.Jackson R. et al.,V¿ture227:672-676, Aug. 1970. Role ofmetlioninein tle initiation ofhaemoglobin synthesis.Jilka R. L. eT al. Arch. Biochem Biophys. 192(l): 290-295, 1979.Synthesis ald processing of t¡e mouse MOPC-32I x Chain inXen opu s laevi s oocytes.JilkaR.L. t al. Biochem. B iophys. Res. Conm.79(3): 625-630, 1977.Sy'nthesis and glycosylation of tle MOPC-46V immunoglobulin inkappa ch"i" n Xenopus laevis ooc.rtes.Kacian D.L. et aI. Nature 23(58)5 : I 67- I 69, 1972. I¡ vit¡o synthesisofDNA components ofhuman genes for flobins.

1977. Mernb¡ane in vitro synthesis, glycosylation, and asymmetricinse¡tion of a ûansmembrane protein.Kindas-Miügge Let al. J. Mol. Biol. 87 : 45I462, 1974. Insectproteinsynthesis in frog cells: the tra¡slation ofÏoney bee promelittin mes-senger RNA inXenopus oocytes.Kitqjewski J. et al . Mol. Cell. Biol. I2(2):784-790, 1992. I¡ter¿ctionof Wnt-! proteins with the binding protein BiPKoch G. J Biol. Chem. 25 f(19): 6097-6 I 07 , 1976. Synthesis of themitochondrial inner membrane in cultured Xenopus laevis oocytes.Köhle¡ G. Proc. Natl. Acad. Sci. USA 77(4): 2197-99, 1980.Inrmunoglobulin chain loss in hybridoma lines.Ko¡tbeek-Jacobs N. etal. J. Immunol. Meth.24(L/2):195-199, 1978.Detection of specific antibody producing cells in porcine colostrumby in ovo banslation of their mRNA.Kou¡ides I.A. et al . Proc. Natl. Acad. Sci. USA 76(l): 298-302, Jan.1979. mRNALi¡ectedbioE¿nthesis of cr subunit oftlyrotopin: trans-lation i¡ cell-f¡ee a¡d whole-cell syst€ms.Kreil G. Ann. Reu. B íoch em. 50 : 3 I 7-M8, 198 l. Transfer of proteinsac¡oss membra¡es.Kvist S. et ú. Cell 29:61-69, May 1982. Memb¡a¡e i¡se¡tion andoligomeric assembly of HLA-DR histocompatibility antigens.LabarcaC. et al. Proc. Natl. Acad. Sci. USA 1 4(1Q: rA624465, Oct.1977. mRNA-directed synthesis of catalytically active mousep-glucuronid,se ii Xenopus oocyles.L¿brie F. Nature 221: 12l'7-1222, Mar. 1969. Isolation ofan RNAwitl the propefies of haemoglobin messerger.L¿emrnli U.K. Natu,e 221,680-685, Aug. 1970. Cleavage of struc-tural proteins during tle assembly ofthe head ofbacteriophage T4.I-¿nclos K.D. Cel/ Dif.1 : 259-270, 1978. Effects of estradiol on earlymessenger RNA in male Xenopus laev¡'s liver.I-a¡eC. etal. Eun J. Biochem. l0l(2):485495,1979. Sequestrationand turnover of guinea-pig milk proteins and chicken ovalb¡¡min inXenopus oocytes.La¡e C. et aI. J. Mol. Biol.6l: 73-91, 1971. Rabbit haennglobinsynthesis in frog cells: the translation ofreticulocyte 9 s RNA in ftogoocytes.L¿ne C.D. Cum Top. Deu. B iol. 18: 89-l 16, 1983. The fate of genes,

messengers, and proteins inlroútced. iato Xenopus oocytes,L¿ne C.D. et al. -Biochem. Animal Dev. 145-181,1975. The injectionof RNA into living cells: the use of frog oocytes for the assay ofmRNA and the study ofthe control ofgene expression.I-ane C.D. et al. Eur J. Biochen. Lll:225-235, 1980.1be Xenopusoocyte as a suffogate secretory system.Larkins B.A. et ¿1. Proc. Natl. Acad. Sci- USA 76(12): 6448-6452,Dec. 1979. Synthesis and processilg of maize storage protei.ns inXenopus laevß oocyfes.I-¿skovR. etal.l Exp. Med.515-541, 1970: Syntlesis, assembly, andsecre{ion of gamma globulin by mouse myeloma cells.Lebreleu B. et zl. Biochem. Biophys. Res. Comm.82(2): 665-673,197E. T¡anslation of mouse interferon rll,Rl:{A Xenopus laevisoocytes.Lederberg J. Scimce 1649-1653, Jun. 1959. Genes a¡d antibodies.Iæe S.Y etal.Proc. NalAcad. Sci. USl68(6): 1331-1335, Jun. 1971.A polynucleotide segrr.entrich in adenylic acid il the rapidly-labeledpolyribosomal RNA com¡nnent ofmouse sa¡coma 180 ascites cells.

Lenno¡r E.S. et al. Cold Spring Harbor Symposia on SuanlitativeBiolpgt32:249-254, 1967. A search forbiosynthetic subunits oflightald heavy chails of immunoglobulins.LimL.etal. Biochim. Biophys. Acta36l:241-247 ,1974. Isolation ofrnicrosomal poly(a)-RNA Aomratbrain directingthe syatlosis ofthemyelin encephalitogenic protein ia Xenop,ts oocytes.

Lim L. et aL Nature 227: 710-'712, 1970. Adenine-¡ice pol¡m.erassociated with rabbit reticulocyte messenger RNA.LingappaVR- et al. J. Cell Biol.79: 567-512, Nov. 1978. Nascent

chicken ovalbumin contai¡s the frrnctional equivalent of a simalsequence.

Lingappa V.R. et al. Nature 281: ll7-121, Sep. 1979. Chicken

ovalbumin contains an intem¿l signal sequence.

LingappaV.R. etal. Proc. Natl. Acad. Sci- USA74Q):2432-2436,Jur... 1977. Nascent prehormo¡es ¡ìre i¡termediates i¡ thebiosynthesis of authentic bovine pituitary gowth hormone andprolactin.Lisowsk¿-Bemstein B. et a.l. Pro¿. Natl. Acad, Sci. USA 66(2):425-532, Jun. 1970. Synthesis ofimmunoglobulin heavy and ligbt chainsby the free ribosomes of a mouse plasm¿ cell tumo¡.

Liu C.P. et zl. Proc. Natl. Acad. Sci. USA 76(9): 4503-4506, Sep.

1979. Biological detection of specific mRNA molecules þmicroinjection.Lockard R.E. et al. Nucl. Acids rRes. 5(9): 323'7-3247, S€,?. 1978.Requirement for 7-methylguanosine in hanslation of globin nRNAir¡ vivo.Mach B. et al. Mol. Biol. Rep. l: 3-6, 1973. Different size of theprodtict of the l4s light ch¡in ¡nRNA ûa¡slated in vitro and inamphibial oorytes.Mains P.E. et al. J. Biol. Chem.258(8): 5027-5033, 1983. Therequirement of light ch,i" for the su¡face deposition of the heavychai¡ of immu¡oglobulin M.Maizel J.Y. Methods in Yirologt, 5: 179-246, 1971. Polyacrylamidegel electrophoresis of viral proteins.Masui Y. J. Exp, Zool. 166(3): 365-376, 1967. Relative roles ofthepituitary, follicle cells, and progesterone i¡ the induction of oocyterratu¡ation in.Rana pipiens.Mechler B. et al, I Cell Biol. 61: l-I5, 1975. Memb¡a¡e-boundribosomes of myeloma cells.Medlmmune, Inc. v. Gmentecå, 12c., No. 05608 (lJ.S.), Brief forPetitione¡.Medlmmune, Inc. v. Gøen!æh, }rc., No. 05{08 (J.S.), Brief fo¡Respondent City of Hope.Medlmmune, Inc. v. Genentech, 1¿c., No. 05-608 (U.S.), Brief ofRespondent Genentech, lnc.Mdlmmune, Inc.v. Genentech, Inc., No. 05-608 (U.S.), Reply Brieffor Petitio¡er.Medlmmune, Inc. v. Genentech, Inc., No. 05-608 (U.S.), hanscript oforal argument.Miflin B.J. el ù. Seed Proî. Improv. l: 137-159, 1979. The biologyald biochemisfy of cereal seed prolamins.Mills F,C. et al. trr'ature306:809-812, Dec. 1983. DNase I hypersen-sitive sites intle cb¡om¿tin ofhumanp immunoglobulin heavy+haingetres.

Moa¡VA. etal.l Mol. Biol.67:93-103, 1971. Translational capacþof living frog eggs andoorytes, as judgedby messenger RNAinjec-tion.Mor¡ison S. Ann. Rev. Immunol.2:239-56,1984. T¡a¡sfer andexprégsion of immunoglobulin genes.

Morrison S. etal. Adu Immunol.44:65-92, 1989. Genetically engi-neered antibody molecules.Monison S. eTal. Proc. Natl. Acad. Sci. USA 8l: 68516855, 1984.Chimeiic human aatibody molecules: mouse antigen-bindingdomains with human consrr¡t rqlion domains.Moriison S.L. Science 229(4719): 1202-1207 ,1985. T¡ansfectomasprovide novel chime¡ic a¡tibodies.Morse¡ J. et al. J. Gen. Virol.44(l): 231-234. Cba¡acte¡ization ofinterfero¡ messenger RNA from human lymphoblastoid cells.Mous J. et al. Biochen. Biophys. Res. Comm.79(4): llll-l116,1979. Synttresis of rat prostatic binding protein h Xenopus oæytesand inwheat germ.



Mous J. et al. Eun J. Biochem.94:393400,1979. Translation ofbiologically active messenger RNA from human placeÃlaln Xenoptts

oocytes.Mous J.M. et al. J. Biol. Chem. 251(19): 11822-11828, Oct. 1982.

Assembly, glycosylation, and secretion ofthe oligorneric rat prostât¡c

birding protein in Xenopils oocyles.

Neuberger M. En boJ. 2(8): 1373-1378, 1983. Expression and regu-lation of immunoglobulin heavy chain gene t¡â¡sfected intolymphoid cells.O'Fa¡rell P. J. Biol. Chem. 250(10): 40074021,1975. High resolu-

tion two-dimensional electrophoresis of proteins.

Ochi A. et zl. Proc. Natl. Acad. Sci. USA 80: 6351-6355, 1983.

Functional imrnunoglobulin M production after t¡ansfection ofcloned immunoglobulin heavy and light chain genes into lymphoidcells.Olsson L. Proc. Nail. Acad. Sci. USA 77(9): 5429-543L, 1980.

Human-humal hybridomas producing monoclonal antibodies of pre-

defred antigenic specifrcity.Olsson L. eT al. J. Immunol. Meth. 6lt 17-32, 1983. A-ntibody pro-ducing human-human hþridomas.Palade G. Science 189:347-358,1975. Intacellula¡ aspects oftheprocess of proteil synthesis.Palmite¡ R. et al. J. B io l. Chem. 246(3): 7 24 -7 37, I 97 l. Modulationofovalbumin synthesis by esEadiol-l7p and actinomycin D ¿s stud-

ied in explants ofchick oviduct in cultu¡e.

Papkoff J. et zl. Mol. Cell. Biol. 10(6): 2723-2730, 1990. Secreted¡nt-l Protein Is Associated wit¡ the Cell Su¡face.Penm¡¡ S. et al. J. MoL Biol. 34:49-69, 1968. Localization andkinetics of form¿tion of nuclea¡ heterodisperse RNA, cytoplasmic

heterodisperse RNA and polyribosorne-associated messenger RNAi¡ HeLa cells.Pilzl. et al. Proc. Natl. Acad. Sci. USA 77(L): ll7-121,1980. Eflectofcleaving interchain disulfide bridges on the r¿dius ofgyration and

maximun length ofarti-poly(D-alanyl) antibodies before and after¡eaction with tetraalanine hapten.Potter M. Methods in Cancer Research II: 105-157,1967. Theplasma cell hrmors andmyelomaproteins of mice.

PotterM. etal.I Gen.Wol.24(5): I I53-I163, I960. Studiesoneightbalsplantable plasma-cell neoplasms of mice.

Queea C. et al. Cell33:'141:74a, 1983. lmmunoglobulin gene tra.n-

scription is activated by downsEeam sequence elernents.Raftery M.A. ü. al. Biochem. Biophys. Res. Comm. 10(6): 467-72,1963. Tryptic cleavage at cysteinyl peptide bonds.RapoportT.A. et al. Eur. J. Biochem.ST:229-233,1978. Synthesis ofcarp proinsulir in Xenopus oocytes.Rascbke W. C. et al. Proc. Natl. Acad. Sc¡. USA 76(7):3469-3473,Jul. 1979. Assembly and secretion of pentameric IgM in a fusionbetween a nonsecreting B cell lynphoma and an lgG-secretingplasmacloma.Reynolds, Jr. F.H., et 21. Proc. Nail- Acad. Sci. USA72(12):4881-4885, 1975. lnterferon activity produced by translation of hum¿ninterferon messenger RNÁ, in cell-free ¡ibosomal systems and inXenopus oöcfies,Robertson M. Nature 301(13): 114, 1.983. Control of antibody pro-duction.Rollins J.W. etal. Science 178: 1204.-1205,1972. Collagen synthesisin Xenopus oocytes after injection ofnuclea¡ RNA ofûog ernbryos.Ross J. etal. Proc. Nal Aced. Sci. USA69 (l):264-268, 1972. Invit¡osynthesis of DNA cornplementary to puriñed rabbit globin mRNA.RotI R.A. et al. Biochem. 20: 6594-6599, 1981. Role of disulfideinterch2nge enzyme in immuoglobulin synthesis.Rothma¡ J.F. et al. Nature 269: 775-7E0, 1977. SynchronisedEansmembrane i¡sefion and glycosylation of ¿ nascent memb¡aneprotein.Rubi¡steinM. etal. Science2lZ: 1289 -1290, 1978. Human leukocleinterferon puriûod to homogeneity.Scher¡er, K. Prac. Nat. Åcad. Sci. USA 56: 157 l-1578, 1966. Patterns

of RNA metabolism i¡ a differentiated cell: ¿ rapidly labeled,unstable 605 RNA with messenger properties in duck erfh¡oblasts.Schubert D. et aI. J. MoL Biol. 53:305-320, 1970. Immunoglobulirbiosynthesis.

Sehgal P.B. etal Proc. Natl.Acad. Sci. USA74\8):3409-3413,1977 'lnterfe¡on messenger RNA content of huma¡ frbroblasts duringinduction, shutoff, and superinú¡ction of interferon production.

Sehgal P.B. et al. Proc. Natl. Acad. Sci. USA 75(10): 5000-5033'

1978. Does 3'-termi¡al poly(A) stabilizehu¡¡¿¡ ûbroblast interferon

mRNA ir ooc¡es of Xenopus laevis?.

Seidman J,G. et al. Nature 27 6(21): 790-795, 1978. The anangement

ald reanangemont of antibody genes.

Shen C.J. et ¿I. Proc. Natl. Acad. Sci. USA 66(4): I 183-l I89, 1970.

lmmunoglobulin synthesis and secretion, V I-ncorpo¡ation ofleucineand glucosamine into immunoglobulin on free and bound

polyribosomes.Shore G.C. d al. J. Cell B iol. 7 2: 7 26-1 43, 1977 . Tu¡o fractions ofrough endoplasmic reticulum from r¿t liver.Siden E. et al. Proc. Natl. Acad. Sci. USA 78(3): L823'1827, Mal1981. Synthesis of immunoglobulin ¡r chain gene products precedes

synthesis of light chains during B-lynrphocyte development.

Siden E.J. et al. Cell 16: 389-396, 1979. lnmunoglohulin Synthesis

by Lymphoid Cells bansformed in vitro by abelson mu¡ine leukemiavirus.Smit¡ A.E. et ú,. J. Virol. 28(l): t40-153, 1978. ExÍaction a¡dfngerprint aaalysis of simian vi¡us 40 large and small T-antigens.SmitÏ M. el aL J. MoL Biol.80: 553-557,1973. Tra¡slation ofMessenger RNA for ¡nouse immunoglobulin l.ight chains in livingftog oocfes.Srnithies O. S c ienc e I 57 : 267 -27 3, I 967. Antibody variability.Snel P. et al. Nøfå. J. Med.2l: !38-143,1978. Removal ofbile acidsbyplasma exchange orplasma cell se,paration followedbyperfusionthrough a charcoal adso¡be¡.Soeiro R. et al. J. Cell Biol.39: ll2-118, 1968. The h.mover ofnuclea¡ DNAJike RNA in HeLa cells.Soreq, H. Critical Reviews in Biochemistry 18(3): 199-238' 1985.

The biosynthesis of Biologically Active Proteins in mRNA-Microinjected Xeøopzs Oocfes.Stavnezff J. et al. Nanre New Biologt 23O(14): 172-116, 1971.

Synthesis of a mouse immunoglobulin light chain in a ¡abbitreticulocyte cell-ftee system.Stevens R.H. et al . J. Cell Biol.50: 818-E29, 1971. RNAmeabolismin HeLa cells at reduced temperature.Stevens R.H. d al. Nature 239: 143-146, 1972. Specific IgG ÍIRNAmolecules from myeloma cells in heterogeneous nuclear and c¡rto-plasrnic RNA contairing poly-A.StevenÞ R.H. et al. Proc. Netl. Acad. Sci. USA 7O(4): tl27'll3l,1973. Isolation ofmessenger RNA coding fo¡ mouse heavy'cl¡¡inimmrrnoglobulin.Stevêns R.H. et al. Proc. Natl. -Acad. Sci. USA 72'. 4679, 1915.Autlò¡s' stateme¡t on the isolation of I¡RNA coding forimmunoglobulin heavy chain.StraussA.W. et al, Critical Reviews in Biochemistry, d. Fasma¡G.D'205-235, Ma¡. 1982. Comparünentaion ofnewly synthesized pro-teins.Summe¡s D.F. eIal. Proc. Natl Acad. Sci. USA 54: 505-513' 1965.

Evidence for vi¡us-specifi c noncapsid proteins in poliovirus-i¡fectedHeI-¿ cells.Swan D. et al. Proc. Natl. Acad. Sci. USA 69Q): 1967-197 I, 1972.Purification andproperties of biologicallyactive messenger RNA fora myeloma light chail.SzilardL. Proc. Natl. Acad. Sci. USA 46: 293-302, 1960. The molecu-lar basis ofantibody formation.Yalle G. et ú. Eu n J B ioc hen. I 32: I 3 l -l 38, I 983. Post-ha¡slationalfate of va¡ia¡t MOPC 3 15 À chains 'n Xenopus oocytes and mousemyeloma cells.vande¡Donk J.A, et al. Neure 271: 479481, 1978. The use ofXenopus qg cells to assay the mRNA of single cells.Vassalli P. et al. .[ Mol. Biol.56: I -19, 1971. Cell-Êee synthesis ofr¿timmunoglobulin.Vassalli P. eT al- Proc. Natl. Acad. Sci. USA 58: 2422-2429, 1967.Studies on cell-ûee synthesis ofrat immunoglobulils, II. Synthesisof immunoglobulin and of antibody to the dinitrophenyl hapten.Vassa¡t G. et zl. Eur J. Biochem. 55: 15-22, 1975. Thyroglobulinmessenger RNA: T¡anslatio¡ of a 33-S nRNA i¡to a peptide immu-nolog'rcally related to thyroglobulin.


as7,923,221BlPage20

Vassart G. et al. Proc. Nal Acad. Sci. USA12(10):3839-3843, 1975

Translation of thyroglobulia 33S messenger RNA as a mea¡s ofdetemining thyroglobulin quaternary sfucture.Verma I.M. et a!. Nalure New Biolop 235(58): 163-167, 1972 In'vitro synthesis of DNA complementary to rabbit reticulocle l0SRNA.Vemon T.O. Proc. Netl. Acad. Sci. USI 80: 825-829, 1983.

Immunoglobulin gene expression in transfomred lymphoid cells.Wabl M. et zl. Proc. Natl. Acad. Sci. USA 79:6976'6978, 1982' Atheory ofallelic and isotypic e,xclusion fo¡ immunoglobulin genes.

Wallace R.A. et al. Developmental Biologt 19: 498-526, 1969. Stud-ies on amphibian yolk.Wallace R.A. etal. J. Cell. Physiol.T2(2):73-89,1968. The i¡ducedsynthesis andtranryort of yolk proteins and theiraccumulation by the

oocyte ln Xenopus I aev i s.

Wallace R.A. et aL. J. Exp. Zool. l75Q): 259-2'70, 1970. Proteinincorporation by isolated amphibian oocytes.WheelerT. et al.l Yirol. 2l(L): 215-224, 1977. Cell'free synthesis ofpolyoma virus capsid proteins VPI andVP2.White J.O. et zl. B i och em. Soc. Tran s. 3 : 9 4-95, 1975. Properties ofrat brai¡ microsom¿l ribo¡ucleeic acid çe¡1¿ining polyadenylate.Wilde C.D, et al, Eun J. Immtmol. lO: 462-267, 1980. Analysis ofimmunoglobulin chain sec¡etion using hybrid myelomas.Wiltiarnson A.R. Biochem. Soc. Thans. 5: 139-175, 1969. TheBiosynthesis of multichair protehs.Williamson R. et al. Ser Haemat.lV(3):23-36,I971. The isolationand DNA/RNA hybridization of messenger RNA for globin.Winberry L. et al. J. Immunol. 124(3): ll74-L182, 1980.

Immuaoglobulin production and secretion by variant clones oftleMOPC3I5 mouse myeloma cell line.Woodla¡d Ii.R. et zl. Developmmtal Biologt 3g(1): 134-14O, 1974.The translation of mammalian globin mRNA injected into fertilisedeggs ofXenopus laevis.YtpC.C. etal. Proc, Natl. Acad. Sci. USA72(12):417?4779,1975.Tra¡slation of messenger ribo¡ucleic acid f¡om isolated pancrealic

islets and human i¡sulinomas.Zehavi-Will¡er T. et ¿1. Cell ll: 683693, 1977. Subcellularcompartmentation of albumin and globi¡ made in oocytes under thedirection of i-njected messenger RNA.Herzenberg, L., "Genetic studies with mammalia¡ cells (mics)"Gra¡t ID R0lCA0468l as entered into the CRISP database, Sep. 3,

1992 (Abstract only).Kabat et al., "Sequences ofimmunoglobulin chains: tabulation and¡nalysis of arni¡o acid sequences ofprecwsors, V-regions, C-regions,J-chain and þtal2-microglobulins . . . ," The Kabat Database ofSequences of Protei¡s of Immunological hterest, 1979, PublicationNo. 80-2008, p. 185, National Institute of Health, Bethesda' MD.Kuehl, W'M., "Light chain fragments: aberrant expression ofimmunoglobulin genes,"Trends Biochem. Sci., Aug. l98l' pp. 206-208, vol. 6, No. 8, Elsevier, Cambridge, Englard.Ma¡tinis et al., "Monoclonal antibodies with dual antigen specifrc-ity," hotides of the Biological Fluids Proceedings Colloquium, vol.30, Neuroproteins, Monoclonal Antibodies Separation Methods,1983, pp. 3ll-316, vol. 30, Peeters, H. (Ed.), Pergamon Press,

Oxford England.Margulies et al., "Regulation of immunoglobulin expression inmousemyeloma cells" Cold Spring Harbor Symposia on quantitativebiology, 1979, pp. 781-791.Sea¡s et al., "Ph¿se-I clinical t¡ial qf m6¡6ç16¡al antibody in teat-ment of gasûointesti¡al nrmou¡s," l¿ncet, Apt 3, 1982,pp.762-765'I¿¡cet R¡blishing Group, Londol, Englaad.Reeck et al., "Homology" in P¡oteins a¡d Nucleic Acids: A Termi-nology Muddle and aWay Out ofit, Cell, Aug. 28, 1987, p. 667, vol.50, No. 5, Cell P¡ess, Cambridge, MA.Davis, "Immunoglobulin molecules and genes" MicrobiologyIncluding lmmunology and rnolecula¡ Genetics, Thi¡d edition, 1980,tafret 11, pp. 338-379, Harper & Row, Hagerstown, MD.U.S. Appl. No. 071233,430, Boss et al. (File History), frled Aug. 18,

1988.U.S. Appl. No. 071930,82L, Boss et al. (File History), filedAug. 14,

1992.U.S. þpl. No. 08/165,530, Winteret al. (File History) filed Dec. 13,

1993.

U.S. Appl. No. 08/320,381, Boss et al. (File History) filed Oct. I I't994.U.S. Appl. No.08/450,727, Boss et al. (File History) filed May 26'

1995.

U.S. Appl No.081452,420, Boss et al' (File History) fled May 26'

1995.

U.S. Appl. No. 08/453,,149, Boss et al. (File History) fled May 30'

1995.

U.S. Appl. No. 08146l,07l, Moore et al. (File History) filed Jun. 5'

t99s." l4tl Amuâl Report-Top 1 00 Biotechnology Companìes" Med AdNews 24 (7) : cover page 22-28, 30, 32, 34, 35 (JuI 2005).

"Columbia, Co-tra¡sformation, Commercialization & Confroversy'

The Axel Patent Litigation" Hamard Journal of Law & Technologt

l7 (2):s83-6t8 (Spring 2004).

"Recommend¿tions on Bacterial hoduction of A¡tibodies" (Memo

Aom RRG to Herbert Heyneke¡ Cabilly Ex 2134, Cabilly v. Boss'

lnterfe¡ence 105, 53 1) (Feb. 2, 1983).

"ReoPro" þackage inse¡t, Boss Ex. lû3l, Cabilly v. Bass, lnterfer-ence 105,53 l) pp. 14 (Nov. 16, 2005).48 Federal Register 2696 (LEXSEE 48 FR 2708), effective Feb. 27,

I 983 (Boss Exhibit 1040, Cabilly v. Boss, lnterference 105, 53 l) pp.

l-35 (Jan.20, 1983).A collection of pichues, graphs and drawings (Cabilly Ex' 2138'

Cabilly v. Boss, lnterference 105,531).A description of experiments and drawings (Cabilly F,x.2137,Cabilly v. Boss, lnte¡ference 105'531).Adocument containing single chain o<pression, double chain expres-

sion a¡d list ofreferences (Cabilly Ex. 2136, Cabilly v. Boss' I¡ter-ference 105,53 l).Affd¿vit of Herbert L. Heyneker; EP 0125023 Opposition (CabillyExhibit 2151; Cabillyv. Boss, lnterfe¡ence No. 105,531) (N4a¡. 20'

1997).A-ffidavit of Ronald lVeEel in U.S. Appl. No. 06/483,457 (CabillyExhibit 2170, Cabilly v. Boss, Interference No. 105,531) (Jul' 22,

1986).Albert¿ et al. Molecular Biologt of the Cel/, New York:Ga¡landPublishing, Inc. (1983).Alexander et al., '! heavy ch¡i¡ disease in man: cDNA sequence

supports partial gene deletion model" Proc. Natl. Acad. Sci. USA

79(ro) :3260 -326a (May 1982).Allore a¡d Ba¡ber, 'A ¡ecommendation for visualizing disulfidebonding by onedimensional sodium dodecyl sulfate-polyacrylamide gel electrophoresis" Analytical BiochemisÍry137 (2):523-527 (Mar. 1984).Amzel et al., '"The Th¡ee Dime¡sional Structure of a ConbiningRegion-Ligand Complex of Immunoglobulin NEW at 3.5-A Reso-

luTion" Proc. Natl. Acad. Sci. USATL(4):1427-1430 (Apr' 1974).

Andersen et al., "P¡oduction tech¡ologies for monoclonal antibodies

a.nd their fragruents" Cun Op. Biotechnol. l5:456462(20M).A¡swer and Counterclaim to the Complaint for Declarafory Judg-

neni òf Invalidity, Unenforceabiliry and Noninfringement withExhibits (G/axoSrn ilhKline v. Genentech and City of Hôpe, Ca'seNo.3 : 10--cv-00675-JSW) (Ma¡ 10, 20 t0).Arthur Riggs Proposal to Genentech (Cabilly Exhibit 2149; Cabillyv..Boss, Interference No. 105,531) (Oct. 5, l98l).Associated hess, "RI scientists ûnd way to mass-produce possible

cancer ûghters" pp. 1-2 (Jul. I I, 1982).Auffray and Rougeon, "Nucleotide s€quence of a cloned cDNAcorrespon¡ling to secreted ¡r chail of mouse immunoglobulil'' Gene

t2(I -2):7 7 -86 @ec. I 980).Baker et al., "Expression of an immunoglobulil kappa light-cbaingene in lymphoid cells usirg a bovine papillomavirus-l (BPV'I)vecïor" Gøe 69(2):349-355 (Sep. 30' 1988).

Banerji et al., 'A Lymphocyte-specitc Cellular Enhance¡ Is LocatedDownstream of the Joining Region in lmmuaoglobulin Heavy Chain

Genes" Cell 33:729-740 (Jul. 1983).Banoji et al., "Expression ofa p-globin gene is enhanced byremoteSV40 DNA sequences" Cell 27(2Pt l):299-308 (Dec. 1981).

Barrett et ¿1., "Enzyme-linked inmunosorbent assay for detection ofhuma¡ antibodies to Salmonellatyph iVr antgen" Journal of C lin ic a IM icrobiologt I7 (4) :625 -627 (Apr. 1983).


as7,923,221ßlPage2l

Basic & Clinica! Immunolog (pp. 28-29, 34-37, 83-95, 254-257,

266-267, 342-381, 7 42, 7 45 -746), H. Hugh Fudenberg, 3¡d edition,

Los Altos:Large Medical Publications (1980).

Bergnan and Kuehl, "Co-banslational modification of nascent

immunoglobulin heavy and light cheins" Journal ofSupramolecularStructilre 1 l(l) :9-2a Q97 9).

Black's Law Dictionary,Gamer,B¡ianA.' 7th edition, St. Pa¡rl:West

Group pp. 129 (1999).

Bolivar et al., "Construction and.Chz¡asteÅzalion ofNov CloningVehicles. II. A Multipurpose Cloning System" Gene 2 :95'Il3(t977).Bollen et al., "Expression in Escl¡erichia coli of wokinase antigenic

determin¿nts" Biochemical & Biophysical Research Communica-

tions 103(2) :39 l-40 I (1981 ).Boss List ofExhibits (as updated Oct. 17, 2008) (Cabillyv Boss,

Interference 105,53 1).

Boss List of Exhibits (as updated Sep. 28, 2007) (Cabilly v. Boss,

Interference 105,53 l).Boss List of hoposed Motions (Cabilly v. .Boss, I¡terfe¡ence105,531) (Mar. 2,2M7).Boss Miscella¡eous Motion 2 (Motion to Exclude Evidence)(Cabillyv. Boss, Interference 105,531) (Oct. 31, 2007).Boss Miscellaneous Motion 3 (Motion to Stike Cabilly Reply 5)(Cabillyv. Boss, lnte¡fe¡ence 105,53f) (Oct. 21,2008).Boss Notification of Notice ofApp øl (Cabilly v. Boss, lnterference

105,531) (Feb. I l, 2009).Boss Objection to Served Evidence Served with Cabilly Reply I(Cabilly v. Boss, lnterference 105,531) (Oct, 5,2007).Boss Opposition ! (Cabilly v. Boss, Interference 105'531) (Aug. 24,

2007).Boss Opposition 2 (Cabillyv. Boss,Interference 105,531) (Aug. 24,

2007).Boss Opposition 4 (Cabillyv. Boss, Interference 105,531) (Aug. 29,

2008).Boss Opposition 5 (Cabi l ly v. B os s, lnterfere¡ce 105'53 1 ) (Aug 29,

2008).Boss Reply | (Cabillyv, Boss, Interference 105,531 ) (Sep. 28, 2007).

Boss Repty 2 (Motion to Exclude Evidence) (Cabilly v. Bass, Inter-ference 105,53 1) (Dec. 5, 2007).Boss Reply 3 (Ca bi lly v. B os s, lúerterence I 05,53 l) (Nov. 4, 2008).

Boss Response to Cabilly Reply 4-Additional Material Facts

(Cabillyv. Boss, I¡terference 105,53f) (Oct. 17, 2008).Boss Response to Cabilly Response to PaperNo. 80 (Ca billyv' Boss,Interference 105,53 l) (Apr. 4, 2008).Boss Responseto Memora.ndum Opinion and Order(Cabillyv' Boss,Interference 105,53 l) (Mar. 2, 2OO7).

Boss Substantive Motion I (forjudpentbased on obviousness-typ€double patenting) (Cabillyv. Boss, lnterfere¡ce 105,531) (May 25,2007).BossUKapplication GB 8308235 (CabillyEx. 2186' Cabillyv. Boss,Interfe¡ence 105,53 l) (Mar. 25, 1983).

Boss' Response to Cabilly Reply 5-Additio¡al Maferial Facts

(Cabillyv. Eoss, lnterference 105,531) (Oct. 17' 2008),Boven and Pi¡edo, "Monoclonal antibodies in cancer te¿ünent:whe¡e do we st¿nd after l0 years?" Radiotherepy &, Oncologt 5

(2) :r09-l 17 (Feb. 1986).Bowden et al., 'Clonirg ofeukaryotic genes in single-strand phage

vecto¡s: the huma¡ interferon genes" Gene 27(l):87-99 (Jan. 1984).Br¿ur €t a1., "The second cenhry ofthe antibody. Molecular per-

s¡rectives i.n regulation, pathophysiology, and therapeutic applica-tions" Wælern Journal of Medicine l57Q):158-168 (Aug. 1992).Brekke and Sandlie, 'lherapq¡tic a¡tibodies fo¡ huma¡ diseases atthe daw¡ of the twenty-firstcenirt'' Nature Reviqts. DrugDiscov-ery 2(l) :5242 (Jan. 2003).BÍousseau et al., "Synthesis of a human ilsulin gene V. E¡zymahcassernbly, ç16¡i¡g and characterization of the huma¡ proinzulilDNA'Ge¿e 17 :279-289 (1982).Burton, D., "Human Monoclonal Antibodies: Achievement andPoteútal" Hospitel Practice 27(8) :67-74 (Ãug. 15,1992).Cabilly Exhibit List (Interference 104,532).Cabilly List of Exhibits (as fled on Sep. 17, 2007) (Cabilly v.

Eosslnterference I 05,53 I ).

Cabilly List of Exhibits (as fiIed on S ep 28, 2007) (Cabil þ v' B os s'

lnterference I 05,53 I ).Cabilly Motions L ist (Cabilly v. Boss, lnterference 105,53 l) (N'Iar. 2'

2oo7).Cabilly Notice of Related P¡oceedin gs (Cabilly v. Boss, Interferencc

105,531) (Jan. 30, 2007).

Cabilly Notice ofService ofSupplemental Evidence (Responding to

Boss's Objection to Cabilly Exhibit2089) (Cebillyv, Boss, I¡terfe¡'ence 105,53 l) (Sep. 17,2001).Cabilly Oppositior I (Cabilly v. Boss, Interferenco 105'531) (Aug'24,200'7).Cabilly Opposition 2 (Opposing Boss Motion to Exclude Evidence)

(Cabillyv. Boss, Interference 105,531) (Nov. 2O,2O07).

Cabilly Oprposition3 (Cabillyv. Eosq Interference 105,53I) (oct.28,2008).Cabilly Reply (Rçgarding Boss "Response" to PaperNo . 80) (Cabillyv. .Boss, lnterference f05,53 l) (Apr 8, 2008).

Cabilly Reply I (Reply to Boss Opposition I to Cabilly Substantive

lrlotiot l) (Cabitly v. -Boss, lnterference 105,531) (Sep .28,2007).Cabilly Reply 2 (Reply to Boss Opposition 2 to Cabilly Substantive

MoTion2)(Cabilly v. Bo,ts, lnt€rference 105,531) (Sep. 28'20oi)'Cabilly Reply 4 (Reply to Boss Oppositiot 4) (Cabilly v. Boss'

lnterfe¡ence 105,531) (Oct. 10, 2008).Cabilly Reply 5 (Reply to Boss Oppositioa 5) (Cabilly v' Boss'

Interfe¡ence f 05,53 1) (Oct. 10, 2008).Cabilly Response to Paper No. 80 (Coórþ v. Boss, Interference

105;531) (N4a¡. 17, 2008).Cabilly Substantive Motion I (For Judgrrent Based on Estoppel)(Cebillyv. Boss, I¡te¡ference 105'531) (May 25, 2007).Cabilly Substantive Motion2 (For Judsm.entu¡der35 U.S.C' 102(g))(Cabillyv. Bass, Interference 105,531) (May 25,2007).Cabilly Substantive Motion 4 (To Change Beneût Accorded Boss)(Cabillyv. Boss, lnterfe¡ence 105,531) (Jun. 27,2008).Cabilly Substantive Motion 5 (For Judgement on hiority) (Caór'þv.8oss, lnterference 105,53 1) (Jun. 27, 2008).Cabilly Supplemental Notice of Related Proceedings (Cabilly v.

.Boss, lnterfe¡ence 105,531) (Sep. l7,2001).Cabilly Tutorial (Cabilly v..Bos.r, Interfe¡ence 105,531) (May 25'2007).Cabilly's Response to Request for Prio¡ Art (in ¡esponding to thememoraldum opinion a¡d orde¡ (paper No. 3) dated Jan L6' 2007(Cabillyv. Boss, lnterference 105,531) (Mar. 2,2007).Cabilly's Responsive Paper Discussing Moore Patent (inrespondingto the memo¡a¡dum opinion and order þaper No. 3) dared Jan. 16'

20O7 (Cabillyv. Boss, Interference 105'531) (Ma¡. 2,2007)Cabilly's Updated List of Exhibits (as of Nov 12,2008) (Cabilly v.

8ass, lnterference 105,531) (Nov. 12,2008).Calendar for year 1983 (Cabilly Exhibit2l53, Cabilly v. 8oss, Inter-fe¡ence No. 105,53 l) (1983).

Celltech R&D Ltd.'s Reply Brief in Support of Its Motion for Judg'ment on the Pleadings (Redacte{ Non-Co¡fde¡rtial Version),

Mdimmunev. Genentech, City ofHope, and Celltech,Case No. CV03-02561 MRP (CTx) (Cabilly Ex. 2127 , Cabilly v.Bo,ss, Interfer-ence 105,531) (Dec. 5,2003).Centocor's Reply to Defen¡lants' Fi¡st Amended Counterclaims(Centocor v. Gqtentech and City ofHope, Case No. CV 08'03573

MRP (cTx) (Nov. 26, 2008).Cetrtóçor, Inc.'s Opening Brief on ClaimConstuction with Exhibits(Ceitòcor v. Genentech and City of Hope, Case No. CV 08-03573

MRP (CTx) (Apr. 14, 2009).Chang et al ., "Phenotypic E4pression in E coli of a DNA Sequence

Coding for Mouse Dihydrofolate Reductase" iV¿l¿re 275 :617-624(oct. 19, 1978).City of Hope's Answerto First Amended Complaint andAff¡mativeDefenses, Jury T¡ial Demanded (Cenlocor v. Genentech and Cþ ofl{opa, Case No. CV 08-03573 MRP (CTx)) (Sep' 19, 2008).

City of Hope's Answer to Second Amended Complabt and Atr¡m¿-tiveDefenses, JuryTrial Demanded(Centocorv. Genentech and Cþofflope, Case No. CV 08-03573 MRP (CTx) (Jul . 14,2009).Civil Mlnutes--4etreral, Scheduling Conference (Centocor v.

Genentech and Cþ of Hope, Case No. CV 08-03573 MRP (CTx)(Feb. 9,2009).


tJS 7,923,221 B1Page22

Claim ConstuctionOrdet (Centocorv. Genentech a¡d City of Hope,Case No. CV 08-03573 MRP (CTx)' (Jun. 8, 2009).Claim ConsüuctionOrdet (Medlmmunev. Genentech, Case No. CV03-2567 MRP (CTx)) (Aug. t6,2007).Clarification (Decision on Cabilly request for clariûcation) (Cabillyv. Bass, Interference 105,531) (Dec. 30, 2008).

Cohen et ¿1., 'l.,lonch¡omosomal A¡tibiotic Resista¡ce in Bacteria:Genetic Tra¡sform¿tioî of EscherichiacolibyR-FactorDNA'Proc.Natl. Acad. Sci. USA 69(8) :21 l0-2 I 14 (Aug. 1972).Comparison of Draft U. S, Appl. No. 06 I 483,457 daled, tr.lar. 25, 1983

with U.S. Appt. N o. 06/ 483,457, frledApr. 8, t 983 (Cabìlly Ex. 2 124,Cabilly v. Boss, Interference 105,531).Comparison of Draft U.S. Appl. No. 06/483,457 datedMar. 3l , 1983

with U.S. Appl. N o. 06/ 483,45'1, ñledApr. 8, I 983 (Cabilly Ex. 2 125,

Cabilly v. Boss, lnterfe¡ence 105,531).Comparison of Draft Aprpllcation of U.S. Appl. No. 06/483,457 dated

Feb.25, 1983 a¡d U.S. Appl. No.061483i457, filed Apr. 8, 1983

(Cabilly Ex. 2 123, Cab i lly v. Bo.rs, lnterference I 05,53 l).Complaint for Declaratory Judgment (Centocor v. Genentech &. Cilyof Hope, case No. CV08-03573P4 (AGRx), C.D. Cal.) (May 30,

2008).Complaint for Declaratory Judgrnent of tnvalidity, Unenforceability,ard Noninûingernent with Exhibits (GlaxosmithKline v. Genentechand City of Hope, Case No. 3:10-cv-00675-JSW) (Feb. l'7,2010).Complaint uftr Exhibits (G/cxo,Sn ithKline v. Genentech and Ciry ofHope,Civll Action 09-61608) (Oct.8, 2009).Cordingley ald Preston,'"Transcription and t¡anslation of the herpessimplex virus type I tlymidine ki¡ase gene after microi.njection intoXenopus laevis oocylæ" Journal of General Wrologt 5a (P'2):409-414 (Juu. l98l).Conespondence between cou¡sel for Cabilly and cou¡sel fo¡ Boss

regarding joint response to Paper No. 80 i¡ Interference 105,531(Cabilly Ex. 2126, Cabilly v. 8oss, Interference 105,531) (Mar.

2008).çqsimi et al., "IJse of monoclo¡al a¡tibodies to T-cell subsets forimmunologic moaitoring a¡d treatrnetrt in recipients of ¡enalallografts" New England J. ofMedicine 305(6) :308-314 (Aug. 6,

r98r).Cover letter, Extension of Time, Repl¡ and Terminal Disclaime¡ inU.S. Appl No. 08/422,187 (Cabilly Ex;hibit 2201, Cabilly v. Boss,I¡terference No. 105,531) (Mar. 3,2003).Crea et al,, 'Chemical Syntlesis of Genes for Human Insulìn" ProcNatI Acad Sci U S A75(12) :5765-5769 (Dec. 1978).Croce et al., "Cbromosomal location of the genes for humanimrnunoglobulin heavy chainJ' Proc. Natl. Acad. Sci. USA 76(7 ) :34 16-34 t9 (Jul. 1979).Croce et al., 'Prefe¡ential retention of human ch¡omosome 14 inmouse X huma¡ B cell hþrids" European Journal of Immunologtr0 :486488 (1980).Cross-Exami¡ation of Michael Botchan, Ph.D. (Boss Exhibit f 043,Cabillyv. Boss, Interference 105,53I) (Jul. 31, 2008).Cross-Exarri¡ation of Ronald B. WeEel, Ph.D. (Boss Exhibit 1039Cabilþv. Boss, lnterference 105,531) (Aug. 5, 2008).C¡oss-Exami¡¿tion of Shmuel Cabilly (Boss Exlibit 1042,Cabillyv.-Boss, lnterference f05,531) (Aug. 12, 2008).Curiculum Vit¿e of Ian A¡d¡ew Mlson, D. Phil., D.Sc., F.RS.(Cabilly Exhibit 2061. Cabilly v. Boss, lnterference 105,53 I ).CurriculumVtae of Steven Lanier McKnight (Cabilly Exhibit 2107,Cabilly v. Boss, Interfe¡ence 105,531).Dalla-Favera et al., "Human c-myc onc gene is located on the regionof ch¡omosome 8 that is hanslocated in Burkitt lymphoma cells"Proc. Natl. Acad. Sci. USA79(24):7824-7827 (D€c. 1982).Date stamped postcard from yto (Cåbilly Exhibit 2158, Cabillyv..Boss, lnterference No. 105,531) (Apr. 8, 1983).Date stamped receipt ftom PTO dated Apr. 8, 1983; cove¡ lette¡ datedApr. 22, 1983 fromDeGastyne to Jobnston; anddebitnotedatedApr.22, 1983 (Cabilly Exhibit 2143, Cabilly v. Boss, Interfe¡e¡cel05,s3l) (Apr. 1983).de Sai¡tVincent et al., '"The Cloning a¡d Reintroduction into AnimalCells of a Fu¡ctional CAD Genq a Domi¡ant Amplifiable GeneticM¿¡ker" Cell21(Paft l) :267-277 (Dec. L98l).

Declarìafion for Patent Application dated Apr. 4, 1983 ard Apr. 5,

1983 (Cabilly Exhibit 2 140, Cabilly v. Bo¡s, Interference 105,53 1)

(1e93).Decla¡ation ofA¡thurD. Riggs, Ph,D., filed on Jun. 27, 2008 (CabillyExhibit 2200, Cabillyv..Boss, Interference No. 105,531) (Jun. 20,

2008).Declaration ofA¡úur Riggs ir Patent Interfe¡ence 102,572 (CabillyE),JibitZl44, Cabillyv. Boss,Interference 105,53 l) (Oct. 28, l99l).Declaration ofDaralyn J. Durie in Support ofDefendants Genentech,

lnc. a¡d Cþ of Hope's Motion to T¡ansfer witl Exhibits(GlaxoSmithKl ine v. Genentech an¿ Cily of Hope, Case No. 3 : 10-cv-

00675-JSW) (Mar. 10, 2010).

Decla¡¿tion of Dennis R. Burton, Ph.D. with Exhibit @oss Exhibit1004, Cabillyv. Boss, Interference 105,531) (May 25, 2007).

Decla¡ation of Dr Kate H. Murashige, Esq., filed Jùr'.27, 2008(Cabilly Exhibit 2195, Cabilly v. Boss, hterference No. 105,531)(Jun. 23,2008).Decla¡ation of Dr Ma¡y-Jane Gething with Exlibit (Centocor vGenentech and City of llope, Case No. CV 08-03573 MRP (CTx)(Mar.24,2009).Decla¡ation of Dr. Richard Axel, fled Oct. 5, 1999 ir US A¡pl. No'08/422, 187 with Exhibits.Declaration ofGeofüey ThomasYan'aaton (Received at PTO on Jul.

17, 1995 for U.S. Appl. No. 08/450,727,Czbilly F,x.2078ì'. Cabillyv -Boss, lnterference 105,531) (Jun. I, 1995).Decla¡ation of GeofteyThomasYarranton, filedApr. 3, 1996 in U.S.Appl. No. 08/165,530 (Cabilly Ex. 2094, Cabilly v. Boss, lnterfer-ence 105,531) (Mår. 13, 1996).Decla¡alion of Geofrey Thomas Yarranton, filed in U.S. Afpl. No'08/233,430 (Cabilly Ex. 207 0, Cabi lly v. B os s,Itterference 105,53 1)

(Mar.2a, ß92}Decl¿rätion of Geoftey Thomas Yaranton, filed i¡ U.S. Appl. No,08/ 450,721 (Cabilly Ex. 2078, Cabilþ v. -Boss, lnterference 105,53 l)(Ju¡. l,1995).Decla¡alion of He¡bert L. Heyneke¡ Ph.D., ûled Jun. 27, 2008(Cabilty Exhibit 2198, Cabilly v. Boss, Interference No. 105'531)(Jun. 24, 2008).Declaration of Ia¡ A. Wilson, D. Phil., D.SC., F.R.S. (Cabilly Ex.2066, Cabillyv. Boss, lnterference 105,531) (May 22, 2007).Declaration of Jeanne Perry in Patent Interference No. 102,572(Cabilly Exhibit 2179, Cabilly v. Boss, lnterference No. 105,531)(Oct. 21, l99l).Declaration of L. Jeanne Perry Ph.D., filed Jun. 27,2008 (CabillyÞ{hibit 2203, Cabilly v. Boss, Interfe¡ence No. 105'531) (Jur. 23,2008).Decla¡ation ofMa¡cus E. Sernel in Support ofGenentech, lnc.'s andCity of Hope's Opening Brief on Claim Const¡uction with Exhibits(Centocor v. Gqentech and City of Hope, Case No. CV 0843573MRP (CTx)) (Ma¡. 24, 2009).Decla¡ation of Mark Lemley in Support of Defenda¡ts Ge¡entech,lnc. a¡d City of Hope's Motion to Transfer (GlaxosmithKl¡ne v.

Genentech and City of Hope, Case No, 3: l0-cv-00675-JSVD (Ma¡.r0,2010),Decl¿ration of Martin P. Hoftnan, Esquire, filed Jun. 27, 2008(Cabilly Exhibit 2190, Cabilly v. Boss, lnterference No. 105,531)(Jur. 24, 2008).Declaration of Michael Botchan under 37 CFR 1.132 witl Exhibit,filed in Reexamination ConEol Nos. 90/007,542 and 90/007'859(Cabilly Exlribit 2193, Cabilly v. Boss, lnterference No. 105'531)(May.20,2001).Declaration of Michael Botch¿¡, Ph.D., fled Jun 27,2008 (CabillyF->ùibit 2187, Cabilly v..Boss, Interference No. 105,531) (Jun. 23,2008)iDeciarårion of Ronald B. Weøel, Ph.D., filed Ju¡. 27, 2008 (CabillyExhibit 2199, Cabitlyv. Eoss, lnterfe¡ence No. 105,531) (Jun. 24,2008).Declaration ofRonald WeF¿el in Patent Interfe¡ence No. 102,572(Cabilly Exhibit 2169, Cabilly v. Boss, lnterfe¡ence No. 105,531)(Oct.28, l99l).Declaration of Shmuel Cabilly in Patent lnterfe¡ence No. 102,572(Cabilly Exhibit 2162, Cabilly v. Boss, Interfe¡ence No. 105,531)(Oct.28, r99r).


as7,923,221B1Page23

Declaration of Shmuel Cabilly, Ph.D. (ln Support of Priority ofInvention), ûled Jun . 27, 2008 (Cabilly Exúibit2204, Cabil ly v' Boss,

Interference No. 105,531) (Jur. 25,2008).Decla¡a¡ion of Steven La¡ie¡ McKnight, filedAug. 24,2007 (CabillyEx. 2093, Cabilly v. Boss, Interference 105,53 I ) (Aug. 23,200'l).Declaration of Mlliam E. Holmes, Ph. D., ûled Jun. 27, 2008(Cabilly Exhibit 2188, Cabilly v..Boss, Interference No. 105,531)(Jun. 20, 2008).Declaralion of William Holmes in Patent Interference No. 102,572(Cabilly Exhibit 2159, Cabilly v. Boss, Interfe¡ence No. 105,531)(oct.28, l99l).DeclarationofYvonne Bobadill¿, filed Jun. 27, 2008 (Cabilly Exhibit2202, Cabilly v..8ass, lnterference No. 105,53 l) (Jun. 24, 2008).

Defend¿nt Genentech, Inc.'s andCity of Hope's Counterclaims, Jury

Trial Dema¡ded with Exhibits (Centocor v. Genentech and City ofI/ope, Case No. CV 08-03573 MRP (CTx)) (Sep. 19, 2008).

Defenda¡t Genentech, lnc.'s and City of Hope's F.i¡st Amended

Counterclaims, Jury Trial De¡n¿¡ded with Exhibits (Centocor Y.

Gerientech and City of Hope, Case No. CV 08-03573 MRP (CTx)(Oct. 10,2008).Defenda¡t Genentech, Inc.'s Answer to Fi¡st Amended Conplainta¡d Affnnative Defenses, Jury Trial Dem¿nded (Centocor v.Genentech and. Cþ of Hope, Case No. CV 08-03573 MRP (CTx)(Sep. 19,2008).Defendant Genentech, Inc.'s A.nswer to Second Amended Corrplainta¡d Affirmative Defenses, Jury Trial Dem¿¡ded (Cmtocor v.

Genentech and City of Hope, Case No. CV 08-03573 MRP (CTx)(Jul. 14,2009).Defend¿nts Genentech lnc.'s and City of Hope's Second AmendedCou¡te¡claims, Ju¡y Trial Demand (Centocor v. Genentech and Cityofilope, Case No. CV 08-03573 MRP (CTx)) (Jul. l, 2009).Defend¿¡ts Genentech, lnc. and Cþ ofHope's Motion to T¡ansfe¡iMemora¡dum of Points and Autho¡ities (GlexosmithKline Y.

Genqttech and City of Hope, Case No. 3:10-cv-00675-JSSD (Ma¡.r0,2010).Defendants' Motion to Dismiss o¡ in the Alternative Transfe¡ Actionto the United States Distict Cou¡t for the Cent¡al District of Califo¡-nia and Supporting Memorandum of Law (GlaxoSmithKline v.Gene¡tech and City ofHope, Civil Action 09-61608) (Dec 16, 2009).Deposition of A¡thu¡ D. Riggs, Ph.D. witl Er'hrbits (Centocor v.

Genøtech and City of Hope, Case No. CV 08-03573 MRP (CTx)(Mar.26,20I0).Deposition of Dennis Bu¡ton, Ph.D. @oss Exhibit 1035, Cabilly v.Boss, lnterfe¡ence 105,53 l) (Aug. 2,2007).Deposition of Dennis Burton, Ph.D. @oss Exhibit 1051, Cabilly v.

8o¡s, lnterfe¡ence 105,531) (Sep. 24,2008).Deposition of Dennis R. Burton, Ph.D. (Cabilly Ex . 2092, C a bil Iy v.

Bo.ys, lnterfe¡ence 105,531) (Aug. 2,2007).Deposition of He¡bef Heyneker, Ph.D. with Exhibits (Centocor v.

Genentech and City of Hope, Case No. CV 08-03573 MRP (CTx)(Apr 2,2010).Deposition ofJohn E. Shively with Exhibits (Centocor v. Genentechand Cþ of Hope, Case No. CV 08-03573 MRP (CTx)) (Mar. 2,

2010).Deposition of Joha llllcLaul$lin(Cenlocorv. Genentech and City ofË1ope, Case No. CV 08-03573 MRP (CTx) (Jul. 3 l, 2009).Deposition of Kate H. Murashige with Exhibits (Centocor v.

Genentech and Cily of Hope, Case No. CV 08-03573 MRP (CTx)(Mar.9,20r0).Deposition of Kate H. Murashige, Ph.D. (Boss Exhibit lHl,Cabillyv. Boss, Interference 105,53 l) (Aug.7,2008).Deposition of L. Jeanne Perrywith Etrhibits (Centocor v. Genentechend City of Hope, Case No. CV 08-03573 MRP (CTx)) (Apr. 30,2010),Deposition of Ronald Wetzel with Exhibits (Cenlocor v. Genentechand City of Hope, Case No. CV 08-03573 MRP (CTx) (Jaa. 28,20r0).Deposition of Shmuel Cabilly, Ph.D. with Exhibits (Centocor v.

Genqtech and City of Hope, Case No. CV 08-03573 MRP (CTx))(Apr.9,2010).Deposition of Wendy M. Lee (Centocor v. Genmtech and City ofI1ope, Case No. CV 08-03573 MRP (CTx) (Apr.27,20l0).

Deposition of Mlliam E. Holmes, Ph .D. (Cenlocor \' Genentech and

City of Hope,Case No. CV 08-03573 MRP (CTx) (Apr' 30' 2010).

Deposition Trarscript of A¡thu¡ D. Riggs, M.D. with F-><hibits

(Medimmune,Inc.v. Ge¡tentech, Inc. and Cþ ofHope' Case No.

cv03-2567 MRP (cTx)) (Nov. t6,2007).Depoòition Trarscrþt of Danny Huntington, Esq. (Mdinmune, Inc.v. Genentech, Inc and City of HopeCase No. CV03-2567 MRP(CTx)), (Dec. lS, 2007).Deposition Transcript of E. Finø¡ Walton, Ph.D. (Medimmne v'

Genentech and Ciþ ofãope,CaseNo. 03-2567 MRP (CTx) ) (Apr.

23,2008).Deposition Transcript of Gilger Dreger with Exhibits (Medimmune,

[nc.i. Genentech, Inc. and City of Hope, Case No. CV03-2567 MRP(CTx)) (oct. t7,2007).Deposition Transcript of Henry Lowmal,Ph.D. (Medimmune, Inc.vGenentech, Inc. and City ofHope,Case No. CV03-2567 MRP (CTx)(Feb.6,2008).Deposition Transcript of Herbert Heyneker with Exhibits (Medim-

mune, Inc.v. Genentech, Inc. andCity ofHope,CaseNo. CV03'2567MRP (CTx)) (oct. 28, 2007 ).Deposition Transcrip of Ian M. Amitage with E¡<hibits (Medìm-

mune, Inc. v. Genentech, Inc. and City of Hope, Case No' CV03'2567MRP (CTx)) (oct. t6,2oo7).Deposition Tra.nscrþt of Jea¡¡e Perry, Ph.D. (Medimmune, Inc. vGenentech, Inc. and Cify ofHope, Case No. CV03-2567 MRP (CTx)(Jan. 18,2008).Deposition Transcript of Lau¡ie H. Glimcher, M.D. (Mdimnune,Inc.v. Genentech, Inc. and Cþ ofHope, Case No. CV03-2567 MRP(cTx)) (Apr. 22,2008).Deposition Transcript of Matthew P. Scott, Ph.D. (Medimmune,Inc'v. Genentech, Inc. and City of Hope, Case No. CV03-2567 MRP(CTx)) (Ap¡. 16,2008).Deposition Transcript of Max D. Hensley with Ex\ibits (Medim-

munet Inc, v. Genentech, Inc. and City of Hope, Case No' CV03-2567MRP (CTx)) (oct. 24, 2007).

Deposition Transcript of Ronald Burnell WeEel with Exhibits(Medimmune, Inc. v. Gqentech, Inc. and Cþ of Hope, Case No'Cv03-2567 MRP (CTx) (Nov. 29,2007)'Deposition Transcript of Scott Chanber:s,Ph'.D. (Mdimmune, fnc. vGenentech, Inc. and City ofHoPe, C¿se No. CV03-2567 MRP (CTx)(Apr. 2a,2008).Deposition Tra:rscrþt of Sean Joh¡ston (Medimmune, Inc, v'Genentech, Inc. and City offiope, Case No. CV03-2567 MRP (CTx)(Nov.9, 2007).DepositionTranscript of Sharon E. Crane, Ph.D. (Mdimmune, Inc.v.Genentech, Inc. and City ofilope, CaseNo. CV03-2567 MRP(CTx)(Dec. 18,2007).Deposition Transcript of Shmuel Cabilly (with exhibits, Medim-mune, Inc. v. Genenlech, Inc. and Cþ of Hope, Case No' CV03'2567MRP (CTx) (l-[ov. 1,2007).Deposition Transcript of Timotly R. Schwartz(Medimmune, Inc.v.Genentech, Inc. and City ofúope, Case No. CVO3-2567 MRP (CTx)(Dec.4,2007).Deposition Transcript of William E. Holmes with Eútbit (Medin-mune, Inc. v. Genenlech, Inc. and City of Hope, Case No. CV03'2567MRP (CTx)) (oct. t9,2007).Diagram (PlaintitrExhibit 76, Centocor v. Genentech and Ciþ ofIIope, Case No. CV 08-03573 MRP (CTx).Diagranr (Plaintitr Exhibit 77, Cenlocor v. Genentech and City ofI{ope, Case No. CV 08-03573 MRP (CTx).Ditlma¡ et al., "Therapy of cbronic lymphoclic leukemia and cuta-

neous T-cell lymphoma witl Tl0l monoclonal antibodf' Joumal ofClinical Oncologt 2(8):881-891 (Aug. 1984).Dill¡4an, R., "Monoclonal antibodies in the hea.tnent of ca¡cet''Critièal Reviews in Oncologt-Hemotolog L @):357-385 (19&l).Docket repof as ofSep. 17,2007, Medimmune Inc.v. Genentech,

12c., U.S. DisEict Court, Central Distict Court of Califomia. Case

No. ì2:03+v-02567-MRP-CT (Cabilly Ex. 2112, Cebilly v. Boss,

lnterfeience I 05,5 3 I ).Docirment entitled 'T-egod to Figures" (Cabilly Exhibit 2165,

Caùillyv. Boss, lnte¡fe¡ence No. 105,531).


as7,923,221BlPage24

Draft Applicafion of U.S. Appl. No. 06/483,457 (Annotated withha¡dwritten li¡e numbers, Cabilly Ex. 2 120 A, Cabil Iy v. 8oss, I¡ter-ference 105,531) (Feb.25, 1983).

Draft Application of U.S. Appl. No.06/483,457 (Cabilly Ex. 2120,

Cabillyv. Boss, Interference 105,531) (Feb. 25, 1983).Draft Application of U.S. Appl. No.06/483157 (Cabilly Ex. 2121,

Cabillyv. Boss, lnterference 105,531) (Mar. 25, 1983).

Draft Application of U.S. Appl. No. 06/483157 (Cabilly 8x.2122,Cab illy v. B oss, Interference 105,53 I ) (Mar. 3 I, 1983).

Dunnick et al., 'A mouse immunoglobulin heavy chai¡ deletion

muta¡t: isolation of a cDNA clone and sequence analysis of themRl.Í A" Nucleic Acids Research 8(7) :147 5 -l4M (Apr. I I, 1980).

Ebersma, D., "Investment Community Meeting: Fina¡cial Over-view" (Slides presented on Genentech, Inc. webcast) pp. I -23 (Mar.

r4,2008).Echols and Mu¡ialdo, "Genetic map of bacteriophage lambda"

Microbiological Reviews 42(3) :577 -591 (Sep. 1978).Edelman et al., "Reconstitution of Immunologic Activity by Interac-tion ofPolypepitde Chains ofA¡tibo dies" Proc. Natl. .Acad. Sci. USA

50 :753-761 (1963).Edelman et al., "The covalent sfiucture of a.n entire 1Gimmunoglobulin molecule" Proc. Natl. Aced. Sci. USA 63 :7E-E5(re6e).fdslman, "Antibody Structure and Molecular Immunolory" (NobelLecture: Physiolory or Medicine) pp. 3 l-54 (D€c. 12, 1972).

Edge et al., "Total Synthesis ofa Human Leukocyte Interfeton Gend'Nature 292:7 56 -762 ( I 98 I ).Engvall and Perlma¡n, "Enzymeli¡ked immunosorbent assay

(ELISA) Quantitative ass¿y of immuroglobulin G'Immunochemistry 8(9) :871-874 (Sep. 1971).Erikson et al., "Assignment of the genes for huma¡ l'immunoglobulin chains to ch¡omosome22" Neture 294(5837) :173-175 (Nov 12, l98l).ErrataConecting Declaration (Paper No. 1.5) (Caát7þv..Boss, I-nter-

ference 105,531) (Mã. 9,2007).Etkin and Maxson Jr., '"The synthesis of¿uthentic sea urchi¡ tran-scriptional a¡d üanslation¿l products by sea urchin histone genes

injected i-nto Xenopus laevis oocytes" Developmental Biologt 7 5(l):13-25 (Mar. 1980).Excerpts from P¡osecution File History (Exhibit 1173, Glaxo v.C ab il Iy, Inføfercnce No. I M,532, datd I 994- 1995).Excerpts from the prosecution historyofU.S. Appl, No.08/165,530(Winter et al.) fled Dec. 13, 1993 (dated 1996-197).Expense Reimbu¡sement Document (Cabilly Eyûibit 2150; Cabillyv. 8oss, Interference No. 105,531).Expert Rebuttal Report of John E. Shively, Ph.D. (Plai¡titr Exhibit134, Centocor v, Genentech and City of Hope, Case No. CV08-03573 MRP (CTx)) (May 5, 2000).Expert Repof ofAfte Skerra, Ph.D. (Cez tocorv. Genentech and CityofHope, Case No. CV 08-03573 MRP (CTx) (May 14, 2010).Expert Report of Carlo M. Croce, M.D. with E>úibits(Medlmmune,Inc.v. Genentech, Inc. and Cþ ofHope, Case No. CV03-2567 MRP(CTx), C.D.Cal.) (N,far. 1,2008).Expert Report of E. Fintan Waltot (Medimmune v. Genenrech andCity ofHope, C¿se No. CV03-2567 (CTx) (Feb.29, 2008).Expert Report of Esther M. Kepplinger with ErÁibrts (Mdlmmune,In c. v. Gen entech, Inc. and City of Hope (Case No. CV03-2567 MRP(CTx), C.D.cal.)) (Mar. l,2008).Expert Report ofEugene Rzrcidlo (Centocorv. Genentech and Cþof Hope, Case No. CV 08-03573 MRP (CTx)) (Møy l4,20l0).Expert Report of JamesA. Fo¡$ne¡ with Exhibits (Medlrtmune,Inc.v. Genentech, Inc- and City of Hope (Case No. CV03-2567 MRP(cTx), C.D,cal.)) (Jan. 24, 2008).Expe¡t Report of K¿tlryn L. Calame, Ph.D. with Exhibits (Medlm-mune, Inc. v. Genenlech, Inc. and C ity ofHope (CaseNo. CVO3 -2567MRP (CTx), C.D.Cal.)) (Jar. 25, 2008).Expert Report of Lau¡ie H. Glimcher, M.D. with Exhlbits (MdIm-mune, Inc. v. Gøtentech, Inc. and C ity ofHope (C.aseNo. CV03 -2567MRP (CTx), C.D.Cal.)) (Jan. 25, 2008).Expert Report of Mary-Jane H. Gething, Ph.D. with Exhibits(Medlmmune, Inc.v. Genentech, Inc. and Cþ ofHope (Case No.CV03-2567 MRP (CTx), C.D.Cal.)) (Mar. 1,2008).

Expert Repof of Mattlew P. Scott, Ph.D. with Exhibits (Medlm-

mune, Inc.v. Genenlech, Inc. and CityofHoPe(CaseNo. CV03-2567MRP (CTx), c.D.Cal.)) (Ma¡. l,2008).Expert Report of Michel C. Nussenzweig M.D', Ph.D. with Exhibits(Medlmmune, Inc. v. Genentech, Inc. and Cþ of Hope (Case No.Cvo3-2s67 MRP (CTx), C.D.Cal.)) (Jan. 25, 2008).Expert Report of Røndolph Wall, Ph ,D. (Cqrtocor Y. Genentech endCity of Hope, Case No. CV 0843573 MRP (CTx) (lvlay 14,2010)'Expert Report of Robe¡t B, F¡eedman witl Exhibits (Mdlmmune,Inc. u. Genentec h, In c. and C i ty of Hope (Case No. CV03-2567 MRP(cTx), c.D.cal.)) (Feb. 29, 2008).Expert Reports of De¡nis R Buton, Ph.D. A¡d Jonathan S, Weiss-

man, Ph.D., Genentech, Inc. v. Celltech Therapeutics, Ll¿., CaseNoC98-392ó MMC ENE (Cabilly Ex. 2089Þq Cabilly v. .Boss, lnte¡fer-ence 105,531) (Apr. 14,2000).Expert Witness Report of Scott A.M. Chambers, Ph.D. with E><hibits

(Medlmmune, Inc. v. Genentech, Inc. ønd Cþ of Hope (Case No.Cv03-2567 MRP (CTx), C.D.Cal.) (Jan. 24,2008).Express Mail Post Ofrce Receipt date.d Ma¡.22, 1983 and City ofHope Request for Petty Cash (Cabilly Exhibit 2166' Cabillyv. Boss,lnterfe¡ence No. 105,53 l) Mz1. 22, 1983).

Express mail receipt dated Mar. 29, 1983 and City ofHope Request

for Petty Cash (Cabilly Ex. 2139, Cabilly v.8ass, Interfe¡encel0s,53l) (r983).First Amended Complaint for Declaratory Judgrnent (Centocor v.

Genentech and City of Hope, C¿se No. CV 08-03573 MRP (CTx)(Sep. 3, 2008).First Recla¡ation (Paper No, 19) (Cebilþ v. Boss, Interfe¡ence105,53 1) (Feb. 14, 2007).Fjerrrcdzl,G. MagicBzl/els(dust jacket andtable of contents), NewYo¡k:Macmillian Publishing Company (198a).

Flight itinerary forDr Cabilly(CabillyExlibit 2168, Cabillyv. Boss,

lnterfe¡ence No. 105,53 l) (Jan. 1983).Folger et al., "Pattems of integration of DNA microinjected intocultwed m¿¡nmalian cells: evidence for homologous recombinationbetween injected plasmid DNA molecules" Molecular &' CellularBiologt 2(11) :1372-1387 (Nov. 1982).Foon et al., "Effects ofmonocloral antibody therapy in patients withcbronic lymphorytic leukemia" Blod 6a$) :1085-1093 (Nov'1984).Freedman and Sel4 "R.ecovery ofspecific activity upon ¡eoxidationof completely reduced polyalaroyl rabbit aatibody'' Journal of Bio-logiòal Chemistry 241(22) :5225-5232 (Nov. 25, 1966).

Gerfentech, lnc.'s and City of Hope's Corrected Opening B¡ief onClaim Constructi o1 (Centocor v. Ganentech and Cþ ofHope, CaæNo. CV 08-03573 MRP (CTx)) (Apr. 2,2009).Genêntech, Inc.'s and City of Hope's Opening Brief on Claim Con-stuction (Centocor v. Genentech and City of Hope, Case No. CV08-03573 MRP (cTx)) (Mar. 24, 2009).Genèntech, Inc.'s and City of Hope's Reply Brief on Claim Con-struction (Centocor v. Genentech and City ofHope, Case No. CV08-03573 MRP (CTx)) (Apt.28,20@).Genentech, I-nc., "Genentech and Lilly Reach Settlement" (Press

release: Boss Exhibit 1030,Cabillyv. Boss, Interfe¡ence 105,53 l) pp.

I (Jan.5, 1995).Ge¡hard et al., "Repeloire of antivi¡al antibodies expressed byso¡natic cell hybrids"Prac. NøL Acad. Sci. USA 75(3) :1510-1514(Mar, 1978).Gheysen and Fiers, "Expression and excretio¡ ofhuman fibroblast B¡intei.fe¡on in monkey cells after transfection with a re¡ombin¡ntSV40 plasmid vectof' Journal of Molecalar & Applid GenetÍcs I(5) :38s-394 (1982).Glaxo Group Limited and GlaxoSmitlKli¡e's Notice of DismissalWithout hejudice (GlarcSmithKline v. Gqtentech and City of Hope,Civil Action 09-61608) (Feb. 17,2OlO).Glaxo Wellcome Inc. Exhibit List (Glaxo v. Cabilly, Inte¡fe¡ence104,532).Goeddel et al:, "Expression 'n Escherichia cali of chemically syn-thesized genes for hum¿n i¡suli¡" Proc. Natl. Acad. Sci. USA 76(l):106-ll0(1979).Goto and Hamaguchi, "IJnfolding and refolding ofthe constant frâg-ment of the immunoglobulia light chail" Journal of Molecular Biol-ogt $6 @):891-910 (Apr. 2s, t982).


as7,923,221BlPage25

Goto and Hamaguchi, "Unfolding aad refolding ofthe ¡educed con-st¿nt fragment of the immunoglobulin light chain. Kinetic role of thei¡uacb¿i¡ disulfide bond" Journal of Molecular Biologt 156 (4) :

9l l-926 (Apr. 25, 1982).G¡atram a¡d van der Eb, "T¡a¡sformation of rat cells by DNA ofhuma¡ adenovin¡s 5" Virologt 54 (2) :536-539 (Aug. 1973).Graves et al., "Sequence-specific DNA uptake in transformation ofNeisseria gonorrhoeae" Jorrnal of B acteriologt 152 (3) :lO7 l -107 7(Dec. i982).G¡osschedl and Baltimore, 'Cell-type specifrcity of immunoglobulingene e"xpression is regulated by at least tùree DNA sequence ele-ments" Cell 4l (3) :885-897 (Jul. 1985).Grosschedl et aI., "lnEoduction of ¿ pimmunoglobulin gene into tlemouse germline: specitc e.xpression in lymphoid cells and synthesisof i¡nctional antibody''Ce// 38 (3) :6a7{58 (Oct. 1984).G¡unstein and Hopess, "Colony hþridization: a method for tleisolation ofcloned DNAS that contai¡ a speciûc gene" Proc. Natl.Acad. Sci. USA72(lO):3961-3965 (Oct. 1975).Gunge, N., "Yeast DNA plasmids" Annual Review of Microbiologt37 :253-216 (1983).Haber, 8., "A¡tibodies as models forratioml drug desigf'Biochemi-c al P h armaco logt 32 (13) : 19 61 - 7977 (Jul. l, 1983).Haber, E., "A¡tibodies l¡ vivo" Pharmacological Reviews 34 (l) :

77-U (Mar. 1982).Haber, E., "Monoclonal a¡tibodies to drugs: new diagnostic andtherapeutic tools" Monoclonal Antibdies in Clinical Mdicine, A.J.McMichael et al., NewYork:Academic Press pp. 477 -500 (1982).Habe¡, E., "Recovery of Altigenic SpecificityAfterDenatu¡¿tion andComplete Reductionof Disulfides i¡ a Papain Fragnent ofAntibody''Proc. NatL Acad. Sci. USA 52:1099-1 106 (Oct. 1964).Hamer and Leder, "Expression of the ch¡omosomal mouse pmaj -globin gene cloned in SY4o" Nature 281(5126):3540 (Sep. 6,1979).Hemer et ¿1., "SV40 recombinents carrying rabbit p-globin gene

coding sequences" Cell L7Q):725-735 (Jul. 1979).Hanahan et al., "Characteristics of a¡ SV4O-plasmid recombi¡anta¡d its movement into a¡d out of tle genome of a mur ne cell" Cell21 :t27 -139 (Aug. 1980).Handwritten Yield Calculation (Plaintiff Exhibit E2, Centocor v.Genentech and CiÍy of Hope, Case No. CV 08-03573 MRP (CTx))(20r0).Hardyet al., "Productio¡ nB. subtills ofhepatitis B core antigen anda major artigen of foot and mouth dise¿se virus" Nature 293(5832):481483 (Oct. E, l9El).Hawleyet al., "Immunoglobulin synthesis in non-B cell line s" Immu-nologt Letters 12 (5-6) :257-262 (Jun. 1986).Hellman et al., "Characterization and molecula¡ cloning of themRNA fo¡ the heavy (e) chain of rat irnmunoglobulin E" Proc. Natl.Acad. Sci. USA79 (4):1264-1268 (Feb. 1982).Hess et al., "Cooperation of Glycolytic En4¡mes" Advances inEnzyme Regulation, George Weber, NewYork:Pergamon P¡ess vol.7 :149-167 (1968).Hi¿tt et aI., '?roduction of antibodies in transgenic plants" Nature342 (6245):76-78 (Nov. 2, 1989).Hitzeman et al., "Expression of a Human Gene fo¡ lnterferon inYezst" Nature 293 :7 17 -7 22 (1981).Hitzema¡ et al., "Expression of Hepatitis BVirus Surface A-ntigen inYeast" Nucleic Acids Research ll (9) :2745-2763 (1983).

Hitzeman et al., "Isolation and Cha¡acterization of the Yeast3-Phosphoglycerokilase Gene @GK) by an Immunological Screen-ing Technique" Journal ofBiological Chemistry 255 (24) :12073-12080 (Dec. 25, 1980).Hodgson, J., "Making monoclonals i¡ microbes" Biolîechnologt 9(s) :42t42s (N{ay 1991).Holla¡d and Holla¡d, 'lsolation and Identification ofYeast Messen-ger fubonucleic Acids Coding for Enolase, Glyceraldehyde-3-phos-phate Dehydrogenase, aad Phosphogþerate Kinase" Biochemistryr7 (23) :49o04907 (197 8).Hood et al., "The org,anization, expression, a¡d evolution ofantibodygenes and other multigene families" Ann Rev. Genet.9 :305-353(1e75).Howard, M.C., "Antigen-induced B lymphocyte differentiation"CRC Crit. Reu. Immunol.3 (3) :181-208 (1982).

Hube¡, R., "spatial strucnre of immunoglobulin molecules"Klinische Wochenschrif 58 (22) :1217 -1231 (Nov. 17, 1980).

Hung, P., "The cloning, isolatjon and cha¡acterization ofa biologi-cally active human enzl¿ne, urekinasç, in E. coll' Advances inExperimental Medicine & Biologt I7Z :281'293 (1984)'I¡dex ofDocuments Ente¡ed in Interference No. 105,53 I (as of Sep.

t3,2001).Iøku¡a et al., "Expression in Escherichia coli of aChemically Syn'tlesized Gene for the Hormone Somâtostatin" Science 198:1056'1063 (t97'.7).

Jirgensons et al., "struchue studies on human serum 1-globulins and

myeloma proteins. III. t<id¿tive sulfitolysis of myeloma globulinsa¡d reconstitution of the macromolecules" Archives ofBiochemistry & Biophysics lll (2) :283-295 (Aug. 1965).

Joint,Decla¡atio¡ of Shmuel Cabilly, Herbert Heyneke¡ WilliamHolmes, A¡thur Riggs and Ronald Wetzel ûled Nov. 3, 2003 in U.S.Appl. No. 08/422,187 (Cabilly Ex. 2145, Cabillyv. Bass, lnterfer-ence 105,53 l).Joint Rule 26(f) Report (Centocor v. Gqrentech and Ctly ofHope,Case No. CV 08-03573 MRP (CTx) (Feb.2,2009).Jones, E., "hoteinase Muta¡ts of ,Saccharomyces cerevisiaè' Gqet-lcs 85 (l) :23-33 (Jan. 1977).

Judgment (Paper No. L4l) (Cabilly v. .Boss, fnterference 105,531)(Dec. 8,2008).Judgment (U.S. Court of Appea.ls fo¡ the Fede¡al Circuit, Boss v.

C abi I ly, Intefierence I 0 5, 53 I ) (Dec. I l, 2009).Judgme.rt, Genentech v. Celltech, CaseNo, C98-3926 MMC (WDB)U.S. District Cou¡t, Northem Dishict of California, San Francisco

Division (Cabilly Ex. 2027, Cabilly v. .Boss, Interfe¡ence Nol0s,53l) (M¿r. 16, 2001).Kabat et al. Sequences of Innwoglobulin Cåafts (NIH Pub. No.80-2008), Bethesd¿, MD:National Institutes of Health pp. 133-154(1e7e).

Kabat et al. Sequences of Imnunoglobulin Cåcrzs (NIH Pub' No'80-2008), Bethesd¿, MD:National Institutes of Health pp. 185

(1e79).Keamey JF et al, '.A trew mouse myelorna cell line that h¡s lostimmunoglobulin expression but permits the const¡uction of anti-body-æcreting hybrid cell Ínes" J. Immunol 123 (4) :1548-1550(Oct. 1979).Kenten et al., "Cloning and sequence determilation ofthe gene forthehuman immunoglobulin echain expressedinamyelomacell line"Proc. Natl. Acad. Sci. US.A 79 (21) :6661-6665 (Nov. 1982)'Kenten et al., "P¡operties ofa human immuaoglobulin e-chain frag-ment syntlesized ln Escherichia coli" Proc. Natl. Acad. Sci. USASI(t0) 295s-2959 (May 1984).Kingsrnan et al., "Replication ln Saccharomyces cerøtisiae ofPlasmid pBR3l3 Carrying DNA Aom the yeast Ípl Region" Geze7 il4r:r52 (1979).Kipþs et al., "Allotype Switch Varia.nts i¡ Cultu¡ed Monoclo¡¡l P¡o-ducing Hþridomas" Journal of Cellular Biochemistry (Absüact0443) 26 (S8A) :163 (1984).Koide et al., "Recognition of IgG by Fc receptor and complement:effects of glycosidase digestion" Biochemical & BiophysicalResearch Communications 75 (4) :838-8aa ( Apr.25, 1977)Koprowski etal., "hoduction ofantibodies against influenzavirus bysomatic cell hybrids between rnouse myeloma and primed spleencells" Proc. Natl. Acad Sci. USA 74 Q) :2985-298E (Jul. 1977).

Ku¡okawa et al., "Expression of human immunoglobulin E e ch¡incDNAin.E coli" Nucleic Acids Research Ll (lO) :3O77-3085 (l983).Larson et al., "Im¿ging of mela.nomawith l-l3l-labeled monoclonala¡tibodief' Journal of Nuclear Medicine 24 (2) :t23-129 (Fó.1983).Iauþ et al, 'Expression of tle Human Insulin Gene in an AlternateMammalian Cell and in Cell Exhacts" Jourzal of Biologícal Chem-istry 258 (10) :60376042 (19E3).Laub et al., "Expression of the Hum¿n Insulin Gene ¿¡d cDNA in ¿Heterologous Manunal ran Sy stenf ' Journal of Bio logi ca I Chemi stry258 (10) :6043-6050 (1983).Law Deparhnent Status Repoft (Cabilly Ex. 2131, Cabilly v. Boss,lnterference 105,53 l) (Nov. 3, 1982).


as7,92322lBlPage26

Iænnox, E., "Monoclonal antibodies a¡d tumor antigens---a perspec-

ti,vø" Hybridomas in Cancer Diagnosis and Treatment (hogress inCancer Resea¡ch and Therapy vol. 2l), Mitchell et al., NewYo¡k:Raven Press pp. 5-13 (1982).

Letter ftom Ron¿ld Wetzel to George Rose regarding IgG (PlaintifExfibit 78, Cenîocor v. Genentech and Cþ ofHope, Case No. CV08-03573 MRP (CTx)) (Apr. 14, 1983).Letter to M¿rtin P Hoftnan from Linda K. Johnston (Cabilly Ex.

2 l 4 l, Cab illy v. Boss, Interference 1 05, 53 1 ) (Apr. 6, 1 983).Liu et al., "Clonirg a¡d nucleotide sequence of mouse

immunoglobulin e ch¿in cDNA" Proc. Natl. Acad. Sci. USA 19(24) :'7852-78s6 (Dec. 1982).

Marked-up copy of Mar. 25, 1983 Draft Application (Cabilly Ex.2 142, Cab illy v. 8ass, Interference I 05, 53 I ) (Mar. 25, I 983).

Marked-upcopy ofproposed Ex. 2122, forwa¡ded to Boss byCabillywitl Dr¿ft Joint Submission Responding to Paper 80, showing com-parison bet. Cabilly Mar. 25, 1983 draft apph. and Cabilly Mar. 31,

1983 draft appl-n. @oss Exhibit 1036, Cabilly v. Boss, Int. 105,531)(Mar.3l, 1983).Marson, "The puriûcation ofeukaryotic polypeptides synthesized inEscherichia coli" Biochemical Journal 24O:l-f2 (1986).Martens et al., "Heavy chain genes of rabbit IgG: isolation ofa cDNAencoding t heavy chein a¡d identiûcation oftwo genomic Crgenes"Proc. Natl. Acad. Sci. USA 79 (19) :6018-6022 (Oct. 1982).McCarty, M., "Chemical Natu¡e and Biological Specifrcity of Thre

Substance lnducing Tra:rsformation of Pneumococcal þpes" B acte-riological Reviews l0 (l-2) :63-71 (Mar. 1946).McCormick et a[., 'Inducible expression of anpliûed human betai¡terferon genes in CHO cells" Moleculat' & Cellular Biologt 4(I) : 166-t7 2 (Jan. 1984).Med Ad News (Top 50 pharmaceutical companies ch¿rts and lists

included) 13 (9) :10, 12, 14 (Sep.2007).Medimmune, Inc. v. Genentech, Inc,, Cþ of Hope and Celltech,Order remanding to district couf (Fed Cir. Nos. 04-1300,-1364

Qvlat7,2007).Medimmune, Inc. v. Genentech, Inc., City of Hope end Celltech,Stipulation and OrderReschedulhgApr. 17, 2007 Status Co¡fe¡ence(C.D. Cal. No. Cv 03-2s67 MRP (cTx) (Apr. 12,200?).Medlmmune, Inc.v. Genentech, Inc., No. 05-608 (U.S.), slip opinion(Jan. 9,2007).Medlrnmune, lnc.'s Responses and Objections to Genentech, Inc.'sSecond Sa of Interogatories (Medimmme v. Genentech, Cþ ofHope and Celltech, C¿se No. CVO3-2567 MRP (CTx) (Feb. 24,2004).

(Jun. a,2008).Memo¡andum Opinion and Order @ecision on Cabilly Motion2--?atent¿bility) (Paper No. 139) (Cabilly v, -Boss, lnterferenceI0s,53l) @ec. 8,2008).Memorandum Opinion and Order @ecision on Cabilly MotionS-lriority) (Paper No. 140) (Caáillyv. Boss,Interference 105,531)(Dec. 8, 2008).Memorandum Opinion and Orde.r @aper No.3) (Cabilly v. Boss,Interference 105,53 l) (Jan. 16, 2007).Memorandum Opinion and Order (Paper No. 80) (Cabilly v. Boss,Interfere¡ce 105,53 1) (Feb. 12, 2008).Me¡E and Gurdon, "Pu¡ified DNAs a¡e ha¡sc¡ibed afrer microiljec-t\oninto Xenopus oocytes" Proc. Natl. Acad. Sci. USA74 (4):1502-1506 (Apr. 1977).Miller andLevy, "Responseofcutaneous T cell lymphomato therapywith hþridoma monoclonal antibody'' Lancet 2 (8240) :226-230(Aug. r, l98r).

Miller et al., "Considerations fo¡ te¿Ínent with hþridorna antibod-ies".Hybridomas in cancer diagnosis lnd treatment (Progess inCancer Rese¿¡ch and Therapy, vol. 2l), Mitchell et al., NewYork:Raven Press p¡r. 133-145 (1982).Miller et al., '"Treabnent of B-cell lynphom¿ with monoclonal anti-idiotype antibody'' New England J. of Medicine 306 (9) :517'522(Mar.4, 1982).

Milstein et al., "lnterchai¡ Disulphide Bridges of MouseImmnnoglobulin M" Biochemical Jownal l5l :615424 (1975).

Mi¡utes from Markman Heaing, Centocor v. Genentech and City ofI{oþ, Case No. CV 08-03573 MRP (CTx) (May 12,2009).Mirutes of Order, C tocor v. Genentech and Cþ of Hope'CaseNo,CV 08-03573 MRP (CTx) (Jun.9, 2009).Minutes ofTelephonic Status Conference, Centocor v. Genentechand City of Hope, C¿se No. CV 08-03573 MRP (CTx) (Jun. 10,

2009).Miozza¡i and Ya.nofsþ, "T¡anslatio¡ of the leade¡ region ofEscherichia cofi tryptophan operon" Journal of Bacteriologt 133

(3) :1457 -t¿t66 (1978).Monoclonal Antibodres, Roger H. Kennett et al., NewYo¡k:Plenumhess pp. 8-l r, 75-99, l7 l -182, 27 5 -289 (1980).

Morrison and Schlom, "Recombin¿nt chimeric monoclonal antibod-ies" Important Advances in Oncologt,1994 Philadelphia:J.8. Lip-pi¡cott Compaûypp. 3-18 (1990).

Morrison etal., "Production of novel immunoglobulin molecules bygene transfection" Mount Sinai Journal ofMedicine 53 (3) :175-180(Mar. 1986).Muihürski et al., "Mouse immunoglobulin D: consEuction a¡dcha¡-acte¡ization ofaclonedô chain cDNA 'Proc. Natl. Acad. Sci. USA77(\ :7 a0s-7 a09 (Dec. 1980).Myers and Spiegelmal, "Sodiumpyrophosphate inhibition of RNA.DNA hþrid degradation by reverse Fa.nscriptase" Prac. Natl. ,4'cad.

Sci. USA 75 (l l) :5329-5333 (Nov. 1978).Nakamurâ, R., "Mo¡oclonal antibodies: methods and clinical labo-ratory applications" Clinical Physiologt & Biochemìstry I (2-5) :

r60-172 (1983).Neumaier et al., "Cloning ofthe genes for T84.66, an antibody thathas a high specifcity and atrnity for carcinoembryonic antigen, andexpression of chimeric human/mouse T84.66 genes in myelom¿ andChinese hamste¡ ovary cells" Cancer Research 50 Q) :2128-2134(Apr I, 1990).New¡na¡ et al., "Selection and properties of a mouse L-celltansforma¡t expressing humøn transfer¡in receptor" Netwe 3M(5927) :643 445 (Aug. 1983).Ng et al., "Monoclonal antibodies and immuaologic approaches tomalienant Etmors" Advances in Internal Medicine 28 :253-276

I0s,53 l) (Jan. 16, 2007 ).Noticè ofEx Pa¡te Reexamination Certificate Issuance, Cenlocorv.Genènlech and Cþ of Hope, Case No. CV 08-03573 MRP (CTx)(May2t,2009).Notice of Manual Filng, Cenlocor v. Genenlech and City of Hope,Case No. CV 08-03573 MRP (CTx) (Jun. 15, 2009).Obata et al., "Immunoglobulin yl heavy chain ge¡e: struch¡ral genesequences cloned in a bacte¡ial plasmid' Gene 9 (l-2) :87-97 (Apr.1980).Ohno and Tanigrrchi, "Inducer-responsive expression of the clonedhuman interfe¡on p, gene inüodrced into culhued mouse cells"Nucleic Acids Research l0 Q) :967-977 (Feb. I t, 1982).OldlramandSm¿lley, "Immunotherapy: the oldandtheneu/' JournalofBiological Response Modifiers 2 (l) :t-37 (1983).

Olsson andKaplaa, "Human-human monoclonal aatibody-produc-ing hybridomas: tecbnicalasryts" Methods in Enzymologt92 :3-16(1983).

Meeting notes prepared by Kate Murashige (Cabilly Ex. 2135, (1983).Cabillyv.Boss,lnterference 105,531)(Mar. 14, 1983). Norman, P, 'TmmunotherÐpy' Progess in Allergt 32 :318-346

Mellon et al., "Identification of DNA seçences required for tra¡- (1982).scription of the huma¡ <r,l - globin gene in a new SV40 host-vector Nose et aI., "Biological Sipifcance of Carbohydrate Cheins on

systenÌ' Cell 27(2 part l):279-288 (1981). Monoclonal A¡tibodies" Proc. Natl. Acad. Sci. USA 80 :6632-6636Mello¡ et al., "Efrcient s¡rnthesis of enzymatically active calf (Nov. 1983).chymosin in Seccharomyces cerevisiae" Gene 24 (l) :l-la (Sep. Notes or Cabilly Patent (Plaintif Exhibit 135, Cqttocor v.

1983). Genentech end City ofãope, Case No. CV 08-03573 MRP CTx)Memo¡a¡dum Opinion and Order @ecision on Cabilly Motion (2000).l----estoppel) (Paper No. 95) (Caàlþ v. .Boss, Interference 105,531) Notice of Decla¡ation (Paper No. L) (Cabilly v. Boss, Interference


as7,923,221BlPage27

Olsson, L,, "Monoclo¡al antibodies inclinical immunobiology Deri-vation, potential, a¡d limitations" Allergt 38 (3) :tas-l54 (Apr.

1983).Order-Motion Times-Bd.R. 104(c) (Cabilly v. 8oss, I-nterference

105,531) O{ar. 9,2007).Order--Ðral Argument a¡d Other Matte¡s (Cabilly v. Boss, lnterfer-ence 105,531) (Oct. 3,2008).Order-Priority Motion Times-Bd.R. l0a(c) (Paper No. 90)

(Cabilly v. Boss, Interference t05,53 I ) (Apr. I 6, 2008).

Order Dismissing Czse (GlaxoSmithKline v. Genentech and Ciry ofHope, Cwll Action 09-6 1608) (Feb. 17, 2010).Order Regarding Resolution of Interference, Genentech, Inc. v.

Celltech Therapøttics, Ltd.,CaseNo. C98-3976 MMC (Cabilly Ex.

20a3, C ab il ly v. Boss, Interference I 05,53 I ) (Mar. 16, 200 I ).Ove¡head slides presented by Dr. He¡a.eker (Cabilly Ex. 2133,

Cab il Iy v. B os s, Interference I 05,53 I ) (Feb. I, I 983).

Overhead slides presented by Dr. Heyneker with Kate Murashige'snotes (Cabilly Exlibit 2183, Cabilly v. Boss, Interference No.l0s,s3t) (Feb. I, le83).Paabo et al., "Association between bansplaatation antigens and a

vi¡al membrane protei-n synthesized from ¿ mammalian expressionvætof' Cell35 (2) :445453 (Jun. t983).Page 57 from Notebook of D¡. Ro¡¿ld WeEel, provided to Cabillyduring depositionofD¡.WeEel on Aug. 5,2008 (Boss Exhibit 1037,

Cabillyv. Boss, Interference 105,531) (Feb. 24,1983).Pages Aom Dr. Ron¿ld Wetzel's I-¿b Notebook compiled duringdeposition ofDr. Wetzel on Aug. 5, 2008, providedto Cabilly duringdçosition ofDr. Wet'zel onAug. 5, 2008 (Boss Exhibit lî38,Cabillyv, .Boss, lnterference 105,53 I ) (1983).Pavlakis and Hamer, "Regulation of a metallothionein-growth hor-mone hþrid gene in bovine papilloma virus" Proc. Natl- Acad. Sci.USA 80 (2) :397 401 (Jan. 1983).PCT aprplication No. PCT/GBE4/00094 (W084/037I2 publishedSep. 27, 198{, 6led by Boss et al. (Cabilly Exhibit 2194, Cabilly v.

Boss, Interfèrence No. 105,531) (Mar.23, 1984.).

Pen¡ica et al., "Clonilg and Expression of Huma¡ Tissue-typePlasminogen Activator cDNA in E. coli" Nature 301 :214-221(1e83).Perry and Wetzel, "Disulûde bond engineered into T4 lyso4ane:st¿bilization ofthe protein toward thermal inactivation" Science 226(4674):555-557 (Nov 2, 1984).Perry et al,, "Purificatio¡ of monoclonal antibodies usilg high per-

formance liquid cfuomatography (HPLC)" Preparative Biochemis-try L4 (5):431441 (19&1).Perry laboratory notebook 1683 (Cabitly Ex¡ibit 2185, Cabillyv.Boss, lnterference No. 105,53 l) pp . 19-21 a¡d25-27 .

Perry laboratory notebookNo. 1290 (Cabilly Exlibit2líZ, Cabillyv.Boss, Interfe¡ence No. 105,531) pp.48-51.Perry laboratory notebookNo. 1290 (Cabilly Exhibit2lg2, Cab illy v.Boss, I-nterference No. 105,531) pp. 9 (t983).Petersen a¡d Do¡¡ington, "¿¡ ¡¡ t¡¡o system for studying the kineticsof interchain disulfide bond formation in immunoglobttlinG" Jour-nal of B iological C hem i s t ry 249 <17) : 5 633 - 564 I (Sep. I 0, I 974).Piggee, C., "Therapeutic antibodies coming through tÏe pipelire"Analytical Chemistry 80 (7) :2305-2310 (Apr. I, 2008).Plaintiff Centocor O¡tho Biotech Inc. and Thfud Party psf6¡dent5

Global Pha¡m¿ceutical Supply Group, LLC, Centocor Biologics,LLC a¡d Jom Pharmaceutical Services, lnc.'s Fi¡st Amended Replyto Defend¿nts' Second Amended Counte¡claims (Centocor v.

Genentech & Ciþ ofHope,Case CY 08-03573 MRP) (Jul. 20, 2009).Plai¡tiff Centoco¡ O¡tho Biotech Inc. a¡d Third Party DefendantsGlobal Pharmaceutical Supply Group, LLC, Centocor Biologics,LLC a¡d Jom Pbarmaceutical Sewices, lnc.'s Reply to Defendants'SecondAmended Counte¡claims, Ce¿tocor v. Geneñtech and City of.Flope, Case No. CV 08-03573 MRP (CTx) (Jul. 14,2009).Plaintitr Exhibit 74, Drawing page ftom US Patent 6,331,415(Centocor v. Genentech and Cþ of Hopûzse No. CV 08-03573MRP (CTx)) (Dec. 18,2001).Plaintiffs Glaxo Group Limited and GlaxoSmithKline LLC's Oppo-sition to Defendants' Motion to Tra¡sfe¡ with Exhibits

<Glaxosn¡thKline v. Genentech and Cíty of Hope, C¡¡se No. 3 : l0-cv-675-JSW) (Mar. 26, 20 I0).

Plucktlun and Skerr¿, "Expression of frrnctional antibody Fv and Fab

fragnents in.Escå erichia colÌ" Methds in Enzymologt 178 :497 -515(1e8e).Pluckthun, A.,'Escherichia coli Producing Recombinant A¡tibod-ies" Recombinant Mictob$for Industial and Agricultural Applica-tions (Pan of Bioprocess Tecbnology Series v' l9), Murooka mdI¡nan¿ka NewYork:Marcel Delkeer, Inc., Chapter 13, pp. 233-252(lee4).Polisky, 8., 'ColEl replication conhol circuitry: sense fro¡na¡tisense" Cell 55 (6):929-932 (1988).

Poljak et al., "shuctu¡e ofFab' New at 6 A resolutio¡" Nature NuBiologt2S5 :137-140 (Fú.2, 1972).

Poynton ald Reading,'Monoclonal antibodies: the possibilities forcancer therzpf' Experimental Biologt 43 (l ) : I 3-33 (1984).

Prelimi¡aryAmendment in the Moo¡e U.S. þpl' No' 08 /461,07 I pp.l4 (Jun. s, 1995).Preliminary Statement ofthe Pa¡tyCabilly et aI., B oss et al. v' Cebillyet al., I¡tertercnce 102,572 (Boss Exhibit 1049, Cabilly v. Boss,

lnterference I 05,53 l) (Jun. 4, 1991).P¡entice et al., "Use ofanti-T-cell ¡nonoclonal antibody OKT3 toprevent âcute graft-versus-host dise¿se i¡ allogeneic bo¡emanowtansplantation fo¡ acute leukaemia'' Lancet | (8274):10O-7O3 (Mar'27,1982).Proposed Order Granting Glaxo Group Limited and SmitlKlineBeecham Corporation d/b/a GlaxoSmithKline's Unopposed Motionfor Enlargement of Time to Respond to Motio¡ to Disniss or in the

Alternative T¡ansferAction (G/axaSm ithKl ine v. Gøentech and Cityof Hope, Civil Action 09-61608) @ec. 23'2009).Putnarn, F., "Immunoglobulin structure: variability and homology''Science 163 (868):633-643 (Feb. 14' 1969).R¿rdcin et al., "Expressior in Escherichic cali of biologically active

enryme by a DNA sequence coding for the human plasminogen

activator urokinase" Proc. Netl. Acad. Sci. USA 18 (6) :3313-3317(Jun. 1981).

Recoid ofOral Hearing (OraI Hearing Held: Jan' 23' 2008) (Paper

No.19) (Cabilly v. 8ass, lnterference 105,53 t ) (Feb. I I, 2008).

Report on the Filing or Dete¡mi¡ation of an Action Regarding aPatent or Trademark (GlaxoSmithKline v. Gqentech and City ofHope, CaseNo.3: I0-cv-00675-JSW) (Feb. I8, 2010).Report to PTO on the Filing of Action Regarding Patent(GkixoSmithKline v. Genentech and City of Hope, Civil Action09-61608) (Oct. 8, 2009).Reporter's TranscriS of Proceedings, Markman Hearng, Centocor

v. Genmtech and Cþ of Hope, Case No. CV 0843573 MRP (CTx)(Mzy 12,2009).Request for Clarilcation (regardirg disposition of CabillyMotion 4)(Cabillyv. Boss, lnterference 105,531) (Dec. 18, 2008).Response Exp€rt Report ofMark E. Nusbaumwitl Exlibits(MdIn-mwte, Inc.v. Gqtentech, Inc. and City ofHope (CaseNo. CVOS'2567MRP (CTx), c.D.Cal.)) (Mar. l, 2008).Response to Genentech's Seco.nd Set oflnterrogatories to Centocor,

lnc. Q.{os. I l-21) (Centocorv. Genentech and City ofHope, CaseNo.CV 08-03s73 MRP (CTx)) (Apr. 15, 2009).Ringold et al., "Co-expression and Ampliûcation of DihydrofolateReduct¿se cDNA andthe Escherieh¿? ¿ofi XGPRT Gene in Chi¡eseHamster Ovary Cells" Journal of Molecalar & Applied Genetìcs I(3):l6s-l7s (1981).Rituxan(R) Prescribing lnfo¡mation (Provided to Boss during theSecond Deposition of Dennis Bu¡ton Ph.D., Sep. 24' 2008) (CabillytuJibit22ll, Cabi llyv. B oss,lntefierence No. 105,53 l) (Sep. 2@8).Rit2 and Schlossman, "utiliz¿tion of monoclonal antibodies in the

Eeatrent of leukemia and lymphoma" Blod 59 (l) :l-11 (Jan.

r982);:Roge¡s et al., "Binding studies on two diffe¡ent monoclonal antibod-ies iaised against CEA' European Journøl of Cancer & ClinicalOncologt 19 (5) :629-639 (May 1983).Rogers et al . , '"[wo mRNAs with differe,nt 3' ends encode menbrane-bound a¡d secreted forms of immunoglobulin ¡r chain" Cell20 (2) :

303-312(Jun. 1980).Ross, J., "mRNA stability in måmmålia¡ cells" Microbiol. Rev. 59

(3) :423as0 (199s).RRG Presentation by Herb Heyneker (Cabilly Ex. 2132' Cabilþ v'.Bass, lnterfe¡ence 105,53f) (Feb. l, 1983).



Russell et al., "Monoclonal antibodies for the diagnosis and teat-metrt oftansplant rcjectiot" Annual Revievt of Medicine35:63-8L(1e84).Russell, P, "New approachesto tÏe use of a¡tibodies for immulosup-pression" Tansplantation Proceedings 14 (3) :50ó-508 (Sep. 1982).

Sann et al., 'T.apid fractionation of serum immunoglobulins by highpressure liquid gel permeation chromatography. fuplication to rou-tine se.rologic procedures" Journal of Immunological Methods 59(t):r2t-127 (Apr. ls, 1983).

Sarma et al., "The Th¡ee-Dimensional Structure at 6 A Resolution ofa Human 1Gl Irnmrmoglobulin Molecule" J Biological Chem. 246 :

3',7s3-37s9 (t97t).Satz and Singe¡ "Differential expression of porcine majorhistocompafibility DNA sequences inhoduced into mouse L cells"Molecular & Cellular Biologt 3 (l l) :2006-2016 (Nov. 1983).Schlom et al., "Generation ofhuman monoclonal antibodies reactivewith human mammary ca¡cinom¿ cells" Proc. Natl. Acad- Sci. USA7 7 (It) :684 1 -6Ms ( t 980).Scbreie¡ et al., "Multiple differences between the nucleic acidsequencesofthe IgG2a" andlgGar alleles ofthemouse" Proc. NatI.Acad. Sci. USA 78 Q):21495-4499 (Jul. l98l).Sch¡ohenlohe¡ and Hester, "Reassembly of immunoglobulin Mheavy and light chains in vit¡o" ,Scaz dinavian Journal oflmmunologts (6-7) :637 -646 (1976).Second Amended Complaint for Declantory Judgment , Centocor v .

Genentech and City of Hope, Case No. CV 08-03573 MRP (CTx)(Jul. 2, 2009).Second Supplemental Notice of Related Proceedings \Cabilly v.Boss, Interference I05,531) (Jun. 13, 2008).Segal et al., "The tl¡ee-dimensional sEucture of

^phosphorylcholine-binding mouse immunoglobulin Fab and thenatu¡e ofthe a.ntigen binding site" Proc. Natl. Acad. Sci. USA 7l(l l) :42984302 (Nov. 1974).

Seto et al., 'Monoclon¡l anti-MM46 antibody:ricin A chain conju-gate: in vitro and in vivo antitumù activity" Cancer Research 42(12) :5209 -5215 (Dec. 1982).Shulman et al., 'A bette¡ cell line for making hþridomas secretingspecific antibodies" Nature276 (5685) :269-270 (Nov. 16, 1978).Silverto¡ et al., "Three-dimensio¡al st¡ucture of an intact huma¡imrnunoglobulin" P roc. N at l. Acad. S c i. USÅ 7 4 :5 140 -5 144 (197 7 ).Simmons, L. et al., "Expression of fi.rll-length immunoglobulins inEscherichia coli: Rapid a¡d efficient production of aglycoslateda¡tibodies" Journa I of Im nunologi cal Methd I 263 : 133 - I 47 (2002).Si¡e et al., "R¿t irnmu¡oglobulin delta heavy çft¡in gene: nucleotidesequence derived from cloned cDNA" Gene 20 (3) :317386 Qæ,.1982).Skerra, ¡¡¡s,'B..terial Expression of Irnmunoglobulin Fragments"Current Opinion in Immunologt 5 :256-262 (1993).Stat€ment of Material Facts and Responses Thereto (In Motion 4.Opposition 4, and Reply 4) (Cabilly v.8oss, lnterference 105,531)(Oct .24, 2008).Statement of Mate¡ial Facts and Responses Thereto (ln Motion 5,

Opposition 5, and Reply 5) (Cabillyv..Boss, Interference 105,531)(oct.24,2008).Status Report Regãding Notice of Intent to Issue Ex Pa¡te Reexami-nation Certificate , Ceniocor v . Gøentech and City of Hope, CaseNo .

Cv 08{3s73 MRP (cTx) (Feb.24,2009).Stepien et al., "Synthesis ofaHuma¡ lnsulinGeneVl. Expression ofthe synthetic proinsdin gene in yeasf' Gne24 (2-3):289-297 (Oct.1983).Stinchcomb et al., "Isolatìon ald characterisation ofayeast ch¡omo-somal replicator" Nature 282 (5134) :3943 (Nov. f, 1979).Stipulation Re Fithg of AmendedComplaint to ldentift Correct Cityof Hope Entity as Defendant, Centocor v. Genentech and Cþ ofIlope, Case No. CV 08-03573 MRP (CTx) (May t3, 2009).Sua et al., "Antigen recognition byan aatibodyligþtchain" Journalof Biological Chemistry269 (I):734-738 (Jn.7, 1994).Supplemental andAmended Responses to Genentech lnte¡rogatories(Nos. 13-15 & 18) (Centocor v. Genentech and City of Hope, CaseNo. CV 08-03573 MRP (CTx) (Mar. 5,2010).Supplemental Declaration of Ma¡cus E. Sernel in Support ofGenentech, Inc.'s and City of Hope's Reply Brief on Claim Con-

stuction with Exhibits, Centocor v. Genentech and City of Hope,

C¿se No. CV 08-03573 MRP (CTx) (Apr. 28, 2009).

Supplemental Report of Dr. Ifuthryn Calame (Medlmmune, Inc. v'Gmentech, Inc. and C ity ofHope (Case No. CV03-2567 MRP(CTx),C.D.C¿I.)) (Apr. 8, 2008).Supplemental Repo¡t of Dr. Laruie H . Gltrncher (Medlnmune, Inc 'v '

Genentech, Inc. and C ity ofHope (CaseNo. CV03-2567 MRP(CTx),C.D.Cal.) (Ap¡. 8, 2008).Supþemental Report of Dr. Michel C. Nussenzweig (MdlmmuneInc.v. Genentech,Inc. and CþofHope (CaseNo. CV03-2567 MRP(CTx), C.D.cal.)) (2008).

Supplemental Report'of James A. Forstner,Ph.D. (Mdlmmune, fnc'v. Genentech, Inc. and City of Hope (Case No. CV03-2567 MRP(CTx), C.D.Cal.)) (Apr.7, 2008).

Supplemental Repo¡t of Scott A.M. Chambers, Ph.D. (Mdlmmune,Inc. v. Genentech, Inc. and City of Hope(Case No. CV03-2567 MRP(CTx), C.D.Cal.) (Apr.7, 2008).Supplemental Responses to Genentech's lnterrogatories Nos. 16 &17 (Cøttocor v. Genentech and Cþ ofHope, Case No. CV 08-03573

MRP (CTx) (Apr 2t,20r0).Supplemental Sub¡nission in Response to PErer No.3 (Cabilly v.

.Boss, hterference 105,531) (Apr 25,2008).Thaler et zl. Mdical Immunologt, Philadelphia:J.8. LippincottCompany pp. 3-8 (1977).Thi¡d Decla¡atio¡ of Den¡is Bu¡ton, Ph.D. (Boss Ëxhibit 1045,

Cabillyv. Boss, lnterference 105,531) (Aug. 28, 2008).Timeline ofEve¡ts heceding S\bmissio¡of Boss Claim49 (CabillyEx. 2068, Cabilly v. Boss,lnterference 105,53 l).Tissue Culture: Methods and Applications, Kruse, Jr. and Patterson,

Jr., NewYork:Academic Press pp. 72-122 (1973).

Transcript of Deposition of Jea¡¡e Perry (Cabilly Exhibit 2f84,Caltilly v. Boss, I¡terference No. 105,53 1) (Jan. 18, 2008).Tra.nscrip of Deposition of Michael Botchan in CÍty of HopeNaticinal Mdical Center v. Genentech, Inc., Caæ No. BC215l52(Los Angeles Co. (Cal.) Super. Ct. (Cabilly Exhibit 2l92,Cabilþv..Bosq,' lnterference No. 105,53 l) (May 23, 2001).Transcript of Deposition of Shmuel Cabilly (Cabilly Exhibit 2163,

C abi I ly v. B os s, Interfe¡ence No. I 05,53 I ) (Dec. I, I 999),Traascript ofOral Hearing on Nov. 13, 2008 (Part l) (Paper No. 144)(C abi I ly v. B os s, lnterfe¡ence 105, 53 l) (Jar. 7, 2009).Transcript of Oral Hearing on Nov. 13, 2008 (Pa¡t 2) (Paper No. 145)(Cabillyv. Boss, I¡terfe¡ence 105,531) (Jan. 7,2009).Tralscript of Proceedings befo¡e Hono¡able lvfariana Pfaelzer,United States District Judge, Markrnan Hering, Medlmmune ; Inc. v.

Genentech, Inc. (C.D. Cal. No. CV 03,2567 MRP (CTx) (Jul. tl,200'7).Tra.nscrþ of Second Deposition of Den¡is Bufon, Ph.D. (CabillyExåibit 22 12, Cab i I ly v. 8ass, Interference No. I 05,53 l) (Sep. 24,200E).Travel request (Cabilly Exhibit 2167 , Cabilly v. Boss, lnterfe¡enceNo. 105,531) (Ma¡. 10, 1983).Tsukada et al., "Effect ofa conjugate ofda¡¡nomycin and antibodiesto rat o¿-fetoprotein on the growth ofct-fetoprotein-producing tumorcells" Proc. NatL Acad Sci. USA 79 (2) :621-625 (Jan. 1982).Tuite et al., 'Regulated high efñciency er<pression of hum¿n inte¡-feron-oin Seccharomyces cereeisiae" EMBO Journal I (5) :603-608(1982).Tur¡er and Rowe, "AntibodiesofIgA andlgGclass in normelhumanwin€' Immunologt 12 (6) :689-699 (Jun. 1967).Tuto¡ial Decla¡ation of De¡nis R. Bufon, Ph.D. with Exhibit (Boss

Ê<hibit 1016, Caå¡'l/yv. Boss, I¡terference 105,531) (May 25,2W7).Tyler et al., "nRNA for surface immunoglobulin 1 chails encodes a

highly consewed t¡ansmemb¡ane sequence and a28-residue intracel-lula¡ domain" Pr¿c. Natl. Acad. Scí. USA 79 (6) :2008-2012 (Mar.r982).U.S. Departnent ofCom¡nerce Patent andT¡ademark Office, "Chap-ter i00: RcceiptandHandling ofMail and Papers"Manual ofPatentExamining Procedure (Boss Ex. 1044, Cabìlly v. Boss, I¡terference105,5.3 1), Fou¡th editionpps. table ofcontentsand 55-70 (Sep. 1982).U.S; Appl. No. 06i358,414 (Moore et al.) þatent application) (Mar.ls, 1982).


as7,923,221B1Page29

U.S. Ap,pl. No. 071385,102 File History (Plaintif Exhibit 139,

Cenlocor v. Genentech and City of Hope, Case No. CV 08-03573

MRP(CTx).Valenzuela at al., "spthesis and Assembly of Hepatitis B Virus

Surface Aatigen Particles inYeast" Nature 298 :347-350 (Jul' 22,

t982).Verma et al., "Antibody engineering: comparison ofbacterial, yeast,

insect and mamm¿lian expression system{' Journal of Immunologi-calMethods216 (l-2):165-l8l (Jul. l, 1998).Volle¡ et al., "Enryme immunoassays with special reference toELISA techniques" .Iournal ofClinical Pathologt 3l (6) :507'520(Jun. 1978).Wa¡d et al., "Binding Activities of a Repertoire of Single

lmmunoglobulin Variable Domains Secreted from Es¿ herichia coli "Nature 341 :544-546 (OcL 12, 1989).Watson, J. Molecalar Biologt of the Gene, Menlo Pa¡k, CA:W.A.Bajamin (1976).Weidle et al., "Reconstitution of fu¡ctionally activeantibody directed

agailst creatine kinase ûom separately e.xpressed heavy and lightchains in non-lymphoid cells" Gene 5I (l) :21-29 (1987).Weissman et al. Ess ential Concepts in Immunologt,Menlo Pa¡k:TheBenjamidCummings Publishing Company, lnc. pp. 2, 12-19, 23-26'49-s4 (1918).Weitzman et al., "Mutations in mouse myeloma cells: implicationsfor huma¡ multiple myeloma a¡d the production ofimmunoglobulins" Annals of Internal MedicineSí (l) :l 10-I l6 (Jul.

1976).Wellborn et al., "Spawning New Forms of Life; Now the PayoffSta¡ts" US ìleÌrs &WorldReport(Foundonp.48 of Special Reportsection.) pp. l-5 (Mar. 28, 1983).

WeÞel et ^1., "Production of Biologically Active

Ncr-Desacetylthymo sin aI n E s cher ic hia co I i throu$Expression ofa Chemically Synthesized Gete'' Biochemislry 19 :6t96-6104(re80).WeEel laboratory notebook 1432 (Cabilly Exhibit 2173, Cabillyv..Boss, Interference No. 105,531) pp. 26, 59,70,72,74,80 a¡d 8l(re83),WeEel laboratory notebook No. 1432 (Cabilly Ex. 2156, Cabilly t.8oss, lnterference No. 105,531) pp.78 (1983).Wefzel, R.,'Applications of RecombinantDNA Tecbnologt'' Ameri-can Scíentßt 68 (6) :66a-675 (1980).Whitney aad Tanford, "Recovery of specific activity after completeunfoldiag and reduction of an antibody fragmenf' Proc. Natl. Acad.Sci. USA 53:524-532 (Mar. 1965).Vr'igler et al., "Biochemical t¡ansfer of single-copy eucaryotic genes

using total cellular DNA as donof' Cell L4 :725-731 (1978).Wigler et al., "Traasfer of purified herpes virus tlymidine kinasegene to cultued mouse cells" Cel/ ll (l) :223-232 (May 197'7).

Williarns, J¡. et al., "Studies of biologic ald serologic activities ofrabbit-IgG a:rtibody depleted of carbohydrate rcsióues" Journal ofImmunologt r I I (6) :1690-t698 (Dec. 1973).Yarmush et al., "Identification and char¿cte¡ization of¡abbit-mousehþridomas secreting rabbit immunoglobulin chains" Proc. Natl.Acad. Sci. USA 77 (5):2899-2903 (1980).

Acberg and McKenzie, "Hybridomas and monoclonal a¡tibodies:ap4rlications in oncology'' Auslralian & New Zealand Journal ofSurgery 52 (4) :43 1438 (Aug. 1982).Zevatil(R) Prescribing Inform¿tion (Provided to Boss during theSecond Deposition ofDennis Bu¡to¡, Ph.D., Sep. 24, 2008) (CabillyExlibit 2210, Cabillyv. Boss, I¡terference No. 105,531) (2008).Ä.mended Memorandum of Decision Re: Defendant Celltech'sMotion for Judgment on the Pleadings a¡d Defend¡¡t Genentech'sMotion for Summa¡y Judgment (Medlmmune, Inc. v. Genentech,

Inc., Ciþ of Hope, and Celltech R&D Ltd.)pps 1-26 (Jan. 12,20M).Celltech R&D Ltd.'s Amende.dA¡swe¡ to Fi¡stAmended Conplaint(Medlmmune, Inc. v. Genentech, Inc., City of Hope, and CelltechR&D Ltd.)p. r-38 (Sep. 22,2003).Celltech R&D Ltd.'s Answer (Mdlmmune, Inc.v Genentech, Inc.,City of Hope, and Celltech R&D Ltd.) W. l-25 (Jur. 4,2003).Celltech R&D Ltd's A¡swer to FirstAmended C ompla;nt (Medlm-mune,Inc.v. Genentech, Inc., City of Hope, end Celltech R&D Ltd.)pp. l-38 (Sep. 2,2003).

Cheng et al ., "Effect of deglycosylation on the binding aad

immunoreactivþ of buman thyroxine-bindiag globulin" Journal ofBiologicat chemistry 254 (18):8830-8835 (Sep. 25, 1979).

Civil Minute O¡der--4enen) (Medlmmune, Inc. v' Genentech, Inc',City of Hope, and Celltech R&D Ltd. W. 14 (Aug.4,2003)Decla¡ation of Dean G. Dunlavey in Suppod of Defend¿¡tGeñ;ntech, lnc.'s Openhg Brief Regarding Claim Construction(MedImmune, Inc. v. Genentech, Inc., City of Hope, and Celltech R &D Ltd.)pp.l-3 with Exlibits Ä'-P (D€c. 19' 2003).Declaration of Jeffiey R. Witham in Support of Medlmmrme, Inc''sOpposition Brief in Support of Claim Constuction (MdlmmuneInc.v. Genentech,Inc., City of Hope, and Celltech R&D Ltd')W. I-3with Exhibits A-M (Jan. 16, 2004).Decla¡alion of Susan L. F¡iedman in Support of Genentech, lnc.'sRequest for Judicial Notice in Support of Reply me¡no¡¿ndurn fo¡Motion to Dismiss theThird a¡d Eleventh Causes of Actìon(Mdlm-mune, Inc.v. Genentech, Inc., City of Hope and Celltech R&D Ltd.)pp. I (Jul. 28,2003).Defend¿¡t City of Hope National Medical Cente¡'s An swer (MdIm-mune, Inc . v . Genentech , Inc. , City of Hope, end Celltech R&.D Ltd ')pp. l-37 (Sep. 2,2003).Defo¡d¿nt Cþ of Hope's Joinde¡ in Defond¡nt Genentech, lnc"sOpening B¡ief Re Claim Constuctiot (Medlmmune' fnc. vGenentech, Inc., Cþ of Hop e, end Celltec h R&D Ltd.) p¡p' I -2 (Dec.

22,2003).Defend¿¡t Genentech, lnc.'s Answer a¡d Affmative Defenses(Medlmmune, Inc. v. Genentech, Inc., City of HoPe, and Celltech

R&D Ltd.)p.l-32 (Sep. 2,2003).þsfs¡.|¡nf Genentech, Inc.'s Opening Brief Regarding Clain Con-

st¡uction (Medlmmune, Inc. v, Genenlech, Inc., City of Hope, andCelltech R&D Ltd ) pp. l-39 (Dec.22,2003).Genentech Inc.'s Notice of Motion and Motion to Dismiss the Thirdand Eleve¡th Ceuses ofAction; Memoranórm ofPoints a¡dAutho¡i-ties in Support (Mdlmmune, Inc. Y. Genentech, Inc., City of Hope,

and Çelltech R&D Ltd.)pp. l-14 (Jun.4, 2003).Genè¡tech, lnc.'s Reply Memorandum of Points andAutlorities inSupport of Motlotr to Dismiss the Thi¡d a¡d Eleventh Causes ofAct\on (Medlmmune, Inc. v. Genentech, Inc., Cþ of Hope, andCelllech R&D Ltd,) pp.-i-v and l-14 (JuI.28, 2003),Geûentec , lnc.'s Request or Judicial Notice in Support of ReplyMernora¡dum for Motion to Dismiss the Thi¡d and Eleventtr Causes

of Aètion (Medlmmune, Inc. v. Genentech, Inc., Cily of Hope, andCelltech RSLD Ltd.)pp. I-22 (Jul. 28, 2003).Gillies andTonegaw4 "Expression of cloned immunoglobulin genes

introduced i¡to mouse L cells" Nucleic Acids Research lL (22) :

7 981-1 997 (Nov. 25, 1983).lntitial Disclosu¡es of Plaintiff Medlmrnune, lrc. (Medlmmune, Inc'v. Genentech, Inc., Cþ of Hope, and Celltech R&D Ltd.) p. l-10(Aug. 21,2003).Joint Claim Co¡struction St¿tement (Medlmmune, Inc. v. Geßentech,

Inc., City ofHope, and Celltech R&D Ltd.)W.1-8 (Nov. 7,2003).Medlmmune, lnc.'s Opposition Brief Regarding ClaimConsbuction(Mdlmmune, Inc. v. Genentech , Inc., City of Hope, and Celltech

R&.D Ltd.) p. i-ii ard l-38 (Jan.16,2004).Medlmmu¡e, Inc.'s Responses and Objections to Genentech, Inc.'sFirst Set ofl¡te¡¡ogatories pp. 1-14 (Sep. 3' 2003).Medlmmune, lnc.'s Responses and Objections to Genentech, lnc.'sFirst Set of Requests fo¡Admission (Medlmmune, Inc. v. Genentech,

Inc., Cþ ofüope, and Celltech R&D Ltd.)pp. l-18 (Sep. 3, 2003).Medlmmune, lnc.'s Responses aad Objections to Genentech, Inc.'sFirst Set of Requests for the P¡oduction of Documents (Mdlmmune,Inc. v. Genentech, Inc., Cþ of Hope, and Celltech R&D Ltd.) pp'l-28 (Sep. 3, 2003).Memorandum of Decision Re: Defendant Celltech's Motio¡ forJudgrnent on tle Pleadings and Defendant Genentech's Motion forSummary Judgrnent (Medlmmune, Inc, v. Genentech, Inc., Cþ ofHopè, and Celltech R&D Ltd.) p- l-26 (Dec. 22,2003).Neuberge¡ M., "Expression aad regulatiol of immunoglobulinheagy chain gene üansfected into lymphoid cell s" Etl4B O Journal 2

(E) i13,73-1378 (1983),Order Granting Genentec lnc.'s Motion to Dismiss the Third andEleventh Causes of Action(Medlmmune, Inc.v. Genentech, Inc., Cityof Hope, and Celltech R&Ð Ltd.) pp. l-2 (Aug. I l' 2003).


as7,923,221B1Page 30

Plaintiff Medlmmu¡e, Inc.'s Opposition to Motion by Defenda.nt

Genentech, lnc to Dismiss the Third and Eleventh Causes of Action(Medlmnune, Inc. v. Genentech, Inc., City of Hope, and Celltech

ReD Ltd.) pp. l-19 (Jul. 14,2003).Wi¡kelhake et al,, "Effects ofpH ûeaunents and deglycosylation ofrabbit immunoglobuli¡ G o¡ the bindingof Cl{'Journal ofBiologi-cal Chemistry 255 (7) :2822-2828 (Apr. 10, 1980).Request for Reexamin¿tion under 35 U.S.C. $ 302 a¡d 37 C.F.R.

1.510 with Appendices A-D.Centoco¡ Ortho Biotech. I¡c.'s and Its Counter-DefendântAlÍliates'Opposition to Defenda¡ts' Motion to Preclude o¡ St¡ike Testimony ofDr. Wall (Centocor v. Genentech and Cily of Hope, Case No, CV08-03573 MRP (CTx)) (Jul .27,20t0).Centocor Ortho Biotech, Inc.'s a¡d lts Counte¡-Defenda¡tAffiliates'Reply ir Support of Their Motion fo¡ Construction of Claim Term

"Immunoglobulin" (Motion No. 2) ( C entoco r v. G en entec h and CþofHope, Case No. CV 08-03573 MRP (CTx) (Aug. 3, 2010).Centoco¡O¡tho Biotecb, lnc.'s ¿nd Its Countet-Defenrl¡nf[.1ffi1¡"1o'Reply ir Support of Their Motion for Summary Judgrnent of Antici-pation (Motion No. 5) (Centocor v. Genentech and City of Hope,Case No. CV 08-03573 MRP (CTx)) (Aug. 3, 2010).Centocor Ortho Biotech, I¡c.'s a¡d Its Counte¡-DefendantA¡tñliates'Reply in Support of Thei¡ Motion fo¡ Summary Judgment of I¡val-idity of Claim 33 for Failu¡e to Conply with 35 USC I 12 (MotionNo. 4) (Centocor v. Genmtech and City of Hope, Case No. CV08-03573 MRP (CTx) (Aug. 3, 2010).Centoco¡ O¡tlo Biotech, lnc,'s and Its Counter-Defen.lzntAÎûIiat€6'Reply il Support ofThei¡ Motion fo¡ Summary Judgment That Claim33 is lnvalid fo¡ Failure to Disclose tle Best Mode (Motion No. 6)(Centocor v. Gmentech and City of Hopq Case No. CV 08-03573MRP (crx)) (Aug. 3, 2010).Genentech, Inc. and City ofHope's Opposition to Cetrtocor lnc.'sMotion for Summary Judgment That Claim 33 is Invalid fo¡ Failu¡eto Disclose tle Best Mode (Motion No. 6) (Cenlocor v. Genentechand Ciry of Hope, Case No. CV 08-03573 MRP (CTX) (Jul. 27,

2010).Genentech, Inc. and City of Hope's Opposition to Centocor's Motionfor Summary Judgrnent of Invalidity of Claim 33 fo¡ Failure toComply with 35 USC I 12 (Motion No. 4) (Centocor v. Genentechand. Cily of Hope, Case No. CV 08-03573 MRP (CTx)) (Jul. 27,

2010).Memorandum in Suppoft ofCentocor Oftho Biotech, fnc.'s a¡d ItsCounte¡-Defendant A.ffiliates' Motion for Construction of ClaimTerm "knmunoglobulin" (Motion No. 2) (Centocor v. Genentech andCity of Hope, Case No. CV 08-03573 MRP (CTx) (tuI. 12,2010).Memora¡dum in Support of Centoco¡ O¡tho Biotech, lnc.'s a¡d ItsÇeìr¡fs¡-þ6fs¡dant A-ffiliates' Motion fo¡ Sunmary Judgment ofAnticipation (Motion No. 5) (Cenlocor v. Genentech and Cþ ofIlope, Case No. CV 08-03573 MRP (CTx) (Jul. 12,2Ol0).Memor¿¡dum in Support of Centocor Ortho Biotech, lnc.'s and ItsCoutrter-Defendant A.ffliates' Motion fo¡ Summary Judgment ofInvalidity of Claim 33 for Failu¡e to Comply with 35 USC ll2(Motion No. 4) (Ceztocor v. Genentech and City of Hope, C¿se No.cv 08-03573 MRP (CTx) (Jut. 12, 2010).Memora¡dum in Support of Centocor O¡tho Biotech, I¡c.'s and ltsCounter-Defendant Afrliates' Motion for Summary Judgrnent ThatClaim33 is Invalidfo¡ Failu¡e to Disclosetle BestMode(MotionNo.6) (Centocor v. Genantech and Cþ of Hope, CaseNo. CV 0E-03573MRP (cTx) (Jul. t2,2010).Memorandum of Points and Autho¡ities in Suppof of Defend¿¡tsGenentech, lnc. and City of Hope's Motion to P¡eclude o¡ StikeTestimony of Dr. Wall (Centocor v. Genentech and Cþ of Hope,C¿se No. CV 08-03573 MRP (CTx)) (Jul. 12, 2010).Opposition by Genentech, Inc, and City ofHope to Centocor OrúoBiotech, Inc.'s and Its Couter-Defend¿¡t A.ffiliates' Motion forSummary Judgrnent of A-nticipation (Motion No. 5) (Centocor v.

Genqrtech and Cþ of Hope, Case No. CV 08-03573 MRP (CTx)(Jul. 27, 2010).Opposition of Genentech, Ilc. & City of Hope to Centoco¡ O¡tloBiotech, Inc.'s Motion for Construction of Claim Term"Immuaoglobulin" (MotionNo. 2) (Centocorv. Genentech and Cþofllope, Case No. CV 08-03573 MRP (CTx)) (Jul .27,2OIO).

O¡de¡ of Dismissal of Entire Action with Prejudice (Cenlocor v'Genentech and Cþ of Hope, Case No. CV 08-03573 MRP (CTx))(Sep. I,2010).Reply Memoraldum of Points and Authorities in Support of Defen-¡lents Genentech, lnc. and City of Hope's Motion to Preclude o¡Strike Testimony of Dr. Wall (Centocor v. Genentech and Cily ofIlape, Case No. CV 08-03573 MRP (CTx)) (Aug. 3, 2010).

Repoil on the Determination of the Action, O¡der of Dismiss¿l ofEntäe Action with Prejudice (Centocor v. Genentæh and City ofHope, Case No. CV 08-03 573 MRP (CTx)) (Sep. l, 20 l0).Repoiter's Tralscript ofProceedings (Status Conference) (Glaxo, etal. v. Genentech, eÍ ¿/., Case No. CV I0-2764-MRP (FMOx) (Oct

r3,20r0).Stipirlation of Dismissal of Enti¡e Action with Prejudic e (Centocor v.

Genentech and City of Hope, Case No. CV 08-03573 MRP (CTx) )(Aug.30,2010).Trarscript of Proceedings, Motions Hûrt¡¡9 (Cqrtocor v. Genentech

and ,City of Hope, Case No. CV 08-03573 MRP (CTx) (Aug' 17,

20l0).Medlmmule, Inc.'s Responses and Objections to Genentech, lnc''sSecond Set of lnterogtories (Feb. 24,2004).Joint Clain Construction Statement (Nov.1 , 2003).

Decla¡ation of Dean G. Durlavey in Support of Defend¿ntGenentech, lnc.'s Opening Brief Regardhg Claim Constuction withExhibits A-P (Dec. 22,2O03).Supplemental Decla¡ation of De¿n G. Dualavey ia Support of Defen-dant Genentech, Inc.'s Reply BriefRegarding Claim Conshuctionwith Exlibit Q Geb. 13,2004).Defend¿nt Genentech, lnc.'s ReplyBrief RegardingClaimCo¡struc-tion (Feb. 13,2004).Deposition Transcript of Ge¡rentech through witness, Ja¡et Hasak(Feb.2s, 2004).Deposition Transcrþ Exhibits l-29 ofJa¡et Hasak (Feb. 25, 2004).Deposition Transcript and Exhibits 30-33 ofGenentech tlrough wit-ness, Jaaet Hasak (Feb. 25, 2004),Deposition Transcrþt of Wendy M. Lee and Exhibits 3441 (M^l4,2OO4).

Deposition Transcript of Wendy M. Lee a¡d Exhibits 48-60 (Mar. 5,

2004).Joint Søteme¡t Responsive to Court's Ja¡, 28, 2004 Order re: Termsto beiConstrued at Markman Heari.ng (Feb. 9, 200a).Expert Report of Carlo M. Croce(Ceztocorv. Genattech and Cþ ofI{ope, Case No, CV 08-03573 MRP (CTx)) (Jun.4,2010).Expert Report of Mattiew P. Seott(Cenlocorv. Genentech and CityofHope, Case No. CV 08-03573 MRP (CTx)) (Jun.4, 2010).Expert Report of Robert B. F¡eedman (Cenlocor v. Genentech andCity of Hope, Case No. CV 08-03573 MRP (CTx) (Jun.4,20IO).Oral deposition ofEugene C. Rztoidlo (Centocorv. Gqentech andCþ of Hope, Case No. CV 08-03573 MRP (CTÐ) (Jun. 25, 2010).Response Expert Report of Mark E. Nusbaum (Centocor v'Genentech and City ofHope, Case No. CV 08-03573 MRP (CTx)(Jun. a, 2010).Videotaped Deposition of Amo *ena (Centocor v. Genentech endCity of Hope, Case No. CV 08{3573 MRP (CTÐ) (Jun. 24, 2010).Videotaped Deposition of Carlo M. Croce (Centocor v. Genentechand City ofúope,CaseNo. CV08{3573 MRP(CTX) (Jul. 8' 2010).Videotaped Deposition of Daniel G .Yztsura (Centoc or v. Genentechand Ciþ of Hope, Case No. CV 08-03573 MRP (CTx)) (Apr. 20,20r0).Videotaped Deposition of Jeftey Krrchat (Cantocø v. Genentechand City ofHopø CaseNo. CV 08-03573 MRP (Cb{) (Jun. 1, 2010)'VideotapedDeposition of Ma¡k E. Nu sblm(Cøttocor v. Genentechand. City of Hope, Case. No. CV 08-03573 MRP (CTx) (Jun.22,2010).Videotaped Deposition of Ma¡k X. Sliwkowski (Centocor v'Genentech and Cily of Hope, C¿se No. CV 08-035?3 MRP (CTx)(Apr 30,2010).Videotaped Deposition of Mattlew Peter Scott (Cantocor v.

Genentech and City ofHope, C¿se No. CV 08-03573 MRP (CTx)(Jun. 15,2010).Videqt¿ped Deposition of Robert B. Freedma¡ (Centocorv.

Geneintech and Cíty of Hope, Case No. CV 08-03573 MRP (CTx)(Iun.22,2oto).



Videotaped Deposition of Sharon Elizabeth Cra-ae (Centocor vGenentèch and City of Hope, Case No. CV 08-03573 MRP (CTX)(Jun. 10,2010).Requestfor Reexamination filedon May 13, 2005 forU.S. Pate¡tNo.6,33 l,4l 5 witl Appendices I -2 l.Restriction Requirement (Paper No. 4) d¿ted Mar. 8' 1990 in U.S.

Appl. No. 07/205,419.Restiction Requirement (Paper No. I l) dâted Sep. 7, 1990 in U.SAppl. No. 071205,419.Intewiew Summary (Paper No. 22) in U.S. Appl. No. 071205,419.Amendment Afte¡ I-nterference (Paper No. 24) filed Oct 4, 2001 inU.S. Appl. No. 071205119.File History of U.S. Patent No. 4,816,39'l (Boss et al.).Aib¿ et al., 'New approach to tryptophan production by Escherichiacoli: genetic manipulation of composite plasmids n vito" Appl.Environ. Microbiol. 43 (2) :289-297 (Feb. 1982).Brandsma et al., "Effect of lexA and ssb genes, present on a uvrArecombinant plasmid, on the LW suwival of Escherichia coli K'12"Gene t&(l):77-85 (Apt. 1982).Enger-Valk et al., "Constructio¡ ofnew cloning vehicles with genes

of the tryptopha:r operon of-EscåerÌchia coli as genetic markers"Gene 9 (l-2): 69-85 (Apr. 1980).Enger-Valk et al., "The constructio¡ ofnew vehicles for the cloningoftranscription termination sisnÃs" Nucleic Acids Research 9 (8) :

1973-1989(Apr. l98l).Fiandt et al., 'Physical mappitlg of the trp endpoint in the n-tl-segment ofphage laûúd¿ trpE-A" Yirologlt 6l (l) :312-314 (Sep.

te74).Friesen a¡d A¡, "E4pression vehicles used in recombinant DNAtechnologf' Biotechnol. Adv. t (2):205-227 (1983).Gough and Murray, "Expression ofthe hepatitis B virus surface, coreand E antigen genes by stable rat a¡d mouse cell lines" J. MoL Biol.162 (t) :4347 (Nov. 25, 1982).Hallewell a¡d Emt¿ge, "Plasmid vectors cont¿in¡ng tÏe tryptophanop€ron promoter suitable for efficient regulated expression offoreigngenes" Gene9 (I-2):2741 (Apr. 1980).He¡shûeld et al., "Plasmid ColEl as a molecular vehicle for cloningard amplification of DNA'Proc. l{¿fl. Acad. Scì. USA 7l (9):3455'3459 (Sep. 1974).

HorowiE a¡d Platt, "Identification oftrp-p2, and intenâl promoter inthe tryptophan operon of Escherichia coli" J. Mol. Biol. 156 (2) :

257-267 (Apr.5, 1982).Imamoto and Tani, "Diversity ofregulation ofgenetic transcription 'Naí New. Biol.240 (l0l) :172-175 (Dec. 6, 1972).Kauûnan and Sharp, "Amplification and Expression of Sequences

Cohansfected with a Modula¡ Dihydrofolate Reductase Conple-mentary DNAG€n€' J. Mol. Biol,l59 (4) :601-621 (Aug. 25, 1982).Legrain et al., "Struchrral and regulatory mutations allowing utiliza'tion of citrulline or carbamoylaspartate as a sou¡ce ofcarbamoylphospbate n Escherichia coli K-12" J. Bactqiol. 128(l) :3948 (Oct. 1976).

Maniatis øf a!. Molecalar Cloning-A Laboratory Manual ,NewYork: Cold Spring Harbo¡ Laboratory pp. l-5a5 (1982).

Nagahari ât al . , "Control oftryptophan synthetase amplified by vary-

ing the numbers of composite plasmids i¡ Eschqichia coli cells"Gene L (2) :l4l-152 (Mar. 1977).Nagahari et al., "Derçression of E coli þ operon on interfamilialt:ansfer" Nature 266 (56M) :745-7 46 (Apt' 21, 1917).

Nagahari etal.,'Expression ofEsclerichia coli Wtophan operon inRhizobium leguminosarum" Mol. Gen' Genet' l7l (2) :ll5-l19(Iltlar 20,1979).P¿uza et al., "Genes encoding Escherichia coli asprtalr-transcarbamoylase: the pyrB-pyrl operon" Proc. Natl- Acad. Sci.

USA'79 (!3):4o204024 (Jul. 1982).

PlaintiffC and cou¡terclaim defendants' prelimilary contentions

regardirg the invalidity of U.S. PâtentNo.6,33L'415 (Glaxo et al.v.Genentech and Cþ of Hope,CaseNo. CV-10-027&lldRP (FMOX)'Exhibits A & B attached.) (Dec 13' 2010).

Rapoport et al., "Construction of a colony bank of E ¿¿lj ç6¡þini ng

hybrid plasmids representative of the Bacillus subfiTr 168 genome'

Expression of fr.uctions harbored by the recombinant plasmids in B.

subtilis" MoL Gen. Gmet. 176 (2):239-245 (Oct 3, 1979).

Roof et al ., "The organization and regulation of the pyrBl operon in

-E coli includes a rho-independent attenuato¡ squ'enc€' Mol. Gen.

Genet. 187 (3):391-400 (1982).

Tumbough Jr., C., 'Regulation of Escherichia coli aqartatet¡ansca¡bamylase synthesis þ gua.nosine tetraphosphate and

pyrimidire ribonucleoside hiphoçhats" J. BacterioL l53 (2) :998-

1007 (Feb. t983).Turnbough, Jr et al . , "Attenuation control ofpyrBl operon expression

n Escherichia coli K-12" Proc. Natl. Acad. Sci. USA 80 (2'¡ :368-312(Jaa. 1983).va¡ Lee¡d¿m et ¿1., "Cloning ofboth ends and the tle¡mo-induciblegenesAandBofbacteriophageMuon amulticopyplasmtt' Gene 13

(l) : I I 1-l 14 (Jan.-Feb. l98l).Wagner et al., "Transport ofhemolysin across the outer membrane ofEscherichia colt requires two functions" I Bacteriol. l54 (l) :200'210(Apr 1983).Watson et ¿1. Recombinant DNA-A Short Course, New

York:Scientific Ame¡ican Books (W.H. F¡eeman & Comp¿¡y) pp.

l-260 (1983).Wild at at., 'A mutation in the catalytic cisEon of aspartate

carbamoyltransferase affecting catalysis, regulatory response and

holoenzyme assernblf ' Nature 292 (582 l) : 373'37 5 (Jul' 23, I 98 I ).Williams et al., "Expression of Escherichia coli up genes and the

mouse di.hydrofolate ¡eductase gene cloned in Bacillus subtilis"Gene 16 (l-3) : 199-206 (Dec. l98l).Yamamoto ald Imamoto, 'Diffe¡ential søbilþ of tp messenger

RNA synthesized originathg at the hp promoter ard pL promoter oflambda trp phage" J. Mol. Biol.9z (2) :289-304 (Feb. 25, 1975).

* cited by examiner


LJ.S. Patent Ãpr.12,2011 Sheet I of19 us 7,923,22181

IFc frogmenl

fisl


GÌTGCTGTGG ITGTCTGGTG TTGAAGGÄGACAACGÀCACC AÀCAGACCAC AACTTCCTCT

fnu4HI scrFIfôk I bbv ecoR¡ I

IOI GCCAGTCÂGG ATGTGGGTGC TGCTATÀGCC TGGTATCÀACCGGTCAGTCC TACACCCACG ACGATATCBG ACCATAG'TTG

sau3AdPn I

20I TCCCTGÂTCG, .' . :, AGûGACTÂGC

301

tthlllCATTGTGÀTG ACCCAGÏCTCGTAACACTAC IGGGTCAGAG

xhol Isau3AdPn I

CTTCÂCAGGC AGTGGATCTGGAAGTGTCCG TCACCIÂGÂC

nnl ITÂGCGGGTAT CCTCTCACGÎATCGCCCATA GGAGAGTGCA

401 TTAACATCTGAATTGTAGAC

scrFIecoRl I

AGAAACCAGG ACAATCTCCT AAACTACTGATCTTIGGTCC IGTTÀGAGGA ITTGATGÀCT

ACAAATTCAT GTCCACATCATGTTTAAGIÂ CAGGTGTAGT

sau96avall alul

TCGGTGCTGG GACCAAGCTGAGCCACGACC E'GGTTCGAC

¡¡nl Imnì I ddelGAGGTGCCIC AGlCST6IGCCTCCACGGÂG TCAGCACACG

hPhlûGACAGATTT CACTCTCACC ATTAGCAATG TGCAGTCTGACCTGTCTAAÀ GTGAGAGT,GG TAATCGTTÂC ACGTCAGACT

hael I Itthllt hphl hael

GTAGGAGACA GGGTCAGCAT CACCTGCÂAGCATCCTCÎGT CCCÁGTCGTA GTGGÂCGTTC

sfaNt

fnu4H Ialul sfaNl bbv

GÀGCTGAAÂC GGGCTGATGC TGCÂCCAACTCTCGACTTTG CCCGACTACG ACGTGGTIGA

xnn ItlcllGÀACÀ ACTICIACCCAAGAACTTGl TGAAGATGGG

Fi g.2A

scrF Incl IhPaII

TTTACTGGGC ATCCÂCCCGGAAATGACCCG TAGGTGGGCCfokl sf¡lll

F?rËÞFl.rÞIJ.+-

hlncllTGACTTGGCA GATTATTTCÏ GTCAACÁATAACTGÀACCGT CTÀAIAAAGA CAGTTGlIAT

hPa Ir¡¡boll hlncll

GIiATCCATCT ICCCAGCATC CAGTGAGCAGCATAGGTAGA AGGGTGGTAG GTCACTCGTC

fok I

¡nbol I acYICAAAGACATC AATGTCAAGT GEAAGATTGA TGGCAGTGAA CGACAAAATGGTITCTSTAG TIÂCAGTTCA CCTTCTAÄCT ACCCTCACTT GCTGTTTTAC

hl nflCACACTGGAGGTGTGACCTC

r-

b.)

b.¡

(t)

tÞ(D

b¿o

\o

cro;J\ob.)(¿)

b.)ì.)idtËlr


501hga IGCGTCCTGAACGCAGGACTT

mnl Ihael I I

hae I60I CTATACCTGT GAGGCCACTC

GATATGGACA CTCCGGTGAG

sau3Adpn I

bcl ICAGITGGACT GÁlCAGGACAGTCAACCTGA CTAGTCCTGÏ

alul a'luI701i' ^'' :åGCICCCCÀG CICCATCCTA

TCGAGGGGTC GAGGTÁGGATfok I

mnl Innl I mnl I

801 TTCTCCTCCT CCICCCTTTCAAGA6GAGGA GGAGGGAAAG

fn u4H Ibbv

GCAAAGACAG CACCTACAGC AIGAGCAGCACGTTTCTGTC GTGGATGTCG TACTCGTCGT

hPhIACAAGACATC ÀACTTLACCCTGTTCTGTAG TTGAAGTGGG

nücì eotl des : 882

nbol I dde¡ mnl ITCTTCCCTTC TAASGTCTTG' GA6GGTTCGCÂGAAGGGAAG ATTCCAGAAC CTCCGAAGGG

alulATTGTCAAGA GCTTCAACAGTAACAGTTCT CGAAGITGIC

CTTGGCTTTT ATCATGCTAAGAACCGAAAA TAGTACGATT

mnll hlncllCCCTCAGGIT .GACCAAGGAC

GÊGAGTGCAA CTGGTTCCTG

hglÂCACAAGCGAC CTACCACTGT TGCGGTGCTCGTGTÍCGCTG GATGGTGÂCA ACGCCACGAG

xmn ITATTTGCAGA AÁATATTCAAATAAACGTCT TTTATAAGTT

GAATGAGTG.T TAGAGACAAACÌTACTCACA AfCTCTGTTT

Fig.2B

alulGAGTAIÊAAC GACATAACAGCTCATACTTG ClGTATTGTC

sau96 hga Idde I

avall acylGGTCCTGÁGA CGCCACCACCCCAGGACTCT GCGGTGGTGÊ

nnl Imnt I mnl I

0AAACCTCCT CCCCACCICCGIlIGGAGGA GGGGTGGAGG

F?Fg¡eFl.tDI)Fl.

hl nfITAAAGTGAGT CTTTGCACTT GA

ATTTCACTCA GAAACGÍGAA CT

rã:r

b.)

ì.)e

(t)

oG(Ðo

\o

c(t)-¡\t)\.)(,b.)b.)t¡tÉ


-9 t - - lo .. 20'teu teu t¡p teu ser gly val glu gly asp lte yl1 191 thr 91! l9I !!l !f: P!9 !9!.!9I !¡f ser val glv asp ars val ser

G uuc cuc ucc uuc ucu GGu GUU GAA GGi cÃc luù GUc Àuc Àcc õlc ucu cAc ¡ie ûuc AUG ucc AcA ucA GUA GGA GAc AGG Guc AGc

30 40 50

l'te thr cys lys aìa ser 9ìn qlP Yt! gii 1!q llq 11.9 llt iIP lyl 9ll 9lI l{: p"o gtv gln ser pro lvs leu leu fle tvr trpAuc Àcc ucc AAG ccc Acu c¡c cAU Êuc Géú eóu ecu AUÀ occ úðõ úia, õtÀ cte ÂÃA lc¡ Õcit c¡¡ ucu ccu AAA cuA cuc AUU uÂc UGG

6070-80ôla ser thr ars his thr gly la! Pfo q;; ðfg PIq t¡f 9lI ser gly tql gU !!T ttp phe thr leu thr lle ser asn val gìn serccA ucc Acc ccc clc Acu ccA cuc ccu cÃú cbð ûriõ Àin Ëei Ãõir ðc"A uðu õei¡ AcA cAû lluc rcu cuc Acc Auu Acc AAU GUG cAG ucu

90 loo . 110

asp ôsp reu ara asp tyr phe cyq gll gll trl:çl gU 3{.f Pr9 19'l !!f PI9 9U qla 9!I !!f Ul l:u elu leu lvs ars ala rsp

clu clc uuc GcÂ GAu uAU uuc uGU cAA cA¡i uiiu ncc õcË uiru õcù cuõ nco ûuc eeü ocu õcõ ¡c,c AÃG cuG GAG cuG AAA c0G Gcu GAU

lz0 130 140

¿la alð pro thr val ser lte phe Pfg P;; sef:91 9!l qln leu thr s9I 9U 9U ala ser val val cvs phe leu ðsn asn phe tvrGcu ÊcA ccA Acu cuÀ uõc Auõ i,ùc bc¡ bcÀ uõc Àeu õ¡e õre úuÃ Àc¡ uõu õci õol ecc uca GUrc Guc ucc uuc uuc AAc AAc uuc uÂc

tso 160 t70

pro lys asp {le ¡sn vol !y! llp lyl lii llP 9U:9I glf qlg 9'!î ?:l gU val ìeu asn selr trp thr asp sln âsp ser lvs asp

ccc AAA cac Âuc AAu GUc AAG ucc AAc Auù oÀú õoö Ãeu õt¡ ccÃ ön¡ Ànu õc-c GUc cuc AAc AGU uGô Acu GAU cAG GAc AGc AAA GAc

r80 190 200

ser thr tyr ser met ser ser thr feu tñi ìeu thr lfl lll 9!!¡ tlr 9ll 1I9 his asn ser tv'r !¡f -c-ys glu ala thr hls ¡ys thr

AGc Acc u¡c Acç AuG Acc Acc Acc cuc Aijô uus Àcc ¡¡c er'c ðÀe úäu ó¡Á ceÃ cAU AAc ecc uru Acc uGu GAc ccc Acu cAc AÀG AcA

2 t0 214ser thr ser Pro lle val lvs !91 Phq ?!! qfg !9!! 9lI gI: AilucA AcU UcA ccc AUU GUc AAG AGc UUc AÃö Ãöõ ÀÃÙ õ¡c u-cu iJÂe ¡ence¡nGGUccUGAGACGCCACCACCAGCUCCCCAGCUCCAUCCUAUCUUCCCUUCUAA

GGUCUUGGAGGCUU CCC CACAÂGCGACC UACCAC UcUUGCGcUcCUCCAAACCUC CUCC CCACCUC CUUCUCCUCCUCCUCCCUUU C CUUGGC UUUUAU CAUGCU AAUÀUUUGCAGAAAA

uAuucAAUAAAGuGAGucuuuGcAcuuGA F i g. 3

Àa(t)a

EÈeFt.(ÞIJFl.

Þ¡-t

ì.)b.)

(t)(Þ@

Èo

\o

cØ;J\obJ(,þb.)l¡tÉl¡¿


hlnflI GAGTCAGCAC

CTCAGTCGTS

sc rF I sau96nnl I

hl nft hl nfl ecoRl I aval IlOI GGAGTCÌGGG GGAGÎCTTAÂ TGGAGCCTGG AGGGTCCCTG-

CCTCAGACCC CCTCÂGAATT ACCICGGACC TCCCAGGGAC

hpoll nnllhlnfl mbol I

201 CAGACTCCGG AGAAGAGGCT GGAGTGGGTC GCÀACCATTAGICfGAGGCC TCTICTCCGA CCTCACCCAG CGTTGGlAAT

rsa I30I GAGACAATGC"]C¡¡EÀ,ICECC CTGTACCTGC AAATGAGCAG

CTCTGTTACG GTTCfIGTGG GACÀTGGÀCG TTTACTCGTC

nnl Idde I

40T AGCGGACTAT GCTAÍGGACÍ ACTGGGÊÍCA ÀGGAÀCCTCA

idcõcrctrn cGATAccTcA lc¡ccccAGT TccTIGGAGT

sau96aval I mnl I

TGAACACGGÂ CCCCTCACGA TGAACIÎCGGACTTGTGCCT GGGGAG'IGCl ACTIGAÀGCC

ddelaìul ahal

GCTCAGCTT6 ATTTACCTlG TCCTTGTTTTCGÀGTCGAAC TAÂATGGAAC AGGAACAAAA

fnu4H IbÞv r¡nl I hf nf I

AAACTCTCCT GTGCAGCCTC TGGATTCACTITTGAGAGGA CACGTCGCAG ACCTAABTGA

GTAGTGGTGG TAGTTCACAC CTTCCAfCCACATCACCACC ATCAAÊTGTG GAAGGIAGGT

fok I

nnl I nnl Iddet ddel haelll

TCTGAGGTCT GAGGACACGG CCAT6TATTAAGACTCCAGA CTCCTGTGCC GGTACATAAT

I t sf alllÁAAAGTTGTC CAGTÊTGAAG IGATGCTGGTfT.TTCAACAG GTCACACTf C ACTACGACCA

mnl Ihohl ddel

siõ;iõcercr ccic¡ecc¡¡ AAcGAcAccc ccAlcrcTcTCNCTEECIE¡ GGAGTCGGTT TTGCTGÍGGG GGTAGACAGA

TICAGTAGATAAGTCAlCIA

GACAGTGTGACTGTCACACT

Fig trq.

Àa(t)a

FËÞ(+tDts-Fl.

ATGCCATGTC TTGGGTTCGCTACG6TACAG AACCCAAGCg

hPh Ihl nfl

AGGGCGATTC ACCATCTCCATCCCGCTAAG ÌGGIAGAGGT

nnl ICCCCCTCTTA TTTCGTTAGlGGGGGAGAAT AAAGCAATCA

xhollscrFI

sau96 sau3ÂecoRI I

hael I I dPnIAfCCACTGGC CCCTGGATCTTAGGTGACCG GGGACCTAGA

CTGTGCAACAG ACAC GTTCT

r-t

b.)

b.)

V)ô(D

(ìo

\o

e(A{\ob¿t,l.)bJlrtÉ


ncolfnu¡lHIbbv

50T GCTGCCCAAA CIAACTCCATCGACGGGTTT GAITGAGGÏA

pvul IhglÂ alul

60l GTGiGCACÀC CTTCCCAGCICACACGTGIG GÂAGGGÌCGA

scrFfhael I I

ncilb9l I hPal I

701 cAAcGTTGCC CACCCGGCCAGTTGCAÂCGG GTGGGCCGGT

nboII "rnboII

801 ÍCTGTCTTCA TCTTCCCCCCAGACAGÀAGT AGAAGGGGGG

scrFt xhol Isfat{I fokl sau3A

tpñi-"econri-" scrFl rj-, scrFl dpnlbstEII ecoRII ddel -- ecoRII banHl

ccrcAcccTG ccAtcccrôG TcÀAGGGcTA TTTcqõicÃc ccÂGTcAcAG TGAccTGGAÂ crcrGcATcc cfGTccAGcG

ccAcrcGGAc ccracGGAõö ÅcïïõõõGAi AAAccGÄcîc õcrc¡crorc Acrcc¡ccrr GAGAcclÀcG GAcAcGrccc

fnu4H I sau96bbv ddel nnl I

ostl mnl I ddel alul ¡rnl t haellt !p!l^-^srcËïðc¡cr crcrööiðr¡ clcrcrcEec Ãecrcnarcl crcrccccTc cAGcccTcGG ccçAGcGAGÀ CCGÍCACCTG

cÀco¡ccrc¡ GAcTGGAGÀï GïcÄ6Àcïcc iðeteïõ¡ci e¡cnecce¡e GTcGccAGcc csGTcccrcÎ cGCAGTGGAC

fnu4H I sc rF Ibbv ecoRl I ndel rsalGcAccAccAA GGTcGAcAAc AAAATtcTcc ccÃecðarre TGGTTGTAAG ccTTGGATAT GTACAGTCcc AGAAGTATcA

cclcGTGGTT cclccTGTrc TTrrAAcAcc GcTcdcTÀÀõ ÀðõErð¡rrc GGAÂCGTATA cATGIOAGGG rcrTcAlAGT

hphl t tncîttllfokt hglA'v"'

-'-_'ad.f' acct fokl aval

AAAGcccAAG cATGTGcTcA cc¡rTÂcrcr c¡crcöiÃÁs GTclccTglc TTGTGGTASA cATcAccAAc GATGATcccG

TTTcGGcrrc crAcAcGAcr ccTAATGAGA crclõcÀïîõ cnstccnclc ÁrAcAccATçÎ cTAcrcGTTc cTAcTAGGGC

sm¡ IscrFl

scrFIncl I

ncl Innl I ddel hPaI I

hglÁ atul ¡tgq! - avãi mntl ddel

cTAcATGÁTc TccAGcTccA c4c4qqlçlq Ac6c¡Àcð¿ð'ecöiqalqç4 GITçAAgAGç 4qTIIçç9ç1 cAGTSAGI0A

cATcrAcrAc AccrcclcGr crcrccAcrc rGccîiËõGc õõdicõïcGï cÀrerrcrcc rcÀAAcGcGA GTcAGTGÂcr

Fig.t+B

sau96 PvUIIav¡II alul9OI AGGTCCAGTT CAGCTGGTTT

TCCACGTCAA GTCGACCAÁA

F?rÉS¡Fl(DH-Fl.

E:r¡.)b¿O

(t)(Do€\*o

\o

e(t)-¡u\ob.)(,b.)ì.JliEÉ


100 I

fnu¡tHIscrFl bbv

ecoRlt hlncll alul !qql------AcrTcccATc AfGcÂccAGc AcrcccTcAÂ TcccAAcGAG TTcAAATGcA cecröÃÃc¡e lGcÀGCTllc ccrcccçccA TccAcAAAAc cÀTcTccAÀA

TcAAGcGTAG TAccrccrcc rGAccGAGrr Acccrlõõ1c AAciTTAccr cccAGliéîc ¡córceluc GÊAcGGGGGT AGcTCTTITG GTAGAGGTTT

rsa IIlOI ÀCCAÂÀGGCA GACCGAAGGC ICCACAGGTG ÍACACCATTC

Îèerrrccer crcccrrccG AcGlGTcclc ATcTGGIAAG

¡nboll mbollI20I TCTTCCCTC¡AGACATTACT GTGGAGTGGC AGTGGAATGG

AGAAGGGACT TCTGTAATGA CACCTCACCG fCACCTTACC

acct ¡t q¡ . mbol I nnl I130I CCiCT¡CNCC AAGCÌCAATGIGCAGAAGAGCÀACTGGGAG-

GCAGATGTCG TTCGAGTTAC ACGTCTÌCTC GTTGAGCCTC

scrFl sau3Anrnl I ecoRll dPnI

I40I AAGAGCCTCTCCCACTCTCC TGGIAAAIGA TCCCÁGTGTC

TICTCGGAGâ GGGTGAGAGG ACCATfTACT AGGGTCACAG

I50I AAAGCACCCA GCACTGCCÌT GGGAAAAATTTCGTGGGT CGTGACGGAA CCCTTfTI

n:åitt'mnl t bal I

CACCTCCCAA GGAÊCAGATG GCCAAGGATA

GTGGAGGGTT CCTCGTCTAC CGGTTCCTÂT

fnu4H Ibbv dde IGCAGCCAGCG GAGÀACTACA AGÀACACTCA

CGTCGGTCGC CTCTTGATGT TCTlGTGAGT

hPhIGCAGGAAATA CTTTCACCTG CTCÍGIGTTACGTCCTffAT GAAAGTGGAC GAGACACAAT

' sau96mnll avall h{nfl

CTTGGAGCCC TCÎGGTCCTA CAGGACTCTG

GAACCTCGGG AGACCAGGAT GTCCTGAGAC

Fig.t-C.

AAGTCAGTCT GACCTGCAIG ATAACAGACTTTCAGTCAGA CTGGÀCGIAC TATTGTCTGA

GCCCATCATG AÀCÂCGÂATG GCTCTTACTTC,ìGGTAGTAC ÎTGTGCTTAC CGAGAATGAA

s¡u96nnl I mbol I

hael I l ddelCAIGAGGGCC TGCACAACCÂ CCATACTGAGGTACTCCCGG ÀCGTGITGGI GGTATGACTC

mnl I nnl IACACCTACCT CCACCCCTCC CTGTATAAAT

IÊTGGÂTGGA GGTGGGGAGG GACATATTTA

F?FËÞ?Fl.rÞIJFl.

r.l

l.)b.)e

V)(D(Þ

-lo

\o

À(t)\¡\ob.)(,b.)bJ

$/


Sheet I of 19 us 7,923,2218tfJ.S. Patent Ãpr. l2,20ll

¡ Ð< Ð< Lu 9a!, pci ?9 E(!t 6'J qt(JF< Llg, q¡o Eó

'o5 oÞ +4 Fo sÞor(5 qt< o= ;Ë ;õ ;õ EñcJ €(9 cL=

û= ct Lt o o< cl è(J o L(J o:D(¿ ô 5(9 o ô'9 oF(J>r(5 É 6,ct rg L(J õ ã< õ'¿õ o ><g cÀ ø= É LrJ ç qÞo> ø< qe o<¡i d'r< doÐ <-o (\¿êo ô¡>l'

E(.' oo := J(5 Fo >tf F(J o(j) L=;i ;å ó= ;ã' -ø5

=q óã ç< lu(r

GD(J alt ro õò ;@ ø" >'9 Êë o:t

Êr..l L= ou t:t f< ?9 Gã 'É(J L<ã5 sct ç{ õõ õqf g- -(J Pa c.'ct>(ã +¡< su ;5 õ= ;rJ G(5 'Éct ø5

F= (trc) L< O)Ct L.J' L(J O< ÉÐ -{trt= E2 o(J Ë¿i Ãõ cr'¡ L(' o= rE=>(9 è= 6= ;- ¡- o< è(J >(5 >(t

o< \< LÐ 3(, à< El? Oo slj 5<

r { clrc, D.r =ó -oõ ><t c!Þ c < Elct

=.( LÐ >\= !Þ Éf :9 Lo øo o<õ= õõ ;cÐ -oó ;ì 9- Go >rct Lo;5 65 õc,' ã< -r¡c¡ E< +¡it u= Ào

F= tLt >,= !(J >r= l.cj olt L(' -a'6= ;õ ;., orõ -(9 o,!' ç<( €(J ¡D=>(!, Ãrlt GD(9 ØA g¡c¡ ø= Âu +¡< >('

ão õ4 ç= +(t q(9 =9

F(5 Fo L<(or= FrJ o,ro i¡'5 tcl' q& ó= ó= ßo;õ otl o< É¿' ¡5 oè >(Ð >c¡ +t<

F(J o= LÐ t< !-q := >r- L(J a='E= ;õ o-o ;i à¿ €c? ;'e €(J >rr';õ e= D< -¡¡ò ¡i5 ¿'< rDrÐ e< r¡5

o tÞ Lël qr= J(5 ÊO E< LC) l(¡ o<É qrÐ a,lJ F> õ5 o- 71 c,'¡ F< 15r Ê(, û= ç( ;õ é(.' otqi ø< ctrcs æ(

!o c) 5c) o L(J O L() O¡¡(Ð 9',Ë!? c' Lo (¡ L(J O øo>r< N qr= nto õ;ã å g5 õ-ql F (r¡Lt o (Uct (â >ìr'i"j --;õ P< -¡'5 -ei åot¡ àø= Nø< N('3

o=| 6< õ< 5(t 6= o= =tt o(J o:ãF=;ã ;ã óG:t ;õ .o<¡ ó(t Fo êu èo

Aa, 5(t Fe Lo L= f= L(J ctl@ ø(to= oã o= Ëó >r- qll o'J L.o à<P= F(, >ø F. ãi ø= ø- 'Ë'J eG

'.lJ L(, Ê.¡ ÊCJ +q >rf

er.Ð os Lo ;. a< ;''' -'5 L<¡ >'r5õ< ø- +¡5 õ< ø<¡ .D(, cDct oo u= q

3s åË åË LE :-i ii ba !q àg t.riFo Þr(lt EDct ;i o(l¡ è(J ø= ø< l'l

à!q àf ?9 ø(r r( õrr Êcl f9 "a Þì;(!-€@>;õo=F(Jo<o(JàGD(t tt(, Ê o -oõ ; 's oó t! < û= l'= ' \

o,rr o:t 9ìe Ê> t< 5(e è€ 9cr +? qt;= iõ a<¡ 0< dr> q¡= L(5 L(r qê5 Áõ oi .g. ;- -() +,= êo rt'e

Ê(J ão ø.t èrJ Êt9 O< LIJ -!¡ "'L'ãi ;<i;i o¡ci ;<' õõ ø= oõ 'P< >(e €<,(, +t(9 r(, t'?< O,Þ !-Þ -t5 L> €'o-o5 -ol5 ;A LÈ ;Ð à1r óa *9 loË- E= o¡¡ oã -¡( {J= >(9 +¡< Êo

ct ¡< ct(9 LL, ã= FO L< -tJ -aõ õi aÇt or¡ or= 9= 'Ê L? o? 'EÐ

3 c¡F.-, ctL= o.,ct go= of.= G)-., €r!< 9o,Ðõ ã'o5 +t- Ñ;= õaõ ¡aos i.'¡E= orc¡<¡ $l-:¡õ 'tct +¡i -- É Ào ¡ o= d >tÐ d ÐÞ À¡ç{3 >r< Ê(, r(J g!¿ 9< o< Lo û<'õ oõ ot¡ r¡ã À.J Ê(J c\(J ø< -<a.tõ l(,, otfJ o(J rD< 9o ãc9 f'¿ tât'tã :ó L.t È. a<¡ ao æ{ o¡, >r<ò -orõ ør¡ À'5 c< o'c¡ eÐ'9 ø< -(È L= F= GD< ó< !< o:t

"!? ÉLO

.Ð o() 6= Lc, -ci .t9 !!l €,P ut<

= ó- t., oÚ acs ¡¡i B(r æ'J G'D

(Jã t(ll Ê\c, >G, ø= !(, ru3.' bÞ rctò;ã-c¡;óà<¡sos=çqõ=õ -ç¡¡õ

+t > 'grc'l ,,;a +¡ < cL= .' < > '5ù eQ È= 5< L(.| f¡< L? !-cl t,t(t5 o 5 o, (J ; È ;- >r< >r< >rr( à

-<(

õ tc.a q= où ;tiõ =(e +tO rr!= r= óG, >cf ?9 L(J

õ= at) >rr¡;õ E< aj5 ¡i= qtc ot., p(r 'P<¿t(Ð €q, rtll +r(9 !< o(9 À9 L(Jô- ;<.l ;- cr= ou à< 2= ooÈa or^¡ 'qtGi È< e= æ'€ Gßlt 'n<'F.9 L= GD< ¡tlJ !(J F!¿ != Lo'o5tO {i':t .qã oo o5 >.t oã r^<


z5o 260 270ile phe Dro pro lys pro lys asp val 1eu thr lle thr leu thr ?!o'!fl yl! !¡I .c.If Ig.L !91 I1! l:P JIe lqf lft llf 9lP pro¡uc Ûuc Tcc bce ¡Áe bcc Eie cIÛ GUG cuc Acc Auu AcU cUG ncu ôCu AÁG GUC ACG UGU GUU GUG GUA GAC AUC AGC AÂG GAU GAU CCC

280 290 300

slu yal stn phe ser trp phe val asp asp yat g!u ya! !!! !¡t !!t 9!! !!t 9!¡ P19 9I9 9!! 9!! 9!1 Pt'!ç !!! !9I !!.f P¡9 t19õna euc õEc üuc nec ùcõ úùu cu¡ cÃû cÀû eue õle Guc cÂc AcA ccu c¡c ¡ce ctr ccc ccc cÂc cÂG cÀG uuc AAc AGc Acu uuc ccc

3lo 320 330ser val ser glu leu pro lle ¡ret hls gln asp trp leu asn sìy ìys slg phq lVl çll qlg !9! ql! l9!:9!! !!t PI! Pf9 llq prouc¡ euc AGU õAA cuu bcc Auc AUG clc õAG cAb ucê cuc AAU ceû ¡Âc e¡c uuc AAA ucc AcG Guc ÂAc Acu GcA ccu uuc ccu Gcc ccc

340 350 360Ite elu lys thr {le ser lys thr lys gly ars Pro lys ala pro 9!! Ya! lyl !!I .¡19 Plg Ptg Pfg lrylq gll T9! q!1 ll: qlfAuc GAG AÃA Acc AUc Ucc AiA Acc ¡i¡ õeó AGÃ bcc ¡Ãe ccu Õcn Õ¡O GUG uÂc Acc AUU ccA CCU CCC AAG GAG CAG AUG GCC AAG GAU

370 380 390lys val ser leu thr cJ's met île thr* ¡e:p phê phe pro glu asp !lg'!!r y9! 9!l ltp 9!! llt t:l 9U 9l! qI9 ll! 9lI lsn tvr¡i¡ ouc AGu cuG Acc uõc AUG AUA Actr GAb Ûuc Úuc ðcu én¡ GÀû AUU Acu GUG c¡s usS CAG UGG A¡U GGG CAG CCA GCG GAG AAC UÂC

¿t 0o 410 420lys asn thr gln pro lle net asn thr asn sly ser tyr phe val tyr l9l lll ]99 191 Y-q! 9!! !M9I 9:! -!lP 9!u ala slv asnIÁc ¡Ec AcU öAG öcc ¡uc AUG ÃÃi Áic nnu õc-c ucu U¡Ic ÛUc GUc UÂc AGc AÀG cuc AAU GUG CAG AAG AGC AAC UGG GAG GCA GGA AAU

430 440 447thr phe thr cys ser val leu hls glu sly ìeu hls ðl! lt!9 !!i !!.1 9ll .!I: f9I leu ser hls sqr Pfq 9U !yl 91. ..^^^^^..,Àcu ûuc Acc Uêc ucu cuc uuÂ CAU ð¡e õa-c cue c¡i À¡c crc cÂu Acu ére n¡e AGc cuc ucc cÂc ucu ccu GGU AAA UGA ucccAcucuccu

UGGAGCCC U C UGGUC CUACAGGACUCUGACACC UAC C UCCAC C CC U CC CUGUA U AAAUAAAGCAC CCAGCACU G C C U U GGGAAAAA

Fi g. 5B

t1(t)a

rrJSlFI(DI)Fl.

r.l

l.)N¡ê

V)(Þô\oo

\Þ

-(t){\Þ\.)t,t)bJl-.EÉ


LJ.S. Patent

P3fl

LtollSou!á

AÚdII

Aúo llP5il

Apr. 12,2011 Sheet l0 of 19 rJS 7,923,22181

!oñHl

tc¡

Psl l. Arolll¡ola-le 55Sbg lro3ñeñlllrñ3ol Drlñet

i;lå'f Eâfi ti".'i,E!''gSculAtrô¡ole l8OÞc lrogñcñlu

1f3

-

.o"to

i13s "0,'

+ 4dÍrre's8o¡¡l{lIAPlSolole lotge iaclorfrcAaenl

P¡I Il¡olote kogto Itogñ¿rìtAYo ll Dorllclll€ôos Po¡l r 4dflTP'¡xôo lll¡'otota 49OÞP lrognent

f4 OHA llgo¡ê

Hoo llSou 3A

Sol I

lcF

Avo I

Fig.6.

AYô I

xlañotJ Pol I + 4dt{tP S

xÞo I

8APl¡olole lorgeYccloflrogñáñl

AYo I

f¡cnoY Pcl Io 4dNTP'sPtf It6ol.le rc€ÂIrogriañl

€conl¡(lcñow Pcl I. ¿l illaf P'3Plr Il¡olclc lof¡e Yêclotl.o¡iìsñl

T4 Ot{a lhc¡€

T4 DNA t¡gose

BolnHI


eotñHl

[LS. Patent Apr. 12,2011 Sheet 11 of19 as 7,923,221B1

Psl Il¡Cots G?8bP ftognc¡lAlù I, Rso Il¡olole ?80b0 trogñìcîtAnÍool gr¡mttãIDATGGAAGTGA.fGC.T6x¡ó¡owPolt +4lNTP'sXoo lll¡olot€ IegbÞ lrogrñ5rì I5'ATG

-

TAc

-

llÞo ll

roQ l. 8oñHlt¡oiot€ too ÞÞ troorn.ñt

EomHlPrl IToeAm

P3r I

ÀpR

T4 ONA ligotc

P5l Ilsolole

^,830bP lrogneñl

Avo lll(lenowPo¡l+ 4óÌ{TP'¡Toq Il3olotoSTSbg Avs¡1.Toq I l?ogm€at

T4 ONA l¡qoto

EcoRlKlènswPol l+4dt{fP'38oúHllrolole lo?go Yôclor (.09n€nl

apF

HColl

gorìHlP¡I I

loq I

EcoRl

BoGHI

AYo IKlenow Pol I+. óNTP,¡Eomllllsolole lorgeYgclor lrogñeôl

EcoRlXlenot¿ Pol I+ 4 dNf PrsP6r Ilrolots ¡or9eY!clof lrogne^t

P3l I

PEI Il¡olole 628bP lrognenlgomHl. ll90lllsolsle 38Obp lroqnenl

Psl I

Avo I Porllolxlc¡ow Pol I

+ 4 dl{ÎPlBoltlHllSolole 869bP lrogrnoñl

ÊcoR I

Prl l. 80ñHll¡ololc 1545ÞP trogmenl

Fig.7.Sol I


U.S. Patent Lpr. l2,20ll Sheet 12 of 19 as 7,923,221Bl

5c--6-õ

4õ-5-o

l_3c--6-ocbo

':*.:j;-..:

: l''

Fig.8A


fJ.S. Patent Ãpr. 12,20ll Sheet 13 of 19 us 7,923,221Bt

:t,

:t-

"1"

"1"¡¡l

.l*:t'

åi'.s,ã . v

9 qioSciì@ It.

l-

"l


fJ.S. Patent Apr.12,20ll Sheet 14 of 19 as 7,923,221Bl

':

z

Fig |8C.


O,lOUg onti-CEA

O.3Ot¡g onti-CEAl.OOpg onti-CEA

K cells (lOpl)

7 cells (l0Ul )

K7 cells (lOUl)

RWö7 - r3000RW57 - K3000

3l:å3] K-Gz'

K 7 cells (2O ul)K cells (20pl)

Fig.9.

ãa(aa

FgÞFl.(ÞIJFF

Þì5Fl

b.)

b.)

(t)

IDo

t,Io

\o

e(t)\¡\oì.)(,bJbJllEÉli


IJ.S. Patent

l.o

o.9

o.8

o.7

o.6

I o.s

o.4

0.3

o.2

o.l

o

-o.t

Apr. 12,2011 Sheet 16 of 19 us 7,923,221Bl

O STANDARD DATA

- STANDARD CURVE

rooooto too looo

Concentrotion (nglml)

Fig.'10.


U.S. Patent Ãpr. 12,20ll Sheet 17 of19

Pstl

ApR

EcoRl

Klenow Pol l+ dNTP's

Pvull

lsolole veclor frogmenl

T4 DNA ligose

us 7,923,221Bl

EcoRl

EomHlSo/l

Avolll

Any restriction enzymewhich culs in3'untronsloted region

Klenow Pol l+ dNTP's

lsolote frogment

Ps/l -

aps

Ã;';,;.'So/l

Pvull

Avolll

lsololefrogment

Fig 'l'1.

p¿CEAtrpZQT-l*(XAP)

pBR322contolning humon72 heovy choin

¡'¡CEAITPZQT-l+humon /moüsehybrid (XAPI


IJ.S. Patent Apr. 12,2011 Sheet 18 of 19 us 7,923,221Bl

. Pvull

.Any reslriction enzYme which

cuts in vorioble region

. Klenow Poll+ dNTP's

. lsolote ontibodY f rogment

T4 DNA ligose

Psll

DELETE AS FOLLOWS:

'Clone Xöol to Pvøll frogment

in Ml3

. Ncol

. Klenow Poll+ dNTP's

. Pvull

. lsolole vector froqment

.' I n vil ro site-direcleddelelion mulogenesis(see Adelmo n et ol., DNA a, 183 ( 1983) )

.Clone modified Xbollo Pvull

frogmenl bock in

p-l ntermediote humon/mouse

hybrid ( XAPI

Xbol

p¡CEAtrpZOT-l*humon/mousehybrid (XAPI

(pChlm l)

pBR322conloininq humon

72 heovy choincDNA inse¡t

Xbol

plnlermediotehumon/mousehybrid (XAP)

s\z2

p¡CEAlrP2O?-l* ?

humon/mousehybrid (XAP)

(pChimll )

Fig 12. apR


EcoRl Hindlll

(XAP)

,/-\ip¡ CEAlnl2

Ncol

Pst I, BomHllso¡ole l543bpf rogment

BomH

Nde I

Avo I

Ncol, Nde I

lsolote 260bp frogmentAnnetj primerS,CAACCACAATCCCKlenow Pol 1+ 4dNTP's

Pst I

apF

T4 DNA ligose

BomHllsolole5'caa

GTT

p tCEAFobtrp 2O7-¡*.(XAP) z

F?rËÊl.l.tÞt-Ft.

l79bp frogmenl

NcolBomHl Fig.13.

BomHl

r-t

l.¿

¡.)

V)(D(Þ

\0o

\a

e(n-¡\oF.)(,ì.)b.)3tÉ


us 7,923,22r B1

1

METHODS OF MAKTNG ANTTBODY HEAVYAI\{D LTGHT CEAINS HAVING SPECTF'ICITY

FORA DESIREDANTTGEN

This is a continuationofapplication(s) Ser' No. 071205,4 I 9 5

ûled on 1 0 Jun. 1988, now U.S. Pat. No. 6,331,41 5, issued on

18 Dec. 2001, which is a continuation of Ser. No' M1483'457filed on 8 Apr. 1 983, now U.S. Pat. No. 4,81 6,567, issued on

28 lMa¡. 1989, which applications are incorporated herein byreference and to which application(s) priority is claimed t0

under 35 USC $120.

BACKGROUND OF THE INVENTION

This invention relates to the ûeld of immunoglobulin pro- ts

duction and to modification of naturally occurring immuno-globulin amino acid sequences. Specifically, the inventionrelates to using recombinant techniques to produce bothimmunoglobulins which are analogous to those normallyfound in vertebr¿te systems and to take advantage ofthese zo

gene modification techniques to construct chimeric or othermodified forms.A. Immunoglobulins and Antibodies

Antibodies are specific immunoglobulin pol¡peptides pro-duced by the vertebrate immune system in response to chal- zs

lenge by foreip proteins, glycoproteins, cells, or other anti-genic foreign substances. The sequence of events whichpermits the organismto overcome invasionby foreigncells orto rid the system of foreign zubstances is at least pafüallyunderstood An important part of this process is the manufac- :oture ofantibodies which bind specifically to a particular for-eign substance. The binding specificity of such polypeptidesto a particular antigen is highJy refined" and the multitude ofspecificities capable of being generated by the individualvefebrate is remarkable in its complexity and variability. rs

Thousands of antigens are capable of eliciting responses,

each almost exclusively directed to the particular antigenwhich elicited it.

ú:rmunoglobulins include both antibodies, as above

described" and analogous protein substances which lack anti- ¿o

gen speciflcity. The latter are produced at low levels by thelymph system and in increased levels by myelomas.

4.1 SourceandUtilityTwo major sources ofvertebrate antibodies are presently

utilized-generation in situ by the m¡mmalian B lympho- +s

cytes and in cell culture by B-cell hybrids. Antibodies are

made in situ as a result of the differentiation of immature BIymphocytes into plasma cells, which occurs in response tostimulation by specific antigens. In the undiflerentiated Bcel l, the portions of DNA coding for the various regions on the so

immunoglobulin chains are separated in the genomic DNA'The sequences are reassembled sequentially prior to tran-scription. A revisry ofthis process has been given by Gough,Trends in Bìochem Scí,6:2O3 (1981). The ¡ssulting rear-ranged genome is capable of expression in the mature B ss

lymphocyte to produce the desired antibody. Even when only¿ single ¿¡figsa is intoduced into the sphere of the immunesystem for a particula¡ mammal, however, a uniform popula-tion of antibodies does not result. The in situ immuneresponse to atry particular antigen is defined by the mosaic of oo

responses to the various determinants which are present onthe antigen. Each subset ofhomologous antibody is contrib-uted by a single population of B cells-hence in situ genera'

tion of antibodies is'þolyclonal".This limited but inherent heterogeneity has been overcome 6s

in numerous particularcases by use ofhybridoma technologyto create "monoclonal" antibodies (Ifuhler, et a7., Eur. J.

2Immunol.,6: 5ll (1976)). In this process' splenocytes or

lymphocytes from a mammal which bas been injected withantigen are fu sedwith a tumor cell line, thus producing hybrid

cells or "hybridomas" which are both immortal and capable

ofproducing the genetically coded antibody ofthe B cell. The

hybrids thus formed are segregated into single genetic shains

by selection, dilution, and regrowth, and each strain thus

represents a single genetic line. They therefore produce

immunoreactive antibodies against a desired antigen which

are assured to be homogenous, and which antibodies, refer-

encing their pure genetic parentage, are called "monoclo¡4l".

Hybridoma technology has to this time been focused largely

on the fusion of murine lines, but human'human hybridomas

(Olsso4 L. et al., Proc. Natl. Acad. Sci. (USA),77: 5429

(1980)); human-murine hybridomas (Scblom, J-' et al. (ibiÐ77: 6841 (1980)) and several other xenogenic hybrid combi-

nations have been prqlared as well. Altematively, primary,

antibody producing, B cells þ¿vs þss¡ immortalized invitroby transformation with viral DNA.

Polyclonal, o¡ much more preferably, monoclonal, anti-

bodies have a variety of useful properties simil¿¡'1s those ofthe present invention. For example, they can be used as spe-

cifið immunoprecipitating reagents to detect the presence ofthe antigen which elicited the initial processing ofthe B cellgenomeby coupling this antigen-antibody reaction with suit-

able detection techniques such as labeling with radioisotopesor with enzymes capable of assay (RIA, EMIT, and ELISA).Antibodies are thus the foundation of immuno diagnostictests for many antigenic substances. In another importa[t use,

antibodies can be directly injected into subjects suffering

fioin an attack by a substance or organism containing the

antigen in question to combat this attack. This process is

currentþ in its experimental stages, but its potental is clearlyseen. Third whole body diagnosis and treaÛnent is madepossible because injected antibodies are directed to specific

target disease tissues, and thus can be used eitherto determinethepresence of the disease by carrying with them a suitable

label, or to attack the diseased tissue by carrying a suitabledrug.

Monoclonal antibodies prcduced by hybridomas, whiletheoretically effective as suggested above and clearly prefer-

able,to poiyclonal antibodies because of their speciûcity,suffer from certain disadvantages. First, they tend to be con-

taminated with other proteins and cellular materials of hybri-doma, (and, therefore, mammalian) origin' These cells con-

tain additional materials, notably nucleic acid fragnents, butprotein fragments as well, which are capable of enhanrcing,

õausing, or mediating carcinogic responses. Second, hybri'doma lines producing monoclonal antibodies tend to be

unstabte and may alterthe structure ofantibody produced orstop producing antibody altogether (Kobler, G., et al., Pruc.

Natl. Acad. Sci (USA)77:2197 (1980); Monison, S. L., -iiImmunol. 123:793 (1979). The cell line genome appears to

alter itself inresponse to stimuli whose nature is not currentlyknown, and this alterationmay result in production of incor-rect sequeûces. Third, both bybridoma and B cells ineviøblyproduce certain antibodies in glycosylated form (Melchers,

F., Biochemistry, 10: 653 (1971)) which, under some circum-stances, may be undesirable. Fourth, production of botlmonoclonal andpolyclonal antibodies is relatively expensive.

Fiff!, and perhaps most important, production by current

techniques (either by hybúdoma or by B cell response) does

not permit manipulation of the genome so as to produce

antibodies with more effective design components than thosenormally elicited in response to antigens from ttre mature B

cell in situ. The antibodies ofthe present invention do not


us 7,923,221Bl3

suffer from the foregoing drawbacks, and, fi:rthermore, offerthe opportunity to provide molecules of superior desip'

Even those immunoglobulins which lack the specificity ofantibodies are usefrrl, atthough over a smaller spectrum ofpotential uses than the antibodies themselves. In presently

understood applications, zuch immunoglobulins are helpfirlin protein replacement therapy for globulin related anemja ' Inthis context,aninability to bindto antigen is in facthelpful, as

the therapeutic value of these proteins would be impaired bysuch fi¡nctionality. At present, such non'specific antibodies

are derivable in quantity only from myeloma cell cultures

suitably induced. The present invention offe¡s an altemative,

more économical sou¡ce. It also oflers the oppornrnity ofcancelling out specificity by manipulating the four chains ofthe tetramer separately.

4.2 General Stucture CharacteristicsThe basic irurrunoglobin structural unit in verÞbrate sys-

tems is now well understood @delman, G- M-, Ann. N.YAcad. Sci.,190: 5 (1971)). The units are composed oftwoidentical light polypeptide chains of molecular weightapproximately 23,000 daltons, and two identical heavy

chains of molecular weight 53,000-70,000. The fou¡ chains

are joined by disulfide bonds in a 'Y' configuration whereinthe light chains bracket the heavy chains starting at the mouthof theY and continuing tbrough the divergent region as shown

in FIG. 1. The "branch" portion, as there indicated, is desig-

nated the Fab region. Heavy chains are classified as gaÍìma'mu, alpba, delta, or epsilon, with some subclasses among

them, and the nature of this chain, as it has a long constant

region, determines the "class" of the antibody as IgG, IgM,IgA, IgD, orlgE. Light chains areclassiûedas eitherkappa orIambda. Each heavy chain class can be prepared with either

kappa or lambda light chain. The light and heavy chains are

covalently bonded to each otheç and the "tail" portions ofthetwo heavy chains are bonded to each other by covalent disul-fide li-nkages when the immunoglobulins are generated eitherby hybridomas or by B cells. However, ifnon'covalent asso-

ciation ofthe chains can be effected in the correct geometry'

the aggregate will still be capable of reaction with antigen, orof utility as a protein supplement as a non-specific immuno-globulin.

The amino acid sequence mns from the N-terminal end at

the top of the Y to the C-terminal end at the bottom of each

chain. At the N-terminal end is a variable region which isspecific for the antigen which elicited it, and is approximatelytOO amino acids in lengtþ there being slight variations

between light and heavy chain and from antibody to antibody.

The variable region is linked in each chain to a constaüt regionwhich extends the remaining length of the chain' Linkage is

seen, at the genomic level, as occurring through a linkingsequence known curently as the "J" region in the ligbt chaingene, which encodes about 12 amino acids, and as a combi-nation of"D" region and "I' region in the heavy chain gene,

which together encode approximaiely 25 amino acids.

The remaining portions of the chain are referred to as

constaût regions and within a particular class do not to varywiththe specificiry of the antibody (i.e., the antigen elicitingir).

As stated above, there are five known Major classes ofconstant regions which determine the class of the immuno-globulin molecule (IgG, IgM, IgA, IgD, and IgE correspond-ing to 1, p, a, ô, and e heavy chain constânt regions). Theconstant region or class determines subsequent effector func-tion of the antibody, including activation of complement (Ka-

bat, E. A,., Structural Concepts in Immunologt and Immu-nochemistry,2nd F.d., p. 413-436, Holt, Rinehart, Mnston(1976\),and other cellul¿rresponses (Andrews, D. W., et al.,

4Clinical Immunobíologt pp l-18, W. B. Sanders (1980);

Kohl, S., ef aT.,Immunologt, aS: 187 (1983)); whilethevari-

able region determines the antigen with which it will react'

s B. Recombinant DNATecbnologY

Recombinant DNA tecbnology bas reached suffcient

sopiristication that it includes a repertoire oftechniques forclóning and expression of gene sequences. V,arious DNA

to sequeices can be recombined with some facility, creating

ner¡i DNA entities capable ofproducing heterologous proteinproduct in tansformed microbes and cell cultures. The gen-

ãral means and methods for the in vitrc ligation of various

blunt ended or "sticþ' ended ftagments of DNA, forproduc-15 ing expression vectors, and for transforming organisms are

now in hand.DNA recombination of the essential elements (i.e'' an ori-

gin ofreplication, one or more phenotypic selection cbarac'

ieristics, expression control sequence, heterologous gene

20 insert and remainder vector) generally is performed outside

the host cell. The resulting recombinant replicable expression

vector, or plasmid, is intrrcduced into cells by transformation

andla¡ç quantities ofthe recombinant vehicle is obtained by

growinã the tansformant. Where the gene is properþ2s inse¡ted wilh reference to portions which govern the tran'

scription and translation of the encoded DIrIA message, the

resulting expression vector is useful to produce the polypep-

tide sequence for which fle inserted gene codes, a process

referred to as "expression"'The resulting product may be

¡o obtained by lysis, iinecessary, of the host cell and recovery ofthe product by appropriate purifications from other proteins'

In practice, the use of recombinant DNA tecbnolory can

expreis entirely heterologous pollpeptides-so+alled direct

expression-or allematively may express a heterologous35 poiypeptide fused to a portion of the amino acid sequence of

ã hõ.ólogout polypeptide' ln the latter cases, the intended

bioactive product is sometimes rendered bioinactive withinthe fused-homologous/heterologous polype' tide until it iscleaved in an extracellular envi¡onment.

40 The art of maintaining cell or tissue cultures as well as

microbial systems for studying genetics and cell physiolory

is well established. Means and methods are available formaintaining permanent cell lines, prepared by successive

serial transieñ from isolated cells. For use in researcb, such

4s cell lines are maintained on a solid support in liquid medium,

or by growth in suspension containing supportrrutriments'Scalô-up for large preparations seems to pose only mechani-

cal problems.

50 SUMMARYOFTHEINVENTION

The invention relates to antibodies and to non-specific

immunoglobulins (NSIs) formed by recombinant tecbniques

using suitable host cell cultures. These antibodies and NSIs

ss can be readily prepared in pure "monoclonal" form. They can

be maniputaied ai the genomic level to produce chimeras ofvariants which draw their homology from species which dif-fer from each ofher. They can also be manipulated at the

protein lwel, since all four chains do not need to be produced

oo by the seme cell. Thus, there a¡e a number of "types" ofimmunoglobulins encompassed by the invention.

First, immunoglobulins, particularly antibodies, ale pro'duced using recombinant techniques which mimiç 1þe ami¡e

acid sequence ofnaturally occurring antibodies produced by

65 eittiér mammalian B cells in situ, or by B cells fl¡sed withsuiuble immortalizing tumor lines, i.e., hybridomas' Second,

the methods of this invention produce, and the invention is


us 7,923,221B15

directed to, immunoglobulins which comprise polypeptidesnot hithe¡to found associated wilh each other in nature. Such

reassembly is particularþ useful in producing "hybrid' anti-bodies capablè of binding more tban one antigen; and inproducing "composite" immunoglobuins wherein heavy and

iigb "ua* ofdifferent origins essentially damp oul.speci-

fiõiff. Third. bv eenetic manipulation, "chimeric" antibodiescanie foráe*i úherein, for-example, the variable regionscorrespond to the amino acid sequence ûom one mammalianmodeisystem, whereas the constant region mimics-thr aminoacid sequence of another. Again, the derivation of these twomimickird sequences may be from different species. Fourth,

also by genètic manipulation" "altered" antibodie-s withimproved specificity and other characteristics canbe formed.

îwo other t¡pes of immunoglobulinlike moieties may-beproduced: 'bnivalenf ' antibodies, which are useful as homingõariers to target tissues, and "Fab proteins" which includeonly the "Fab'tregion of an immunoglobulin molecule i.e, the

braiches of the i'Y'. These univalent antibodies and Fab

fizgments may also be "mammalian" i.e., mimic mammalianamino acid sequences; novel assemblies of mammaliancbains, or chimeric, where for example, the constant and

variable sequence patterns may be of diferent origin. Fimlly,eitherthe light chain orheavy chain alone, or portions thereo{produced by recombinant techniques are included in the

invention and may be mammalian or chimeric.In other aspects, the invention is directed to DNA which

encodes the aforementioned NSIs, antibodies, and portions

the¡eof, as well as expression vectors or plasmids capable ofeffecting the production of zuch immunoglobulins in suitâblehost cells. It-includes the host cells and cell cultures whichresult from transformation with these vectors. Finally, the

invention is directed to methods of producing these NSIs andantibodies, and the DNA sequences, plasmids, and tr¿ns-

formed cells interrnediate to them.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. I is a representationofthe general structureof immu-noglobulins.

FIGS. 2A-B showthe detailed sequence of thecDNA insert

ofpKl7G4 which encodes kappa anti CEA cbain.FIG. 3 shows the coding sequence of the fragment shown in

FIG. 2, along with the corresponding amino acid sequence.

FIGS.4A-C show the combined detaild sequence of the

cDNA inserts of py298 and p1l1 which encode gamma anti

CEA chain.FIGS. 5A-B show the corresponding amino acid sequence

encoded by the fragment in FIG. 4.

FIGS. 6 and 7 outline the construction of expression vec-

tors for kappa and gamma anti-CEA chains respectively'FIGS.8A,88, andSC showthe results ofsizinggels runon

extacts of E. coli expressing the genes for gamma chain,kappa chain, andbothkappa and gamma chains respectively.

FIG. 9 showsthe ¡esults of westemblots of extuacts of cells

Ea¡sformed as those in FIG. 8.

FIG. 10 shows a standard curve for ELISA assay ofantiCEA activity.

FIGS. 11 and L2 show the construction of a plasmid forexpression ofthe gene encoding a chimeric heavy chain'

FIG. 13 shows the constuction of a plasmid for expression

ofthe gene encoding the Fab region ofheavy chain.

DETAILED DESCRIPTION

A. Definitions

As used hereir¡ "antibodies" refers to tetmmers or aggre-gates thereof which have specific immunoreactive activity,

6comprising ligþt and heavy chains usually aggregated in the

"V' connguration of FIG. 1, with or without covalent linkage

between them; "immunoglobulins" refers to such assemblies

whether or not speciûc immunoreactive activity is a property'

s "Non-specific immunoglobulin ' ('NSI") means tlose immu-

noglobúlins which do not possess specificity-i.e', those

which are not antibodies."Mammalian antibodies" refers úo antibodieb wherein the

amino acid sequences of the cbains are homologous withro those sequences foundin antibodies producedby mammelian

systems, either in situ, or in hybridomas. These^ antibodies

mimic antibodies which are othenrise capable of being gen-

erate{ althoughi¡ imFure form, inthese traditional systems'

"Hybrid uttibodie.-' refers to antibodies wherein chains

ts are separately homologous with referenced mammalian anti-

body chains and represent novel assemblies ofthem, so that

two different antigens are precipitable by the teftaúer. Inhybrid antibodies, one pair of heavy and light chain ishomologous to antibodies raised against one antigen, while

ao the othei pair ofheavy and ligþt chain is homologous to those

raised agänst another antigen. This results inthe propefy of"divalence" i.e., ability to bind two antigens simuløneously'Such hybrids ma¡ of course, also be formed using chimericchains, as set forth below.

2s "Composite" immunoglobulins me:lns those wherein the

neavy ana ügbt cbains mimic those of different species ori-gins or specificities, and the resultant is thus likely to be a

ãoo-rpoifi" immunoglobulin (NSI), i.e. -lacking

in anti-

body character.30 "bhim"tic antibodies" refers to those antibodies wherein

one pofion ofeach ofthe amino acid sequences ofheavy and

fiphl chains is homologous to corresponding sequences inan=tibodies derived from a particular species or belonging to a

partiêular class, while the remaining segment of the chains is

:s Loúologous to corresponding sequences in another. Typi-cally, in these chimeric antibodies, the variable region ofbothligbt and heavy chains mimics the variable regioas of anti-bõdies derived f¡om one species of m¡mmals, while the con-

stant portions are homologous to the sequences in¿ntibodies¿o derivôd from another. One clear advantage to such chimeric

forms is that, for example, the variable regions can conve-

niently be derived from presently loown sources using

readiþ available hybridomas or B cells from non human host

organisms in combination \¡/ith constant regions derived

+s tõm, for example, human cell preparations. While the vari'able region has the advantage ofease ofpreparation, and the

specifiõity is not affected by its source, the constant region

bèing human, is less likely to elicit an immune response froma human subject when the antibodies are injected than would

50 the constant region from a non-human source-

However, the definition is not limited to this particularexample. It includes any antibody in which either or both ofthe hõavy or light chains are composed of combinations ofsequencés -i-icking the sequences in antibodies of different

ss sonr"es, whether these sources be differing classes, differingantigen responses, or differing species oforiein and whether

or not the fusion point is at the variable/constant boundary.

Thus, it is possible to produce antibodies in which neither the

constant nor the variable region mimic known antibody

60 sequences. It then becomes possible, for example, to con-

stuctantibodies whose variable region has a higher specific

¿ffinity for a particular antigen, or whose constant region can

elicit enh¡nced complement fixation or to make other

improvements in properties possessed by a particular con-

65 staqt rE¡.ion."Alte;ed antibodies" means antibodies wherein the amino

acid sequence bas been varied from that of a mammalian or


7other vertebrate antibody. Because of the relevance of recom-

binant DNA lgchniques to this invention, one need not be

confined to the sequences of ¡mino acids found in natural

antibodies; antibodies can be redesigned to obtain desired

characteristics. The possible variations are many and range

from the changing of just one or a few amino acids to the

complete redesip. of, for example, the constant region.

Changes in the constart region will, in general, be made inorder-to improve fhe cellular process characteristics, such as

complement fixation, interaction with membranes, and olhereffector functions. Changes in the variable region will be

made in order to imFrove the antigen binding characteristics.

The antibody can also be engineered so as to aidthe speciflcdelivery of a toxic agent according to the "magic bullet"concept. Alterations, can be made by standard recombinant

techniçes aíd also by oligonucleotide'directed mutagenesis

techniques (Dalbadie-McFarland , etal Proc. Natl. Acad. Sci'

(U SA), 7 9 :64o9 ( 1 982))."Ilnivalent antibodies" refers to aggregations which com-

prise a heavy chain/ligbt chai¡ dimer bound to the Fc (oritem) region ofa second heavy chain' Such antibodies are

specific for antigen, but have the additional desirable property

oïtargeting tissues with specific antigenic surfaces, withoutç¿u5ing its antigenic efectiveness to be impaired-i.e., there

is no antigenic modulation. This phenomenon and the prop-erty ofunivalent antibodies in this regard is set forth in Glen-

nie, M. J., et al. , Nature, 295:712 (1982). Univalent antibod-

ies have heretofore been formed by proteolysis.

"Fab" region refers to those portions ofthe cbains whichare rouehly equivalent, or analogous, to the sequences whichcomprise theY branch portions ofthe heavy chain and to the

light chain in its entirety, and which collectively (in aggre-

gãtes) have been shown to exhibit antibody activity. "Fab

protein", which protein is one ofthe aspects ofthe invention,

includes aggregates ofone heavy and one light chain (com-

monlyknownas Fab'), as well astetîamers whichcorrespondto the two branch segments of the antibody I (commonlyknown as F(ab)r), whether any ofthe above are covalently ornon-covalently aggregated so long as the aggregation is

capable of selectively reacting with a particular antigen orantigenfamily. Fab antibodies have, as bave univalent ones,

been formedheretofore by proteolysis, and share the property

of not eliciting antigen modulation on talget tissues. How-ever, as they lack the "effectot''Fc portionthey cannot effect,

for example, lysis of the target cell by macrophages'

"Fab protein" has similar subsets according to the defini-tion ofthe present invention as does tle general term'anti-þ6diss" q¡ "immtrnoglobulins". Thus, "mammalian" Fab pro-tein, "hybrid" Fab protein "chimeric" Fab and "altered" Fab

protein are defined analogously to the corresponding defini-tions set forth in the previous paragraphs for the various typesofantibodies.

Individual heavy or light chains may of course be "mam-malian", "chimeric" or "altered" in accordance with the

above. As will become apparcnt from the detaileddescriptionofthe invention, it is possible, using the techniques disclosed

to prepare other combinations of the four-peptide chain

aggregates, besides those specifically defined, such as hybridantibodies containing chimeric light and mammalian heavy

cbains, hybrid Fab proteins containing chimeric Fab proteins

of heavy chains associated wirh mammalian ligbt chains, and

so forth."Expression vectot'' includes vectors which a¡e capable of

expressing DNA sequences contained therein, i.e., the codingsequences are operably linked to other sequences capable ofeffecting their expression. It is implied although not always

explicitly stated, that these expression vectors must be repli-

us 7,923,22r Bl

cable in the host organisms either as episomes or as an integral

part of the chromosomal DNA. Clearly a lack of replicability

would render them effectively inoperable' A useful, but not a

necessary, element of an ef[ective expression vector is a

5 marKer encoding sequence-i.e. a sequence encoding a pro-

tein which resulis in a phenotypic property (e.g. tetracycline

resistance) of the cellsìontaining the protein which permits

those cells to be readily identified. In sum, "expression vec-

tor" is given a functional definitioq and any DNA s€quence

t0 which ls capable of efecting expression of a specified con-

tainedDNAcode is includedinthisterm, as it is appliedto the

specified sequence. As at present, such vectors ate frequentlyin the forrof plasmids, thus "plasmid' and "expressionvector" a¡e often used interchzngeably. However, the inven-

15 tion is intended to include such other forms of expression

vectors which serve equivalent functions and which ma¡from time to time become known in the art.

"Recombinant host cells" refers to cells which have been

transformed with vecton coßtructed using recombinant20 DNA techniques. As defined herein, the antibody or modifi-

cation thereóf produced by a recombinant host cell is by

virtue of this üansformation, rather thall in such lesser

amounts, or more commonly, in such less than detectable

amounts, as would be produced by the untransformed host'

2s In descriptions of processes for isolation of antibodies

from recombinant hosts, the terms "cell" and "cell culture"are used interchangeably to denote the source of antibody

unless it is clearly specifìed otherwise' In other words' recov-

ery of antibody from the "cells" may mean either from spun30 down whole cells, or from the cell culture containing both the

medium and the suspended cells.

. B. Host Cell Cultures andVectors

35 fbe vectors and methods disclosed herein are suitable foruse in host cells over a wide range ofprokaryotic and eukary-

otic oiganisms.In general, ofcourse, prokaryotes are preferred for cloning

of DÑe sequences in constructing the vectors usefi¡I in the

40 invention. Fãr example, E. coli K12 stntn 294 (ATCC No'

31446) is particularly useful. Other microbial stains whichmay be used include E. coli stains such as E coli B, and E.

colî Xl7 7 6 (AITC No. 31537 ).These examples are, of course, intended to be illustrative

¿s rather than limiting.Piokaryotes may also be used for expression' The afore-

mentioned strains, as well as E coli W3lt0 (F' ?'-, pro-

Jotophic, Af,TC No. 27325), bac1lli such as B acîllus subtilus,'and other enterobacteriaceae such as Salmonella typhímu-

so ríum or Serratiø marcesans, and various Pseudomonas spe'cies may be used.

In general, plasmidvectors containing re,plicon and controlsequences which are derived from species compatible withthe host cell are used in conDection with these hosts. The

55 vector ordinarily carries a replication site, as well as markingsequences which are capable ofproviding phenotypic selec-

tion in transformed cells. For example, E. coli is t¡pically' transformed using pBR322, a plasmid derived from an E. c ol i

species @olivar, elal., Gene2:95 (1977)). pBR322 contains

oo genes for ampicillin and tetmcycline resistance anl thrrs pro-vides easy means for identiffing transformed cells. The

pBR322 plasmid, or other microbial plasmid m¡st also con-

iain, or bè modited to contain, prrcmoters which can be used

by thb microbial organism for expression of its ownproteins.65 Those promoters most commonly used in recombinant DNA

constuction include the BJactamase (penicillinase) and lac-

tosépromoter systems (Cbang et al,Nature,275: 615 (1978);


us 7,923,221B19

Ifakura, et al, Scíence, 198: 1056 (1977); (Goeddel, et al

Nature 281 544 (1979)) and a tryptophan (trp) promotersystem (Goeddel, et al, Nucleíc Acids Res.,8: 4057 (1980);

EPO Appl Publ No. æ36776). While these are the most

commonly used, other mic¡obial promoters have been dis- s

covered and utilized, and details concerning thet nucleotidesequences have been published enabling a skilled worker toligate them functionally with plasmid vectors (Siebenlist, et

al, Cell 2O:269 (1980).In addition to prokaryates, eukaryotic microbes, such as ro

yeast cultures may also be used. Saccharomyces cerevisiae,or common baker's yeast is the most commonly used among

eukaryotic microorganisms, although a number of othersfains are commonly available. For expressionin Saccharo-myces, ttte plasmid YRp7, for example, (Stinchcomb, et al, ts

Nature, 282: 39 ( I 979) ; Kingsman et al, Gene, 7 : la I (l 979) ;

Tschemper, etal, Gene,10: 157 (1980)) is commonly used.

This plasmid already contains the trp I gene which provides a

selection marker for a mutânt strain of yeâst lacking the

ability to grow in tryptophan, for example AICC No. 44076 zo

or PEP4- 1 (Iones, Genet ics, 85: 12 (1977)). The presence ofthe trpl lesion as a characteristic oftheyeasthost cell genome

then provides an effective environment for detecting transfor-mation by growth in the absence of tryptopban.

Suitable promoting sequences in yeast vectors include the z:promoters for 3-phosphoglycerate kinase (Hitzeman, et a7., J.

Biol. Chem.,255:2073 (1980)) or other glycol¡ic enzymes(Hess, et al,l I dv. EnzymeReg., 7: 149 (1968); Holland, etal,Biochemistry, TT: 49{Jt'_ (1978)), such as enolase, glyceralde'hyde-3-phospbate deþdrogenase, hexokinase, pyruvate 30

decarborylase, phosphofructokinase, glucose-6-phospbateisomerase, 3-phosphoglycerate mutase, pyruvate kinase, tri-osephospbate isomerase, phosphoglucose isomerase, andglucokinase. In constructing suitable expression plasmids,the termination sequences associated with these genes are 35

also ligated into the expression vector 3r of the sequence

desired to be expressed to provide polyadenylation of themRNA and termination. Other promoters, which have theadditional advantage of tmnscription controlled by growthconditions are the promoter regions for alcohol dehydroge- ao

nase 2, isocytochrome C, acid phosphatase, degradativeenzymes associated withnitrogen metabolism, ând the afore-

mentioned glyceraldeþde-3-phosphate deþdrogenase, andenzymes responsible for maltose and galactose utilization(Holland, ibid.). Any plasmid vector containing yeast-com- 4s

patible promoter, origin of replication and terminationsequences is suitable.

In addition to microorganisms, cultures of cells derivedfrom multicellular organisms may also be used as hosts. Inprinciple, any such cell culture is workable, whether from so

vertebrate or invertebrate culhue. However interest has beengreatest in vertebrate cells, and propogation of vertebratecells in culture (tissue culture) has become a routine proce-dure in recent years (Tíssue Cuhure, Academic Press, Kruseand Patterson, editors (l 973)). Examples of such useful host ss

cell lines areVERO and HeLa cells, Chinese hamster ovary(CHO) cell lines, and W138, BHK, COS-7 and MDCK celllines. Expression vectors for such cells ordinarily include (ifnecessary) an origin ofreplication, a promoter located in frontoflhe gene to be expressed, along with any necessary ribo- oo

some binding sites, RNA splice sites, polyadenylation site,

and transcriptional terminator sequences.For use in mammalian cells, the control functions on the

expression vectors are often provided by viral material. Forexample, commonly used promoters are derived from os

polyoma, Adenovirus 2, and most frequently SimianVirus 40(SV40). The early and late promoters of SV40 virus are

10particularly useful because both are obtained easily from the

virus as a fragment which also contains the SV40 viral origin

of replication (Fiers, et al, Nature, 273: 1'13 (l 978)) incorpo-

rated herein by reference. Smaller or larger SV40 frag.ments

may also be used, provided there is included the approxi-mately 250 bp sequence extending from the Hind III site

toward the Bgl I siæ located in the viral origin of replication'Further, it iJ atso possible, and often desi¡able, to utilizepromoter or control sequences normally associated with the

ãesired gene sequence, provided zuch control sequences are

compatible with the host cell systems.

An origin of replication may be provided either by con-

srruction ofthe vector to include an exogenous orieir, such as

may be derived from SV40 or other viral (e'g. Polyoma,Adêno, VSY BPV, etc.) source, or may be provided by the

host cell cb¡omosomal replication mechanism. If the vector is

integrated into the host cell chromosome, the latter is oftensufficient.

Itwill beunderstoodthatthis invention, althougb described

herein in terms of a preferred embodiment, should not be

construed as limited to those host cells, vectors and orpres-

sion systems exemplified.

C. Methods EmPloYed

C.l Transformation

If cells without formidable cell wall barriers a¡e used as

host cells, transfection is carried out by the calciumphosphateprecipitation methodas describedby Grzham andVan derEb,hrologt, 52 546 (1978). However, other methods for into-ducing DNA into cells such as by nuclear injection or byprotoplast fusion may also be used'

Ifprokaryotic cells or ce1ls v¡hich contain substantial cellwal1 èonstructions are used, the preferred method oftransfec'tion is calcium treatment using calcium chloride as described

by Cohen, F. N. et al Proc. Natl. Acad. Scí' (USA),69:2110(te72).

C.2 Vector Construction

Construction of suitable yscls¡s co¡þining the desired

coding and coútrol sequences employ standard ligation tech-

niques. Isolated plasmids or DNA fragments are cleaved,taiióréd, and religated in the form desired to form the plas-

mids required. The methods employed are not dependent on

the DNA source, or intended host.Cleavage is performed by treating with restriction enzyme

(or enyzmes) in suitable buffer. In general, about I pg plasmidor DNA fragments is used with about I unit of enzrlme inabout 20 ¡rl ofbufer solution. (Appropriate buffers and sub-

strate amounts for palticular restriction enzl¡nes a¡e specifiedby the manufacturer.) Incubation times of about I hor¡r at 37o

C. are workable. After incubations, protein is removed by

extractionwithphenol andchloroform, andthenucleic acid is

recovered from the aqueous fraction by precipitation withethanol.

Ifblunt ends are required, the preparation is treated for 15

minutes at 15o with 10 units of E. coli DNA Polymemse I(KJenow), phenol-chlo¡oform extacted, and ethanol precipi-tated.

Size separation of the cleaved fragments is performed

using 6 percent polyacrylamide gel described byGoeddel, D.,et a7, Nucleic Acids Res, 8: 4A57 (1980) incorporated herein

by reference.For ligation, approúmately equimolar amounts of the

desired components, suitably end tailored to provide correct


us 7,923,22r Bl11

matching are treated with about 10 units T4 DNA ligase per

0.5 pg DNA. (When cleaved vectors are used as components,

it may be useful to prevent religation of the cleaved vector bypreûeâtîent with bacterial alkaline phosphatase.)

ln the examples described below correct ligations for plas- s

mid construction are confirmed by transforming E. coli Kl2strain 294 (ATCC 31 446) with the ligation mixture. Success-

fif transformants were selected by ampicillin or tetracyclineresistance depending on the mode of plasmid constr.lction-Plasmids from the traûsforma[ts were then prepared, ana- l0lyzed by restrictionand/or sequencedby the methodof Mess-irrg,etal,NucleícAcids Res.,9:309 (1981) orby the methodof Maxem, et al, Methods in Enzymologt,65:499 (1980).

D. Outline of Procedwes ls

D. 1 lvfammalian Antibodies

The first type of antibody which forms a part of this inven-tion, and is prepared by the methods thereof, is "mammalian zo

antibody"-one wherein the heavy and ligbt cbains mimic the

amino acid sequences ofan antibody otherwise produced bya maûrre mammalian B lymphocyte either in situ or when

fi:sed with an immortalized cell as part of a hybridoma cul-tu¡e. In outline, these antibodies are produced as follows: 25

Messenger RNA coding for heavy or ligbt chain is isolatedf¡om a suitable source, eilher mature B cells or a hybridomaculture, employing stândard techniques of RNA isolation,and the use of oligo-dT cellulose chromatography to segre-gate the poly-A mRNA. The poly-A mRNA may, further, be :ofractionated to obtain sequences ofsufficient size to code forthe amino acid sequences in the ligbt or heavy chain of thedesired antibody as the case may be.

Ä. cDNA library is then prepared f¡om the mixtu¡e ofmRNA using a suitable prime¡ preferably a nucleic acid ¡s

sequencewhich is cbaracteristic ofthe desired cDNA. Such a

prirner may be hypothesized and synthesized based on theemino ¿çid ssq¡ence ofthe antibody ifthe sequence is known.In the altenrative cDNA from unûactionated poly-A mRNAfrom a cell line producing the desired antibody or poly-dT ao

may also be used. The resulting cDNA is optionally size

fractionated on polyacryl¡mide gel and then extended wilh,for example, dC residues for annealing with pBR322 ot othersuitable cloning vector which has been cleaved by a suitablerestriction enzyme, such as Pst I, and extended with dG resi- ¿s

dues. Altemative means of forming çlsning vectors conkin-ing the cDNA using other tails and sths¡ çlsnìng vectorremainder may, of cou.rse, also be used but the foregoing is a

standard and preferable choice. A suitable host cell strain,typically E. coli, is tansformed with the annealed cloning so

vectors, and the successful transformants identified by means

of, for example, tetracycline resistance or other phenotypiccharacteristic residing on the cloning vector plasmid.

Successfr¡I üansformants are picked and transfered tomicrotiter dishes or other suppof for further growth and ss

preservation. Nitrocellulose filter imprints of these growingcultu¡es are then probed with suiable nucleotide sequences

containing bases known to be complementary to desi¡edsequences in the cDNA. Several types ofprobe may be used,

preferably synthetic single sftanded DNA sequences labeled oo

by kinasing withATP3'. The cells fixed to the nitrocellulosefiller are lysed, the DNA denatured, and then fixed beforereaction with kinased probe. Clones which successfullyhybridize a¡e detected by contact with a photoplate, thenplasmids from the growing colonies isolated and sequenced os

by means known in the art to veriff that the desired portionsofthe gene are present.

t2The desired gene fragments a¡e excised and tailored to

assure ãppropriate reading frame with the control segnents

when inserted into suitable expressiotr vectors. Typically,nucleotides are added to the 5' end to include a start signal and

a suitably positioned restriction endonuclease siÛe.

The tailored gene sequence is then positioned in a vector

whichcontains a promoter inreading frame with the gene and

compatible with the proposed host cell. A number ofplasmidssuch as those described in U.S. Pat. Nos. 307,473;291,892;and315,657,have been described which already contain the

appropriate promoters, control sequences, ribosome bindingsitès, and transcription termination sites, as well as conve-nient markers.

In the present invention, the gene coding for the light chain

and that coding for the heavy chain are recovered separately

by the procedures outlined âbove. Thus they may be insertedinto separate expression plasmids, or logether in the same

plasmi{ so long as each is under suitable promoter and tans-latisn control.

The expression vectors constructed above are then used totransform suitable cells. The light and heavy chains may be

transformed into separate cell cultures, either of the sâne orofdiffering species; separate plasmids for light and heavychain may be used to co-transform a single cell culture, or,

finalIy, a single expression plasmid containing both genes and

capable ofexpressing the genes for both light and heavy chain

may be transformed into a single cell culture.Regardless ofwhich ofthe three foregoing options is cho-

sen, the cells a¡e grown under conditions appropriate to theproduction ofthe desired protein. Such conditions are prima-rily mandated by the type of promoter and contol systems

used in the expression vector, rather rhan by the nature ofthedesired protein. The protein thus produced is then recovered

from the cell culture by methods known in the art, but choice

of which is necessarily dependent on the form in which theprotein is expressed. For example, it is common for matu¡e

heterologous proteins expressed n E. coli to be depositedwithin the cells as insoluble particles which require cell lysisand solubilization in denaturant to permit recovery. On the

other band, proteins under proper synthesis circumstances' inyeast and bacterial strains, can be secreted into the medium(yeast and gram positive bacteria) or into the periplasmicspace (gram negative bacteria) allowing recovery by less

drasticprocedures. Tissue culture cells as hosts also appear, ingeneial, to permit reasonably facile recovery ofheterologousproteihs.

When heavy and light chain are coexpressed in the same

host, the isolation procedure is designed so as to recover

reconstituted antibody. This can be accomplished in vitro as

described below, or migþt be possible in vivo in a microor-ganism which secretes the IgG chains out ofthe reducingenvironment of the cytoplasm. A more detailed description is

given in D.2, below.

D.2 Chain Recombination Techniques

The ability ofthe methodofthe inventionto produceheavy

and light chains or portions thereof, in isolation û'om each

other offers the opportunity to obtain unique and unprec-

edented assemblies of immunoglobulins, Fab regions, and

univalent antibodies. Such preparations require the use of1sçhniques to reassemble isolated cbains. Such meäìs are

known in the art, and it is, tlus, appropriate to review them

here.While single chain disulfide bond çs¡taining proteins have

been reduced and reoxidizedto regenerate inhigh yieldnativestuctu¡e and activity (Freedman, R. 8., et a7. ln Enzymologt


us 7,923,22r B1

13of Post Translational Modífication of Proteins, l: 157'212(1980) Academic Press, NY.), proteins which consist of dis-

continuous polypeptide cbains held together by disulfidebonds are more difrcult to reconstuct in vitro after reductive

cleavage. Insulin, a c¿üreo case, has received much experi- 5

mental attention over the years, and can now be reconstructed

so efrciently that an industrial process has been built aroundit (Chance, R. E., et a1., \n Peptides: Proceedings of the

Seventh Annual American Peptide Symposium (Rich, D. H'andGross,8., e ds.)721-72S,Pierce óhemical Co., Rockford, i0

ilr. (le8r)).Inrmunoglobulin has proved a more difrcult problem than

insulin. The tetramer is stabilized intra and intermolecularlyb¡ 15 or more disulfide bonds. It has been possible to recom- r,bine heary and light cbains, disrupted by cleavage ofonly the

interchain disulfides, to regain antibody activity even withoutresloration of the inter-chain disulfides (Edelma4 G. M., et

al,Proc. Natl. Àcad. Sci.(USA) 50: 753 (1963)). lnaddition,active fragments of IgG fonned by proteolysis (Fab frag- zo

ments of -50,000 l\,fW) can be split into their fully reduced

heavy chain and light chain components and fairly efficientlyreconstructed to give active antibody (Haber,E., Proc. Natl.

Acad. S ci. (U SA) 52: I 099 (1 964) ; Whit ney, P. L., eT al., P ro c.

Natl. Acad. Sci. (USA) 53: 524 ( I 965). Attempts to reconsti- 25

tute active antibody from fully reduced nåtive IgG have been

largely unsuccessful, presumably due to insolubility of thereduced chains and ofside products or intermediates in therefolding pathway (see discussion in Freedman, M. H., et a1.,

J. Biol. Chem. 241 5225 (1966)). If, howwe¡ the immuno- 30

globulin is randomly modified by polyalanylation of itslysines before complete reduction, the separated chai¡s havethe ability to recover antigen-conþining activity upon reoxi-dation (ibid).

A particularly suitable method for immunoglobulin recon- 35

stitution is derivable from the now classical insulin recombi-nation studies, wherein starting material was prepared byoxid¿tive zulfitolysis, thus generating thiol-labile S-sulfonategroups at all cysteines in the protein, non-reductively break-ing disulfides (Chance et al. (supra)). Oxidative sulfitolysis is ao

a mild disulfide cleavage reaction (Means, G. E., et a1.,

Chemical Modifcation of Proteins, Holden-Day, San Fran-cisco (1971)) which is sometimes more gentle than reduction(Wetzel, R., Bio chemistry,stbmitteÅ(l 983)), andwhich gen-erates derivatives which are stable until exposed to mild as

reducing agent at which time disulfide refomation can occurvia thiol-disulfide interchange (Morehead, H., etal . Bíochem-rsfr7, in pre,ss, (1983). In the present invention the heavy andlight chain S-sulfonates generated by oxidative sulfitolysiswere reconstituted utilizing both air oúdation and tliol-dis- s0

ulfide interchange to drive disulfide bond fonnation. Thegeneral procedure is set forth in detail in U.S. Pat. No. 452,187, filed Dæ,. 22, 1982, incorporated herein by reference.

D.3 Variants Permitted by Recombinant Tecbnology 55

Using the tecbniques described in paragrapbs D.1 andD.2,additional operations which were utilized to gain efficientproduction of mammalian antibody can be varied in quitestaigbtforward ¿trd simple ways to produce a great variety of 60

modiflcations of this basic antibody form. These variationsare inherent in the use of recombinant tecbnology, whichpermits modification at a genetic level of amino acidsequences in normally encountered mammalian immunoglo-bulin chains, and the great power ofthis approach lies in its os

ability to achieve thesevariations, as well as in its potential foreconomic and specific productionofdesired scarce, and often

t4contaminated, molecules. The va¡iations also inhere in the

ability to isolate production of individual chains, and thus

creáte novel assemblies.

Briefly, since genetic manipulations permit reconstruction

of genomic material in the process of constructionof expres-

sionvectors, such reconstruction can be manipulated to pro-

duce new ç6ding sequences for the components of"natual"antibodies or immunoglobulins. As discussed in further detail

belo¡¡¡, the coding sequence for a mammalian heavy chain

may not be derived entirely fiom a single source or single

species, but portions of a sequence can be recovered by the

techniques described in D.1 from differing pools of mRNA,such as mwine-murine hybridomas, human'murine hybrido'mas, or B cells differentiatedinresponseto a series ofantigencballenges. The desired portions ofthe sequences in each case

can be recovered using the probe and analysis lschniques

described in D.1, and recombined in an expression vectorusing the same ligation procedures as would be employed forportions of the same model sequence. Such chimeric chains

can be constructed ofany desired length; hence, for example,

a complete heavy chain can be constructed, or only sequence

for the Fab region thereof.The additional area of flexibilþ which arises from the use

ofrecombinant techniques results from the power to produce

heavy and light chains or fragments thereof in sqrarate cul-tures or ofunique combinations ofheavy and light chain inthe same culture, and to prevent reconstitution ofthe antibody

or immunoglobulin aggreg¿tion until the suitable compo-

nents are assembled. Thus, while normal antibody production

results automatically in the formation of "mammalian anti-bodies" because the light and heavy chain portions are con-

structed in response to a particular determinant in the same

cell, the methods ofthe present invention present the oppor:tunity to assemble entirely new mixtures. Somewhat limitedquantities of "hybrid" antibodies have been produced by

"quadromas" i.e., füsions of two hybridoma cell cultu¡es

which permit random assemblies of the heavy and lightcbains so produced.

The present invention permits a more controlled assembly

of desired chains, eitherby miúng the desiredchains invitro,or by transforming the same culture with the coding

sequences for the desired chains.

D.4 Composite Immunoglobulins

The foregoing procedure, which describes in detail therecombinant production of mammalian antibodies isemployed with some modifications to construct the remain-ing lypes of antibodies or NSIs encompassed by the presentinvention. To prepare the particular embodiment of compos-ite non-specific immunoglobulin wherein the homology ofthe'chäins corresponds to the sequs¡çs5 sf immnnoglobulinsof different specificities, it is of course, only necessary topreþare the heavy and light chains in sepamte cultures and

reassemble them as desired.For o<ample, in order tp make an anti4EA light chain/

anti-he.patitis heavy chain composite antibody, a suitablesource for the mRNA used as a template for the light chainclone would comprise, for instance, the anti CEA producing

cell line ofparagraph 8.1 . The mRNA corresponding to heavychain would be derived from B cells raised in response tohepatitis infection or from hybridoma in which the B cell was

of this origin. It is clear that such composites can be

assembled using the methods of the invention almost at will,and are limited onty by available sources of mRNA suitable


us 7,923,221Bl15

for use as templates for the respective chains. All other fea-

tures of the process are similar to those described above.

D.5 HybridAntibodies s

Hybrid antibodies are paficularly useful as they are

capable of simultaneous reaction with more than one antigen'

Pairs ofheavy and ligþt chains corresponding to chai¡s ofantibodies for diferent antigens, such as those set fofh inparagraph D.4 are pr"put"d in four se,parate cultures, thus 10

preventing premature assembly of the tetramer. Subsequent

miúng of the four separately prepared peptides then permits

assembly into the desired tetramers. While random aggrega-

tion may lead to the formation of considerable undesiredproducti that portion of the product in which homologous ls

light and heavy chains are bound to each other and mis-matched to another pair gives the desired hybrid antibody.

D.6 Chimeric Antibodies 20

For construction of chimeric antibodies (wherein, forexample, the variable sequences are separately derived fromthe constant sequences) tle procedures ofparagraph D.1 andD.2 are again applicablewifh appropriate additions andmodi-fications-A preferred procedure is to recover desired portions 2s

ofthe genes encoding for parts ofthe heavy and light chains

from suitable, differing, sources and then to religate these

fragments using restriction endonucleases to reconstruct thegene coding for each chain.-

For example, in a particularly preferred chimeric construc- 30

tion, portions ofthe heavy cbain gene and ofthe light chaingene which encode the variable sequences ofantibodies pro-duced by a murine hybridoma culture are recovered andcloned from this culture and gene frafents encoding the

constatrt regions of the heavy and light chains for human 35

antibodies recovered and cloned from, for example, humanmyeloma cells. Suitable restriction enzymes may then be

used to ligate the variable portions of the mouse gene to the

constant regions ofthe human gene for each ofthe two chains 'The chimeric chains are produced as set forth in D.1, aggre- 40

gated as set forth in D.2 and used in the same manner as the

non-chimeric forms. Of course, any splice point in the chainscan be chosen.

D.7 Altered Antbodies 4s

Altered antibodies present, in essence, an extension ofchimeric ones. Again, the techniques of D.l and D.2 ate

applicable; however, rather than splicing portions of thecbain(s), suitable amino acid alterations, deletions or addi- s0

tions a¡e made using available techniques such as mutagen-esis (supra). For example, genes which encode antibodiestraving diminished complement fixation properties, or whichhave enhanced metal binding capacities are prepared using

such techniques. The latter type may, for example, take s5

advantage ofthe known gene sequence encoding metalothio-nein II (Karin, M., et al., Nature, 299l.797 (1982)). The

chelating properties of this molecular fragment are useful incarrying heavy metals to tumor sites as an aid intumor imag-ing(Scheinberg, D.4., eta1., Science,2l5:19 (1982). 60

D. 8 Univalent Antibodies

ln another preferred embodiment, antibodies are formedwhich comprise one heavy and ligbt chain pair coupled with os

the Fc region ofa third (heavy) chain. These antibodies have

a particularly usefif property. They can, like ordinary anti-

t6bodies, be used to target antigenic swfaces oftissues, such as

tumo-rs, but, u¡like ordinary antibodies, they do not cause the

anligenic surfaces ofthe target tissue to retreat a$d become

non-receptive. Ordinary antibody use results in aggregation

an{:gubsequent inactivation, for several hours, ofsuch surface

antigens.The method of construction ofunivalent antibodies is a

staightforward application ofthe invention. The gene forheaw cbain of the desired Fc region is cleaved by restiction

"o"y*o, and only that portion coding for the desired Fc

r"gion "*ptess"d.

This portion is then bound using the tech-

ni[ue ofD.2 to separately produced heavy chain the desired

pairs separated from heavylheavy and Fc/Fc combinations,

and separately produced light chain added. Pre-binding ofthetwo héavy chain portions thus diminishes the probability offormation of ordinarY antibodY.

D.9 Fab Protein

Similarly, it is not necessary to include the entire gene forthe heavy chain pofion. All of the aforementioned va¡iations

can be zuperimposed on a procedure for Fab protein produc'

tion and the overall procedure differs only in that that portionof the heavy chain coding for the ¡mino terminal 22O amircacids is employed in the appropriate expression vector.

E. Specific Examples of Preferred Embodiments

The invention has been described above in general terms

and there follow several specific examples of embodiments

which set forth details of experimental procedure in produc-

ing the desired antibodies. Example E.l sets forth the general

procedure for preparing anti CEA antibody components, i'e'io. u "-u-mulian antibody". Example 8.3 sets forth the

procgdwe for reconstitution and thus is applicable to pr€'pa-

ration of mammalian, composite, hybrid and chimeric immu-noglobulins, and Fab proteins and univalent antibodies.

ex-ampte U.+ sets forth the procedure for tailoring the heavy

or light chain so tbat the variable and constant regions may be

derived from different sources. g¡amFle E.5 sets forth the

method of obtaining a shortened heavy chain genome whichpermits the production ofthe Fab regions and, in an analogous

mamer, Fc region.The examples set forth below are included for illushative

purposes and do not limit the scope of the invention.- 8.1 Const-"tion of Expression Vectors for Murine Anti-

CEAAntibody Chains and Peptide Synthesis

Carcinoembryonic antigen (CEA) is associated with the

surface of certain tumor cells of human origin (Gold, P., et al.,

J. Exp. Med., 122: 467 (1965). Antibodies which bind to

CEA (anti{EA antibodies) a¡e usefr¡l in early detection ofthese tumors (Van Nagell, T. R., et al-, Cancer Res. 4O: 502

(19S0), and have the potential for use in treatment ofthosehumantumors which appearto support CEAattheir surfaces'

A mouse hybridoma cell line which secretes anti-CEA anti'bodies of the lgy, class, CEA.66'83, has been prepared as

described by rffagene¡ C, ef al., J. Imrnunol. (in press) whichis incorporated herein by reference, and was used as nRNAsource. The production of anti CEA antibodies by this cell

linè was determined. The N-terminal sequences of the anti-

bodies produced by these cells was compared with those ofmonoðlonal anti CEA as follows. Purified IgG was treatedwith PCAse (Podell, D. N., et al., BBRC 8 I : 176 (1 978)), and

then dissociated in 6M guanidine hydrocbloride, l0 mM2-mercaptoethanol (1.0 mg of immunoglobulin, 5 min, 10Oo

C. water bath). The dissociated chains were separated on a

Watêrs Associates aþl phenyl column using a linear gradi-


us 7,923,221Blt7

ent from 100 percentA (0.1 percent TFA-water) to 90 percent

B (TFAÆIrOA{eCN 0.1/9.9/90) at a flow rate of 0'8 mVmin'

Three majorpeaks were eluted ¿¡d analyzed on SOS gels bysilver staining. The fust two peaks werepure light cbain (MW25,000 daltons), the third peak showed a (7:3) mixture of s

heavy and ligbt cbain. 1.2 nmoles of light chain were

sequenced by the method of Shively, J. 8., Methods in En4t-mologt,79: 3l (1981), with an NHr-terminal yield of 0.4

nmoles. A nixtu¡e of heavy and ligþt chains (3 .moles) was

also sequenced, and sequénce oflignt chain was deducted 10

from the double sequence to yield the sequence ofthe heavy

chain.ln the description which follows, isolation and expression

of the genes for the heavy and light chains for anti CEA t,antibody produced by CEA.66-E3 are described. As the con-

stant røons of these chains belong to the gamma and kappa

families, respectively, "light chain" and "kappa chain", and

"heavy chain" and "p,amma chain", respectivd are used

interchangeablybelow. 20

E.1.1 Isolation of Messenger RNA forAnti CEA Light and

Heavy (Kappa and Gamma) Chains'Iotal RNA fmm CEA.66-E3 cells was extracted essen-

tially as reported by Lynch et a7, Virologt, 98:251 (1979)-

Cells were pelleted by centrifugation and approximately I g zs

portions of pellet resuspended in 10 ml of 10 mM NaCl, l0mMTris HCI þH 7.4), 1.5 mM MgClr. Theresuspendedcellswere lysedby additionofnon-ionic detergentNP-40to a fimlconcenffation of I percent, and nuclei removed by centrifu-gation. After addition of SDS (pH 7.4) to I percent final so

concentration, the superrlatant r¡/as extracted twice with 3 mlportions of phenol (redistilled/chloroform:isoamyl alcohol25:1 at 4o C. The aqueous phase was made 0.2 M inNaCl andtotal RNA was precipitatedby additionoftwo volumes of 1 00percenl ethanol and overnigbt storage at -20" C. After cen- 35

trifugation, polyA nRNA was purified from total RNA byoligodT cellulose chromatography as described by Aviv and

Leder, Proc. Nat' l. Acad. Sci. (USA), 69: l4OB (1972). 1'42 1t4of polyA nRNA was obtained from 1 g cells.

E.1.2 Preparation of E coli Colony Library Containing ao

Plasmids with Heavy and Light DNA Sequence Inserts5 pg of the unûactionated polyA nRNA prepared in pa¡a-

graph E.l.l was usedas template foroligodT primed prepa-

ration ofdouble-stranded (ds) cDNA by sandard proceduresas described by Goeddet et al., Nature 281: 544 (1979) and as

Wickens et al., J. Biol. Chem.253:2483 (1978) incorporatedherein by reference. The cDNA was size fractionated by 6

percent polyacrylamide gel electrophoresis and 124 ng ofdscDNA greater than 600 base pairs in length was recovered byelectroelution. A 20 ng pofion of ds cDNA was extended s0

with deory C residues using terminal deorynucleotidyl trans-ferase as described in Chang et al., Nature 275: 617 (1978)incorporated herein by reference, and annealedwith 200 ng oftheplasmidpBR322 (Bolivaret aL., Gene 2: 95 (1977)) whichhad been cleaved with Pst I and tailed with deoxy G. Each ss

a¡nealedmixturewas thentransformedintoE coliKl2 st¡un'294 (ATCC No. 3144Q. Approximately 8500 ampicillin sen-

sitive, tetracycline resistant üansformants were obtained.E. 1.3 Preparation of Synthetic Probes

The 14mer, 5' GGTGGGAAGATGGA 3' complementary 60

to the coding sequence of constant region for mouse

MOPC21 kappa chain which begins 25 basepain 3' of thevariable region DNA sequence was used as kappa chainprobe. A 15 mer, 5' GACCAGGCATCCCAG 3', complemen-tary to a coding sequence located 72 basepairs 3' of the os

variable region DNA sequence for mouse MOPC2I gammachain was used to prrcbe gamma chain gene.

18Both probes were synthesized by the phoqphotriester

method described in German Offenlegungschrift 2644432'incorporated herein by reference, and made radioactive bykinasing as follows: 250 ng of deoxyoligonucleotide were

combinèd in 25 ¡rl of 60 mM füs HCI (pH 8), l0 mM MgClr'15 mMbeta-mercaptoethanol, and l0Opci (T-3ÐATP (Am-ersharir, 5000 CilmMole). 5 units of T4 polynucleotide kinase

were added and the reaction was allowed to proceed at 37'C.forÌ30 minutes and terminated by addition of EDTA to 20

mM.E.I.4 Screening of Colony Lib¡ary for Kappa or Gamma

Chain Sequences

-2000 colonies prepared as described in paragnph E.I.2were individually inoculated into wells of microtiÚe dishes

containing LB (Mille¡ Experiments in Molecular Genetics,p. 431-3, Cold Spring Harbor [ab., Cold Spring Ha¡bor' N.Y.(1972))+5 Vglnltetracycline and stored at -20o C. after addi-

tion of DMSO to 7 percent. Individual colonies from thislibrary were transferred to duplicate sets of Schleicher and

Schuell BA85/20 nitrocellulose filters and grown on agarplates containing LB+5 ¡rglmJ tetacycline. After -10 hoursgrowth at 37o C. the colony filters were transferred to agarplates containing LB+5 ¡.rglml tetracycline and 12.5 ¡$mlðhloramphenicol and reincubated overnight at 37o C. The

DNA f¡om each colony was then denatured and fixed to the

filter by a modification of the Grunstein-Hopess procedure

as described in Grunstein et al., Proc. Natl. Acad. Sci. (USA)

72: 39 61 (l 975), incorporafed herein by reference. Each tlterwas fl oated for 3 minutes on 0.5 N NaOH, l. 5 M NaCl to lysethe colonies and denature the DNA then neutmlized by floaÞ

ing for 1 5 minutes on 3 M NaCl, 0.5 M Tris HCI (pH 7.5). The

filters were then floated for an additional 15 minutes on

ZxSSC, and subsequentþ baked for 2 hours in an 80o C.

vacuum oven. The filters were preþbridized for -2 hou¡s at

room temperature in 0.9 M NaCl, l xDenhardts, 100 mM TrisHCi (þH 7.5), 5 mM Na-EDTA, I mM AIP, I M sodiumphosphate (dibasic), 1 mM sodium pyrophosphate,0.5 per-

èent NP-40, aúZOO ¡tg/tl E coli t-RNA, and hybridized inthe same solution ovemight, essentially as described by Wal-lace et al. Nucleíc Acíds Research 9: 879 (1981) using -40x106 cpm of either the kinased kappa or gamma prcbe

described above.After extensive washing at37o C. in 6xSSC, 0.1 percent

SDS, the filters were exposedto KodakXR-5 X-ray film withDuPont Lightning-Plus intensiffing screens for 16-24 hours

at -80o C. Approximately 20 colonies which bybridized withkappa chain probe and 20 which hybridized with gamma

chain probe were chancterized.E.1.5 Characterizatton of Colonies which Hybridize to

Kappa DNA Sequence ProbePlasmid DNAs isolated f¡om several different transfor-

mants which hybridized to kappa chain probe were cleaved\¡/ith Pst I and fractionated by polyacrylamide gel electro-phoresis (PAGE). This analysis demonstrated that a numberof plasmid DNAs contained cDNA inserts large enough toencode fuIl length kappa chain. The complete nucleotide

sequence of the cDNA insert of one of these plasmids was

determined by the dideorynucleotide chain terminationmethod as described by Smith, Methods En4tmol. 65, 560

(1980) incorporated herein by reference after subcloningrestiction endonuclease cleavage fiagments into Ml3 vec-

tors (Messing et al., Nucleic Acîds Research 9: 309 (1981)'

FIG. 2 shows the nucleotide sequence of the cDNA insert ofpfiZC+ ana flG.3 shows the gene sequence withthe corre'sponding amino acid sequence. Thus, the entire coditrg regionofmouse anti-CEA kappa chainwas isolatedonthis one large

DNA fragment. The amino acid sequence of kappa chain,


us 7,923,22r Bl19

deduced from the nucleotide sequence ofthe pK 1 7G4 cDNAinsert, coresponds perfectly with the first 23 N-terminalamino acids of mature mouse anti-CEA kappa chzin as deter-mined by amino acid sequence analysis of purified mouseanti-CEA kappa chain. The coding region of pK17G4 con- s

tains 27 basepairs or 9 amino acids of the presequence and642 basepairs or 214 amino acids of the mature protein. Themature unqlycosylated protein (IvfW 24,553) has a va¡iableregion of I 19 ¡mino acids, including the Jl joining region of12 amino acids, and a constant region of 107 amino acids. to

Affer the stop codon behind amino acid 215 begins 2 I 2 base-pairs of 3' untranslated sequence up to the polyA addition.Thekappa chainprobeusedto identify pKl7G4 hybridizes tonucleotides 37 4 -388 (FIG. 2).

E.1.6 Characterizalion of Colonies which Hybridize to rs

Gamma 1 DNA ProbePlasmid DNÀ isolated from several transformants positive

for hybridization with the heavy chain gamma I probe was

subjected to Pst I restriction endonuclease analysis as

described in 8.1.5. plasmid DNAs demonstrating the largest 20

cDNA insert fragments were selected for frrther study.

Nucleotide sequence coding for mouse heavy (gamma-l)chain, shows an NcoI restriction endonuclease cleavage sitenear the junction between variable and constant region.Selected plasmid DNAs were digested with both PstI and zs

NcoI and sized on polyacrylamide. This analysis allowedidentifi cation of a numberof plasmid DNAs that contain NcoIrestiction endonuclease sites, although none that demon-strate cDNA insert fragments large enough to encode theentire coding region of mouse anti-CEA heavy chain. 30

ln one plasmid isolated, p 1298 the cDNA insert of about1 300 bp contains sequence information for the 5' untranslatedregion, the sip.al sequence and the N-terminal portion ofheavy chain. Because p1298 did not encode the C-terminalsequence for mouse anti-CEA gamma 1 chain, plasmid DNA ¡swas isolated from other colonies and screened with PstI andNcoI. The C-terminal region of the cDNA insert of py11 wassequenced and shown to contain the stop codon, 3' untrans-lated sequence and that portion ofthe coding sequence miss-ing from p 1298. 40

FIG. 4 presents the entire nucleotide sequence ofmouseanti-CEA heavy chain (as determined by the dideoxynucle-otide cbaintermination method of Smith, Methods Enzymol.,65: 560 (1980) and FIG. 5 includes the translated sequence.

The amino acid sequence of gamma I (heavy chain) as

deduced from the nucleotide sequence of the py298 cDNAinsef corresponds perfectly to the fi¡st 23 N-terminal aminoacids of mature mouse anti-CEA gamma I chain as deter-mined by amino acid sequence analysis of purified mouseanti-CEA gamma-l chain. The coding region consists of 57 so

basepairs or 19 amino acids ofpresequences and 1346 base-pairs or 447 amino acids ofmature protein. The mature ung-lycosolatedprotein (MW 52,258) has a variable region of 135amino ¿çids, i¡çluding a D region of 12 amino acids, and a J4joining region of 13 amino acids. The constant region is 324 ss

amino acids. After the stop codon behind amino acid 447begins 96 bp of3'untianslated sequences up to the polyAaddition. The probe used to identiff py298 and py I I hybrid-ized to nucleotidæ 528-542 (FIG. 4).

E.l .7 Construction of a Plasmid for Di¡ect Expression of oo

Mouse Mature Anti-CEA Kappa Chain Gene, pKCE-Atrp207-1*

FIG. 6 illustrates the construction of pKCEAtrp2OT-l*First, an intermediate plasmid pHGH207-1*, having a

single trp promoter, was prepared as follows: 6s

The plasmid pHGH 2O7 (described in U.S. Pat. No. 307,473, filed Oct. 1, 1981) has a double lac promoterfollowedby

20thetrp promoter, flanked by EcoR I sites and was used toprepare pHGH207- l. pHGH207 was digested with BamH I ,

followed by partial digestion with EcoR I. The largest frag-ment, whichcontains theenti¡e trp promoter, was isolatedand

ligatedto the largest EcoR I-BamH I fragmentfrompBR322,and the ligation mixture used to transform E coti 294.Te{AmpR colonies were isolated" and most of them containedpHGH207-1. pHGH207-1* which lacks the EcoRl site

between the amp¡ gene and the trp promote! lvas obtained bypartial digestion of pHGH207-1 with EcoR I, filling in the

ends with Klenow and dNTPs, and religation.5 pg of pHGH207-l* was digested with EcoRI, and the

ends;extended to blunt ends using 12 units of DIrIA Poly-mer¿se I in a 50 ¡rl reaction containing 60 mM NaCl, 7 mMMgÇ12,7 mM Tris HCI (pH 7.4) aú I mM in each dNTP at

37oCi for t hour, followedby extractionwithphenoVCHCl,and'precipitation with ethanol. The precipitated DNA was

digèsted with BamH I, and the large vector fragment (frag-ment I ) purified using 5 percent polyacrylamide gel electro-phoresis, electoelution, phenol/CHCl, extraction and etha-

nol precipitation.The DNA was resuspended in 50 ¡rl of 10 mM Tris pH 8, I

mM EDTA and treated with 500 units Bacterial AlkalinePhosphaøse (BAP) for 30' at 65o followed by phenoVCHCl,

ext¡action and ethanol precipitation.A DNA fragment containing part of the light chain

sequence waspreparedas follows: 7 pg ofpKlTG4 DNAwasdigested with Pst I and the kappa chain containing cDNAinsert was isolated by 6 percent gel electrophoresis, and elec-

troelution After phenol/CHCl, extraction, ethanol precipita-

tion and resuspension in water, this fragment was digested

with Ava II. The 333 bp Pst I-Ava II DNA fragment was

isolated and purified from a 6 percent polyacrylamide gel.

A I 5 nucleotide DNÀ primer was synthesized by the phos-

photriester method G. O.2,644,432 (supra) and has the fot-lowing sequence:

Met ÀEP lle Val Met5' ATG GAC ATT GTT ÀTG 3I

The 5' methionine serves as the initiation codon. 500 ng ofthis,prjmer was phosphorylated at the 5'end with l0 units T4¡¡¡4 kin¡se in 20 pl ¡s¿çfis¡ sssl¿ining 0.5 mMAIP. -200ng ofthe Pst I-Ava lI DNAfragmentwas mixedwiththe 20plof the phosphorylated primer, heated to 95o C. for 3 minutesand quick ûozen in a dry-ice ethanol bath. The denaturedDNA solution was made 6O mM NaCl, 7 mM MgClr, 7 mMTris HCt G'H 7 .4), 12 mM in each dNTP and 12 uoits DNAPolymerase l-[,arge Fmement was added. After 2 hours incu-bationat 37o C. this primerrepairreactionwas phenoVCHCl,extracted, ethanol precipitated and digested to completionwith Sau 34. The reaction mixture was then elecûophoresedon a 6 percent polyacrylamide gel and -50 ng of the 182

basepair amino-terminal bluot-endto Sau 3A fragment (frag-ment 2) was obtained after electroelution.

1 00 ng of ûagment I (supra) and 50 ng of fragment 2 werecombined in 20 pl of 20 mM Tris HCI (pH 7.5), 10 mMMgClr, 10 mM DTT, 2.5 mM AfP and I unit of 14 DNAligase. Ater ovemight ligation al 14" C. the reaction was

transformed into E. coliKT2 stain 294. Restriction endonu-clease digestion ofplasmid DNA Aom a number ofampicillinresistant transformants indicated the proper construction andDNA sequence analysis proved the desired nucleotidesequence through the initiation codon ofthis new plasmid,pKCEAIntl (FIG.6).


us 7,923,22t812t

The remainder of the coding sequence of the kappa lightchain gene was prepared as follows:

The Pst I cDNAinsert fragment from7 pgofK17G4 DNAwas partially digested withAva II and theAva II cohesive endswere extended to blunt ends in a DNA Polymerase I large s

fragment reaction. Following 6 percent polyacrylamide gelelectrophoresis the 686 basepair Pst I to blunt endedAva IIDNA fragnent was isolated" purified and subjected to Hpa IIrestriction endonuclease digestion. Tt.e 497 basepair Hpa IIto blunt endedAva II DNA fragment (fragment 3) was iso- to

lated and purified after gel elechophoresis.10 ¡rg of pKCEAIntl DNA was digested with Àva I,

extended with DNA polymerase I large fragment, anddigestedwittr Xba I. Both the large blunt endedAva I to XbaI vector fraement and the small blunt ended Ava I to Xba I lsfragment were isolated and purified from a 6 percent poly-acrylamide gel after electrophoresis. The large vector frag-ment (fiagment 4) was treated with Bacterial Alkaline Phos-phatase (BAP), and the small fraqment was digested with HpaII, electophoresed on a 6 percent polyacrylamide and the 1 69 20

basepair Xba I-Hpa II DNA fragment (fragment 5) was puri-fred. -75 ng offragment 4, -50 ng offragment 3 and-50 ngoffragment 5 were combined in a T4 DNA ligase reaction andincubated ovemight at 14o, and the reaction mixture trans-formed into E. coli K12 stain 294. Plasmid DNA from six zs

ampicillin resistant transformants were analyzed by restric-tion endonuclease digestion. One plasmid DNA demon-strated the proper construction and was designatedpKCEAlnt2.

Final consruction was effected by ligating the K-CEA ¡o

fragment, including the trp promoter from pKCEAInt2 intopBR322(XAP). (pBR322(XAP) is prepared as described inU.S. Pat. No.452,227, filed Dec. 22,1982.)

The K-CEA fragment was prepared by treatingpKCEAInt2 withAva I, blunt ending with DNA polymerase I :s(Klenow fragment) in the presence of DNTPs, digestion withPst I and isolation ofthe desired fragment by ge1 electro-phoresis and electroelution.

The large vector fraement fiom pBR322ÇKAP) was pre-pared by successive treatment with EcoR I, blunt ending with +o

polymerase, and redigestion with Pst I, followed by isolationofthe large vector fragnent by electophoresis and electro-elution.

The K-CEA and large vector fragments as prepared in thepreceding paragraphs were ligated with T4 DNA ligase, and lsthe ligation mixn¡re ûansformed into E. coli as above. Plas-mid DNA from several ampicillin resistant transformantswere selected ¡e¡ analysis, and one plasmid DNA demon-strated the proper construction, and was designated pKCE-Atrp207-I*. so

E.1.8 Construction of a Plasmid Vector for Direct Expres-sion of Mouse Mature Anti-CEA Heavy (Gamma l) ChainGene, p1CEAtrp207-1*

ftC. Z illustrates the construction of pyCEAtrp2OT-7*.This plasmid was constructed in two parts beginning with ss

consfuction of the C-terminal region of the gamma I gene.

5 ¡rg of plasmid pHGH207-1* was digested with Ava I,exfended to blunt ends with DNA polymerase I large frag-ment (Klenow fragment), exbractedwith phenoVCHClr, andethanol precipitated. The DNA was digested with BamH I oo

fteåted with BAP and the large fragment (fragment A) waspurified by 6 percent polyacrylamide gel electrophoresis andelectroelution.

-5 ¡rg ofpyl I was digested with Pst I and the gemm¿ çþ¿i¡cDNA insert fragment containing the C-lerminal portion of os

the gene was purified, digested with Ava II followedby exten-sionoftheAva II cohesiveends withKlenow, followedby Taq

22I digestion. The 375 basepair blunt ended Ava II to Taq Ifragment (fragment B) was isolated and purified by gel elec-

tophoresis and electroelution.9 pg of py298 was digested with Taq I and BamH I for

isolation of the 496 basepair fragment (fragment C).Approximately equimolar amounts of fragments A, B, and

C were ligated ovemight at 14' in 20 ¡rl reaction mixhre, thentransformed into E. coli strain 294. The plasmid DNA fromsix ampicillin resistant transformants was committed torestriction endonuclease analysis and one plasmid DNA,named pyCEAlnt, demonstrated the corect constn¡ction ofthe C-terminal portion of gamma I (FIG. 5).

To obtåin the N-terminal sequences, 30 pg of py298 was

digested with Pst I and the 628 basepair DNA fragmentencoding the N-terminal region of mouse a¡tiCEA gaürma

chain was isolated and puriûed. This fragment was fu¡therdigested with Alu I and Rsa I for isolation of the 280 basepairfragment. A 15 nucleotide DNA primer

t' ffiå :il crc Àrc crc 3'

was synthesized by the phosphotriester method (supra).

The 5'methionine serves as the initiationcodon. 500 ng ofthis synthetic oligomer primer was phosphorylated at the 5'

end in a reaction with 10 units T4 DNA kinase containing 0.5

mM ATP in 20 pl reaction mixn:¡e. -500 ng of the 280basepair Alu I-Rsa I DNA fragment was m.ixed with thephosphorylaûed primer. The mixture was heat denatu¡ed for 3min¡1ss at 95o and quenched in dry-ice ethanol. The dena-tu¡ed DNA solution was made 6O mM NaCl, 7 mM MgClr, 7

mM Tris HCI ftrH 7.4), 12 mM in each dNTP and 12 unitsDNA Polymerase I-large Fragmentwas added.After 2 hoursincubation at 37o C., this primer rqrair reaction was phenol/CHCI3 extracted, ethanol precipitated and digested tocompletion with HpaII. -50 ng of the expected 125 basepairblunt-endto Hpa II DNA fragment (fragment D)was purifiedfrom the gel.

A second aliquot ofp1298 DNAwas digestedwith Pst I, the628 basepair DNA fragment purified by polyacrylâmide gelelectrophoresis, and further digestedwithBamH I andHpa II.The resulting 380 basepair fragment (fagment E) was puri-fied by gel elecûophoresis.

J ¡rg ofpyCEAlnfl was digestedwith EcoR I, the cohesiveends were made flush with DNA polymerase I (Klenow),further digested with BamH I, treated with BAP and electro-phoiesed on a 6 percent polyacrylamide gel. The latge vectorfragment (fragment F) was isolated and purified.

In a th¡ee fragment ligation, 50 ng fragment D, 100 ngfragment E, and 1@ ng fragment F were ligated overnight at4o in a 20 pl reaction mixture and used to transform.E'. coliKl2 stratn294. The plasmid DNAs from 1 2 ampicillin resis-tant transformants were analyzed for the correct constructionand the nucleotide sequence surrounding the initiation codonwas verified to be correct for the plasmid named pyCEAInt2.

The expressionplasmi{ pyCEAtrp2OT-I* usedforexpres-sion ofthe heavy chain gene is prepared by a 3-way ligationusing the large vector fragment frompBR322(XAP) (supra)

and two fragments prepared from pyCEAInt2.pBR322(XAP) was fteated as above by digestion with

EcoRl, blunt ending with DNA polymerase (Klenow) in tbepresence of dNTPs, followed by digestion with Pst I, and

isolation ofthe large vector fragment by gel electophoresis.A 1543 base pair fragment from pyCEAInt2 çs¡þining ûppromoter linked with the N-tenninal coding region of theheavy cbain gene was isolated by treatingpyCEAln0 with Pst


us 7,923,22r Bl23

I followed by BamH I, and isolation of the desired fragmentusing PAGE. The 869 base pair fragment containing the

C-terminal coding portion ofthe gene was preparedby pafialdigestion of plCEAInt2 with Ar¿a I, blunt ending with Kle-noq and subsequent digestion with BamH I, followed by s

purification ofthe desired fragment by gel electrophoresis.The aforementioned three fragnents were then ligated

under stand¿¡d conditions using T4 DNA ligase, and a liga-tion mixtu¡e used to tansform E. coli stntn 294. PlasmidDl[As from several tetracycline resistant transformants were 10

analyzed; one plasmid DNA demonstrated the proper con-struõtion and wäs designated p1CEAtrp207-1*.

8.1.9 Production of Immunoglobulin Chains by E. coliE. coli slrainW3l 10 (AITC No.27325)wastnnsformed

with pyCEAtrp2OT-l* or pKCEAtrp20T-l* using standard tstechniques.

To obtain double transformants, E. coli strainW3l 10 cellswere transformed with a modifi edpKCEAtrp2OT-1 *, pKCE-Atrp207-1À^, which b¿d been modified by cleaving a Pst

I-Pvu I fragment from the ampÀ gene and religating. Cells zo

û¡nsformed with pKCEAtrp2lT-L*L are thus sensitive toampicillin but still resistant to tet¡acycline. Successful trans-formants were retansformed using pyCEAInt2 which con-fers resistance to ampicillin but not tetracycline. Cells con-taining both pKCEAtrp2OT-1*^ and plCEAInt2 thus zs

identified by growth in a medium çs¡taining both ampicillinand tetracycline.

To confim the production ofheavy and/or light chains inthe ta¡sformed cells, the cell samples were inoculated intoM9 tryptophan free medium containing 10 pglml tetracy- 30

cline, and induced with indoleacrylic acid QAA) when theOD 550 reads 0.5. The induced cells were grown at 37o C.

during various time periods and then spun down, and sus-

pended in TE buffer containing 2 percent SDS and 0.1 MB-mercaptoethanol and boiled for 5 minutes. A 1 0x volume of ¡sacetone was added and the cells kept at22o C. for lO minutes,then centrifuged at 12,000 rpm. The precipitate was sus-pended in O'Farell SDS sample buffer (O'Farell, P. H.' IBiol. Chem.,25O: 4C07 (1975)); boiled 3 minutes, recentri-fuged" and fractionated using SDS PAGE (10 percent), and ao

stained with silver stain (Goldman, D. et al., Science 271:1a37 (1981)); or subjected to Westem blot using rabbit anti-mouse IgG (Bumett, W. N., et al., Anal. Bíochem. 112: 195(1981)), for identification light chain and heavy chain.

Cells tmnsformed with ppEAtrp20T-l* showed bands +s

upon SDS PAGE corresponding to heavy chain molecularweight as developed by silver stain. Cells transformed withpKCEAtrp2OT- 1* showed the proper molecular weigbt bandfor light chain as identified by Westem blot; double ttans-formed cells showed bands for both heavy and light chain so

molecular weigbt proteins when developed using rabbit anti-mouse IgG by Western blot . These results are shown in FIGS .

84, EB, and 8C.FIG. EA shows results developed by silver stain from cells

tansformed with plCEAtrpzOT-l* . Lane I is monoclonal s5

anti-CEA heavy cbain (standard) from CEA.66-83. Lanes

2b-5b are timed samples 2hts,4 brs, 6 hrs, and 24 brs afterIAA addition. Laaes 2a-5a are mrresponding untansformedcontrols; I¿nes 2c-5c a¡e corresponding uninduced transfor-mants. 60

FIG. 8B shows results developed by IVestern blot fromcells ûansformed with pKCEAtrpz}T -f . Lanes lb-6b a¡e

extracts from induced cells immediately, I þ 3.5 brs, 5 hrs, 8

hrs, and 24 brs after lAA addition, andla-6a correspondinguninduced controls. Lane 7 is an e¡<tract from a plCE- os

Atrp207-l * control, lanes 8, 9, and 1 0 are varying amounts ofanti CEA-kappa chain from CEA.66-83 cells.

24FIG. 8C shows results developed by Westem blot from four

colonies ofdouble transformed cells 24 hours after IAA addi-

tion (lanes 4-7). Lanes l-3 are varying amounts of mono-clonai gamma chain controls, lanes I and 9 are untransformedand p1õEAtrpZ07-l* transformed cell extracts, respectively.

In another quantitative assay, frozeq transformed -E colicells grown according to 8.1.10 (below) were lysed by heat-

ing in sodium dodecyl sulfate (SDS)/y-mercaptoethanol celllysis buffer at 1000. Aliquots were loaded on an SDS poly-acryl¡mide gel next to lanes loaded with various "mounts ofhybridoma anti-CEA. The gel w_as developed by the Westem

biot, Bumett (supra), using r2sl-labeled sheep anti-mouseIgG antibody from New England Nuclear. The resufts are

shown in FIG. 9. The figure shows that t}Le E. colí products

co-migrate with the authentic hybridoma cbains, indicatingno detectable proteolytic degradation inE coli. Heavy chain

from mammalian cells is expected to be slightly heavier thanE. coli mafenal due to glycosylation in the former. Using the

hybridoma lanes as a standard the following estimates ofheavy and light chain production were made:

(Per gm of ælls)

E. coli (1iV3t10/nCEAtrP207-l *)

E. co li (W 3 110 I pKCE Ahp207- 1 r)

5 mcÏ1.5 mgK

E. coti (\ßfl1lpKCE Atrp207-1'Â, pyCEAIrt2) 0.5 mg K, 1-0 mg Y

E.1.10 Reconstitution of Antibody from Recombinant Kand Gamma Chains

In order to obtain heavy and light chain preparations forreconstitution, transformed cells were grown in largerbatches, harvested and frozen Conditions of growth of the

variously tansformed cells \ryere as follows:E. cotí ('tt31l0lp'/CEAtrp207-l*) were inoculated into

500 ml LB medium containing 5 pgl-l tetzcycline andgrown on a rotarf sbaker for 8 hours. The culture was thenkansferred to 10 liters of fermentation medium containingyeast nutrients, salts, glucose, and 2 ¡rglml tetacycline. Addi-tional glucose was added during growth and at OD 55F20,indoleacrylic (IAA), a trp derepressor, was added to a con-centration of 50 ¡rglml. The cells were fed additional glumseto a final OD 55F40, achieved approximately 6 hou¡s fromthe IAA addition.

E. coti (i{3110)cells tmnsfomedwith pKCEA trp .2O'l -lÁand double fansformed (with pKCEAtrp20T-l*À asdpyCpAlnt2) were grcwn iB a m¡nner analogous to thatdescribed above except thât the OD 550 six hours after IAAaddition at harvest was 25-30.

The cells were then ha¡vested by centrifugation, and fro-zel..

E.2 Assay Method for ReconstitutedAntibodyA¡ti-CEA activity was deterrninedby ELISA as a criterion

for successfif reconstitution. Wells of microtiter plates (Dy-natech Í:rmulon) were saturated with CEA by incubaling 100

¡rl of 2-5 pg CEA/nI solution in O.lM carbonate bufer, pH9.3 for 72 hours at room temperature. The wells were thenwashed 4 times wilh phosphate bufered saline @BS), andthen saturated with BSA by incubating 200 ¡rl of 0.5 percent

BSA in PBS for 2 hours al 37" C' followed by washing 4

times with PBS. Fifty microliters of each sample was appliedto each well. A standard curve (shown in FIG. 10)' was run,which consisted of 50 ¡rJ samples of 10 pg, 5 pg, 1 pg, 500 ng,

100 ng, 50 ng, l0 ng, 5 ng and 1 ng anti-CEA/ml in 0.5 percent

BSA in PBS, plus 50 pl of 0.5 percent BSA in PBS alone as a

blank. All of the samples were incubated in the plate for 90

minutes at37" C.


us 7,923,22r Bl2S

The plates weie then washed 4 times with PBS, and sheep

anti-mouse lgG-alkaline phosphate CIAGO, Inc.) was

applied to each well by adding 100 ¡rJ ofan enzyme concen-

toation of 24 units/mJ in 0. 5 percent BSA in PBS. The solutionwas incubated af 37" C. for 90 minutes. The plates were 5

washed 4 times with PBS before adding the substate, 100 pl

of a 0.4 mg/ml solution of p-nitrophenylphosphate (Sigma) inethanolamine buffered saline, pH 9.5. The substrate was incu-bated 90 minutes at3'7o C. for color development.

The Aoro of each well was read by the'Microelisa Auto 10

Reader (Dynatech) set to a tlreshold of 1.5, calibration of 1 .0

and the 0.5 percent BSA in PBS (Blank) well set to 0.0@. TheAoro data was tabulated in RS- I on the VAX system, and the

standard curve data fitted to a four-parameter logistic model.The unknown samples' concentratiôns were calc-ulated based 1s

on the Aoro data.E.3 Reconstimtion of Recombinant Antibody and AssayFrozen cells prepared as described in paragraph E'1.10

were thawed in cold lysis buffer [10 nM Tris HCl, pH 7 .5, I ^^mM EDTA, O.lM NaCl, 1 mM phenylmethylsulfonyl fluo- '"

ride (PMSF)I and lysed by sonication. The lysate was par-

tially clarifiedby centrifugation for 20mins at 3,000rpm. Thesupematant was protected from proteolytic enzymes by anadditional 1 mM PMSR and used immediately or storedirozen at -80" C. ; frozen þsates were never thaweã more than 25

once.The S-sulfonate of E. coli produced anti-CEA heavy chain

(.y) was prepared as follows: RecombinantE coli cells trans-formed with p1CEAtrp207-1* which contained heavy chainas insoluble bodies, wère lysed and centrifirged as abóve; the 30

pellet was resuspended in the same buffer, sonicated andre-centrifuged. This pellet was washed once with buffer, thensuspended in 6M guanidine HCl, 0.1M Tris HCl, pH 8, I mMEDTA, 20 mglml sodium sulfite and 10 mg/ml sodiumtetrathionate and allowed to react at 25o for about l 6 hrs. The 3s

reaction mixfure was dialyzed against 8M urea, 0.lM TrisHCl, pH 8, and stored at 40, to give a 3 mg/ml solution ofy-SSOr.

650 pl ofcell lysate from cells ofvarious E coli stminsproducing various IgG chains, was added to 5gQ -g urea. To a0

this was added p-mercaptoethanol to 20 mM, Tris-HCl, pH8.5 to 50 mM and EDTA to 1 mM, and in some experinents,y-SSO, was added to 0.1 mg/nl. Afrer standing at 25" for3Q-!Q mins., the reactionmixtures were dialyzed at 4o againsta buffer composed of 0. I M sodium glycinate, pH 1 0.8,-0.5M a5

urea, l0 mM glycine ethyl ester, 5 mM reduced glutathione,

0.1 mM oxidized glutathione. This buffer was prepared ûomN2-saturated water and the dialysis was performed in a

cappedWheatonbottle. A-fter l6-48 hows, dialysis bags weremÅferred to 4o phosphate buffered saline containing- t .M s0

PMSF and dialysis continued another 76-24 hrs. Dialysateswere assayed by ELISA as described in paragraph 8.2 forability to bind cEA. The results below show the values

obtained by comparison with the standard curve inxng/ml ..anti-CEA. AIso shown are the reconstitution efficiencies cal- "culated from the ELISA responses, ninus the background(108 ng/ml) ofcells producing K chain only, and ûom esti-mates ofthe levels ofy and Kchains in the reactionmixtures.

26+ontinued

Perærtng/ml reæm-

mti-CEA bin¿tion

E. coü (W3110/pKCEAûp207-1r),plusT-SS03E. cqti N\t3l1}tpKCEAtry207-1

r^, PTCEAInI2)Hybüdoma æti-CEA K-SS03 ud 1-SS03

E48 0.331580 0.'16

sñ 0.40

E. coli W3110 producing IFN-cA (control)E. c o li ('t'l 3l L0 / pKCEAt¡p2o 7-1')

8.4 Preparation of Chimeric AntibodyFIGS. 11 and 12 show the construction of an expression

vector for a chimeric heavy (gamma) chain which comprises

the murine anti CEA variable region and human'y-2 constantregion.

A DNA sequence encoding the human gamma-2 heavy

cbain is prepared as follows: the cDNA library obtained bystanalardtechniques from a human multiplemyeloma cell lineis probed with 5' GGGCACTCGACACAA 3'to obtain the

p6smid containing the cDNA imert for human gamma-2

cbain (Takahashi, el al., Cell,29 671 (1982), incorporatedherein by reference), and analyzed to verifr its identity withthe known sequetrce in human gamma-2 (Ellison, J., et al.,

Proc. Natl. Acad. Sci. (USA),79:1984 (1982) incorporated

herein by reference).As shown in FIG. 11, two fragments a¡e obtained from this

cloned hr¡man gamma 2 plasmid (p12). The first fragment is

formed by digestion wilh PvuII followed by digestion withAva III, and purification ofthe smaller DNA fragment, whichcontains a portion of the constant region, using 6 percent

PÄGE. The second fragment is obtained by digesting the pT2

with'any restriction enzyme which cleaves in the 3' untans-lated region ofy2, as deduced from the nucleotide sequence,

filling,inwith Klenow anddNTPs, cleavingwithAva III, and

isolating the smaller ûagment using 6 percent PAGE. (Ihechoice of a two step, two fragment composition to supply the

PvuII-3' untznslated fragment provides a cleaner path toproduct due to the proximity of theAvaIII site to the 3 temi-nal end thus avoiding additional restriction sites in tle gene

sequence matching the 3' untanslated region site.)pyCEA2O7-l * is digested with EcoR 1, treated with Klenowand dNTPs to û11 in the cohesive end, and digested with Pvu

II, the large vector fragment containing promoter isolatedby6 percent PAGE.

The locationandDNA seçence surroundingthe PvuII site

in the mouse gamma-l gene are identical to the location and

DNA sequence surounding the PvuII site in the humangamma-2 gene.

The plasmid resulting from a three way ligtion of theforegoing fragments, pChiml, contains, under the influence

ofþ promoter, the va¡iable and part ofthe constant region ofmurine anti-CEA gamma I chain, anda portion ofthe g¡mma2human chain. pChiml will, infact, express achimeric heavy

chain when transformed into E. coli, but one wherein theçh¡nge from mouse to human does not take place at thevariable to constant j unction.

FIG. 12 shows modification of pChiml to constructpChio2 so that the resulting protein from expression willcontain variable region from murine anti CEA antibody andconstant region from the human 1-2 chain. First, a fagment isprepared from pChiml by teating with Nco I, blunt endingwith Klenow and dNTPs, cleaving with Pvu II, and isolatingthe la¡ge vector Aagment which is almost the complete plas-mid exceptfor short segment inthe constant codingregion formouse anti CEA. A second ûagment is prepared f¡om thepreviously described py2 by treating with Pvu II, followed bytreating with any restriction enzyme which cleaves in the

variable region, blunt ending with Klenow and dNTPs and

Perce¡tng/ml ¡ecom-

uti-CEA bi¡atio¡

0-t0E

65


us 7,923,221Bl27

isolating the short fragment which comprises the junction

between variable and constant regions ofthis chain.Ligation ofthe foregoing two fragments produces an inter-

mediate plasmid which is correct except for an extraneous

DNA fragnent which contains a small portion ofthe constant 5

region of the mwine anti CEA antigen, and a small portion ofthe variable region of the human gamma chain' This repaircan be made by excising the Xba I to Pvu II fragment andçlsning into M13 phage as described by Messing et a1',

Nucleíc Acids.Res. 9: 309 (1981), followed by in vitro site iodirected deletion mutagenesis as described by Adelman, etal., DNA, in press (1983) which is incorporated herein byreference. The Xba I-Pvu II fragment thus modified is ligatedback into the intermediate plasmid to form pChim2. Thisplasmid then is capable of expressing in a suitable host a 1s

cleanly constructed murine variabley'human constant chi-meric heavy chain.

In an analogous fashion, but using mRNA templates forcDNA co¡struction for human kappa rather than 1 chain" theexpression plas.¡¿ ¡q¡ shimeric light cbain is prepared. 20

The foregoing two plasmids are then double transformedtnto E, colí W3110, the cells grown and the chains reconsti-tuted as set forth in paragraph E.l-8.3 supra;

8.5 Preparation of Altered Murine Anti-CEA AntibodyE.5.1 Construction of Plasmid Vectors for Direct Expres- zs

sion ofAltered Murine Anti-CEA Heavy Chain Gene

The cysteine residues, and the resultant disulfide bonds inthe region of amino acids 216-23O in the constant region ofmurine anti-CEA heavy chain a¡e suspected to be importantfor complement fi xation (Klein, et a7., Ptoc. Natl. Acad. Sci., :o(USA),78: 524 (1 981 ) but not for the antigen binding prop-erty ofthe resulting antibody. To decrease the probability ofincorrect disulfide bond formation during reconstitutionaccording to the process ofthe invention herein, the nucle-otides encoding the amino acid residues 226-232 which ¡sincludes codons for tt¡ee cysteines, are deleted as follows:

A *deleter" deoxyoligonucleotide, 5' CTAACACCATGT-C,AGGGT is used to delete the relevant portions of the gene

from pyCEAtrp2}T-7* by the procedure ofWallace, et a1.,

Science, 209: 1.396 (1980) or of Adelman, et a1., DNA (in +o

press) 1983. Briefly, the *deleter" deoxyoligonucleotide isannealed with denatured pTCEAt rp2Ù7 -l* DNA, and primerrepair synthesis caried out in vitro, followed by screening b^y

hybridization of presumptive deletion clones with p32

labelled deleter sequence. 4s

E.5.2 Production of Cysteine Deficient Altered AntibodyTheplasmid preparedinE.5.l is transformedinto anE. coli

stain previously transformed with pKCEAtrp2}T-|* as

described above. The cells are grown, extracted for recombi-nant antibody chains, and the altered antibody reconstituted 50

as described in 8.1.10.8.6 Preparation ofFabE.6.1 Construction of a PlasmidVector for Direct Expres-

sion of Murine Anti-CEA Gamma I Fab Fragment GeneplCEAFabtrp20T-l* s5-

FIG. 13 prèsents the construction of pyCEAFabtrp20T-1*.5 pgofpBR322 was digestedwithHind III, thecohesiveendsmade flush by treating with Klenow and dNTPs; digestedwith Pst I, atrd treated with BAP. The large vector frasment,fragment I, was recovered using 6 percent PAGE followed by oo

electroelution.5 pg of p1CEAtrp207-1* was digested with both BamH I

and Pst I and the -1570 bp DNA ûzgment (fragment II)containing the trp promoter and the gene sequence encodingthe va¡iabte region continuing into constant region and fur- os

ther into the anti-CEA gamma I chain hinge region, wasisolated and purified after electrrcphoresis.

28Expression of the anti-CEA gamma 1 chain Fab fragment

rather than complete heavy chain reçires that a termination

codon be constructed at the appropriate location inthe gene'

For this, the 260 bp Nco I-Nde I DNA fragment from 20 ¡rg ofthe py298 was isolated and puriûed. A 13 nucleotide DNAprimrr, the complement of which encodes the last 3 C-termi-

nal amino acidsofthe Fab geneand 2bases ofthe3 neededforthe.stop codor¡ was synthesized by the phosphotriester

method (supra). The probe hybridizes to nucleotides 754 to

767 (FlG.4) which has the following sequence:

ÀSPCYSGIYSEoP5' GECATTGTCÆTTG 3I

The third base of the stop codon is prrcvided by the terminal

nucleotide of the ûlled-in Hind III site fiom pBR322 cleavage

described above. 500 ng of this primer was used in a primerrepair reaction by phosphorylation at the 5' end in a reaction

with I 0 units T¿ DNA kinase containing 0.5 mMATP in 20 FI'and mixing with -200 ng of the Nco I-Nde I DNA fragment.

The mixture was heat denatured for 3 minutes at 95o andquenched in dry-ice ethanol. The denatu¡ed DNA solutionwas made 60 mM NaCl, 7 mM MgCl2, 7 mM Tris HCI (pH7.4), 12 mM in each dNTP and 12 units DNA Polymerase

I-Large Fragment was added. After 2 hours incubatioîat37oC., tlis primer repair reaction was phenoVCHCl, exftacted,

ethanol precipitated, digested with BamH I and the reaction

electrophoresed through a 6 percent polyacrylâmide gel. -50ng of the 181 bp blunt end to BamH I DNA fragment, frag-ment III, was isolated and purified.

-10O ng offragment I, -100 ng each offragments II and IIIwereligatedovemigþt andtransformed into E coliKl2 strain294. Plasmid DNA from several tetracycline resistant tra¡s-forrnants was analyzed for the proper construction and the

nucleotide sequetrce through the repair blunt end filled-inHind III junction was determined for verification of the TGAstop codon.

8.6.2 Production of Fab ProteinThe plasmid pre,pared inE.6. I is transformedint o anE - col i

strain þreviousìy ftansformed with pKCEAtrp2OT'l* as

described above. The celts are grown, extracted for recombi-

nant antibody chains and the Fab prctein reconstituted as

described in E.l.10.

The invention claimed is:1. A method for making an antibody heavy chain or frag-

ment thereof and an antibody ligþt chain or ûagmeût thereofeach having specificity for a desired antigen, wherein the

heavy chain or fragment thereof comprises a human constaût

region sequence and avariable region comprising nonhumanmammalian variable region sequences, the method compris-ing culturing a recombinant host cell comprising DNA encod-

ing the heavy chain or fragment thereofand the light chain orûagment thereof and recovering the heavy chain or fiãgmentthereofand light chain or fragment thereoffrom the host cellculture.

2. The method of claim 1 wherein the light chain or frag-ment thereofcomprises a human constant region sequence

and a variable region comprising non human mammalianvariable region sequences.

3. The method of claim 1 wherein the host cell comprises a

vector, comprising DNA encoding the heavy chain or frag-ment thereof and DNA encoding the ligþt chain or fragmentthereof.

4. The method of claim 1 wherein the host cell comprises a

vector comprising DNA encoding the heavy chain or frag-


29ment thereof and a fu¡ther vector comprising DNA encoding

the light chain or fiagment thereof.5. The method of claim 1 wherein the non human mamma-

Iian variable region sequences are murine.6. The method of claim 1 wherein the host cell is a prokary-

otic cell.7. The method of claim 6 wherein the prokaryotic cell is an

E. coli cell.L The method of claim l wherejn the host cell is an eukary-

otic cell.9. The method of claim I wherein the eukaryotic cell is a

mammaliancell.1.0. The method of claim 9 wherein the m¿rmmalian cell is

selected from the g¡oup consisting ofa\¡ERO, HeLa, Chinese

Hamster Ovary (CHO), W138, BHK, COS-7 and MDCKcell.

11. The method of claim 10 wherein the mammalian cell is

a CHO cell.12. The method of claim 10 wherein the mammalian cell is

a COS-7 cell.13. The method ofclaim I whereinthe eukaryotic cell is a

yeast cell.14. The method of claim 13 wherein the yeast cell is a

S accharomyce s cerev i s iae cell.15 . A method for making an antibody or antibody fragment

capable ofspecifically binding a desired antigen, wherein the

antibody or antibody fragment comprises (a) an antibodyheavy chain or fiagnent thereof comprising a human con-

stant region secluence and a variable region comprising non

human mammalian variable region sequences and (b) an anti-body light chain or fragment thereof comprising a human

constant region sequence and a variable region comprising

non human mammalian variable region sequences, the

method comprising coexpressing the heavy chain or fraement

thereof and the light chain or fragment thereof in a recombi-

nant host cell.16. The method of claim 15 ñ-¡rther comprising recovering

the antibody or antibody fragment from a cell culture com-prising the recombinant cell.

17. The method of claim 15 which results in the productionof an antibody fragment.

18. The method of claim 17 wherein the antibody fragmentis an F(ab), fragment.

19. Themethodofclaim 1.7 whereinthe antibody fragmentis a Fab fragment.

20. The method of claim 15 which results in the productionofan antibody.

21. A method for making an antibody capable of speciû-cally binding a desi¡ed antigen, the antibody comprisingheavy and light immunoglobulin polypeptide chains each

comprising a human constant region sequence and a variableregion comprising non human mammalian variable regionsequences, the method comprising the steps of (a) transform-ing a recombinant host cell witl a replicable expression vec-tor comprising DNA encoding the heavy immunoglobulinpolypeptide chain and a replicable expression vector com-prising DNA enssding the light immunoglobulin polypeptidecbain, wherein each of the DNAs is operably linked to a

promoter; and (b) culturing the host cell to produce a host cellculture tbåt expresses said antibody.

22. A replicable expression vector comprising DNAencodiaganantibody heavy chain or fragment thereofand anantibody ligþt chain or fragment thereof each having speci-ficity for a desired antigen, the heavy chain or fragmentthereofand the ligbt chain or fragment thereofeach compris-

us 7,923,221Br30

ing a human constant region sequence and a variable region

comprising non human mammalian variable region

sequences.ã3. A recombinant host cell comprising the vector of claim

< 'r',24. A recombinairt host cell comprising (a) a vector com-

prising DNA encoding an antibody heavy chain or fragment

thereof comprising a human constant region sequence and a

variable region comprising non human mammalian variable

to region sequences and (b) a vector comprising DNA encoding

an antibody light chain or fragment thereof comprising a

human constant region sequence and a variable region com-prising non human memmalian variable region sequences'

25. A method for making an antibody heavy chain or frag-15 ment thereof and an antibody ligþt chain or fragment thereof

each having specificity for a desired antigen, wherein the

heavy chain or fragment thereofcomprises a variable region

sequence and a human constant region sequence, the methodcomprising culturing a recombinant host cell comprising

20 DNA encoding the heavy chain or fragment thereof and theligbt.chain or fragment thereof and recovering the heavy

cbain 9r fragment thereof and light chain or fragment thereoffrom the host cell culture.

26. T}Le method of claim 25 wherein the ligbt chain or25 fraqment thereof comprises a variable region sequence and a

human constant region sequence.27. Themethodof claim 25 wherein thehost cell comprises

a vector compri5ing DNA encoding the heavy chain or frag-ment thereof and DNA encoding the ligbt chain or fiagment

30 thereof.28. The method of claim 25 wherein the host cell comprises

a vector comprising DNA encoding the heavy chain or frag-ment thereof and a fi¡rther vector comprising DNA encoding

the light chain or fragment thereof.3s 29.'i.}le method of claim 25 wherein the host cell is a

prokaraotic cell.30. The method ofclaim 29 whereinthe prokaryotic cell is

an E. coli cell.31. The method of claim 25 wherein the host cell is a

+o eukaryotic cell.32. The method of claim 31 wherein the eukaryotic cell is

a mammalian cell.33. The method of claim 32 wherein the mammalian cell is

selectedfrom the group consisting of aVERO, Hela, Chinese4s Hamster Ovary (CHO), W138, BHK, COS'7 and MDCK

cell.34.. The methodof claim 32 whereinthemammaliancell is

a CHO cell.35. The method of claim 32 wherein the mammalian cell is

so a COS-7 cell.36. The method of claim 31 wherein the euka¡yotic cell is

a yeast cell.37. The method of claim 36 wherein the yeast cell is a

S ac charomyce s cerevi s iae cell.55 38.4 methodformaking anantibody orantibody fragment

capable of specifically binding a desired antigen, wherein the

antibody or antibody fragment comprises (a) an antibody

heavy chain or fiagment thereofcomprising a variable regionsequence and a human constånt region sequence and (b) an

60 antibody light chain or fragment thereof comprising a vari-able region sequence and a human constatrt region sequence,

the method comp¡ising coexpressing the heavy chain or frag-ment thereof and the light chain or fragment thereof in a

recombinant host cell.6s 39. The method of claim 38 frrther comprising recovering

the antibody or antibody fragment fiom a cell culture com-prising the recombinant cell.


us 7,923,22t Bl31

40. The method of claim 38 which results in the productionof an antibody fragment.

41 . The method of claim 38 wherein the antibody fragmentis an F(ab), fragment.

42. Themethodofclaim 40 whereinthe antibody fiagmentis a Fab fraemcnl.

43. Themethod of claim 38 which results in the productonofan antibody.

44. A method for making an antibody capable of specifi-cally binding a desi¡ed antigen, the antibody comprisingheavy and light immunoglobulin polypeptide chains eachcomprising a variable region sequence and a human constantregion sequence, the method comprising the steps of(a) trans-forming a recombinant host cell with a replicable expressionvectorcomprising DNA encoding the heavy immunoglobulinpolypeptide cbain and a replicable expression vector com-prising DNA encoding the light immunoglobulin polypeptidechain, wherein each of the DNAs is operably linked to a

promoter; and (b) culturing the host cell to produce a host cellculture that expresses said antibody.

3245. A repticable expression veclor comprising DNA

encoding an antibody heavy chain or fizgment thereofand an

antibody ligbt cbain or ûagment thereof each having speci'

ficity for a desired antigen, the heavy cbain or fragmentthereof and the light chain or ûagment thereofeach compris-ing a variable region sequence and a human constanl region

sequence.46.Arecombinant hostcell comprising the vector ofclaim

45.47. A recombinant host cell comprising (a) a vector com-

prising DNA encoding an antibody heavy chain or fragmentthereof compri5ing a variable region sequence and human

constant region sequence and (b) a vector comprising DNAencoding an antibody light chain or fragment thereof com-prising a variable region sequence and a human constantregion sequence.

'k*+**

15


UNITED STATES DISTRICT COURTCENTRAL DISTRICT OF CALIFORNIA

NOTICE OF ASSIGNMENT TO TINITED STATES MAGISTRATE JUDGE FOR DISCOVERY

This case has been assigned to District Judge Stephen V. Wilson and the assigneddiscovery Magistrate Judge is Fernando M. Olguin.

The case number on all documents filed with the Court should read as follows:

evll- 3065 Swü (FMOx)

Pursuant to General Order 05-07 of the United States District Court for the CentralDistrict of California, the Magistrate Judge has been designated to hear discovery relatedmotions.

All discovery related motions should be noticed on the calendar of the Magistrate Judge

=:::::::::::::::::::::::::::::::NOTICE TO GOUNSEL

A copy of this notice must be served with the summons and complaint on all defendants (if a removal action isfiled, a copy of this notice must be served on all plaintíffs).

Subsequent documents must be filed at the following location:

ñ] ry9st9.n Division t I Southern Division U Eastern Division' ' 312 N. Spring St., Rm. G-8 u 4ll West Fourth St., Rm. l-053 3470 Twelfth St., Rm. 134Los Angeles, CA 90012 Santa Ana, CA 92701-4516 Riverside, CA 92501

Failure to file at the proper location will result in your documents being returned to you.

CV-18 (03/06) NOTICE OF ASSIGNMENT TO UNITED STATES MAGISTRATE JUDGE FOR DISCOVERY


Name & Address:

DURIE TANGRI LLPDaralyn J. Durie (SBN 169825)

217 Leidesdorff Street

San Francisco, CA 94111

Telephone: 41 5 -362-6666; [email protected]

UNITED STATES DISTRICT COIJRTCENTRAL DISTRICT OF' CALIF'ORNIA

CASE NUMBERGENENTECH, INC. and CITY OF HOPE,

PLAINTIFF(S)

GLAXO GROUP LIMITED, GLAXOSMITHKLINELLC, HUMAN GENOME SCIENCES, INC., LONZABIOLOGICS PLC and LONZA BIOLOGICS INC., SUMMONS

qhghÉri '#*q"ww ws tr-gfifu

H äWSW,&

DEFENDANT(S).

DEFENDANT(S): GLAXO GROUP LIMITED, GLAXOSMITHKLINE LLC HUMAN GENOMETO:SCIENCES.INC. LONZA BIOLOGICS PLC and LONZA BIOLOGICS INC.

A lawsuit has been fìled against you.

Within 2l days after service of this summons on you (not counting the day you received it), youmust serve on the plaintiff an answer to the attached Ú complaint tr amended complaintn counterclaim ! cross-claim or a motion under Rule 12 of the Federal Rules of Civil Procedure. The answeror motion must be served on the plaintiff s attomey, Daralyn J. Durie (SBN 169825) , whose address isDURIE TANGRI LLP, 217 Leidesdorff Street, San Francisco, CA 94111 . If you fail to do so,

judgment by default will be entered against you for the relief demanded in the complaint. You also must fileyour answer or motion with the court.

APB 1 2 2011

Dated:

[Use 60 days if the defendant is the United States or a United States agency, or is an oficer or employee of the United States. Allowed60 days by Rule I2(a)(3)1.

Clerk, U.S. District Court

CHRISTOF${TR

1 181

U.È Þls¡¡r{$

ffiqä

ô\-Zs"r\d-r' ¿t

#ir #.r*

cv-01A (12107) SUMMONS


:'ffi ffi PYNITED

STATES DISTRICT C'URT, CENTRAL DISTRICT OF CALIFORNIA

I (a) PLAINTIFFS (Check

GENENTECH, INC,box ilyou are representing yourselfD)

and CITY OF HOPE

CIVIL COVER SHEET

DEFENDANTSGLAXO GROUP LIMITED, GLAXOSMITHKLINE LLC, HUMAN GENOME

SCIENCES, INC.. LONZA BIOLOGICS PLC, and LONZA BIOLOGICS, INC.

Attomeys (If Known)(b) Attomeys (Firm Name, Address and Telephone Number. If you are representingyourself, provide same.)

Daralyn J. Durie (SBN 169825)

DUzuE TANGRI LLP,2ll Leidesdorff Street, San Francisco, CA 941I I

415-362-6666

II. BASIS OF JURISDICTION (Place an X in one box only.)

tl I U.S. Govemment Plaintiff d3 Fede.al Question (U.S.

Govemment Not a Party)

D 2 U.S. Govemment Defendant D 4 Diversity (lndicate CitizenshipofParties in ltem III)

III. CITIZENSHIP OF PRINCIPAL PARTIES - For Diversity Cases Only(Place an X in one box for plaintiffand one for defendant.)

Citizen of This State

Citizen of Another State

Citizen or Subject of a Foreign Country

PTF DEF PTF DEF!l !l lncorporatedorPrincipalPlace E4 a4

ofBusiness in this State

E2 E2 IncorporatedandPrincipalPlace D5 n5olBusiness in Another State

tr3 ¡3 ForeignNation D6 ¡6

IV. ORIGIN (Place an X in one box only.)

It originat E 2 Removed from ! 3

Proceeding State CourtRema¡ded fromAppellate Court

E 4 Reinstated orReopened

! 5 Transfened from another district (specify): tr 6 Multi- tr 7 Appeal to DistrictDistrict Judge fromLitigation Magistrate Judge

V, REeUESTED IN COMPLAINT. JURY DEMANDT dY". tr No (Check'Yes' only if demanded in complaint.)

CLASS ACTION UNdCr F.R,C.P. ZS: ¡ YES #O tr MONEY DEMANDED IN COMPLAINT: $

VI. CAUSEOFACTION(CitetheU.S.Civil Statuteunderwhichyouarefilingandwriteabriefstatementofcause. Donotcitejurisdictional statutesunlessdiversity.)

35 U.S.C. section 271; patent infringement

VII. NATURE OF SUIT (Place an X in one box only.)

',,., PRQPERTY, , ',,:

370 Other Fraud371 Truth in Lending380 Other Personal

Property Damage385 Property Damage

Produrct L!3bif iry

422 Appeal 28 USCls8

423 Withdrawal 28

USC I57

442 Employment443 Housing/Acco-

mmodations444 Welfarc445 American with

Disabilities -

Employment446 American with

Disabilities -Other

440 Other CivilRights

510 Motions toVacate SentenceHabeas Corpus

530 General535 Death Penalty540 Mandamus/

Other550 Civil Rights555 Prison Condition

$"öjGËr.18-x--qllaÉ-"TÈ$

íi#frffiìffiË$lïåÌ,!å$AgricultureOther Food &DrugDrug RelatedSeizure ofProperty 2l USC881

630 LiquorLaws640 R.R. & Truck

tr 650 Airline Regs

! 660 OccupationalSafety /Health

tr 690 Other

120 Marine130 Miller Act140 Negotiable Instrument150 Recovery of

Overpayment &Enforcement ofJudgment

l5l Medicare Act152 Recovery of Defaulted

Student Loan (Excl.Veterans)

153 Recovery ofOverpayment ofVeteran's Benefits

160 Stockholders' Suits190 OtherContract195 Contract Product

Liability196 Franchise

iÌiù\ì,ùËhYÞ,iiõÍÈf, :ùvì,riì,:210 Land Condemnation220 Foreclosure230 Rent Lease & Ejectment240 Torts to Land

û 245 Tort Product Liability¡ 290 All Other Real Property

l:iiiirììlìì$q,ïl#.]'lií"f i:,:'TPERS.ONAL:INJURY

"'tr 310 AirplaneE3l5 AirplaneProduct

Liability320 Assault, Libeì &

Slander330 Fed. Employers'

Liability340 Marine345 Marine Product

Liability350 Motor Vehicle355 Motor Vehicle

Product Liability360 Other Personal

Injury362 Personal lnjury-

Med Malpractice365 Personal Injury-

Product Liability368 Asbestos Personal

Injury ProductLiability

r,,:ì:ir,p,ftl[GRêTlo" ñÌii, ì..ìn 462 Naturalization

Application4ó3 Habeas Corpus-

Alien Detainee4ó5 Other Immigration

Actions

tr 400E 410tr 430tr 450

tr 460D 470

E 480E 490tr 810Û 850

E 875

n 890tr 891

8892

¡ 893

fl894tr 89sn 900

tr 950

State ReapportionmentAntitrustBanks and BankingCommerce/lCCRates/etc.

DeportationRacketeer Influencedand ComrptOrganizationsConsumer CreditCable/Sat TVSelective SewiceSecurities/Commodities/ExchangeCustomer Challenge l2usc 3410Other Statutory ActionsAgricultural ActEconomic StabilizationActEnvironmental MattersEnergy Allocation ActFreedom oflnfo. ActAppeal of Fee Determi-nation Under EqualAccess to JusticeConstitutionality ofState Statutes

710

720

730

- ^ti4B0Ri¡":;Ëir!#åüiFair Labor StandardsActLabor/Mgmt.RelationsLabor/-lr4gmt.

Reporting &Disclosure ActRailway Labor ActOther LaborLitigationEmpl. Ret. Inc.

fl740790

791Act

?rßIliIf,fS,-4ËS20 Copyrights

830 Patent840 Trademark

861 HIA (139sfÐ862 Black Lung (923)

863 DIWC/DIWW(a0s(e))

864 SSID Tide XVI! 865 RSI (405(e))låiÈ¡àÐÈRùi:ËÌiijA:$,Sräi¡$¡

870 Taxes (U.S. Ptaintiffor Defendant)

871 IRS-Third Party 26

IJSC 7609

FOR OFFICE USE ONLY: Case Number

COM

cv-7 r (0s/08)

AF'TER COMPLETING THE FRONT SIDE

CIVIL COVER SHEET

THE INFORMATION REQUES'TED BELOW.

Page I of2


lfyes, list case number(s):

VII(b). RELATED CASES: Have any cases been previously filed in this court that are related to the present case? [ No úy.,If yei, iistcase number(s): CV-10-02764 MRP, Judee Pfaelzer; CV-08-3573 MRP, Judee Pfaelzer; CV-03-2567 MRP, Judee Pfaelzer

Civil cases are deemed relâted ifâ previously filed case and the present case:

(Check all boxes that apply) dR. Rrir" from the same or closely related transactions, happenings, or events; or

dg, Cutt for determination of,the same or substantially related or similar questions of law and fact; or

dC. For other reasons would entail substantial duplication oflabor ifhea¡d by differentjudges; or

ID. Involvethesamepatent,trademarkorcopyright,andoneofthefactorsidentifiedaboveina,borcalsoispresent.

IX. VENUE: (When completing the following information, use an additional sheet ilnecessary.)

(a) List rhe County in this District; California County outside olthis District; State if other than California; or Foreign Country, in which EACH named plaintiff resides.

County in this District:* California County outside ofthis District; State, ifother than Califomia; orForeign Country

Los Angeles County - City of Hope San Mateo County - Genentech, Inc.

(b) List the County in this District; Califomia County outside of this District; State if other than California; or Foreign Country, in which EACH named defendant resides

VIII(a). IDENTICAL CAS

UNITED STATES DISTRICT COURT, CENTR,A.L DISTRICT OF CALIFORNIACIVIL COVER SHEET

ES: Has this action been previously filed in this court and dismissed, re¡nanded or closed? dNo ! Yes

County in this District:* California County outside ofthis District; State, ifother than Caìifomía; or Foreign Country

Glaxo Group Limited - United Kingdom; Glaxosmithkline LLC - Pennsylvania;

Human Genome Sciences, Inc- - Maryland; Lonza Biologics PLC - United

Kingdom; Lonza Biologics Inc. - New Hampshire

(c) List the County in this District; Califomia County outside of this District; State if other than Califomia; or Foreign Country, in which EACH claim arose.

Note: In land condemnation cases, use the locâtion of the tract of land involved.

County in this District:* California County outside ofthis District; State, ifother than Califomia; or Foreign Country

-os Angeles County

* Los Angeles, Orange, San Bernardino, Riverside, Ventura, Santa Barbara, or San Luis Obispo Counties

Note: In land condemnation cases. use the location ofthe tract of land invotved

X. SIGNATUREOFATTORNEY(ORPRO peÙ} r^r" April 11, 201I

Notice to Counsel/parties: The CV-7 I (JS-44) Civrl Cover Sheet and the infonnation contained herein neither replace nor supplement the filing and service ofpleadings

or other papers as required by law. This form, approved by the Judicial Conference ofthe United States in September 1 974, is required pursuant to Local Rule 3-1 is not filed

Key to Statistical codes relating to Social Security Cases:

Nature ofsuit Code Abbreviâtion Substântive Statement ofCause ofAction

861

863

862

863

HIA All claims for health insurance benefits (Medicare) under Title 18, Part A, ofthe Social Security Act, as amended.

Also, include claims by hospitals, skilled nursing facilities, etc., for certification as providers ofservices under the

program. (42 U.S.C. l93sFF(b))

BL All claims for "Black Lung" benefits under Title 4, Part B, of the Federal Coal Mine Health and Safety Act of 1969.

(30 u.s.c. 923)

DIWC All claims filed by insured workers for disabiliry insurance benefits under Title 2 of the Social Security Act, as

amended; plus all claims filed for child's insurance benefits based on disability. (a2 U.S.C. 405(g))

DIWI/r' All claims fìled for widows or widowers insurance benefits based on disability under Title 2 of the Social Security

Act, as amended. (a2 U.S.C. 405(9))

SSID All claims for supplemental security income payments based upon disabìlity filed under Title l6 ofthe Social Security

Act, as amended.

RSI All claims for retirement (old age) and survivors benefits under Title 2 ofthe Social Security Act, as amended. (42

u.s.c. (e))

864

86s

cv-7r (0s/08) CIVIL COVER SHEET Page 2 of 2
