functionalized self-assembled monolayer on gold for detection of human mitochondrial trna gene...

ANALYTICAL

Analytical Biochemistry 322 (2003) 14–25

BIOCHEMISTRY

www.elsevier.com/locate/yabio

Functionalized self-assembled monolayer on gold for detectionof human mitochondrial tRNA gene mutations

Weidong Du,a C�eecile Marsac,b Margit Kruschina,a Flavio Ortigao,a

and Catherine Florentzc,*

a ThermoHybaid, Interactiva Division, 89077 Ulm, Germanyb Laboratoire CERTO, Facult�ee Necker, 144 rue de Vaugirard, 75015 Paris, France

c UPR 9002 du CNRS, Institut de Biologie Mol�eeculaire et Cellulaire, 15 rue Ren�ee Descartes, 67084 Strasbourg Cedex, France

Received 28 March 2003

Abstract

We developed a rapid and simple method to identify single-nucleotide polymorphisms (SNPs) in the human mitochondrial tRNA

genes. This method is based on a universal, functionalized, self-assembled monolayer, XNA on Gold chip platform. A set of probes

sharing a given allele-specific sequence with a single base substitution near the middle of the sequence was immobilized on chips and

the chips were then hybridized with fluorescence-labeled reference targets produced by asymmetric polymerase chain reaction from

patient DNA. The ratio of the hybridization signals from the reference and test targets with each probe was then calculated. A ratio

of above 3 indicates the presence of a wild-type sequence and a ratio of below 0.3 indicates a mutant sequence. We tested the

sensitivity of the chip for known mutations in tRNALeuðUURÞ and tRNALys genes and found that it can also be used to discriminate

multiple mutations and heteroplasmy, two typical features of human mitochondrial DNA. The XNA on Gold biochip method is a

simple and rapid microarray method that can be used to test rapidly and reliably any SNP in the mitochondrial genome or else-

where. It will be particularly useful for detecting SNPs associated with human diseases.

� 2003 Elsevier Inc. All rights reserved.

Keywords: DNA chip; Oligonucleotide; SNP; MELAS syndrome; MERRF syndrome; Mitochondria; tRNA

The development of high-throughput biochip tech-

nologies has opened up new research possibilities. Bio-

chip technology integrates elements from physics,

chemistry, microelectronics, and life sciences. Thou-

sands of features can be simultaneously measured onbiochips, allowing large-scale genomic [1–6] and prote-

omic [7,8] studies. The current applications of biochip

technologies include cDNA biochips for gene expression

profiling, single-nucleotide polymorphism (SNP)1 bio-

* Corresponding author. Fax: +33-3-88-60-22-18.

E-mail address: [email protected] (C. Florentz).1 Abbreviations used: Arg-HMb, argininosuccinate synthetase;

MERRF, myoclonic epilepsy with ragged-red fibers; MELAS, mito-

chondrial myopathy, encephalopathy, lactic acidosis, and stroke-like

episodes; SNP, single-nucleotide polymorphism; aso, allele-specific

nucleotide; FITC, fluorescent isothiocyanate; RT, room temperature;

SSC, standard saline citrate; SSPE, standard saline phosphate–EDTA;

TBS, Tris-buffered saline; PBS, phosphate-buffered saline; wt, wild

type; mut, mutant.

0003-2697/$ - see front matter � 2003 Elsevier Inc. All rights reserved.

doi:10.1016/S0003-2697(03)00468-8

chips for disease predisposition, proteomic biochips for

protein interactions, and cell or tissue biochips for di-

agnosis and screening of diseases. The large amount of

information carried on chips enables rapid determina-

tion of the functions of thousands or more genes andidentification of gene products with interesting proper-

ties, so that much information about biological mole-

cules can be collected in a short time [1]. However, chips

are relatively expensive, and many researchers prefer to

immobilize hundreds or dozens of their own biomole-

cules on customized biochips to detect changes in the

gene or protein of interest. Therefore, custom-made,

reusable, low-density biochips would undoubtedly be ofgreat value, not only producing rapid results but also

decreasing production costs. A new versatile sensor

platform, XNA on Gold microarray (96-well format),

has been developed for expression profiling, SNP de-

tection/scoring, and diagnostic/prognostic screening.

This chip is based on a streptavidin monolayer, which

mail to: [email protected]

W. Du et al. / Analytical Biochemistry 322 (2003) 14–25 15

captures biotinylated sensor elements, such as peptidesor proteins [9] and nucleic acids (DNA, PNA) [10].

Recently, attention has been focused on the identi-

fication of disease-associated SNPs, i.e., functional

SNPs [1–3,11–18]. These SNPs are all very important

regardless of whether they are in coding or noncoding

regions. Thus, the development of rapid, simple, and

inexpensive methods for detecting SNPs would be of

great value for the diagnosis and prognosis of humanhereditary diseases. Oligonucleotide-based chips have

already been developed for the clinical diagnosis of

gene mutations associated with BRCA1 [1], cystic fi-

brosis [19], and p53 [13]. Here, we optimized a func-

tional monolayer on gold for the detection of human

mitochondrial tRNA gene mutations. These mutations

are associated with a large panel of severe neurode-

generative disorders [20,21]. So far, about 80 differenttRNA gene mutations have been reported (http://

www.gen.emory.edu/mitomap). Most of these muta-

tions were detected by restriction fragment length

polymorphism analysis [22–24] or by use of denaturing

gradient gel electrophoresis [25].

A set of short oligonucleotides covering the DNA

region containing known SNPs was arrayed onto chips

(Fig. 1). The DNA sample of interest was amplified byasymmetric PCR to incorporate fluorescent-labeled

nucleotide targets and hybridized to the biochips.

Duplexes with one or more base mismatches are un-

stable and dissociate easily. Perfectly base paired oli-

gonucleotide–DNA duplexes are formed efficiently and

give stronger fluorescent signals than mismatched hy-

brids. This efficient, specific, and reproducible hy-

bridization chip procedure demonstrates the inherentproperties of the XNA on Gold chip platform and

shows that it should be possible to use it to detect

SNPs. Probes linked to the chips were designed to

Fig. 1. Schematic diagram of the linker chemistry procedure used to attach pr

chip by a 50 biotin tag, which allows them to bind to the streptavidin coati

corresponding probe perfectly are retained on the chip and detected.

analyze the known mutations at positions 3243, 3251,3256, 3260, 3302, and 3303 in the human mitochon-

drial genes encoding tRNALeuðUURÞ and position 8344

in tRNALys. We optimized this technique and checked

its suitability with a synthetic target (a single-stranded

fluorescent-labeled oligonucleotide) and successfully

applied it to samples from patients already diagnosed

with MELAS syndrome caused by mutation A3243G

or with MERRF syndrome caused by mutationA8344G. We optimized the sensitivity of the system to

overcome inherent difficulties linked to mitochondria,

such as heteroplasmy (presence of both wild-type and

mutation-carrying mitochondrial DNA in samples)

and polymorphisms (presence of nonpathogenic mu-

tations in addition to pathogenic mutations in patient

samples). This technique offers an excellent basis for

engineering chips (series of chips) devoted to the si-multaneous analysis of all previously described path-

ogenic mutations. Furthermore, it can be used to

detect new SNPs.

Materials and methods

Materials

XNA on Gold microarrays and oligonucleotides

(probes and targets) were produced by ThermoHybaid,

Interactiva Division, Germany. Mitochondrial DNA

was collected from patients in different Parisian hospitals.

Patient 1 had MELAS syndrome and mutation A3243G

was detected in the mitochondrial tRNALeuðUURÞ gene.Patients 2 and 3 were diagnosed with MERRF syndromeand mutation A8344G was found in the mitochondrial

tRNALys gene in both cases.

obes to XNA on Gold. Oligonucleotide DNA probes were fixed on the

ng on the glass slide. Only single-stranded DNA targets that match a

http://www.gen.emory.edu/mitomap

http://www.gen.emory.edu/mitomap

16 W. Du et al. / Analytical Biochemistry 322 (2003) 14–25

Preparation of chips

Preparation of XNA on Gold basic chips (support)

XNA on Gold microarrays were used for SNP

analysis. Streptavidin was immobilized on gold surfaces

as reported previously [9,10]. Briefly, standard glass

slides (22� 75mm) covered with a 0.1-lm 24-carat gold

layer were coated with a 50-lm hydrophobic Teflon

film. This creates hydrophilic microwells (1.5mm di-ameter), which prevents nonspecific interactions with

the chip background. A self-assembled monolayer was

formed by incubation in 16-mercaptohexadecanoic acid

solution at room temperature (RT) overnight (Aldrich,

Taufkirchen, Germany). The resulting monolayer was

biotinylated with Biotin-PEO-Amine (Pierce, Rockford,

USA) via linker molecules (N -hydroxysuccinimide and

1-ethyl-3-(3-dimethylaminopropyl)carbodimide) (Sigma,Steinheim, Germany) and then saturated with re-

combinant streptavidin (Sigma).

Preparation of biotinylated oligonucleotide probes

Two series of probes were used. The first series is

based on the sequence of yeast argininosuccinate syn-

thetase (Arg HMb) and the second series is based on the

sequences of human mitochondrial tRNALeuðUURÞ andtRNALys genes. Both probe series (15mers) shared an

allele-specific sequence with a single base substitution in

or near the middle of the given sequence (Fig. 1). These

oligonucleotide probes, consisting of a 50 biotin followed

Fig. 2. Probes used to analyze point mutations in human mitochondrial tR

DNA domain encompassing the gene coding for tRNALeuðUURÞ (3230–3304)nucleotide indicated to the left of the nucleotide position, mutated nucleotid

orders. For each mutation position a series of four antisense probes was sy

resentation of human mitochondrial tRNALys gene, showing the location of t

mutation.

by a poly(T) (unless otherwise indicated) spacer, wereimmobilized onto gold to allow sufficient space to fa-

cilitate the interaction with the labeled target. Both

series were used to standardize XNA on Gold oligo-

nucleotide SNP chips.

Five different lengths of Arg HMb probe were syn-

thesized. The sequences of the biotinylated probes were

as follows: HMb10, 50-biotin-(T)10CGGTGCCGTA-30;HMb12, 50-biotin-(T)10CGGTGCCGTATG-30; HMb14,50-biotin-(T)10CGGTGCCGTATGGA-30; HMb16, 50-biotin-(T)10CGGTGCCGTATGGAAG-30; and HMb18,

50-biotin-(T)10CGGTGCCGTATGGAAGAG-30.The second series of allele-specific probe sequences

(15mers) were complementary to parts of human mito-

chondrial tRNALeuðUURÞ or tRNALys. They corre-

sponded to positions 3243, 3251, 3256, 3260, 3302, and

3303 of the tRNALeuðUURÞ gene or position 8344 of thetRNALys gene of the mitochondrial genome [26,27]. For

each of these positions (3243, 3251, 3256, 3260, 3302,

3303 and 8344), the oligonucleotide was complementary

either to the wild-type nucleotide or to one of the three

other possible nucleotides. Thus, a total of 28 allele-

specific oligonucleotides (aso-a, aso-t, aso-c, aso-g) was

generated (Fig. 2). For example, the sequences of the

four antisense probes for position 3243 in tRNALeuðUURÞ

gene were as follows: 50-biotin-(T)15GGCT*CTGCCA

TCTTA-30 (Leu3243-aso-t) (the star follows the positionof interest), 50-biotin-(T)15GGCA*CTGCCATCTTA-30

(Leu3243-aso-a), 50-biotin-(T)15GGCC*CTGCCATCT

NA genes. (A) Schematic representation of the human mitochondrial

showing the point mutations studied here. These mutations (wild-type

e indicated to the right) are related to various neurodegenerative dis-

nthesized, as illustrated in detail for position 3243. (B) Schematic rep-

he known mutation at position 8344 and the probes used to explore this


TA-30 (Leu3243-aso-c), and 50-biotin-(T)15GGCG*CTGCCATCTTA-30 (Leu3243-aso-g). As another example,

the sequences of the antisense probes for position 8344

of tRNALys were 50-biotin-(T)15GTGTTGGTT*CTCT

TA-30 (Lys8344-aso-t) and derivatives of this.

Preparation of targets

Two types of target were prepared. They consistedeither of a synthetic single-stranded oligonucleotide la-

beled at its 50 end or the product of asymmetric PCR

amplification from mitochondrial DNA of patient

samples. Synthetic targets were as follows. Arg-HMb

target sequence, 50Cy5ATCTGCCGTACGCAGTCAT

CAATCTGATCCAATGAAGATGAGTAATCTCTC

TCTCCTGCCTTTAAATGACTCTTCCATACGGCA

CCGTT-30; tRNALeuA3243T target sequence, 50GTTAAGATGGCAGT*GCCCGGTAATCGCATAAAAC

TTAAAACTTTACAGTCAGAGGTTCAATTCCTC

TTCTTAACACCA-30 (carrying either Cy5 or FITC at

its 50 end). Similarly, other targets for different

tRNALeuðUURÞ gene positions do have the correct nu-

cleotide at the position of interest. tRNALysA8344G

target was prepared in the same manner. Multimutation

tRNALeuðUURÞ targets I and II basically had the samesequence as tRNALeuðUURÞ wild-type target but with

three mutations (see Fig. 8).

Asymmetric PCR was carried out with an AGS Gold

PCR Kit (ThermoHybaid, Interactiva Division, Ger-

many) to generate single-stranded DNA targets from

patient samples. The primers for both tRNALeuðUURÞ

and tRNALys genes were as follows: leucine forward

primer, 50-CCTCCCTGTACCAAAGGA-30 (nucleo-tides 3116–3133 in the human mitochondrial genome),

and reverse primer, 50-AAGAGCGATGGTGAGAG

CTA-30 (nucleotides 3555–3536). (the resulting PCR

fragment, encompassing the tRNALeuðUURÞ gene (nu-

cleotides 3230–3304), was 441 bp long); lysine forward

primer, 50-CTTTGAAATAGGGCCCGTATTTAC-30

(nucleotides 8248–8262), and reverse primer, 50-ATTGT

GGGGGCAATGAATGA-30 (nucleotides 8567–8548)(the resulting PCR fragment, encompassing the tRNALys

gene (nucleotides 8295–8364), was 309 bp long). Both of

these forward primers were labeled with FITC. Four

aymmetric PCR were done in a 200-ll reaction volume

(50 ll� 4) containing 75mM Tris–HCl, pH 9.0, 20mM

(NH4)2SO4, 0.01%Tween 20, 400 lMdNTPmix, 200 nM

forward primer, 2 nM reverse primer, and 100 ng of

template DNA. Following a denaturation step at 95 �Cfor 3min, 20 units of AGS Gold DNA polymerase was

added. PCR was carried out in a Sprint-cycler (Thermo-

Hybaid,UK) at 94 �C for 30 s, 56 �C for 30 s, and 72 �C for

40 s for 40 cycles, followed by a final elongation step

at 72 �C for 10min. The PCR products were purified

with a Qiagen PCR purification kit and precipitated with

ethanol. DNA pellets were dissolved in 50 ll of 5� SSC–0.1% SDS and were loaded onto chips.

Basic optimalized assay for hybridization onto chips

All XNA on Gold chips were prepared and used in

the same manner. To load biotinylated oligonucleotide

probes onto the streptavidin-coated ‘‘microwells’’ of

the chips, biotinylated probes were adjusted to a con-centration of 10 pmol/ll in TBS-T buffer (150mM

NaCl, 10mM Tris–HCl, pH 8.0, 0.1% Tween 20; Sig-

ma). One-microliter aliquots were spotted onto each

microwell by a Tecan Miniprep robot (MSP 9000

Sampler Processor, Tecan, USA). After incubation at

50 �C for 1 h and at 4 �C overnight, chips were rinsed

in water or 0.5% Tween 20 briefly with gentle agitation

and dried in a nitrogen atmosphere. The ready-to-usechips were stored at 4 �C before use. Fifty mictroliters

of hybridization solution (1 lM in 5� SSC–0.1% SDS,

750mM NaCl, 75mM sodium citrate, pH 7.0, 0.1%

SDS; Sigma) (unless otherwise indicated) containing

the labeled target was loaded onto the corresponding

array of the chip, covered with a glass slide, and hy-

bridized in a humidity chamber at 30 �C for 3 h. The

chips were washed three times in 2� SSC–0.1% SDSbuffer at RT for 2min and then in 0:2� SSC–0.1%

SDS at 40 �C for 30min to decrease unspecific binding.

Arrays were scanned with a fluorescence scanner (XNA

ScanPro 20 microarray scanner, ThermoHybaid, UK)

at 488 nm for FITC and at 543 nm for Cy5, respec-

tively. A spatial resolution of 16 bits per pixel and a

pixel size of 50 lm were chosen for scanning the bio-

chips. Image data were quantified with microarrayanalysis software (AIDA 2.11) from Raytest (Strau-

benhard, Germany). The fluorescence obtained with

only loading dilution buffer (TBS-T) was considered to

be the background value. The fluorescence signal is

expressed as arbitrary units per 1mm2 (AU/mm2).

Each step of this procedure was optimized by varying

individual parameters.

Single-nucleotide mutation assay for detection of muta-

tions in human mitochondrial tRNA genes

On the basis of the work described above, chips with

biotinylated antisense probes for human mitochondrial

tRNALeuðUURÞ and tRNALys genes were prepared to

analyze positions 3243, 3251, 3256, 3260, and 8344.

Mitochondrial samples from patients with either wild-type tRNALeuðUURÞ and tRNALys genes or with muta-

tions in these genes were compared by use of asymmetric

PCR, to amplify either tRNALeuðUURÞ or tRNALys as

target. MtDNAs from patients (200 ng) were subjected

to asymmetric PCR with specific primers for

tRNALeuðUURÞ gene in a 200-ll PCR volume. After

ethanol precipitation, the DNA pellet was dissolved in


50 ll of 5� SSC–0.1% SDS solution. The chips werecovered with cover slips and placed in a humidified

chamber at 30 �C for 3 h for hybridization. The chips

were then washed in 2� SSC–0.1% SDS at RT briefly

and then in 0:2� SSC–0.1% SDS at 40 �C for 30min.

Fluorescence was then measured.

Results

Optimization of DNA chips

The hybridization efficiency and the thermal stability

of the hybrids formed between the nucleic acid target

and the short oligonucleotide probe on chips depend

strongly on the nucleotide sequence and the stringency

of the reaction conditions, such as nucleic acid length,base composition, concentration of probe and target,

spacer length, hybridization temperature and time, pH,

and ionic strength [8]. Therefore, these parameters

should be optimized before using chips. All optimization

steps, including loading probes on chips, were done in

the same manner and evaluated according to the final

fluorescence signal obtained.

Fig. 3. Optimization of hybridization step. (A) Optimization of target conce

targets (as indicated) were hybridized with Leu3243-aso-a chips at 30 �C fo

peratures for hybridization of FITC-labeled tRNA Leu A3243T target on

Optimization of hybridization time. HMb 18 chips were hybridized with Cy5

LeuA3243T targets in different hybridization buffers were incubated with Le

buffer. SSC hybridization buffers containing different salt concentrations we

LeuA3243T target.

Probes on chips

The binding of biotinylated probes to streptavidin on

chips was optimal at temperatures over 50 �C with a

probe concentration above 10 lM for 1 lM target (not

shown). Thus, the optimal surface density on each spot

was 1.64� 109 molecules/mm2 and the amount of nu-

cleic acid detectable was 135 pg/mm2. The signal-noise

ratio was optimal with probes formed by (T)15 spacer

arms followed by 15 specific nucleotides. This facilitatedthe interaction of the target for hybridization, reduced

the steric interference of hybrids, and increased the

hybridization intensity (not shown).

Hybridization of targets to probes

The optimization of the hybridization conditions

between the probe and the target is described in Fig. 3.

A reliable and satisfactory hybridization signal-noiseratio was obtained at a target concentration of 1 lM(Fig. 3A). To validate thermal dynamics of hybrid for-

mation in the chips, Leu3243-aso-a chips were hybrid-

ized at different temperatures; the signal-noise ratio was

optimal at 30 �C (Fig. 3B). Further, the hybridization

time course was recorded and an approximately linear

correlation was observed up to 3 h incubation (Fig. 3C).

ntration. Different concentrations of FITC-labeled tRNALeuA3243T

r 3 h. (B) Optimization of hybridization temperature. Different tem-

Leu3243-aso-a chips were assayed with a 3-h incubation period. (C)

-labeled Arg target. (D) Choice of hybridization buffers. FITC-labeled

uA3243T-aso-a chips at 30 �C for 3 h. (E) Stringency of hybridization

re used in chips loaded with Leu3243-aso-a and FITC-labeled tRNA-


Even for incubation times of just half an hour, sufficientfluorescence signals could be clearly detected under op-

timized conditions. Thus, this platform was very sensi-

tive for detecting hybridization signals.

The ionic strength of buffers affects the hybridization

dynamics and discrimination of specific hybridization

signals. For this reason, we tested several hybridization

buffers: 5� SSC–0.1% SDS (pH 7.0), 5� SSPE–0.1%

Tween 20 (pH 7.4), 1� TBS–0.1% Tween 20 (pH 8.0),and PBS (pH 7.5). The signal intensity increased with

the salt concentration in the hybridization buffer. The

binding capacity was stronger with 5� SSC–0.1% SDS

or 5� SSPE–0.1% Tween 20 than with the other two

buffers (Fig. 3D). Fluorescence intensity also increased

as the salt concentration of the SSC hybridization buffer

increased (Fig. 3E).

However, although salt concentration had a positiveeffect on hybridization, it reduced specificity during the

washing step. This is illustrated in Fig. 4, where three

chips loaded with the same series of probes and hybrid-

ized to the same target were washed with different salt

concentrations. Only one of the five probes tested

(Leu3243-aso-t) was expected to match the target fully.

Two led to a single mismatch (Leu3243-aso-c and aso-a),

Fig. 4. Importance of washing buffer stringency after hybridization step to di

of hybrids on three chips loaded with the same pattern of probes (five probes a

tRNALeuA3243-wt target at 30 �C for 3 h under three different washing con

0.1% SDS, or 0:1� SSC–0.1% SDS. Only one probe gave a perfect match wi

and aso-a) contained a single nucleotide mismatch. The two last probes (Lys

for the three fully matching couples.

and two (Lys8344-aso-t and aso-c) did not match at all.The tRNALeuA3243 wild-type target (A at position

3243) hybridized to some extent with three of the probes,

i.e., the expected wild-type probe (aso-t), but also with

nonmatching probes (aso-c and aso-a). The ratio of

fluorescence intensity between wt and mutant (wt/mut

ratio) was maximal when the washing buffer was 0:2�SSC–0.1% SDS. Thus, under these conditions, the chip

becomes specific and it is possible to distinguish betweena full match and a single mismatch.

Reproducibility and scanning environment

To demonstrate the reproducibility of inter- and in-

tra-biochips, six Leu3243-aso-a chips were hybridized

with complementary Cy5-labeled tRNALeuA3243T

target. The fluorescence intensities of each spot and each

chip were quantified. The reproducibility was very high:the mean fluorescence intensity (AU/mm2) of the oli-

gonucleotide chips was 17.83� 2.46 (inter-chip) and

17.29� 3.10 (intra-chip). The coefficient of variation for

the fluorescence signals ranged from 1.8 to 8.9%. Two

parallel tests were carried out to investigate the effect of

scanning environment (wet, dry, and rehydrated) on

fluorescence signals. The fluorescence intensities of dried

stinguish between perfectly matching probe/target pairs. (A) Detection

s indicated, repeated four times) after hybridization with FITC-labeled

ditions. Chips were washed in either 0:5� SSC–0.1% SDS, 0:2� SSC–

th the target (probe Leu3243-aso-t). Two other probes (Leu3243-aso-c

) did not match the tRNALeu3243 target at all. (B) Intensity of signals


chips were dramatically lower than those of the wetchips, regardless of which fluorescence dye (Cy5 or

FITC) was used to label targets. Even when dried chips

were rehydrated for long periods, the fluorescence in-

tensities of the hybridization signals were lower than

those of wet chips, because of partial quenching of dye

emission intensity [10,28] (not shown).

Use of the biochips to detect human mitochondrial tRNA

gene point mutations

Preparation of targets

MtDNA in human blood samples can be easily am-

plified by classical PCR, generating double-stranded

mitochondrial DNA targets covering desired genes or

nucleotide stretches. However, the patients� double-

stranded DNA targets yielded very weak signals(Fig. 5A), even after heat denaturation, as compared to

single-stranded targets with fully matching probes.

Thus, it is important to prepare single-stranded DNA

fragments of a given length for efficient strand-specific

hybridization. Asymmetric PCR involves unequal con-

centrations of the two primers from the beginning. One

of the primers is completely consumed during PCR

amplification, meaning that only the extension productcorresponding to the remaining primer is amplified

during subsequent cycles. The resulting PCR products

were precipitated with ethanol and used directly for

hybridization. This procedure avoids the need for the

complicated isolation of single-stranded targets with

other materials. The products of single-stranded PCR

fragments from two to four asymmetric PCRs were

quantitatively sufficient for use on one SNP array and togive specific hybridization signals on chips (Fig. 5B).

Fig. 5. Effect of the target on signal. (A) Single-stranded and double-stranded

stands for a probe with a deletion at the nucleotide of interest, nucleotide 324

PCR performed on a patient sample to give a detectable signal on a chip. T

Specificity of chips when tested with human samples

To evaluate specificity for the detection of human

mitochondrial tRNA gene mutations, blood samples

from a patient previously diagnosed with MELAS syn-

drome due to a single point mutation (A3243G) in the

tRNALeuðUURÞ gene and from two patients with

MERRF syndrome due to a single point mutation

(A8344G) in the tRNALys gene were analyzed.

The results of the analysis of the MELAS patient areshown in Fig. 6. Several disease-related point mutations

can be found in the mitochondrial tRNALeuðUURÞ geneof patient 1 with MELAS syndrome, including specific

mutations at positions 3243, 3251, 3256, and 3260.

Thus, chips with pairs of duplicated probes (wild type

and mutant) were used to investigate these four posi-

tions simultaneously. These probes were hybridized to

tRNALeuðUURÞ gene-specific targets amplified fromblood samples of a healthy person and the MELAS

patient (Fig. 6). Only the probes that matched the target

perfectly were able to hybridize and were detected. To

decrease interassay interference, a ratio of 3 between

wild-type and mutation fluorescence values was con-

sidered to indicate the presence of a wild-type sequence.

The chips could identify a mutation leading to a single

mismatch (Fig. 6). The ratio was 0.1 when consideringLeu3243-aso-c in the case of a blood sample from the

patient diagnosed with MELAS. None of the other ra-

tios obtained for this sample were below 0.3. This is in

full agreement with the presence of mutation A3243G in

the patient�s mitochondrial DNA.

The results of the analysis of samples from the

MERRF patients are shown in Fig. 7. Chips were de-

signed not only to detection mutations at position 8344of the tRNALys gene but also to distinguish

tRNALeu3243T targets were tested on different Leu3243 probes (aso-d

3). (B) Estimation of the amount of target recovered from asymmetric

he wild type/mutation ratio could be increased by using more target.

Fig. 7. Use of the chips to detect single point mutations in the mitochondrial tRNALys gene in blood samples. Chips were designed with duplicate

series of probes to allow the investigation of nucleotide 8344 within the tRNALys gene either in its wild-type form or mutation A8344G. In addition,

three probes directed toward the tRNALeuðUURÞ gene were coated on the same chips. Targets were obtained by asymmetric PCR using blood samples

from a healthy person and from two patients (patients 2 and 3) previously diagnosed with MERRF syndrome due to a single point mutation

(A8344G) in their mitochondrial tRNALys genes. The PCR primers used here specifically amplified the tRNALys gene. The wt/mut ratios calculated

refer to the fluorescence of spots corresponding to tRNALys-specific probes.

Fig. 6. Use of the chips to detect single point mutations in the mitochondrial tRNALeuðUURÞ gene in blood samples. Chips were designed with

duplicate series of probes to allow the simultaneous investigation of four nucleotide positions within the tRNALeuðUURÞ gene (3243, 3251, 3256, and3260), either in wild-type or mutant forms. Mutant probes were restricted to those allowing the detection of only those mutations known to be

associated to neurodegenerative disorders. Targets were obtained by asymmetric PCR performed with primers specific for the tRNALeuðUURÞ gene,using blood samples from a healthy person and from patient 1, previously diagnosed with MELAS syndrome due to the single point mutation

(A3243G) in his mitochondrial tRNALeuðUURÞ gene. After hybridization and washing, fluorescence was measured for each spot and ratios of fluo-

rescence obtained for wild-type probes and mutant probes (wt/mut ratios) were calculated.


tRNALeuðUURÞ, used here as negative control. PCR

products from the healthy patient sample gave a strong

signal only for the Lys83344-aso-t probe, and thus a wt/

mut ratio of 6.61. However, PCR products from pa-

tients gave strong signals only with Lys8344-aso-c

probes. The, wt/mut ratios were largely below 0.3 for the

two patients, which is also in agreement with the pres-ence of the A8344G mutation.

Natural sequence variability and heteroplasmy, two typ-

ical features of mitochondrial DNA

Mitochondrial DNA is subject to a high rate of

mutations, most of which are not disease related. Ex-

ploration of these polymorphisms by means of sequence

comparisons in large human populations have led to the

description of haplogroups [29]. Thus, there is not onesingle human mitochondrial DNA sequence, but several.


This may a priori complicate the detection of disease-related mutations on chips, due to the possible presence

of a pathogenic mutation and a neighboring polymor-

phism (which may be different depending on the pa-

tient�s haplogroup). The probes used in our study were

based on the reference human mitochondrial DNA se-

quence [26,27] and on known disease-related mutations.

To tackle the question of multiple sequence variations in

the target as compared to the probes, we tested thespecificity and hybridization signals of targets with

multiple mutations. Two synthetic targets correspond-

ing to tRNALeuðUURÞ with three different mutations were

tested on chips coated with a subset of Leu probes al-

lowing the detection of mutations at six positions

(Fig. 8A). Target I contained mutations A3243G,

C3256T, and C3303T, and target II contained mutations

A3243T, A3251G, and A3302G. The probes also madeit possible to test position 3260. Only four and three

strongly fluorescent spots were obtained with target I

and target II, respectively (Fig. 8B). In six of these cases,

the wt/mut fluorescence ratios were below 0.3, con-

firming the presence of three mutations in each of the

two targets. This assay demonstrates that individual

mutations can be detected even if the target contains

multiple mutations.However, this is true only if neighboring mutations

are located far enough apart so that they are not

Fig. 8. Dealing with several mutations in a single sample. (A) Schematic re

sequence, including three point mutations each. (B) Fluorescence on chips lo

target II (right); the ratios of fluorescence intensities obtained for wild-type

detected by the same probe. This is illustrated by theabsence of fluorescence on spots corresponding to both

probes Leu3251-aso-t and aso-a, even though target I

has a wt nucleotide at position 3251 (Fig. 8B). The ab-

sence of signals is due to a mismatch induced by mu-

tation C3256T in the target, although the probe allows

for hybridization with the wild-type nucleotide at this

position. In this example, the proximity of positions

3251 and 3256 leads to interference. As a consequence itmust be stressed that the absence of fluorescent signals

for both probes of a pair (wt and mutant) cannot allow

us to draw conclusions about the status of the nucleotide

of interest (i.e., for nucleotide 3251 with the Leu3251

probes).

It is possible that, in patient samples, a polymor-

phism is so close to a pathogenic mutation that both

would be tested by the same probe, leading to falsepositives (no hybridization). To overcome this problem,

minisequencing can be carried out efficiently on chips

(W. Du et al., unpublished).

Heteroplasmy is defined by the combined presence

of wild-type and mutated mitochondrial DNA in a

given cell (or tissue). Patients with mitochondrial dis-

orders are either homoplasmic with regard to mutated

DNA or heteroplasmic with high levels of mutatedDNA (over 50%) [20,21]. It should be possible to de-

tect a single point mutation in heteroplasmic samples.

presentation of two synthetic targets covering the tRNALeuðUURÞ geneaded with various Leu probes and hybridized to either target I (left) or

and the corresponding mutant probes are indicated.

Fig. 9. Dealing with heteroplasmic samples. (A) Fluorescence on two identical chips loaded in triplicate with two probes and hybridized to 12

combinations of wild-type and mutant targets in different ratios (as indicated in C). (B) Variation of the fluorescence ratio wt/mut in the two ex-

periments. (C) Numerical data for B.


We prepared two chips with Leu3243 probes to allow

the detection of both wild-type and tRNALeuA3243G

targets or both wild-type and tRNALeuA3243T targets

(Fig. 9A). Each spot on the chips was hybridized to

artificial mixtures of synthetic wild-type and mutated

targets, ranging from 0 to 100% wild type. On both

chips, increasing amounts of wild-type target and de-

creasing amounts of mutated targets can be easilyfollowed (Fig. 9B). Interestingly, the mean wt/mut

fluorescence ratio was always below 0.3 when there was

less than 5% wild-type target, i.e., more than 95%

mutant. Conversely, the ratio always exceeded 3 when

there was more than 95% wt in the target, i.e., less than

5% mutant (Figs. 9C and D). Thus, heteroplasmy can

easily be detected on the chips and the limit of sensi-

tivity for this detection is about 5% of one type ofDNA. As patients classically have 50 to 100% mutated

DNA, this detection limit will not lead to false nega-

tives when using chips for diagnosis.

It is possible that both heteroplasmy and polymor-

phisms (next to a disease-related mutation) coexist in a

given patient sample. In these situations, the polymor-

phism would have the greatest effect and lead to a lack

of hybridization with several probes. This would requiredirect sequencing of the DNA region, thus leading to the

discovery of the disease-related mutation and hetero-

plasmy.

Discussion

A number of different support matrixes have been

developed for microarray analysis, including nylon

membranes [30], glass [4,9,10], polypropylene sheets

[31], polyacrylamide gel pads [32], and silicon [3]. An

ideal support matrix should meet the following criteria:

(1) the attachment must be chemically stable, (2) thelinker should be long enough to eliminate undersized

steric interference from the support matrix, (3) the linker

should also be hydrophilic to ensure complete solubility

in aqueous solution, and (4) the chemical attachment

should not produce nonspecific binding to the support

matrix. The most suitable platform is currently a gold-

coated glass surface, because chemisorption of alkan-

ethiols on gold generates highly ordered monolayers[33,34]. The key property of the XNA on Gold platform

is the streptavidin monolayer, which has a repetitive

tetrameric structure and a strong binding affinity for

biotin (Keq 1� 10�15 M�1). The use of streptavidin to

bind any biotinylated molecules is a powerful tool.

Moreover, streptavidin presents a hydrophilic environ-

ment which, when coated with a thin hydrophobic

Teflon film, creates hydrophilic ‘‘microwells’’ at thestreptavidin interface, ensuring that aqueous arrayed

biomolecules are tightly bound to the chip surface. This

maximizes uniformity during array fabrication and thus


reduces cross-contamination between arrayed biomole-cules. Use of this chip saves time and makes the samples

accessible and the location definable.

These chips can be used for any DNA/DNA hy-

bridization. Probe oligonucleotides are precisely immo-

bilized on chips via biotin. All steps of chip preparation

and handling, including hybridization to target and

specificity of discrimination of SNPs, have been opti-

mized. It should be possible to use this technology todiagnose human genetic diseases. So far, we have been

able to detect the A to G transition at nt-3243 of human

mitochondrial tRNALeuðUURÞ gene, which is linked to

MELAS syndrome, and the A to G transition at posi-

tion 8344 of the tRNALys gene, which is linked to

MERRF syndrome. Thus, it can potentially be used to

diagnose disorders linked to point mutations in mito-

chondrial tRNA genes. The hybridization step is highlyspecific and makes it possible to detect a single mis-

match. Furthermore, the technology is sensitive enough

to deal with mitochondria-specific features such as

polymorphism and heteroplasmy.

Acknowledgments

This project was founded by European CommunityGrant QLG2-CT-1999-00660. We thank Hubert Hug,

Joern P€uutz, and Marie Sissler for helpful comments on

the manuscript.

References

[1] J.G. Hacia, L.C. Brody, M.S. Chee, S.P.A. Fodor, F.S. Collins,

Detection of heterozygous mutations in BRCA1 using high-

density oligonucleotide array and two-color fluorescence analysis,

Nat. Genet. 14 (1996) 441–447.

[2] D.I. Stimpson, J.V. Hoijer, W. Hsieh, C. Jou, J. Gordon, T.

Theriault, R. Gamble, J. Baldeschwieler, Real-time detection of

DNA hybridization and melting on oligonucleotide arrays by

using optical wave-guides, Proc. Natl. Acad. Sci. USA 92 (1995)

6379–6383.

[3] R. Jenison, S. Yang, A. Haeberli, B. Polisky, Interference-based

detection of nucleic acid targets on optically coated silicon, Nat.

Biotechnol. 19 (2001) 62–65.

[4] Z. Guo, R.A. Guilfoyle, A.J. Thiel, R. Wang, L.M. Smith, Direct

fluorescence analysis of genetic polymorphisms by hybridization

with oligonucleotide arrays on glass supports, Nucleic Acids Res.

22 (1994) 5456–5465.

[5] M.A. Unger, M. Rishi, V.B. Clemmer, J.L. Hartman, E.A.

Keiper, J.D. Greshock, L.A. Chodosh, M.N. Liebman, B.L.

Weber, Characterization of adjacent breast tumors using oligo-

nucleotide microarray, Breast Cancer Res. 3 (2001) 336–341.

[6] J. Ziauddin, D.M. Sabatini, Microarray of cells expressing defined

cDNAs, Nature 411 (2000) 107–110.

[7] R.P. Huang, R. Huang, Y. Fan, Y. Lin, Simultaneous detection of

multiple cytokines from conditioned media and patient�s sera by

an antibody-based protein array system, Anal. Biochem. 294

(2001) 55–62.

[8] R.F. Service, Science 294 (2001) 2080–2082.

[9] P. Pavlickova, N.M. Jensen, P. Hurbert, M. Schaeferling, C.

Giammasi, M. Kruschina, W. Du, M. Theisen, M. Ibba, F.

Ortigao, D. Kambhampati, XNA on Gold biochip for serodiag-

nosis of Lyme disease, J. Proteome Res. 4 (2002) 7.

[10] J. Bintrup, W. Du, F. Ortigao, M. Krause, K.M. Debatin, E.

Kohn, H. Hug, Easy and rapid detection of point mutations in the

human b-hemoglobin gene with DNA-chips, Biotechnology 2

(2003) 121–130.

[11] E. Lopez-Crapez, T. Livache, J. Marchand, J. Grener, K-ras

mutation detection by hybridization to a polypyrrole DNA chip,

Clin. Chem. 47 (2001) 186–194.

[12] B.J. Conner, A.A. Reyes, C. Morin, K. Itakura, R.L. Teplitz, R.B.

Wallace, Detection of sickle cell b2-globin allele by hybridization

with synthetic oligonucleotides, Proc. Natl. Acad. Sci. USA 80

(1983) 278–282.

[13] S.A. Ahrendt, S. Halachmi, J.T. Chow, L. Wu, N. Halachmi,

S.C. Yang, S. Wehage, J. Jen, D. Sidransky, Rapid p53

sequence analysis in primary lung cancer using an oligonucleo-

tide probe array, Proc. Natl. Acad. Sci. USA 96 (1999) 7382–

7387.

[14] U. Maskos, E. Southern, A novel method for the parallel analysis

of multiple mutations in multiple samples, Nucleic Acids Res. 21

(1993) 2269–2270.

[15] K.J. Livak, W.J. Hainer, A microtiter plate assay for determining

apolipoprotein E genotype and discovery of a rare allele, Hum.

Mutat. 3 (1994) 379–385.

[16] A.C. Syvanen, Detection of point mutations in human genes by

the solid-phase minisequencing method, Clin. Chim. Acta 226

(1994) 225–236.

[17] T.T. Nikiforov, R.B. Rendle, P. Goelet, Y.R. Rogers, M.L.

Kotewicz, S. Anderson, G.L. Trainor, M.R. Knapp, Genetic bit

analysis: a solid phase method for typing signal nucleotide

polymorphisms, Nucleic Acids Res. 22 (1994) 4167–4175.

[18] A. Ahmadian, B. Gharizadeh, A.C. Gustafsson, F. Sterky, P.

Nyren, M. Uhlen, J. Lundeberg, Single-nucleotide polymor-

phism analysis by prosequencing, Anal. Biochem. 280 (2000)

103–110.

[19] M.T. Cronin, R.V. Fucini, S.M. Kim, R.S Masina, R.M. Wespi,

C.G. Miyada, Cystic fibrosis mutation detection by hybridization

to light-generated DNA probe arrays, Hum. Mutat. 7 (1996) 244–

255.

[20] E.A. Schon, E. Bonilla, S. DiMauro, Mitochondrial DNA muta-

tions and pathogenesis, J. Bioenerg. Biomemb. 29 (1997) 131–149.

[21] D.C. Wallace, Mitochondrial diseases in man and mouse, Science

283 (1999) 1482–1488.

[22] Y. Goto, I. Nonaka, S.A. Horai, A mutation in the tRNALeuðUURÞ

gene associated with the MELAS subgroup of mitochondrial

encephalomyopathies, Nature 348 (1990) 651–653.

[23] J. Shoffner, M. Lott, A.M.S. Lezza, P. Seibel, S.W. Ballinger, D.C.

Wallace, Myoclonic epilepsy and ragged red fiber disease

(MERRF) is associated with mitochondrial DNA tRNALys

mutation, Cell 61 (1990) 931–937.

[24] P. Seibel, F. Degoul, N. Romero, C. Marsac, B. Kadenbach,

Identification of point mutations by mispairing PCR as exempli-

fied in MERRF disease, Biochem. Biophys. Res. Commun. 173

(1990) 561–565.

[25] D. Sternberg, C. Danan, A. Lomb�ees, P. Laforeet, E. Girodon, S.

Amselem, Exhaustive scanning approach to screen all the mito-

chondrial tRNA genes for mutations and its application to the

investigation of 35 independent patients with mitochondrial

disorders, Hum. Mol. Genet. 7 (1998) 33–42.

[26] S. Anderson, A.T. Bankier, B.G. Barrel, M.H. de Bruijn, A.R.

Coulson, J. Drouin, I.C. Eperon, D.P. Nierlich, B.A. Roe, F.

Sanger, et al., Sequence and organization of the human mito-

chondrial genome, Nature 290 (1981) 457–465.

[27] R. Andrews, I. Kubacka, P. Chinnery, R.N. Lightowlers, D.M.

Turnbull, N. Howell, Reanalysis and revision of the Cambridge


reference sequence for human mitochondrial DNA, Nat. Genet.

23 (1999) 143.

[28] R.A. Cardullo, S. Agrawal, C. Flores, P.C. Zamecnik, D.E. Wolf,

Detection of nucleic acid hybridization by nonradiative fluores-

cence resonance energy transfer, Proc. Natl. Acad. Sci. USA 85

(1988) 8790–8794.

[29] R. Cann, M. Stoneking, A. Wilson, Mitochondrial DNA and

human evolution, Nature 325 (1987) 31–36.

[30] F. Bertucci, K. Bernard, B. Loriod, Y.-C. Chang, S. Granjeaud,

D. Birnbaum, C. Nguyen, K. Peck, B.R. Jordan, Sensitivity issues

in DNA array-based expression measurements and performance

of nylon microarrays for small samples, Hum. Mol. Genet. 8

(1999) 1715–1722.

[31] R.S. Matson, J. Rampal, S.L. Pentoney, P.D. Anderson,

P. Coassin, Biopolymer synthesis on polypropylene support:

oligonucleotide arrays, Anal. Biochem. 224 (1995) 110–116.

[32] K.A. Khrapko, Y. Lysos, A. Khorlin, V. Shick, V. Florentiev,

A. Mirzabekov, Hybridization of oligonucleotides as a method of

DNA sequencing, FEBS Lett. 256 (1989) 119–122.

[33] C.D. Bain, J. Evall, G.M. Whitesides, Formation of monolayers

by coadsorption of thiols on gold: variation in the head group,

tail group, and solvent, J. Am. Chem. Soc. 111 (1989) 7155–

7164.

[34] H.H.J. Persson, W.R. Caseri, U.W. Suter, Versatile method for

chemical reactions with self-assembled monolayers of alkanethiol

on gold, Langmuir 17 (2001) 3643–3650.

functionalized self-assembled monolayer on gold for detection of human mitochondrial trna gene...

Documents