Functional profiling of recombinant NS3 proteases from all four serotypes of dengue virus using tetra-

and octa-peptide substrate libraries.

Jun Li ‡&, Lim Siew Pheng§&, David Beer§, Viral Patel§, Daying Wen§, Christine Tumanut‡, David C. Tully‡, Jennifer A. Williams‡, Jan Jiricek‡,

John P. Priestle¶, Jennifer L. Harris‡*# and Subhash G. Vasudevan§*#

‡Genomics Institute of the Novartis Research Foundation, 10675 John Jay Hopkins Drive, San Diego, CA 92121, USA, §Novartis Institute for Tropical Diseases, 10 Biopolis Road #05-01

Chromos, Singapore 138670, ¶Novartis Institute for Biomedical Research, Basel, Switzerland

Running Title: High throughput substrate profiling of the Dengue NS2B-NS3 proteases

& These two authors contributed equally to this work. # Address correspondence to: jharris@gnf.org or subhash.vasudevan@group.novartis.com

Regulated proteolysis by the two-component NS2B/NS3 protease of dengue virus is essential for virus replication and maturation of infectious virions. The functional similarity between the NS2B/NS3 proteases from the four genetically and antigenically distinct serotypes was addressed by characterizing the differences in their substrate specificity using tetra- and octa-peptide libraries in positional scanning format, each containing 130,321 substrates. The proteases from different serotypes were shown to be functionally homologous based on the similarity of their substrate cleavage preferences. A strong preference for basic amino acid residues (Arg/Lys) at the P1 positions was observed, while the preferences for the P2, P3 and P4 sites were in the order Arg > Thr > Gln/Asn/Lys, Lys > Arg > Asn and Nle > Leu > Lys > Xaa, respectively. The prime-site substrate specificity was for small and polar amino acids in P1’ and P3’. In contrast, the P2’ and P4’ substrate positions showed minimal activity. The influence of the P2 and P3 amino acids on ground-state binding and the P4 position for transition-state stabilization was

identified through single substrate kinetics with optimal and suboptimal substrate sequences. The specificities observed for Dengue NS2B/NS3 have features in common with the physiological cleavage sites in the dengue polyprotein, however all sites reveal previously unrecognized suboptimal sequences.

Dengue virus is the etiologic agent of dengue fever, dengue hemorrhagic fever (DHF), and dengue shock syndrome (DSS) and is the most prevalent arthropod transmitted infectious disease in humans. Dengue consists of four closely related, but antigenically distinct, viral serotypes (DEN1 to DEN4), of the genus flavivirus (1,2). Following primary infection, lifelong immunity develops, preventing repeated assault by the same serotype but does not provide protection from a virus of a different serotype (3). Dengue diseases are endemic in the tropics and subtropics, and the viruses are maintained in a cycle that involves humans and the Aedes aegypti mosquito. Infection with dengue viruses produces a spectrum of clinical illness ranging from a nonspecific viral syndrome to severe and fatal hemorrhagic disease (1,2). Currently there is no antiviral drug or vaccine available against Dengue viruses and the pathogenesis of the disease is poorly understood.

JBC Papers in Press. Published on June 1, 2005 as Manuscript M500588200

Copyright 2005 by The American Society for Biochemistry and Molecular Biology, Inc.

by guest on Novem

ber 6, 2018http://w

ww

.jbc.org/D

ownloaded from

2

As with other members of the Flaviviridae family, the genomes of the dengue viruses consist of a positive single-stranded RNA of approximately 10,700 bases in length (4). Co-and post-translational processing of the polyprotein, gives rise to three structural proteins, and at least seven non-structural proteins (4). The correct processing of these proteins is essential for virus replication and requires host proteases such as signalase and furin (5) and a two component viral protease NS2B/NS3 (4). Previous studies have showed that the N-terminal part of NS3 contains trypsin-like protease domain (6) and the activity of NS3 was dependent on at least 40 amino acids of NS2B (6-8).

The preferred NS3 protease-cleavage sites in the viral polyprotein have two basic amino

acid residues (Arg-Arg, Arg-Lys, Lys-Arg or occasionally Gln-Arg) at the P2 and P1 positions, followed by a Gly, Ala, or Ser at the P1’ position (4). The crystal structure of the DEN-2 NS3pro in the absence of NS2B has been determined at 2.1 Å resolution by Murthy et al. (9) and shows a shallow substrate binding site indicating a lack of significant interactions beyond P2-P2’. The NS3pro domain in the absence of NS2B is an inefficient protease as demonstrated by the low turnover rate of the small chromogenic substrate, N-α-benzoyl-L-Arg-p-nitroanilide (10). Although NS2B is required for efficient enzymatic activity of the NS3pro, the structure of the latter without the cofactor resembles that of the related hepatitis C NS3 protease bound to its activating peptide NS4A. The exact mechanism by which NS2B cofactor stimulates the protease is not currently known. However, it is plausible that NS2B resembles NS4A and interacts directly with the NS3 protease domain causing a conformational change that extends the binding pockets(10).

The aim of the current study was to elucidate and compare the substrate specificity of NS3 protease from all four serotypes. We performed functional substrate profiling of the P1-P4 and P1’-P4’ for the DEN1-4 protease complexes using tetra- and octa-peptide positional scanning peptide libraries. As a consequence, we expanded the earlier findings on DEN2 NS3 to a broader extent (P4-P4’) and identified that its substrate preference was shared by enzymes of the other three serotypes.

EXPERIMENTAL PROCEDURES Materials― Dengue virus serotype 1

(strain Hawaii), and serotype 4 (H241) were purchased from ATCC (Manassas, VA, USA). Dengue virus serotype 3 (strain S221/03, accession no. AY662691) was obtained from a dengue patient and was a kind gift from Dr Eng Eong Ooi (Environmental Health Institute, Singapore). The plasmids, pGEM-T-(E-NS3) and pET15b-NS3NS5 respectively, containing the NS2B/NS3 and NS3 cDNAs from Dengue virus serotype 2 (strain TSV01, accession no. AY037116) are kind gifts from James Cook University, Queensland, Australia. Dengue virus NS3 protease substrate peptide BOC-gly-arg-arg-amc was purchased from Bachem (Bubendorf, CH). Restriction enzymes and modifying enzymes were purchased from New England Biolabs (Beverly, MA).

RT-PCR of DEN1, 3 and 4 cDNA

fragments encoding NS2B/NS3― C6/36 cells were inoculated with DEN1, 3 or 4 virus and incubated at 28oC for 5-7 days. Cell culture media was collected, and spun at 14K rpm to remove cell debris. Viral RNAs was obtained by extracting 2 ml of the clarified culture media with 1 ml Trizol LS Reagent (Invitrogen; Carlsbad, CA) according to the manufacturer’s instructions. 1st strand cDNA synthesis for the NS2B/NS3 sequences were performed with primers DEN1REV (5’-TGTTGTGGAAGTTTCCCTATTTC-3’), DEN3REV (5’-TGGTGTTATTACTGTTGTGGC-3’) or DEN4REV (5’- GTAAGTTGGCAAACTGGCAATC-3’) with Superscript II (Invitrogen) at 45ºC for 1 h and followed by PCR with Pfu polymerase (Stratagene, La Jolla, CA) and DEN1FOR (5’- TGGCTATGGTACTGTCAATTG), DEN3 FOR(5’- CCATTCTTGGCTTTGGGATTC-3’) or DEN4FOR (5’- CCATTATGGCTGTGTTGTTTG-3’) and the corresponding reverse primers.

Preparation of CF40-gly-NS3pro185

expression constructs― All DEN1-4 CF40gly-NS3pro185 expression constructs comprised the 40aa hydrophilic core sequence of serotype specific NS2B (cNS2B; aa 1394-1440) linked via a flexible Gly4SerGly4 linker to the N-terminal 185 amino acids of NS3 (NS3pro185; aa 1476-1660) (11) and cloned into the vector pET15b

by guest on Novem

ber 6, 2018http://w

ww

.jbc.org/D

ownloaded from

3

(Novagen, Madison, WI). To obtain the cNS2B sequence, PCR was carried out using the primers: DEN1-4 NS2BFOR (DEN1:5’TATGCTCGAGGCCGATTTATCACTGGAGAAA-3’; DEN2: 5’- TATACTCGAGGCTGATTTGGAACTGGAGAG-3’; DEN3: 5’-TATGCTCGAGGCGGACCTCACTGTAGAAAAA-3’; DEN4: 5’- TATGCTCGAGGCAGACCTGTCACTAGAGAAG-3’); and DEN1-4 NS2BREV (DEN1: 5’- CCCGCCTCCACCACTACCTCCGCCCCCGAGTGTGTCATCTCTCTCTTCAT-3’; DEN2: 5’-CCCGCCTCCACCACTACCTCCGCCCCCCAGTGTTTGTTCTTCTTCTTCA-3’; DEN3: 5’- CCCGCCTCCACCACTACCTCCGCCCCCTAGGATATTCTCAGTCTCATCAT-3’; DEN4: 5’- CCCGCCTCCACCACTACCTCCGCCCCCTATCATATTGGTTTCCTCGATGT). To obtain the NS3pro185 sequence, PCR was carried out using the primers: DEN1-4 NS3FOR (DEN1: 5’- GGGGGCGGAGGTAGTGGTGGAGGCGGGTCAGGAGTGCTATGGGACAC-3’; DEN2: 5’- GGGGGCGGAGGTAGTGGTGGAGGCGGGGCCGGAGTATTGTGGGATGT-3’; DEN3: 5’- GGGGGCGGAGGTAGTGGTGGAGGCGGGTCCGGCGTTTTATGGGACG-3’; DEN4: 5’- GGGGGCGGAGGTAGTGGTGGAGGCGGGTCAGGAGCCCTGTGGGAC-3’); and DEN1-4 NS3REV (DEN1: 5’- ATCGATGATCATTACCTAAACACCTCGTCCTCAATC -3’; DEN2: 5’- TAATGGATCCTTACTTTCGAAAGATGTCATCTTCA -3’; DEN3: 5’- GGCGGATCCTTATGCATTTGTTTGCGCTATTCC -3’; DEN4: 5’- GGCGGATCCTTACTTTCGAAAAATGTCCTCATCC -3’). DNA templates were either DEN1, 3 and 4 NS2B/NS3 PCR products or the plasmids pGEM-T-(E-NS3) for DEN2 cNS2B and pET15b-NS3NS5 for DEN2 NS3pro185. DEN1-4 CF40-gly-NS3pro185 chimeric sequences were generated in an overlap PCR reaction with the two PCR products (cNS2B and NS3pro185) and the primers DEN1-4 NS2BFOR and NS3REV. DEN1 CF40-gly-NS3pro185 was digested with XhoI/BclI and DEN2-4 CF40-gly-NS3pro185 were digested with XhoI/BamHI. They were then cloned into the XhoI/BamHI sites in pET15b. All constructs were verified by automated sequencing (PE Applied Biosystems, Foster City, CA).

Expression and purification of DEN 1-4

CF40-gly-NS3pro185― Competent E coli

BL21-CodonPlus-(DE3) (Stratagene) were transformed with pET15b-DEN 1-4 CF40-gly-NS3pro185 expression vectors and grown in 500 ml Luria-Bertani broth containing ampicillin (100 µg/ml), chloramphenicol (50µg/ml) and 0.2% (w/v) glucose at 37 °C with shaking until OD595 reached approximately 0.5. Cells were centrifuged in a Sovall SLA 3000 rotor at 5000g for 10 min and resuspended in 500ml of LB media with ampicillin and chloramphenicol. Cultures were induced with 0.4 mM IPTG and growth was continued for a further 16 h at 16°C. The resulting cells were pelleted and resuspended in 30ml cold lysis buffer (50mM HEPES pH 7.5, 300mM NaCl, 5% glycerol). Cells were passed through a cell disruptor twice at 20 000 psi (Basic Z model, Constant systems Ltd) and debris was removed by centrifugation at 35,000g for 30min. The protein solution was filtered by 0.22 µm filter and loaded onto a 5ml HiTrap chelating HP (Amersham Biosciences, Piscataway, NJ) column equilibrated with the lysis buffer. The resin was washed with 10 column volume lysis buffer before the bound proteins were eluted from the column with lysis buffer and a linear gradient of imidazole from 20-300mM in the same buffer. The peak fractions were analyzed by 10% SDS-PAGE. The positive fractions were pooled, desalted and concentrated with spin concentrators (Amicon Ultra-15ml, Millipore, Billerica, MA) with a molecular weight cut-off of 10,000Da.

SDS-Page gels and Western analysis―

Protein samples were resolved on a 12% SDS-PAGE, transblotted onto Hybond-C membranes (Amersham Biosciences), blocked with 3% nonfat skim milk in PBS, then probed with anti-NS3 polyclonal (a gift from James Cook University) or anti-His monoclonal (1:1000 dilution; QIAgen, Valencia, CA) antibodies for 1 h at room temperature. After extensive washes in 0.05% Tween 20 in PBS, a secondary anti-mouse antibody conjugated to horseradish peroxidase

(1:5000 dilution; Sigma, St Louis, MI) was applied to the blots for at least 1 h at room temperature. Washes were repeated and membrane bound antibodies were detected with ECL chemiluminescence kit (Amersham Biosciences).

Profiling of P4-P1 and P1’-P4’

specificities with substrate libraries― For P4-P1 substrate specificity determination, two-position

by guest on Novem

ber 6, 2018http://w

ww

.jbc.org/D

ownloaded from

4

fixed positional scanning tetrapeptide libraries were synthesized and assayed as previously described (12-15). Assays were carried out in 384-well plates on SpectraMax Gemini EM or XS microtiter plate reader (Molecular Device). The final reaction mixtures (30µl) contained 50mM Tris HCl (pH 8.5), 20% glycerol, 1mM CHAPS and approximately 150 µM total substrate. After enzyme addition (1-3 µM of CF40gly-NS3pro185 proteases) to the tetrapeptide coumarin library, reaction mixtures were incubated at 37°C and the liberated coumarin fluorophore was monitored at a λex of 380 nm and λem of 450 nm. Initial fluorescent velocities in relative fluorescent units per second (RFU/s) were calculated as a fraction of the highest velocity in the library set and plotted into 2D format with DecisionSite (Spotfire).

The octapeptide donor quencher positional scanning library was synthesized and assayed as previously described (16). Briefly, CF40gly-NS3pro185 proteases (0.5-2 µM) were incubated in 96-well plates with 100 µL reaction containing the same buffer as above with approximately 100 µM total substrates (16,17). The reactions were monitored at a λex of 320 nm and λem of 380 nm and initial velocities were analyzed and graphed in DeltaGraph.

Steady-state kinetics of fluorogenic and

chromogenic peptide substrates― Five fluorogenic tetrapeptide substrates with the acmc coumarin leaving group (Bz-nKRR-acmc, Bz-nKTR-acmc, Bz-nTRR-acmc, Bz-TKRR-acmc and Bz-TTRR-acmc) were synthesized using standard fmoc solid-phase peptide synthesis techniques (14,15). The thiobenzyl ester substrate, Bz-nKRR-SBzl, was purchased (Peptides International). After HPLC purification, the concentration of aliquots of each fluorogenic substrate was determined using total hydrolysis with trypsin and the released acmc fluorophore was read at a λex of 380 nm and a λem of 450 nm. The concentration of each substrate was then calculated with standard acmc solutions. The concentration of the SBzl substrate was also determined using total hydrolysis with trypsin and the released SBzl moiety was monitored spectrophotometrically at 324 nm in the presence of 0.5 mM 4,4’-dithiodipyridine and concentration was determined using the extinction coefficient of 19,800 M-1cm-1 for the SBzl-thiopyridine conjugate. Active site titration for purified

CF40gly-NS3pro185 proteases were performed by inhibition with freshly reconstituted aprotinin (18,19). For kinetic studies, CF40gly-NS3pro185 proteases were incubated with various concentrations of individual acmc-, amc-, or SBzl-peptide substrates at 37°C. The proteolytic reaction was monitored as an increase in fluorescence at a λex of 380 nm and λem of 450 nm for the acmc and amc substrates or increase in absorbance at 324 nm in the presence of 0.5 mM 4,4’-dithiodipyridine for the SBlz substrate. Typical reaction mixtures (100µl) contained 50mM Tris HCl pH 8.5 20% glycerol, 1mM CHAPS, 10 nM enzyme and fluorogenic/chromogenic peptide substrates ranging from 0.5 µM to 1mM. Initial fluorescence or absorbance velocities (RFU/min or RAU/min) were converted to M·s-1 from a standard acmc or amc calibration curve or extinction coefficient of 19,800 M-1cm-1 for the SBzl-thiopyridine conjugate. The progression curves were fitted into Michaelis-Menten equation by nonlinear regression using GraphPad Prism. Steady-state kinetic constants of each substrate were determined from duplicate measurements and reported as Mean ± SE.

Model of substrate binding to the NS3 pro

structure― The P4-P4’octapeptide (nKRRSGSG) was fitted to the active site of the enzyme using the crystal structure of the dengue NS3 protease complex with mung bean Bowman-Birk inhibitor (PDB code 1DF9 (20)) as a guide. The side chains of residues 44-51 of the inhibitor, representing P4-P4', were mutated to the sequence of the octapeptide and manually fitted to dengue NS3 protease using the molecular modeling program Maestro (Schrödinger LLC, Portland, Oregon) seeking to maximize electrostatic interactions, hydrogen bonds formation and hydrophobic interactions. The main chain coordinates were not moved, nor were any atoms of the protein altered.

RESULTS In vitro expression and purification of

DEN1-4 CF40-gly-NS3pro185― Clum et al. showed that the expression of the core hydrophilic domain of DEN2 New Guinea C strain NS2B (cNS2B; 40 amino acids) as a N-terminal fusion was sufficient for activating the NS3 protease domain (21). The introduction of a flexible protease resistant 9-aa linker

by guest on Novem

ber 6, 2018http://w

ww

.jbc.org/D

ownloaded from

5

(Gly4SerGly4) generated a soluble and catalytically active protease complex (11). In the study presented here, similar constructs were expressed based on this strategy by cloning the chimeric CF40-gly-NS3pro185 cDNAs derived from dengue serotypes 1-4 into the pET15b vector from Novagen (Materials and Methods). Expression of recombinant DEN2 CF40-gly-NS3pro185 protease as a N-terminal His-tag fusion protein in E.coli followed by affinity purification, led to high yields (typically 15-20 mg from a 1 liter culture) of soluble protein, of which >95% were full length (Fig. 1). The identity of CF40-gly-NS3pro185 was confirmed with western analyses using anti-His and -NS3 antibodies (Fig. 1). The minor lower band detected by the anti-NS3 antibody (asterisk) but not by the anti-His antibody (Fig 1) is presumably the heterodimeric protein without the hexahistidine tag. CF40-gly-NS3pro185 proteases for DEN1, 3 and 4 were similarly expressed and purified, except that the yield of the DEN4 derived enzyme was 10-fold lower (data not shown). Active site titration with aprotinin was used to accurately assess the active enzyme concentration (11). Aprotinin binds to the four CF40gly-NS3pro185 proteases with high affinity (Ki= 79, 25, 88, 6.4 pM for DEN1-4 CF40gly-NS3por185 respectively).

Characterization of enzymatic activity of DEN1-4 CF40-gly-NS3pro185 on a fluorogenic tripeptide substrate― The activities of the four CF40-gly-NS3pro185 enzymes were characterized using the fluorogenic peptide Boc-GRR-amc which had previously been shown to be cleaved by DEN2 NGC cNS2B/NS3 protease complex (10). The Km, Vmax and kcat/Km or substrate specificity for DEN2 CF40gly-NS3pro185 using Boc-GRR-amc was determined by varying the substrate concentration from 1000 to 10µM using 12 serial dilutions (Materials and Methods). The steady-state kinetic parameters obtained were: kcat = 0.13 ± 0.02 s-1, Km= 150 ± 15 µM and kcat/Km = 840 ± 100 M-1 s-1 (Table I).

The activities of the purified DEN1, 3 and 4 CF40-gly-NS3pro185 were characterized using the same Boc-GRR-amc fluorogenic peptide. All four proteases exhibited comparable Km values but the kcat and kcat/Km values showed greater variations, with the values for DEN1 protease being lower and hence the least active (Table I). This observation was consistent also for a DEN 1 protease cloned from a clinical isolate obtained

during the Dengue fever outbreak in the Indonesian city of Jakarta (data not shown).

Profiling of P4-P1 specificities of DEN1-

4 CF40-gly-NS3pro185― To explore the substrate SAR, the P4-P1 substrate specificities of recombinant NS3 proteases from DEN1-4 were examined using tetrapeptide positional scanning synthetic combinatorial libraries of the general structure Ac-X-X-X-X-acc (Fig. 3) (14,15,17). The tetrapeptide substrates were synthesized and assayed as mixtures of peptides in a positional scanning format where two positions were fixed with a specific amino acid and two positions were randomized with 19 amino acids (cysteine and methionine were excluded and norleucine was included). Specifically, the tetrapeptide substrates used in this study represented each combination of the P1-position fixed as a specific amino acid with either a fixed P2-, a fixed P3- or a fixed P4-position for a total of 1083 wells (361 wells for P1 x P2, 361 wells for P1 x P3, and 361 wells for P1 x P4) with each well containing 361 substrates as a mixture (19 randomized amino acids x 19 randomized amino acids x 1 fixed amino acid x 1 fixed amino acid). The total number of substrates in the library was 130,321 (19 x 19 x 19 x 19). Cleavage of the peptide-acc bond results in an increase in fluorescence that can be directly monitored. The total concentration of substrates in each well was approximately 150 µM or approximately 0.4 µM for each substrate. The relative rates for the mixture of substrates are represented in a two-dimensional matrix with each square in the matrix representing both the identity of the two fixed amino acids (x- and y-axis) and the relative activity as indicated on a grey-scale with white representing no activity and black representing the highest activity (Fig. 3B). The activity of the enzyme across all three sub-libraries (P1 x P2, P1 x P3, and P1 x P4) was normalized to the highest activity as indicated by the white-to-black scale below each of the two-dimensional graphs. The enzymatic activity was also represented in histogram form (Fig. 3B) where the P1-position is fixed as Arginine and the x-axis represents the P2-, P3-, and P4-fixed positions and the y-axis represent the normalized hydrolysis rates in relative fluorescence units per second (RFU/s). The substrate specificity at each subsite in the tetrapeptide can be determined by the highest hydrolysis rate (in RFU/s) observed in the individual P2-, P3-, and P4-sub-libraries.

by guest on Novem

ber 6, 2018http://w

ww

.jbc.org/D

ownloaded from

6

The substrate specificities for the four NS3 proteases from DEN1-4 were found to be very similar (Fig. 3B). Since the whole library is assayed at constant substrate concentration, the relative importance of the amino acid at a particular position can be compared with the intensities of corresponding signals across the library. An exclusive preference for basic amino acid residues (either Arg or Lys) at the P1 position was observed in P1-P2, P1-P3 or P1-P4 fixed libraries (Fig. 3B, left panel). After plotting the activities from wells containing Arg at P1, P2-P4 preferences were readily observed in the following order: Arg>Thr>Gln/Asn/Lys for P2, Lys>Arg>Asn for P3 and Nle>Leu>Lys>Xaa for P4 (Fig. 3B, right panel).

Steady-state kinetic constants for the

hydrolysis of optimal substrates by dengue NS3 proteases― For serine proteases, the well established catalytic mechanism involves a two-step process of acylation and deacylation (Mechanism 1).

E + S ES ES* EKd k3 k5

2HN-Protein (prime)

Protein-COOH (non-prime)

Acylation Deacylation

MECHANISM 1

During the acylation step, the catalytic serine acts as a nucleophile to attack the P1-carbonyl of the substrate forming an acyl-enzyme intermediate where the non-prime portion of the peptide substrate remains covalently bound to the enzyme and the prime-site segment of the substrate dissociates from the enzyme. In the subsequent deacylation step, water acts as the nucleophile to form the new C-terminus of the cleaved substrate with the ensuing regeneration of the catalytic serine (22). A consequence of this catalytic mechanism is that the macroscopic steady state constants kcat and Km are related to the acylation (k3) and deacylation (k5) rate constants through the following equations (Equation 1 and 2). (Eq. 1)

kcat =k3 . k5

k3 + k5 (Eq. 2)

Km =k5

k3 + k5Kd

When acylation is rate determining,

k5>>k3, the steady state kinetic constants simplify to kcat = k3 and Km = Kd. For most serine proteases acylation is rate determining for amide bond hydrolysis and deacylation is rate determining for ester bond hydrolysis (22-24). To determine if the acylation step is rate determining for Dengue NS3 protease, the steady state kinetic constants were determined for two substrates that contained the same peptide sequence but with different leaving groups – Bz-nKRR-acmc representing amide bond hydrolysis and Bz-nKRR-SBzl representing thio-ester bond hydrolysis. If deacylation was rate determining for both substrates, then the catalytic rate constants would be largely indistinguishable since the catalytic rate would be dependent on deacylation of the acyl-enzyme intermediate and the acyl-enzyme intermediate formed by both substrates is identical. If acylation is rate determining for one or both of the substrates, then the catalytic rates would be significantly different and would depend on the relative reactivity’s of the leaving groups in the original substrates. Indeed, for Dengue NS3 protease (Table I, DEN4) the kcat for the Bz-nKRR-SBzl substrate is approximately 1000-fold greater than that of the Bz-nKRR-acmc substrate, kcat,SBzl = 300 s-1 versus kcat,acmc = 2.8 s-1. This observation is consistent with acylation being the rate determining step for amide bond hydrolysis by Dengue NS3 protease.

To validate the substrate specificities identified from the non prime-site substrate profiling, we synthesized a series of individual substrates and examined the contribution of P2-P4 positions by comparing their steady-state kinetic parameters (Km, kcat, kcat/Km; Table I). Bz-nKRR-acmc contains the combination of optimal amino acids at P4-P1 while the other substrates, Bz-nKTR-acmc, Bz-nTRR-acmc, Bz-TKRR-acmc and Bz-TTRR-acmc, each contain one or two substitutions at P2-P4 with the corresponding optimal residue replaced by the suboptimal Thr residue. The kcat/Km values of Bz-nKRR-acmc for the four NS3 enzymes are 75-1000 fold higher than that of Boc-GRR-amc, a widely used NS3 substrate (Table I). The increase in activity is due to both a decrease in Km and an increase in kcat. This drastic difference is not likely caused by the use of a modified fluorophore because Bz-nKRR-amc and Bz-nKRR-acmc have comparable Km and kcat values (Table I, DEN4).

by guest on Novem

ber 6, 2018http://w

ww

.jbc.org/D

ownloaded from

7

The recognition of dibasic residues at the P1 and P2 sites by Dengue NS3 protease is considered the key specificity characteristic of flaviviral NS3 enzymes and has been reported by a number of groups (7,8,25). The data presented here demonstrates that P2 is very sensitive to substitution and supports the role of P2 in substrate ground-state binding in view of the markedly increased Km of the suboptimal substrate Bz-nKTR-acmc when compared to Bz-nKRR-acmc (Table I).

The single substrate kinetic data also indicates that non prime-subsites beyond P2 also significantly contribute to substrate binding and turnover. Specifically, a suboptimal P3 substitution (Bz-nTRR-acmc) causes an increase in Km up to 10-fold but has little influence on kcat. The P4 substitution with a suboptimal amino acid, Bz-TKRR-acmc, maintains a similar Km but displays a 6-fold decrease in kcat. The role of P4 in catalysis can also be observed when comparing the suboptimal substrates Bz-nTRR-acmc and Bz-TTRR-acmc. Not surprisingly, changing both P3 and P4 (Bz-TTRR-acmc) to suboptimal residues affects both Km and kcat and leads to the loss of kcat/Km by 34-168 fold.

Profiling of P1’-P4’ specificities of

DEN1-4 NS3 protease― Many lines of evidence have suggested the presence of NS3 protease prime-site substrate specificity. Murthy et al. first reported the crystal structure of the NS3 serine protease domain at 2.1 Å (26). This structure revealed a restricted substrate binding cleft with few predicted interactions beyond P2-P2’. A similarly restricted substrate-enzyme contact was also observed in the structure of NS3 protease bound with Bowman-Birk Inhibitor (20). Mutations in the residues comprising the proposed S1’ pocket (26): Gly133 to Ala substitution strongly reduces the autoprocessing of NS2B-NS3 (27).

To further elaborate the prime-site substrate specificity of NS3, a focused P1’-P4’ octapeptide donor-quencher library was synthesized in a positional scanning format (Fig. 4A). The P1’-P4’ region of the donor-quencher positional scanning library contained a tetrapeptide sequence with one position fixed as a specific amino acid and three positions randomized as 19 amino acids for a total of 130,321 substrates (19 x 19 x 19 x 19) in mixtures of 6,859 per well (19 randomized amino acids x 19 randomized amino acids x 19

randomized amino acids x 1 fixed amino acid). Cleavage of the peptide between the fluorescence donor methoxycoumarin group (MCA) and the quencher dinitrophenyl group (DNP) results in an increase in fluorescence. The library was designed to bias for cleavage between the P1 and P1’ positions by occupying the P4-P1 sites with the sequence nKRR, the non-prime specificity determined from the tetrapeptide positional scanning library (Fig. 3). The dependence of the hydrolysis rate on the identity of the amino acid in the prime-site position is represented in Fig. 4B where the x-axis represents the amino acid in the fixed position and the y-axis represents the relative rate of hydrolysis in RFU/s.

Dengue NS3 proteases from all four serotypes displayed similar prime site substrates specificity as observed in the donor-quencher positional scanning substrate library (Fig. 4). In particular, P1’ and P3’ sites exhibited specificity for small and polar amino acids such as serine while the P2’ and P4’ substrate positions showed minimal activity when compared to the P1’ and P3’ positions.

Correlation of substrate specificities with

natural cleavage sites― The NS3 protease is responsible for the cleavage of at least 2A-AB, 2B-3, 3-4A and 4B-5 boundaries of the viral-encoded polyprotein (Fig. 5B) (6,7,25,28,29). These sites are highly conserved: dibasic residues at P1 and P2 followed by a small or polar residue at P1’ (S, G, A). The only exception is that the N2B/3 sites of all four dengue serotypes contain a Gln residue at the P2 position. The dibasic cleavage patterns are evident from the substrate profiling experiment (summarized in Fig. 5A). At the P3 position, the four sites of DEN1-3 contain optimal Lys/Arg or near optimal Gly while three of DEN4 sites are occupied with unfavorable Ser/Thr/Pro. On the prime-site, the strong preference for Ser at P3’ in profiling study was not reflected in the native sites except for the 3/4A linker in DEN1.

Octapeptide substrate docking into NS3

active site―The structure of the Dengue NS3 protease complexed with Bowman-Birk inhibitor was used to dock the optimized octapeptide (nKRRSGSG) by mutating the corresponding P4-P4’ residues in the bound inhibitor. The schematic of the structure with the potential interacting side-chains are shown in Fig. 6. Despite the strong preference for a positive

by guest on Novem

ber 6, 2018http://w

ww

.jbc.org/D

ownloaded from

8

charge at P1 and P2 positions in the substrate, the corresponding substrate binding pockets do not appear to contain any negative charges. In the S1 pocket, it has been recently suggested that the Tyr 150 may be involved in pi-interaction with the side-chain of P1-Arg (30). The residues that line the P1-pocket are mostly conserved in all the NS3 sequences (data not shown) except at position 115 where Leu, Thr, or Ile can be found. The predicted S2 pocket is lined by the side-chains of Gln 35, and Asn 152. All three residues are completely conserved and it is conceivable that the P2 Arg side-chain may hydrogen bond with Gln 35. In the S3 pocket the side-chains of Leu 128, Asp 129, Pro 132 and Val 155 are completely conserved in all NS3 sequences with the exception of Arg 157 which may be replaced by a Lys or Thr. The prediction of a hydrophobic wall provided by the completely conserved side-chains of Val at positions 153 and 155 is consistent with the P4-norleucine preference from the substrate profiling results. The Ser 135 and His 51 are close to the S2 pocket and positioned to interact with the carbonyl group of the scissile bond. The pockets that occupy the prime-site residues are less prominent except that His 51 may interact with Ser at P1’.

DISCUSSION Four genetically similar but antigenetically

distinct serotypes of dengue viruses (DEN-1-4) have been identified. Each of these serotypes can infect human and induce host immunity to the corresponding serotype. However DHF or DSS is thought to be mostly associated with secondary infections and therefore remains a factor that poses challenges to the development of a safe vaccine (31). The encoded dengue viral protease, NS3, is an attractive therapeutic target as it is essential for the formation of the virally encoded non-structural proteins (32,33).

While efforts are under way to develop protease inhibitors against dengue viral infection, the question remains open if a pan-serotype inhibitor can be developed or if multiple inhibitors will have to be designed for individual serotypes. Based on the sequence analysis, the NS3 proteases from the four serotypes share greater than sixty percent identity in the protease domains (Fig. 2). To reveal the functional similarity between the four dengue NS2B/NS3 proteases, we report the bacterial expression and purification of highly active chimeric single-chain NS2B/NS3 proteases from all four

serotypes. With combinatorial peptide substrate libraries, it was demonstrated for the first time that all four enzymes exhibit very similar substrate specificities at both non-prime-sites (Fig. 3) and prime-sites (Fig. 4). Individual substrate kinetics further confirmed the similar preference and sensitivity to replacement at P4-P1 positions by all four NS3 proteases (Table I). These results suggest that the four NS3 proteases share very similar, if not identical, peptide substrate structure activity relationships and imply that it is possible to develop a single inhibitory agent targeting all four dengue NS3 proteases.

The other open question pertains to the extent that the enzyme substrate binding site. The crystal structure of the DEN2 NS3pro in the absence of NS2B shows a shallow substrate binding site indicating that significant interactions are restricted to P2-P2’(9). The substrate profiling study presented here clearly supports the importance of P2-P2’ in substrate binding as indicated by the strong dibasic preference at P1 and P2 as well as small amino acids at P1’ (Fig. 3, 4). The critical role of P2-P2’ is also reflected in changes of kinetic parameters upon single residue substitution (Table I). For example, Bz-nKRR-acmc binds to the enzyme 3-30 fold tighter compared to their P2 suboptimal counterparts, Bz-nKTR-acmc (3-30 fold increase in Km). More importantly, the profiling and kinetic data reveal for the first time that the P3 position also contributes to the substrate ground-state binding. Substitution of optimal P3 Lys to Thr leads to a decrease in Km by 4-10 fold for all four NS3 proteases. Besides P3, a clear preference for Ser at P3’ also suggests a strong enzyme-substrate interaction beyond P2-P2’. The discrepancy between this observation and the crystal structure could be explained by the difference of enzyme source. The enzymes used in this study are composed of the protease domain of NS3 tethered to the central 40 amino acid of hydrophilic NS2B element that confers full proteolytic activity to NS3 and therefore more closely resembles to its native conformation (11). In contrast, the crystal structure is derived from the NS3pro domain in the absence of NS2B (20,26). Although the structure without the cofactor resembles that of the related hepatitis C NS3 protease bound to its activating peptide NS4A, the exact mechanism by which NS2B cofactor stimulates the protease activity is not currently known. Yusof et al.

by guest on Novem

ber 6, 2018http://w

ww

.jbc.org/D

ownloaded from

9

experimentally compared the kinetic properties of NS3 and NS2B/NS3 and their results suggested that NS2B generates additional specific interactions with the P2 and P3 residues of the substrates (10). It is possible that NS2B activates the NS3 protease directly or interacts with the NS3 protease domain causing a conformational change in the substrate binding pockets (10). Although substitution at P4 from suboptimal Thr to optimal Nle does not significantly alter the Km, it does increase kcat by six-fold. This again supports the idea that the substrate specificity of NS3 protease is influenced by more extensive contact than previously reported.

Several groups have characterized the enzymatic properties of NS2B/NS3 proteases with synthetic peptide substrates bearing endogenous dengue cleavage sites (11,34,35). The best substrate from both studies, Ac-TTSTRR-pNA covers the sequence from NS3/4A cleavage site with a kcat/Km of 275 M-1s-

1. From the current study, Bz-nKRR-acmc was the optimal sequence identified from the profiling experiments and exhibits a kcat/Km of 51,800 M-

1s-1, thus representing a >150-fold improvement in activity over existing substrates.

The studies presented here not only provide a powerful tool to monitor the proteolytic activity of dengue NS3 proteases, but illustrate the fact that natural cleavage sites are not necessarily occupied by optimal residues. The

most obvious example is the conserved glutamine residue at 2B/3 boundary in all four serotypes. Consistent with previously reported results from Kumthong et al. and Leung et al. (11,35), our kinetic study with synthetic peptides resembling the native cleavage sequence revealed much slower kcat/Km for the substrate with 2B/3 sequence (supplemental data). These data support the observation from the in vitro processing study that an intramolecular cleavage between 2A/2B precedes an intramolecular cleavage between 2B/3 (6). The differential rates of cleavage at the four major cleavage sites (Fig. 5B) may guide an ordered processing of dengue viral polypeptide, yield sufficient intermediates with desired function, and harmonize viral replication and assembly. A similar example of timed cleavage has been recently observed with HIV Gag precursor (36-38).

Taken together, a systematic evaluation is presented of the extended substrate specificity of dengue serine proteases from all four distinct serotypes using a combination of synthetic positional scanning combinatorial libraries and single substrate kinetics. This study represents the first observation on the conserved and extended substrate specificities among the four dengue NS3 proteases. The data provided here should facilitate the development of dengue NS3 protease inhibitors with detailed peptide substrate structure-activity relationships and should greatly improve protease activity detection agents.

by guest on Novem

ber 6, 2018http://w

ww

.jbc.org/D

ownloaded from

10

REFERENCES

1. Gubler, D. J. (1998) Clin Microbiol Rev 11, 480-496. 2. Monath, T. P. (1994) Proc Natl Acad Sci U S A 91, 2395-2400 3. Halstead, S. B., Rojanasuphot, S., and Sangkawibha, N. (1983) Am J Trop Med Hyg

32, 154-156 4. Chambers, T. J., Hahn, C. S., Galler, R., and Rice, C. M. (1990) Annu Rev Microbiol

44, 649-688 5. Stadler, K., Allison, S. L., Schalich, J., and Heinz, F. X. (1997) J Virol 71, 8475-8481 6. Preugschat, F., Yao, C. W., and Strauss, J. H. (1990) J Virol 64, 4364-4374 7. Falgout, B., Pethel, M., Zhang, Y. M., and Lai, C. J. (1991) J Virol 65, 2467-2475 8. Zhang, L., Mohan, P. M., and Padmanabhan, R. (1992) J Virol 66, 7549-7554 9. Murthy, H. M., Clum, S., and Padmanabhan, R. (1999) J Biol Chem 274, 5573-5580 10. Yusof, R., Clum, S., Wetzel, M., Murthy, H. M., and Padmanabhan, R. (2000) J Biol

Chem 275, 9963-9969. 11. Leung, D., Schroder, K., White, H., Fang, N. X., Stoermer, M. J., Abbenante, G.,

Martin, J. L., Young, P. R., and Fairlie, D. P. (2001) J Biol Chem 276, 45762-45771. 12. Pinilla, C., Appel, J. R., Blanc, P., and Houghten, R. A. (1992) BioTechniques 13,

901-902, 904-905 13. Rano, T. A., Timkey, T., Peterson, E. P., Rotonda, J., Nicholson, D. W., Beckeer, J.

W., Chapman, K. T., and Thornberry, N. A. (1997) Chemistry & Biology 4, 149-155 14. Harris, J. L., Backes, B. J., Leonetti, F., Mahrus, S., Ellman, J. A., and Craik, C. S.

(2000) Proc Natl Acad Sci U S A 97, 7754-7759 15. Harris, J. L., Alper, P. B., Li, J., Rechsteiner, M., and Backes, B. J. (2001) Chem Biol

8, 1131-1141. 16. Petrassi, H. M., Williams, J. A., Li, J., Tumanut, C., Backes, B. J., and Harris, J. L.

(2005, in press BMCL) 17. Shipway, A., Danahay, H., Williams, J. A., Tully, D. C., Backes, B. J., and Harris, J.

L. (2004) Biochemical and Biophysical Research Communications 324, 953-963 18. Copeland, R. A. (2000) Enzymes: A Practical Introduction to Structure, Mechanism,

and Data Analysis, 2nd Ed., WILEY-VCH 19. Kuzmic, P., Sideris, S., Cregar, L. M., Elrod, K. C., Rice, K. D., and Janc, J. W.

(2000) Anal Biochem 281, 62-67 20. Murthy, H. M., Judge, K., DeLucas, L., and Padmanabhan, R. (2000) J Mol Biol 301,

759-767 21. Clum, S., Ebner, K. E., and Padmanabhan, R. (1997) J Biol Chem 272, 30715-30723 22. Zerner, B., and Bender, M. L. (1964) Journal of the American Chemical Society 86,

3669-3674 23. Hedstrom, L., Szilagyi, L., and Rutter, W. J. (1992) Science (Washington, DC, United

States) 255, 1249-1253 24. Harris, J. L., Peterson, E. P., Hudig, D., Thornberry, N. A., and Craik, C. S. (1998)

Journal of Biological Chemistry 273, 27364-27373 25. Cahour, A., Falgout, B., and Lai, C. J. (1992) J Virol 66, 1535-1542 26. Murthy, H. M., Clum, S., and Padmanabhan, R. (1999) J Biol Chem 274, 5573-5580 27. Valle, R. P., and Falgout, B. (1998) J Virol 72, 624-632 28. Preugschat, F., and Strauss, J. H. (1991) Virology 185, 689-697 29. Arias, C. F., Preugschat, F., and Strauss, J. H. (1993) Virology 193, 888-899 30. Nall, T. A., Chappell, K. J., Stoermer, M. J., Fang, N.-X., Tyndall, J. D. A., Young, P.

R., and Fairlie, D. P. (2004) Journal of Biological Chemistry 279, 48535-48542 31. Rothman, A. L. (2004) J Clin Invest 113, 946-951

by guest on Novem

ber 6, 2018http://w

ww

.jbc.org/D

ownloaded from

11

32. Matusan, A. E., Kelley, P. G., Pryor, M. J., Whisstock, J. C., Davidson, A. D., and Wright, P. J. (2001) J Gen Virol 82, 1647-1656

33. Matusan, A. E., Pryor, M. J., Davidson, A. D., and Wright, P. J. (2001) J Virol 75, 9633-9643.

34. Khumthong, R., Angsuthanasombat, C., Panyim, S., and Katzenmeier, G. (2002) J Biochem Mol Biol 35, 206-212

35. Khumthong, R., Niyomrattanakit, P., Chanprapaph, S., Angsuthanasombat, C., Panyim, S., and Katzenmeier, G. (2003) Protein Pept Lett 10, 19-26

36. Erickson-Viitanen, S., Manfredi, J., Viitanen, P., Tribe, D. E., Tritch, R., Hutchison, C. A., 3rd, Loeb, D. D., and Swanstrom, R. (1989) AIDS Res Hum Retroviruses 5, 577-591

37. Pettit, S. C., Moody, M. D., Wehbie, R. S., Kaplan, A. H., Nantermet, P. V., Klein, C. A., and Swanstrom, R. (1994) J Virol 68, 8017-8027

38. Wiegers, K., Rutter, G., Kottler, H., Tessmer, U., Hohenberg, H., and Krausslich, H. G. (1998) J Virol 72, 2846-2854

FOOTNOTES

Acknowledgements― We thank Fong Chii Shyang, Phong Wai Yee and Andy Yip for assistance in cloning the DEN1-4 protease expression constructs, Drs Mark Schreiber and Ooi Eng Eong for bioinformatics assistance and providing the DEN3 virus stock, respectively.

1The abbreviations used are: aa, amino acid; AC, acetyl; Ac-TTSTRR-pNA, Ac-threonyl-threonyl-seryl-threonyl-arginyl-arginyl-para-nitroanilide; acc, 7-amino-4-carbamoylmethyl coumarin; acmc, 7-amino-3-carbamoylmethyl-4-methyl coumarin; amc, 7-amino-4-methyl coumarin; Boc, tert-butoxycarbonyl; Boc-GRR-amc, Boc-glycyl-arginyl-arginyl-amc; Bz, Benzoyl; Bz-nKRR-acmc, Bz-norleucyl-lysyl-arginyl-arginyl-acmc; Bz-nKRR-acmc, Bz-norleucyl-lysyl-arginyl-arginyl-amc; Bz-nKRR-SBzl, Bz-norleucyl-lysyl-arginyl-arginyl-SBzl; Bz-nKTR-acmc, Bz-norleucyl-lysyl-threonyl-arginyl-acmc; Bz-nTRR-acmc, Bz-norleucyl-threonyl-arginyl-arginyl-acmc; Bz-TKRR-acmc, Bz-threonyl-lysyl-arginyl-arginyl-acmc; Bz-TTRR-acmc, Bz-threonyl-threonyl-arginyl-arginyl-acmc; CF40gly-NS3pro185, NS2B (amino acids 1394-1440) fused to NS3 protease domain (amino acids 1476-1660); DEN1-4, Dengue serotypes 1-4; DHF, Dengue hemorrhagic fever; DNP; dinitrophenyl; DSS , Dengue shock syndrome; DTT, dithiothreitol; IPTG, isopropyl β-D-thiogalactoside; MCA, methoxycoumarin; Nle, n, norleucine; NS3pro, NS3 protease domain (amino acids 1476-1660); RAU, relative absorbance units; RFU, relative fluorescent units; SBzl, thiobenzyl ester.

by guest on Novem

ber 6, 2018http://w

ww

.jbc.org/D

ownloaded from

12

FIGURE LEGENDS

Fig. 1. Expression of recombinant DEN2 CF40-gly-NS3pro185 protein. Expression profiles of DEN2 CF40-gly-NS3pro185 proteins following overnight induction with IPTG as observed on: A, 10% SDS-PAGE gel; B, western analysis with anti-NS3 antibodies; C, western analysis with anti-His-tag antibodies. Lanes (1) consists of pre-IPTG induced bacteria fraction, (2) consists of bacteria fraction induced with IPTG after 16h, (3) consists of whole bacteria cell lysate, (4) clarified supernatant after ultracentrifugation, and (5) purified DEN2 CF40gly-NS3pro185 protein after Ni2+ Hi trap chromatography. Arrow indicates DEN2 CF40-gly-NS3pro185. Asterisk denotes the fraction of CF40-gly-NS3pro185 that has lost its N-terminal His tag. Fig. 2. Percent identity matrix for dengue NS3 protease domain. The amino acid sequences of NS3 protease domain for Dengue 1 (Hawaii Strain), Dengue 2 (TSV01 Strain), Dengue 3 (S221/03 Strain) and Dengue 4 (H241 Strain) are aligned with that of human trypsin 1 mature domain (NP_002760) using Cluster W method (DNASTAR). The percent identity between two domains inversely represents their distance in the phylogenetic tree. Fig. 3. P4-P1 specificity of Dengue NS3 serine proteases. A, The representative structure of peptides in the libraries. B, The initial velocities associated with each substrate in individual library for each NS3 protease were normalized with the highest initial velocity observed and presented in 2D format scaled by grey intensity (white for no activity and black for highest activity). The amino acids are represented as the single letter code and norleucine is represented as “n”. The initial velocities of P4, P3 and P2 positions when P1 is fixed at arginine are presented in the right panels. “X” stands for the 19 amino acid equimolar mixture (cysteine excluded; methionine replaced by the isostere norleucine), “O” for single fixed amino acid, and “R” for arginine. (Numerical data is available in the supplemental material.) Fig. 4. P1’-P4’ substrate specificity of NS3 proteases. A, representative structure of the donor-quencher peptide substrate in a positional scanning library format. P1’-P4’ represents positions in the peptide that are either fixed as a specific amino acid or are an equimolar mixture of 19 amino acids (cysteine excluded; methionine replaced by the isostere norleucine). B, initial velocities associated with each substrate in the library for each NS3 protease were normalized with the highest activity and presented as relative fluorescent units per second (RFU/second). The amino acids are represented by the single letter code and norleucine is represented as “n”. “X” stands for the 19 amino acid equimolar mixture, “O” for single fixed amino acid, and “R” for arginine. Fig. 5. Comparison of subsite specificities of NS3 proteases with their natural cleavage sites in viral polypeptide. A, summary of the P4-P4’ substrate specificities of the NS3 proteases. B, the P6-P6’ boundary cleavage sites between NS2A and NS2B (2A/2B), NS2B and NS3 (2B/3), NS3 and NS4A (3/4A), NS4B and NS5 (4B/5) are listed. Source of dengue viral strain: Dengue 1, Singapore strain; Dengue 2, New Guinea C strain; Dengue 3, H87 strain; Dengue 4, Dominica strain. The P1 and P1’ in each site is separated by a space to indicate the scissile bond. Fig. 6. Summary of theoretical molecular interactions of NS3 protease with substrate. Of the residues that form the various substrate binding pockets, all but two are invariant across the four dengue serotypes. Position 115 is deep in the S1 subsite near the head group of the P1 residues (ε-amino group of Lys or the guanidinium group of Arg) and can either be a Leu (serotypes 2 and 4) or a Thr (serotypes 1 and 3). Replacement of Leu with the smaller Thr side chain enlarges the S1 pocket but removes any direct contact between the side chain of residue 115 and the P1 residue of the substrate. Residue 157 of the dengue NS3 protease can either be a Lys (serotypes 3 and 4), Arg (serotype 2) or Thr (serotype 1).

by guest on Novem

ber 6, 2018http://w

ww

.jbc.org/D

ownloaded from

13

Table I. Steady-state kinetic parameters for the dengue CF40gly-NS3pro185 proteases.

Serotype Substrate kcat (s-1) Km (µM) kcat/Km (M-1s-1)

Boc-GRR-amc 0.03 ± 0.01 120 ± 30 290 ± 20

Bz-nKRR-acmc 0.32 ± 0.01 6.2 ± 0.8 51,800 ± 5,500

Bz-nKTR-acmc 0.97 ± 0.07 202 ± 29 4,820 ± 370

Bz-nTRR-acmc 0.28 ± 0.02 71 ± 15 4,000 ± 600

Bz-TKRR-acmc 0.05 ± 0.01 6.6 ± 1.5 7,520 ± 1,570

DEN1

Bz-TTRR-acmc 0.21 ± 0.03 360 ± 77 580 ± 60

Boc-GRR-amc 0.13 ± 0.02 150 ± 15 840 ± 100

Bz-nKRR-acmc 1.4 ± 0.1 12 ± 2 112,100 ± 18,500

Bz-nKTR-acmc 1.4 ± 0.1 34 ± 10 40,300 ± 10,200

Bz-nTRR-acmc 0.76 ± 0.03 46 ± 6 16,700 ± 2,000

Bz-TKRR-acmc 0.20 ± 0.01 11 ± 1 18,300 ± 2,100

DEN2

Bz-TTRR-acmc 0.17 ± 0.01 76 ± 9 2,200 ± 200

Boc-GRR-amc 0.09 ± 0.02 125 ± 16 690 ± 150

Bz-nKRR-acmc 0.61 ± 0.02 12 ± 1 51,700 ± 5,700

Bz-nKTR-acmc 1.1 ± 0.1 180 ± 20 6,160 ± 370

Bz-nTRR-acmc 0.58 ± 0.02 53 ± 5 10,800 ± 800

Bz-TKRR-acmc 0.10 ± 0.01 13 ± 3 7,400 ± 1,300

DEN3

Bz-TTRR-acmc 0.33 ± 0.02 220 ± 23 1,540 ± 90

Boc-GRR-amc 0.07 ± 0.01 180 ± 40 380 ± 95

Bz-nKRR-acmc 2.8 ± 0.1 7.3 ± 0.9 380,000 ± 40,000

Bz-nKTR-acmc 4.9 ± 0.2 52 ± 5 93,900 ± 7,100

Bz-nTRR-acmc 1.1 ± 0.02 72 ± 4 15,600 ± 600

Bz-TKRR-acmc 0.43 ± 0.01 8.6 ± 0.7 49,200 ± 3,300

Bz-TTRR-acmc 0.48 ± 0.07 210 ± 60 2,250 ± 380

Bz-nKRR-amc 2.9 ± 0.1 8.6 ± 1.8 340,000 ± 72,000

DEN4

Bz-nKRR-SBzl 300 ± 25 6.0 ± 2.9 50,200,000 ± 24,800,000

by guest on Novem

ber 6, 2018http://w

ww

.jbc.org/D

ownloaded from

14

Fig. 1.

(A)

1 2 3 4 5

MW (kDa)

206.7 –

115.8 –

98 –

54.6 –

37.4 –

29.6–

(B)

(C)

*

←

by guest on Novem

ber 6, 2018http://w

ww

.jbc.org/D

ownloaded from

15

Fig. 2

by guest on Novem

ber 6, 2018http://w

ww

.jbc.org/D

ownloaded from

16

Fig. 3A

Fig. 3B

by guest on Novem

ber 6, 2018http://w

ww

.jbc.org/D

ownloaded from

17

Fig. 4A

Fig. 4B

by guest on Novem

ber 6, 2018http://w

ww

.jbc.org/D

ownloaded from

18

Fig. 5A

Fig. 5B

AQTPRR GTGTTGTTNTRR GTGNIGLGGGRR GTGAQG 4B/5

FASGRK SITLDIFAAGRK SLTLNLFAAGRR SVSGDL 3/4A

QVKTQR SGALWDEVKKQR AGVLWDQKKKQR SGVLWD 2B/3

KGASRR SWPLNERTSKKR SWPLNEKIWGRK SWPLNE 2A/2B

Dengue 4

Dengue 3

Dengue 2

Dengue 1

VGTGKR GTGSQG

FAAGRK SIALDL

QKQTQR SGVLWD

DTLKRR SWPLNE

NH

HN

N H

H N

O

O

O

O

N H

H N

N

HN

O

O

O

O P3 P1

P4 P2

H

P1’

P2’

P3’

P4’

Aliphatic /Basic (L/K)

Strong Basic (R/K)

(K/R) Strong

(K/R) Very Strong

Basic

Small(S>G)

Strong Small polar

(S)

(D/E/G) Weak Acidic

(G/X) Weak Small

by guest on Novem

ber 6, 2018http://w

ww

.jbc.org/D

ownloaded from

19

Fig. 6

by guest on Novem

ber 6, 2018http://w

ww

.jbc.org/D

ownloaded from

Supplemental Table 1. Steady-state kinetic parameters of DEN2 CF40-gly-NS3 pro185 using

fluorogenic hexapeptides with natural dengue cleavage sites.

Km (µM)

kcat (s-1)

kcat/Km (M-1 s-1)

2A/2B (Ac-RTSKKR-pNA) 15 ± 5 0.05 ± 0.01 3370 ± 1580

380 ± 150 0.16 ± 0.04 474 ± 208 2B/3 (Ac-EVKKQR-pNA) 79 ± 19 0.10 ± 0.02 1320 ± 678 3/4A (Ac-FAAGRK-pNA) 138 ± 30 0.13 ± 0.02 1020 ± 380 4B/5 (Ac-TTSTRR-pNA)

by guest on Novem

ber 6, 2018http://w

ww

.jbc.org/D

ownloaded from

P4-P1 Preference of Dengue 1 NS3 protease

Arg Lys His Asp Glu Asn Gln Ser Thr Tyr Phe Trp Gly Ala Pro Val Ile Leu NleArg 1 0.66 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Lys 0.26 0.16 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0His 0.06 0.03 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Asp 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Glu 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Asn 0.14 0.05 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Gln 0.28 0.21 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Ser 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Thr 0.53 0.16 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Tyr 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Phe 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0.02 0 0Trp 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Gly 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Ala 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Pro 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Val 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Ile 0.02 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

Leu 0.13 0.08 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Nle 0 0.04 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

Arg Lys His Asp Glu Asn Gln Ser Thr Tyr Phe Trp Gly Ala Pro Val Ile Leu NleArg 0.18 0.11 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Lys 0.51 0.27 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0His 0.12 0.13 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Asp 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Glu 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Asn 0.12 0.08 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Gln 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Ser 0 0.10 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Thr 0 0.11 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Tyr 0 0.05 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Phe 0 0.03 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Trp 0.02 0.06 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Gly 0.24 0.17 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Ala 0 0.09 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Pro 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Val 0 0.07 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Ile 0 0.04 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

Leu 0 0.09 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Nle 0 0.06 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

Arg Lys His Asp Glu Asn Gln Ser Thr Tyr Phe Trp Gly Ala Pro Val Ile Leu NleArg 0.21 0.13 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Lys 0.30 0.15 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0His 0.17 0.12 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Asp 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Glu 0.02 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Asn 0.05 0.08 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Gln 0 0.08 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Ser 0.09 0.22 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Thr 0 0.10 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Tyr 0.14 0.09 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Phe 0.11 0.07 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Trp 0.16 0.15 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Gly 0.30 0.13 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Ala 0.11 0.06 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Pro 0.11 0.06 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Val 0.08 0.04 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Ile 0.03 0.08 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

Leu 0.42 0.11 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0.06Nle 0.43 0.09 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

Supplemental Table 2.

P1Values shown as normalized relative fluorescent units per second (RFU/s)

P1

P4

P2

P1

P3

by guest on Novem

ber 6, 2018http://w

ww

.jbc.org/D

ownloaded from

P4-P1 Preference of Dengue 2 NS3 protease

Arg Lys His Asp Glu Asn Gln Ser Thr Tyr Phe Trp Gly Ala Pro Val Ile Leu NleArg 1 0.65 0 0.05 0 0 0 0 0 0 0 0 0.10 0 0 0 0 0 0Lys 0.24 0.19 0.02 0 0 0 0 0 0 0 0 0 0.04 0 0 0 0 0 0His 0.10 0.03 0.08 0 0 0.02 0 0 0 0 0 0 0 0 0 0 0 0 0Asp 0.08 0 0.13 0 0 0 0 0 0 0 0 0 0 0 0 0 0.06 0 0Glu 0.03 0.03 0.14 0 0 0 0 0 0 0 0 0 0 0 0.02 0 0 0 0Asn 0.32 0.07 0.14 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Gln 0.35 0.18 0.10 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Ser 0.07 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Thr 0.83 0.17 0 0 0 0 0 0 0 0 0 0 0 0.03 0 0 0 0 0Tyr 0.07 0.02 0 0 0 0 0 0 0 0 0 0 0.06 0 0 0 0.03 0 0Phe 0.05 0.03 0 0 0.03 0 0 0 0 0 0 0 0 0 0 0 0 0 0Trp 0.04 0 0 0.06 0 0.02 0 0 0 0 0 0 0 0 0 0 0 0 0Gly 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Ala 0 0 0 0 0 0 0 0 0 0 0 0 0 0.03 0 0 0 0 0Pro 0.03 0 0 0 0.03 0 0 0 0 0 0 0 0 0 0.08 0 0 0 0Val 0.10 0.03 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Ile 0.17 0.03 0 0.02 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

Leu 0.13 0.05 0 0.08 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Nle 0.07 0.04 0 0.04 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

Arg Lys His Asp Glu Asn Gln Ser Thr Tyr Phe Trp Gly Ala Pro Val Ile Leu NleArg 0.36 0.13 0.03 0.04 0 0 0 0 0 0 0 0 0.05 0 0.03 0.02 0.04 0 0Lys 0.71 0.27 0.03 0.02 0 0 0 0 0 0 0 0 0.04 0.02 0 0 0.03 0 0His 0.15 0.07 0.04 0.03 0 0.02 0 0 0 0 0 0 0 0.02 0 0 0 0 0Asp 0.07 0 0 0.02 0 0 0 0 0 0 0 0 0.03 0 0 0 0.02 0 0Glu 0.03 0.02 0.04 0.03 0 0 0 0 0 0 0 0 0.02 0 0 0 0.02 0 0Asn 0.24 0.06 0 0.05 0 0 0 0 0.03 0 0 0 0.10 0.02 0.03 0.03 0.06 0 0Gln 0.12 0.03 0.04 0.04 0 0 0 0 0 0 0 0 0.03 0 0.02 0.04 0.03 0 0Ser 0.19 0.07 0.03 0.02 0 0.02 0 0 0 0 0 0 0.04 0 0 0.02 0.04 0 0Thr 0.18 0.09 0.03 0.03 0 0 0 0 0 0 0 0 0.06 0 0 0 0.02 0 0Tyr 0.08 0.06 0.04 0.04 0 0 0 0 0 0 0 0 0.02 0 0.02 0 0.02 0 0Phe 0.11 0.06 0.04 0.06 0.02 0 0 0 0 0 0 0 0 0 0 0 0.04 0 0Trp 0.08 0.05 0.03 0.06 0 0 0 0 0 0 0 0 0.04 0 0 0 0.03 0 0Gly 0.23 0.11 0.03 0.02 0 0 0 0 0 0 0 0 0.03 0.02 0 0 0.04 0 0Ala 0.22 0.11 0.03 0.05 0 0 0 0 0 0 0 0 0.04 0 0.02 0.02 0.03 0 0Pro 0.12 0.04 0.05 0.03 0 0.03 0 0 0 0 0 0 0 0 0 0 0 0 0Val 0.07 0.07 0.05 0 0 0 0 0 0 0 0 0 0.03 0 0.02 0 0.02 0 0Ile 0.07 0.05 0.05 0 0 0 0 0 0 0 0 0 0.02 0.05 0.03 0 0.02 0 0

Leu 0.10 0.08 0.04 0.03 0 0 0 0 0 0 0 0 0.03 0.03 0 0 0.03 0.02 0.03Nle 0.09 0.08 0.05 0.03 0 0 0 0 0 0 0 0 0.02 0.03 0.02 0 0.03 0 0

Arg Lys His Asp Glu Asn Gln Ser Thr Tyr Phe Trp Gly Ala Pro Val Ile Leu NleArg 0.27 0.11 0.03 0 0 0 0 0 0 0 0 0 0.05 0 0 0.03 0.05 0 0Lys 0.37 0.14 0.04 0.04 0 0 0 0 0 0 0 0 0 0.02 0 0 0.03 0 0His 0.17 0.13 0.04 0.07 0 0 0 0 0 0 0.03 0 0.04 0 0 0.02 0.04 0 0Asp 0.04 0 0 0.03 0 0 0 0 0 0 0 0 0.03 0 0 0 0.02 0 0Glu 0.06 0.02 0 0.03 0 0 0 0 0 0 0 0 0.03 0 0 0 0 0 0Asn 0.20 0.08 0 0.03 0.03 0 0 0 0.03 0 0 0 0.04 0.02 0.02 0.03 0.03 0 0Gln 0.17 0.08 0 0.03 0 0 0 0 0.03 0 0 0 0.03 0 0.02 0.04 0.03 0 0Ser 0.23 0.21 0.03 0.03 0 0 0 0 0.03 0 0 0 0.03 0 0 0.03 0.03 0 0Thr 0.12 0.09 0.03 0.03 0 0 0 0 0 0 0 0 0.03 0 0 0.02 0.03 0 0Tyr 0.14 0.07 0.03 0.03 0 0 0 0 0 0 0 0 0.04 0.02 0 0 0.02 0 0Phe 0.17 0.07 0.02 0.05 0 0 0 0 0.02 0 0 0 0.04 0 0 0.02 0.03 0 0Trp 0.20 0.12 0.03 0.03 0 0.02 0 0 0 0 0 0 0.04 0 0.02 0.02 0.04 0 0Gly 0.24 0.13 0.02 0.03 0 0 0 0 0 0 0 0 0.02 0 0 0 0.02 0 0Ala 0.21 0.09 0 0.06 0 0 0 0 0 0 0 0 0.02 0 0 0.03 0.04 0 0Pro 0.22 0.07 0.04 0.04 0 0.02 0 0 0 0 0 0 0.03 0 0 0.02 0.02 0 0Val 0.13 0.05 0.03 0.03 0 0 0 0 0.02 0 0 0 0.03 0 0 0 0.02 0 0Ile 0.18 0.07 0.05 0.02 0 0 0 0 0 0 0 0 0.07 0 0 0 0.03 0 0

Leu 0.39 0.08 0.04 0.06 0 0 0 0 0.03 0 0 0 0.08 0.02 0 0 0.04 0 0Nle 0.49 0.09 0.05 0 0 0 0 0 0 0 0 0 0.05 0.02 0.02 0 0.03 0 0

Values shown as normalized relative fluorescent units per second (RFU/s)

P1

P1

P4

P2

P1

P3

by guest on Novem

ber 6, 2018http://w

ww

.jbc.org/D

ownloaded from

P4-P1 Preference of Dengue 3 NS3 protease

Arg Lys His Asp Glu Asn Gln Ser Thr Tyr Phe Trp Gly Ala Pro Val Ile Leu NleArg 1 0.41 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Lys 0.27 0.09 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0His 0.05 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Asp 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Glu 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Asn 0.06 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Gln 0.08 0.06 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Ser 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Thr 0.47 0.05 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Tyr 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Phe 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Trp 0.04 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Gly 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Ala 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Pro 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Val 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Ile 0.14 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

Leu 0.27 0.04 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Nle 0.05 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0.06

Arg Lys His Asp Glu Asn Gln Ser Thr Tyr Phe Trp Gly Ala Pro Val Ile Leu NleArg 0.37 0.09 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Lys 0.39 0.12 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0His 0.18 0.07 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Asp 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Glu 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Asn 0.24 0.06 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Gln 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Ser 0.07 0.06 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Thr 0.06 0.06 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Tyr 0.03 0.03 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Phe 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Trp 0.05 0.05 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Gly 0.39 0.16 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Ala 0 0.04 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Pro 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Val 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Ile 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

Leu 0 0.03 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0.08Nle 0 0.02 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

Arg Lys His Asp Glu Asn Gln Ser Thr Tyr Phe Trp Gly Ala Pro Val Ile Leu NleArg 0.28 0.07 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Lys 0.42 0.10 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0His 0.15 0.04 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Asp 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Glu 0.06 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Asn 0.14 0.06 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Gln 0.10 0.03 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Ser 0.18 0.13 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Thr 0.06 0.06 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Tyr 0.18 0.06 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Phe 0.15 0.06 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Trp 0.16 0.08 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Gly 0.29 0.07 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Ala 0.21 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Pro 0.22 0.05 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Val 0.11 0.03 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Ile 0.13 0.05 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

Leu 0.41 0.07 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Nle 0.48 0.06 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

Values shown as normalized relative fluorescent units per second (RFU/s)

P1

P1

P4

P2

P1

P3

by guest on Novem

ber 6, 2018http://w

ww

.jbc.org/D

ownloaded from

P4-P1 Preference of Dengue 4 NS3 protease

Arg Lys His Asp Glu Asn Gln Ser Thr Tyr Phe Trp Gly Ala Pro Val Ile Leu NleArg 1 0.37 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Lys 0.43 0.20 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0His 0.09 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Asp 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Glu 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Asn 0.17 0.02 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Gln 0.13 0.10 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Ser 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Thr 0.33 0.06 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Tyr 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Phe 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0.02 0 0Trp 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Gly 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Ala 0 0 0 0 0 0 0 0 0 0 0.05 0 0 0 0 0 0 0 0Pro 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Val 0.06 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Ile 0.14 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

Leu 0.09 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Nle 0.04 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

Arg Lys His Asp Glu Asn Gln Ser Thr Tyr Phe Trp Gly Ala Pro Val Ile Leu NleArg 0.39 0.12 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Lys 0.86 0.39 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0His 0.10 0.06 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Asp 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Glu 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Asn 0.08 0.04 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Gln 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Ser 0.02 0.06 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Thr 0 0.05 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Tyr 0 0.05 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Phe 0 0.04 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Trp 0 0.04 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Gly 0.30 0.15 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Ala 0 0.03 0 0 0 0 0 0 0 0 0.16 0 0 0 0 0 0 0 0Pro 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Val 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Ile 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

Leu 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0.07Nle 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

Arg Lys His Asp Glu Asn Gln Ser Thr Tyr Phe Trp Gly Ala Pro Val Ile Leu NleArg 0.25 0.07 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Lys 0.40 0.12 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0His 0.17 0.06 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Asp 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Glu 0.05 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Asn 0.12 0.07 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Gln 0.05 0.07 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Ser 0.14 0.14 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Thr 0.04 0.08 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Tyr 0.16 0.06 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Phe 0.13 0.04 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Trp 0.06 0.04 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Gly 0.31 0.10 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Ala 0.17 0.03 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Pro 0.15 0.02 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Val 0.13 0.04 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Ile 0.16 0.06 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

Leu 0.41 0.07 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0Nle 0.37 0.07 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

Values shown as normalized relative fluorescent units per second (RFU/s)

P1

P1

P4

P2

P1

P3

by guest on Novem

ber 6, 2018http://w

ww

.jbc.org/D

ownloaded from

G. VasudevanC. Tully, Jennifer A. Williams, Jan Jiricek, John P. Priestle, Jennifer L. Harris and Subhash Jun Li, Siew Pheng Lim, David Beer, Viral Patel, Daying Wen, Christine Tumanut, David

virus using tetra- and octa-peptide substrate librariesFunctional profiling of recombinant NS3 proteases from all four serotypes of dengue

published online June 1, 2005J. Biol. Chem. 

  10.1074/jbc.M500588200Access the most updated version of this article at doi:

 Alerts:

  When a correction for this article is posted• 

When this article is cited• 

to choose from all of JBC's e-mail alertsClick here

Supplemental material:

  http://www.jbc.org/content/suppl/2005/06/14/M500588200.DC1

by guest on Novem

ber 6, 2018http://w

ww

.jbc.org/D

ownloaded from