functional conservation of b-hairpin dna binding - genetics

Copyright � 2008 by the Genetics Society of AmericaDOI: 10.1534/genetics.108.088690

Functional Conservation of b-Hairpin DNA Binding Domains inthe Mcm Protein of Methanobacterium thermoautotrophicum

and the Mcm5 protein of Saccharomyces cerevisiae

Ronald P. Leon,*,†,1 Marianne Tecklenburg* and Robert A. Sclafani*,†,2

*Department of Biochemistry and Molecular Genetics and the †Program in Molecular Biology,School of Medicine, University of Colorado, Denver, Colorado 80045

Manuscript received February 29, 2008Accepted for publication April 1, 2008

ABSTRACT

Mcm proteins are an important family of evolutionarily conserved helicases required for DNA rep-lication in eukaryotes. The eukaryotic Mcm complex consists of six paralogs that form a heterohexamericring. Because the intact Mcm2-7 hexamer is inactive in vitro, it has been difficult to determine the precisefunction of the different subunits. The solved atomic structure of an archaeal minichromosome main-tenance (MCM) homolog provides insight into the function of eukaryotic Mcm proteins. The N-terminalpositively charged central channel in the archaeal molecule consists of b-hairpin domains essential forDNA binding in vitro. Eukaryotic Mcm proteins also have b-hairpin domains, but their function is un-known. With the archaeal atomic structure as a guide, yeast molecular genetics was used to query thefunction of the b-hairpin domains in vivo. A yeast mcm5 mutant with b-hairpin mutations displays defectsin the G1/S transition of the cell cycle, the initiation phase of DNA replication, and in the binding of theentire Mcm2-7 complex to replication origins. A similar mcm4 mutation is synthetically lethal with themcm5 mutation. Therefore, in addition to its known regulatory role, Mcm5 protein has a positive role inorigin binding, which requires coordination by all six Mcm2-7 subunits in the hexamer.

THROUGHOUT evolution, eukaryotic organismshave developed sophisticated mechanisms to tightly

regulate the duplication of their chromosomes. Properduplication of genetic material requires that organismsreplicate their DNA only once per cell cycle (Bell andDutta 2002; Sclafani and Holzen 2007). These eventsmust be coordinated precisely to prevent mutationsthat may lead to genomic instability, cancer, or celldeath. At the heart of this process is the regulation ofDNA replication, which can be divided into three basicsteps: (i) assembly of the prereplication complex (pre-RC), which accumulates at replication origins; (ii)melting of these origins by helicases required for repli-cation initiation; and (iii) elongation, which occursduring S phase (Bell and Dutta 2002; Sclafani andHolzen 2007).

To initiate DNA replication, several proteins must berecruited to replication origins in a controlled fashion.Orc1-6 proteins [origin recognition complex (ORC)] arebound constitutively to origins in Saccharomyces cerevisiae(Bell and Dutta 2002; Sclafani and Holzen 2007),and together, act as ‘‘landing pads’’ for all other re-

quired DNA replication proteins to bind chromatinand activate origins in G1 phase. Specifically, the ORCrecruits Cdc6p and Cdt1p, both of which are responsi-ble for loading the Mcm2-7p complex, which most likelyacts as the replicative helicase (Tye 1999; Forsburg

2004; Lei 2005). Cdt1p protein binds the Mcm2-7pcomplex and loads it onto Cdc6p that is already boundto the ORC (Randell et al. 2006; Speck and Stillman

2007). The activities of the Dbf4-dependent kinase(DDK) and the cyclin-dependent kinase (CDK) (Tanaka

et al. 2007; Zegerman and Diffley 2007) are then re-quired to activate Cdc45p, which in concert with Sld2p,Sld3p, and the GINS complex loads polymerases ontothe pre-RC (Bell and Dutta 2002; Sclafani andHolzen 2007). Once activation of the Mcm2-7p com-plex has taken place, DNA replication ensues.

The eukaryotic Mcm2-7p complex consists of six es-sential proteins that form a heterohexameric ring. Sub-complexes of Mcm4/6/7p contain ATPase, helicase,and DNA binding activities (Tye 1999; Forsburg 2004).However, the intact Mcm2-7p complex, or any subcom-plexes containing Mcm5p are inactive for DNA bindingand helicase activities in vitro (Ishimi et al. 1998; Lee

and Hurwitz 2000; Schwacha and Bell 2001), al-though weak dsDNA binding has been detected recentlywith recombinant yeast Mcm2-7 complexes in vitro(Bochman and Schwacha 2007). The implication fromthese in vitro studies is that Mcm4/6/7 complexes are

1Present address: Department of Laboratory Medicine and Pathology,Medical School, University of Minnesota, Minneapolis, MN 55455.

2Corresponding author: Department of Biochemistry and MolecularGenetics, P.O. Box 6511, Mail Stop 8101, Bldg. RC-1, Room L18-9100,School of Medicine, University of Colorado, Aurora, CO 80045.E-mail: [email protected]

Genetics 179: 1757–1768 (August 2008)

Dow

nloaded from https://academ

ic.oup.com/genetics/article/179/4/1757/6064680 by guest on 12 February 2022

catalytic and Mcm2/3/5 complexes are regulatory. TheMcm protein complex is thought to form a doublehexamer, a common architecture for many eukaryotichelicases (Tye 1999; Forsburg 2004). Methanobacteriumthermoautotrophicum (MtMcm) represents a simpler sys-tem for studying Mcm proteins, in that it has only a sin-gle Mcm protein with ATPase and helicase activities(Tye 1999; Forsburg 2004). The N-terminal portion ofMtMcm forms a dumbbell-like, double hexamer, whichis homohexameric (Fletcher et al. 2003). The MtMcmstructure has a long, positively charged channel run-ning through the center of the molecule (Figure 1A;Fletcher et al. 2003). In each monomer, basic residuesare found between b-sheets 9 and 10, which forms a b-hairpin with an overall positive charge at the tip in thiscentral channel (Figure 1). Mutation of these basic res-idues in MtMcm reduces DNA binding activity in vitro(Fletcher et al. 2003). Because yeast Mcm5p is similar toMtMcm in this b-hairpin region (Fletcher et al. 2003)and the role of Mcm5p in DNA binding is unknown asit inhibits DNA binding in vitro (Ishimi et al. 1998; Lee

and Hurwitz 2000; Schwacha and Bell 2001), amolecular genetic analysis of the importance of thesebasic residues in Mcm5p was performed. Strains withmutations in these basic residues have severe defects inthe initiation of DNA replication and display a dramaticdecrease in the binding of the Mcm complex to repli-cation origins in vivo. These data demonstrate a clearfunctional conservation of b-hairpin domains in Mcmproteins from different species and suggest that theMcm2-7 protein complex likely requires coordinatedDNA binding from all six members of the heterohexamer.

MATERIALS AND METHODS

Yeast strains, media, and plasmids: All S. cerevisiae strainsused in this study are listed in Table 1. Yeast strains were grownas described previously (Sclafani et al. 1988). To producemcm5-TPTHA, we made mutations using the overlap PCRmethod used previously for mcm5 (Aiyar et al. 1996; Fletcher

et al. 2003). Mutations were marked by addition or deletion ofa DNA restriction site and all plasmids were verified by PCRfollowed by restriction digest and DNA sequencing. To pro-duce mcm5-TP, plasmid pRS414-MCM5 (Hardy et al. 1997) wasused as a template using the following primers in overlap PCRreactions, where lowercase boldface letters represent thenucleotide change. For K304A: (K304A-fwd) CTATAATTCTgccAATGGgGCCGGA and (pRS414-MCM5-rev) CACTATAGGGCG AATTGGGT, (K304A-rev) TCCGGCgCCATTggcAGAATTATAG and (pRS414-MCM5-fwd) CACTATAGGGCGAATTGGGT (adds BglI site). PCR reactions yielded a 2.0-kbfragment, which was cut with XhoI/PstI and cloned into theXhoI/PstI site of pRS414-MCM5 yielding pRS414-mcm5-K304A.For R311A, pRS414-mcm5-K304A was used as a template withthe following primers in overlap PCR reactions: (R311A-fwd)CGGATCaGGAgcGAGCGGGGGTG and (pRS414-MCM5-rev)CACTATAGGG CGAATTGGGT, (R311A-rev) CACCCCCGCTCgcTCCtGATCCG and (pRS414-MCM5-fwd) CACTATAGGGCGAATTGGGT (loses BamHI site). PCR yielded a 2.0-kb frag-ment, which was cut with XhoI/PstI and cloned into the XhoI/

PstI site of pRS414-mcm5-K304A yielding pRS414-mcm5-K304A-R311A. For R324A, pRS414-mcm5-K304A-R311A was used as atemplate with the following primers in overlap PCR reactions:(R324A-fwd) AGTGGTGTTGCaATTgcAACACCTT AT and(pRS414-MCM5-rev) CACTATAGGGCGAATTGGGT, (R324A-rev) ATAAGGTGTTgcAATtG CAACACCACT and (pRS414-MCM5-fwd) CACTATAGGGCGAAT TGGGT (gains MfeI site).PCR reactions yielded a 2.0-kb fragment, which was cut withXhoI/PstI and cloned into the XhoI/PstI site of pRS414-mcm5-K304A-R311A, yielding pRS414-mcm5-K304A-R311A-R324A,the mcm5 triple mutant plasmid (mcm5-TP). To generate thepRS304 integrating versions of these same plasmids, we clonedthe 5.3-kb NotI/XhoI fragment from the pRS414-CDC46 plas-mids to the NotI/XhoI site of pRS304.

To generate MCM5THA and mcm5-TPTHA plasmids, weperformed a PCR reaction on genomic DNA from strain 908(MCM5THA) generating a 1.6-kb fragment with the followingprimers: (MCM5-fwd) CACCACTTCCTCCATTTCCACC and(MCM5-rev) CCCCAG ATTTAGTGAATAAGAGCCC. The 1.6-kb genomic fragment was cut with NruI/BclI and cloned intothe NruI/BclI site of pRS306-MCM5 yielding pRS306-MCM5THA. The pRS306-MCM5THA plasmid was then cutwith BstAPI/NotI, yielding a 5.8-kb fragment, which was ligatedto a 4.1-kb BstAPI/NotI fragment cut from either pRS304-MCM5 or pRS304-mcm5-TP, yielding pRS306-MCM5THA andpRS306-mcm5-TPTHA, respectively.

To generate the MCM4 b-hairpin mutations, the sameoverlap PCR method was used as for MCM5. MCM4 mutationswere marked by the addition or deletion of a DNA restrictionsite and all plasmids were subsequently verified by PCRfollowed by restriction digest and DNA sequencing. To pro-duce mcm4-4A, plasmid pRS316-Mcm4 was used as a PCRtemplate for using the following primers in overlap PCRreactions. Lowercase boldface letters represent the nucleotidechange. For R445A, (R445A fwd) ATCCCCATTgcAGCgAATTCC and (R445A rev) GGAATTgCGTgcAATGGGGAT (addsan EcoRI site). For K454A, (K454A fwd) CGCGTgCTAgcGTCGTTGTAT and (K454A rev) ATACAACGACgcTAGcACGCG(adds NheI site). For K458A, (K458A fwd) TCGTTGTATgcAACATAtGTC and (K458A rev) GACaTATGTTgcATACA ACGA(adds NheI site). For H465A, (H456A fwd) GATGTGGTggcCGTTAAAAAA and TTTTTTAACGgccACCACATC (addsHaeIII site). The following outside primers were used in alloverlap PCR reactions in combination with the above muta-genesis primers: (pRS316-Mcm4 fwd) AGTCAGGGAGAGGGAAACATCAG) and (pRS316-Mcm4 rev) GCAATAGAGCGGGCTAATAAACTG. Final overlap reactions yielded a 1414-bpfragment that was sequentially digested with restrictionenzymes NruI and AfeI, and gel purified with the QIAGENgel purification kit. The final PCR fragment (1232 bp) wasligated into the NruI/AfeI site of pRPL106 (pRS316-MCM4),yielding the final plasmid pRPL107 (pRS316-mcm4-4A). Tomake the pRS305 LEU2 versions of either MCM4 or mcm4-4A,a 4.7-kb SacI/HindIII fragment from either pRPL106 orpRPL107 was inserted into SacI/HindIII of the vectorpRS305, yielding pRAS693 (pMCM4 LEU2) or pRAS691(pmcm4-4A LEU2) or pRS315, yielding pRAS662 (pMCM4LEU2) or pRAS685 (pmcm4-4A LEU2).

To produce the mcm4ThisG-URA3-hisG knockout cassette,the BamHI/BglI fragment from plasmid pNKY51 (Alani et al.1987) and the hisG-URA3-hisG were inserted into the compat-ible BclI site of pRAS662, yielding pRAS668. To knock out theMCM4 gene, strain YRL214 was transformed with pRS662(pMCM4 LEU2), yielding strain RSY1214. RSY1214 was trans-formed with a SalI/SacI restriction fragment containing themcm4ThisG-URA3-hisG disruption from plasmid pRS668. Ura1

transformants were selected on �Ura media, then passedthrough 5-FOA, yielding strain RSY1220 mcm4ThisG (pMCM4

1758 R. P. Leon, M. Tecklenburg and R. A. SclafaniD

ownloaded from

https://academic.oup.com

/genetics/article/179/4/1757/6064680 by guest on 12 February 2022

TABLE 1

S. cerevisiae strains and plasmids

Strains Genotype Source

RSY907 MATa/MATa leu2-98/leu2-98 ade2-101/ade2-101 ura3-52/ura3-52 lys2-801/lys2-801his3-200/HIS3 trp1-1/TRP1 cry1R/CRY1 can1R/CAN1 CYH2/cyh2R MCM5/MCM5THA

Ross-MacDonald

et al. (1999)RSY908 MATa leu2-98 ade2-101 ura3-52 lys2-801 his3-200 MCM5THA This studyyRL154 MATa mcm5DTKanMX4 ura3 trp1 cyh2 leu2 tyr1 ade1 ade2 (YCp50 URA3 MCM5) This studyyRL214 MATa mcm5DTKanMX4 ura3 trp1-289TTRP1 MCM5 cyh2 leu2-3,112 tyr1 ade1 ade2 This studyyRL220 MATa mcm5DTKanMX4 ura3 trp1-289TTRP1 mcm5-TP cyh2 leu2-3,112 tyr1 ade1 ade2 This studyyRL230 MATa mcm5DTKanMX4 ura3 trp1-289TTRP1 MCM5 cyh2 leu2-3,112 tyr1 ade1 ade2

(pDK243)This study

yRL231 MATa mcm5DTKanMX4 ura3 trp1-289TTRP1 MCM5 cyh2 leu2-3,112 tyr1 ade1 ade2(pDK368-7)

This study

yRL236 MATa mcm5DTKanMX4 ura3 trp1-289TTRP1 mcm5-TP cyh2 leu2-3,112 tyr1 ade1 ade2(pDK243)

This study

yRL237 MATa mcm5DTKanMX4 ura3 trp1-289TTRP1 mcm5-TP cyh2 leu2-3,112 tyr1 ade1 ade2(pDK368-7)

This study

yRL251 MATa bar1 his6 mcm5tsTMCM5THA leu2-3,112 ura3 trp1 This studyyRL253 MATa bar1 his6 mcm5tsTmcm5-TPTHA leu2-3,112 ura3 trp1 This studyRSY311 MATa trp1 leu2-3,112 ura3 can1 his6 bar1 Sclafani et al.

(2002)RSY1184 MATa trp1 leu2-3,112 ura3 can1 his6 bar1 mcm5-461 (mcm5ts, C183Y) This studyRSY1214 MATa mcm5DTKanMX4 ura3 trp1-289TTRP1 MCM5 cyh2 leu2-3,112 tyr1 ade1 ade2

(pRAS662)This study

RSY1220 MATa mcm5DTKanMX4 ura3 trp1-289TTRP1 MCM5 cyh2 leu2-3,112 tyr1 ade1 ade2mcm4ThisG (pRAS662)

This study

RSY1225 MATa mcm5DTKanMX4 ura3 trp1-289TTRP1 MCM5 cyh2 leu2-3,112 tyr1 ade1 ade2mcm4ThisG (pRPL106)

This study

RSY1238 MATa mcm5DTKanMX4 ura3 leu2-3,112 his3 ade1 trp1-289TTRP1 mcm5-TP This studyRSY1240 MATa mcm5DTKanMX4 ura3 trp1-289TTRP1 mcm5-TP cyh2 leu2-3,112 ade1 mcm4ThisG

(pRPL106)This study

RSY1241 MATa mcm5DTKanMX4 ura3 trp1-289TTRP1 MCM5 cyh2 leu2-3,112 ade1 mcm4ThisG(pRPL106)

This study

RSY1265 MATa mcm5DTKanMX4 ura3 trp1-289TTRP1 MCM5 leu2-3,112TLEU2 MCM4 ade1mcm4ThisG

This study

RSY1266 MATa mcm5DTKanMX4 ura3 trp1-289TTRP1 MCM5 leu2-3,112TLEU2 mcm4-4A ade1mcm4ThisG

This study

RSY1264 MATa mcm5DTKanMX4 ura3 trp1-289TTRP1 mcm5-TP leu2-3,112TLEU2 MCM4 ade1mcm4ThisG

This study

Plasmids Genotype Source

p583 mcm5-461 Dalton andHopwood (1997)

pRAS651 pRS306-MCM5 URA3 Sclafani et al.(2002)

pRAS662 pRS315-ARS CEN MCM4 LEU2 This studypRAS685 pRS315-ARS CEN mcm4-4A LEU2 This studypRAS668 ARS CEN URA3 mcm4ThisG-URA3-hisG This studypRAS691 pRS305-mcm4-4A LEU2 This studypRAS693 pRS305-MCM4 LEU2pDK243 ARS(1x)/CEN LEU2 Hogan and

Koshland (1992)pDK368-7 ARS(8x)/CEN LEU2 Hogan and

Koshland (1992)pRPL100 ARS/CEN pRS414-MCM5 This studypRPL101 ARS/CEN pRS414-mcm5-TP This studypRPL102 pRS304-MCM5 TRP1 This studypRPL103 pRS304-mcm5-TP TRP1 This studypRPL104 pRS306-MCM5THA URA3 This studypRPL105 pRS306-mcm5-TPTHA URA3 This studypRPL106 pRS316-ARS CEN MCM4 URA3 This studypRPL107 pRS316-ARS CEN mcm4-4A URA3 This study

Origin Binding Domains of Mcm5 1759D

ownloaded from



LEU2). RSY1220 was then transformed with pRS316-MCM4URA3 and selected on�Ura media. These URA3 colonies werethen screened for the loss of LEU2 on nonselective YEPDmedium, yielding strain RSY1225 mcm4ThisG (pMCM4 URA3).

To make the mcm5-TP mcm4-4A double mutant strains, strainRSY1225 was crossed with RSY1238 to yield strain RSY1240mcm5D KanMX4 trp1TTRP1 mcm5-TP mcm4ThisG (pMCM4URA3) and strain RSY1241 mcm5D KanMX4 trp1TTRP1MCM51 mcm4ThisG (pMCM4 URA3). The presence of themcm5-TP allele was followed by PCR and restriction digests.Strains RSY1240 and RSY1241 were then transformed witheither plasmids pRAS691 (LEU2 mcm4-4A) or pRS693 (LEU2MCM4), which were digested with HpaI to target integration tothe leu2-3, 112 locus. These four strains were subjected to 5-FOA to select for loss of the pMCM4 URA3 plasmid. Only theMCM5 MCM4 (strain RSY1265), MCM5 mcm4-4A (strainRSY1266), and mcm5-TP MCM4 (strain RSY1264) combina-tions were found as the mcm4-4A mcm5-TP double mutant isinviable (synthetic lethality).

Mcm5 and Mcm4 protein structural alignments and pre-dictions: Primary sequences were aligned using the CLUSTALW(ver. 1.81) program (http://align.genome.jp/sit-bin/clustalw)as shown in Figure 1C. Although only a portion of the Nterminus is shown, full-length sequences were used for theanalysis. Protein homology/analogY recognition engine(PHYRE) (http://www.sbg.bio.ic.ac.uk/phyre/index.cgi) (Bennett-Lovsey et al. 2008) was used to produce a 3D-atomic model ofScMcm5 and ScMcm4 proteins shown in Figure 1D. PyMol(version 1.0) was used with the Phyre prediction coordinatesto generate the protein fold predictions. This is more accuratethan just a BLAST or CLUSTALW alignments as it is astructure-aided alignment. PHYRE produces a 3D-atomicmodel of the protein by finding a sequence alignment to aknown atomic structure in the structural database. In this case,ScMcm5 and ScMcm4 aligned to the solved N-terminal struc-ture of archaeal MtMCM.

Plasmid loss assays: To generate the strains used for plasmidloss assays, pRS304-MCM5 and pRS304-mcm5-TP were linear-ized with Bsu36I and transformed into yRL154, integrating atthe trp1-289 locus by homologous recombination. Loss of theURA3 MCM5 plasmid was selected using 5-FOA, and Trp1

transformants were selected generating strains yRL214(MCM5) and yRL220 (mcm5-TP). yRL214 and yRL220 werethen transformed with either pDK-243 LEU2 (1x-ARS site) orpDK-368-7 LEU2 (8x-ARS sites), and Leu1 transformants wereselected, generating strains yRL230 (MCM5, 1x-ARS), yRL231(MCM5, 8x-ARS), yRL236 (mcm5-TP 1x-ARS), and yRL237(mcm5-TP, 8x-ARS). The stability of the ARS plasmids wascalculated as described previously (Hogan and Koshland

1992; Loo et al. 1995).Generation of mcm5 ts strains: To generate the parental

mcm5ts strain, plasmid p583 (Dalton and Hopwood 1997) wasdigested with MluI and ClaI, yielding a 1.8-kb fragment, whichwas cloned into the MluI and ClaI sites of pRS306-Mcm5(Pessoa-Brandao and Sclafani 2004) to produce pRAS651(Table 1). pRAS651 was linearized with NruI and transformedto strain RSY311 (Sclafani et al. 2002), resulting in a targetedduplication event at the MCM5 locus. Ura1 transformants wereselected and then purified on 5-FOA media to select for Ura�

‘‘pop-outs.’’ 5-FOAR colonies were screened for the tempera-ture-sensitive phenotype at 37� (frequency 30%). To integrateMCM5 or mcm5-TP into the mcm5ts genome, pRS306-MCM5THA and pRS306-mcm5-TPTHA were both cut withSnaBI to linearize and transformed into the mcm5ts strain,resulting in a targeted duplication event at the MCM5 locus,generating strains yRL251 (mcm5tsTMCM5THA) and yRL253(mcm5tsTmcm5-TPTHA).

Immunoprecipitations and Western blot analysis: Proteinextracts for all immunoprecipitations were prepared asdescribed previously (Pessoa-Brandao and Sclafani

2004). Briefly, 2 mg of protein extract were incubated with30 ml protein G-sepharose beads (Sigma-Aldrich) blocked inPK lysis buffer (50 mm Tris pH 8.0, 50 mm NaCl, 0.1% Tween,0.1% Triton-X-100, 1.0 mm EDTA, 0.1% BSA, 0.01% NaA-zide) and supplemented with 0.5 mm PMSF, 0.8 mg/mlleupeptin/0.6 mg/ml pepstatin for 3 hr at 4�. Primaryantibody was added to each reaction as follows: 50 mg anti-HA antibody (Roche), 2 mg anti-Mcm2p antibody (SantaCruz), or 2 mg anti-Mcm7p antibody (Santa Cruz). Negativecontrols were performed in the absence of antibody andcontaining beads only. All reactions were incubated at 4�with end-over-end rotation for 3 hr. Samples were centri-fuged at 1500 rpm at 4�, and supernatant was mixed with 53boiling sample buffer (13 final), and boiled at 100� for5 min before loading to SDS–PAGE. Pellets were washed3 times with 500 ml of lysis buffer supplemented with 0.5 mm

PMSF, 0.8 mg/ml leupeptin/0.6 mg/ml pepstatin, and re-suspended in 50 ml 2.53 boiling sample buffer. For immu-noblot analysis, 10% of each fraction, whole-cell extract,pellet, or supernatant were resolved as described below.Protein extracts for Western blots were prepared as de-scribed previously (Pessoa-Brandao and Sclafani 2004).For Western blots, protein extracts were resolved by 7%SDS–PAGE, transferred to nitrocellulose membrane, and probedwith anti-mouse Mcm5 monoclonal antibody (Weinreich et al.1999) at a 1:500 dilution, anti-HA antibody (Roche) at a 1:2500dilution, anti-Mcm2p antibody (Santa Cruz) at a 1:1000 dilu-tion, anti-Mcm2-7 (Bowers et al. 2004) at a 1:1000 dilution,and anti-Cdt1(UM185) (Bowers et al. 2004) at a 1:15,000 dilu-tion. For Mcm5 and HA blots, a secondary HRP-conjugatedanti-mouse antibody (Jackson ImmunoResearch) was usedat a 1:3000 dilution. For the Mcm2p blot, a secondary HRP-conjugated anti-goat antibody (Santa Cruz) was used at a1:3000 dilution. For Cdt1p and Mcm2-7p blots (Bowers

et al. 2004), a secondary HRP-conjugated anti-rabbit anti-body (Biorad) was used at a 1:3000 dilution. Immunoblotswere visualized on film using an ECL chemiluminescence kit(Pierce).

Time course and cell synchrony for ChIP analysis: Themcm5ts strains were grown in YEPD to a density of 2 3 107/ml at22� and arrested with nocodazole (final concentration of10 mg/ml) at 22� for 60 min. Cells were placed at 37� for 120 minto complete the nocodazole arrest and inactivate the endog-enous mcm5ts. Cultures were washed twice in 37� YEPD mediato remove nocodazole and released to 37� in prewarmed YEPDcontaining a-factor at 200 nm final concentration. Ten-minutetime points were taken for 60 min at 37�.

Chromatin immunoprecipitation (ChIP) analysis: Chroma-tin immunoprecipitation (ChIP) analysis was performed asdescribed previously (Meluh and Koshland 1997; Sclafani

et al. 2002) with the following modifications: 100 ml yeast cells(2 3 107/ml) were formaldehyde fixed for 2 hr at roomtemperature. Cells were spheroplasted with Zymolyase 100T(Seikagaku) in 20 mm HEPES pH 7.4, 1.2 m sorbitol supple-mented with 0.5 mm PMSF. Spheroplasts were sonicated onice, 6 pulses (output level 5 with microtip, Fisher ScientificModel 550 sonic dismembrator) for 10-sec intervals. Thelysates were centrifuged at 14,000 rpm at 4�, and supernatantswere diluted in IP dilution buffer (0.01% SDS, 1.1% Triton X100, 1.2 mm EDTA, 16.7 mm TRIS pH 8.1, 167 mm NaCl) at 1:9dilution. Immunoprecipitations were set up with 1.5 mlchromatin solution per IP reaction. For HA immunoprecipi-tations, chromatin solution was incubated with 25 mg anti-HAantibody (Roche). For Mcm2p immunoprecipitations, chro-matin solution was incubated with 2 mg anti-Mcm2p antibody


ownloaded from



(Santa Cruz). For Mcm7p immunoprecipitations, chromatinsolution was incubated with 2 mg anti-Mcm7p antibody (SantaCruz). All immunoprecipitations were incubated at 4� for18 hr. BSA blocked protein G-sepharose beads (30 ml, asdescribed above) were added to each reaction, with 4 mgsonicated Lambda DNA (NEB) and incubated at room tem-perature for 2 hr. ChIP chromatin was subjected to PCRanalysis with the following primers: ARS305 fwd-GATTGAGGCCACAGCAAGACCG, ARS305 rev-CTCCGTTTTTAGCCCCCC GTG, ARS1 fwd-GCTGGTGGACTGACGCCAGAAAATGTT, ARS1 rev-GGTGAAA TGGTAAAAGTCAACCCCCTG,ARS501 fwd-CTTTTTTAATGAAGATGACATTG CTCC, ARS5-01rev-GATGATGATGAGGAGCTCCAATC, ARS305 1 8 kb fwd-TCAT TTCACTGGGTAGTTCGC, and ARS305 1 8 kb rev-

CCGACCATACTCACACACAAG. Each PCR product was runon a 1% agarose gel, followed by densitometry analysis usingImageQuant v5.2. For quantitation, the densitometry value forthe no antibody controls were subtracted from the densitom-etry values for both the wild-type (WT) and TP PCR signals. Tocalculate the percentage of immunoprecipitate (IP), the fol-lowing formula was used: percentage of IP ¼ densitometryvalue of IP ‘‘sample’’ divided by 10(a) 3 densitometry value ofthe ‘‘total’’, where (a) is equal to the volume of the IP sampleused in the PCR reaction divided by the volume of the totalused in the PCR reaction 3 100. Typically, 2.5 ml of the IPsample were used per 25 ml PCR reaction, and 1 ml of the total(diluted at 1:20 in H2O) was used per 25 ml PCR reaction. AllChIP experiments were repeated three times.

Figure 1.—The overall atomic structure of theN-terminal domain of the MtMcm protein ascompared to eukaryotic homologs. (A) Space fill-ing model of the end view of the MtMcm mole-cule that shows enrichment of positivelycharged amino acids in the central channel. Pos-itively charged residues are in blue, negativelycharged residues, in red. (B) A ribbon diagramof the MtMcm showing the six b-hairpins facingtoward the central channel. The indicated b-hair-pin contains b9-turn-b10 (9 and 10 in red). (C)CLUSTALW alignment of eukaryotic Mcm5 pro-teins, yeast Mcm4, and archaeal SsoMCM andMthMCM proteins (Hs, Homo sapiens (human);Xl, Xenopus laevis (frog); Dr, Danio rerio (zebra-fish); Dm, Drosophila melanogaster (fruit fly); Caeno-rhabditis elegans (nematode); Kl, K. lactis (creameryyeast); Sp, S. pombe (fission yeast); Sc, S. cerevisiae(ale yeast); Sso, S. solfataricus (crenarchaeon), Mth,M. thermoautotrophicum (euryarchaeon). Basic res-idues between b-sheets 9 and 10 that have beenmutated or are mutated in this report are inred letters. (D) Structural predictions for ScMcm5and ScMcm4 proteins that were generated withPyMol (version 1.0) using the PHYRE predictioncoordinates and the known atomic structure ofN-terminal domain of MthMcm (bottom) as de-scribed in materials and methods. Basic resi-dues at the tip of the b-hairpin domains areindicated with arrows. The extra N-terminal do-main in ScMCM4 is also indicated. A and B areadapted from Fletcher et al. (2003).


ownloaded from



Fluorescent-activated cell sorter analysis: Cells were grownin YEPD and processed for fluorescent-activated cell sorter(FACS) analysis (Ostroff and Sclafani 1995).

RESULTS

mcm5-TP shows defects in the initiation phase ofDNA replication: To explore the possibility of a commonstructure and function of yeast Mcm proteins, the N-terminal MtMcm crystal structure (Fletcher et al. 2003)was used as a model to query the in vivo origin bindingproperties of the yeast Mcm2-7p complex. Alanines weresubstituted at positions K304, R311, and R324 in Mcm5,creating a mcm5-triple mutant (mcm5-TP). We focusedon the Mcm5 protein because it is believed to have aregulatory function and not be involved in DNA bindingfrom in vitro studies (Ishimi et al. 1998; Lee and Hurwitz

2000; Schwacha and Bell 2001). In addition, becauseother yeast Mcm proteins have been shown to bindorigin chromatin by ChIP (Aparicio et al. 1997; Tanaka

et al. 1997), it is assumed that yeast Mcm5 protein alsobinds, but this has never been demonstrated directlyusing ChIP. MtMcm and Mcm5 are also alike in that theyare of a similar size and both lack an additional N-terminal domain seen in other Mcm proteins such as inMcm4 (Fletcher et al. 2003) (Figure 1D), which is thesite of phosphorylation by DDK and CDK (Sheu andStillman 2006). Thus, it is important to investigate thecellular role of Mcm5 protein in binding origins ofreplication by using yeast genetics.

From both the CLUSTALW primary sequence align-ment and the structure-aided PHYRE alignment (Figure1, C and D), these basic residues lie within the potentialb-hairpin domain of Mcm5p, between sheets b9 andb10. Mutation of some of these basic residues in twoarchaeal proteins, MtMcm (R226A K228A) (Fletcher

et al. 2003) and in SsoMcm (K246A R247A), reducesDNA binding activity in vitro (McGeoch et al. 2005). Infact, there is conservation of basic residues in betweenb9 and b10 sheets in all Mcm5 proteins (Figure 1C).The exact alignment is not critical as even in thearchaeal proteins, the residues do not exactly line up(residues highlighted in red in Figure 1C).

The archaeal MtMcm lacks the glycine rich sequencein the b-hairpin domain seen in yeast Mcm5, which hasnine glycines in the loop region containing the 19 addi-tional amino acids. Glycine residues typically have nosecondary structure, and the Phyre program was unableto predict the overall fold of the b-hairpin region due tothis glycine-rich region (Figure 1D). In fact, it is not wellconserved in other eukaryotic Mcm5 proteins such asfrom budding yeast Kluyveromyces lactis (KlMcm5) andin the fission yeast Schizosaccharomyces pombe (SpMcm5),both of which have only one glycine in the region(Figure 1C). The Phyre program also had difficultypredicting part of this region in ScMcm4 (Figure 1D).Nonetheless, the prediction showed that both ScMcm5

and ScMcm4 do indeed have a basic residue near the tip(R324 in ScMcm5 and R445 in ScMcm4) (Figure 1D).

Strains yRL214 and yRL220 were constructed thatcontained either MCM5 or mcm5-TP, respectively, as thesole MCM5 gene integrated at the TRP1 locus, instead ofhaving the MCM5 gene on a ARS CEN plasmid. In thismanner, we avoid the possibility that a mutant growthphenotype results from just the single origin (ARS) onthe plasmid firing inefficiently. The mcm5-TP straingrows slowly with a 5-hr doubling time as compared to2 hr for the MCM5 strain in rich YPD medium at 22�.Most of the phenotype is due to the R324A mutation asK304A or R311A single mutants have little phenotypeand the R324 mutant has a similar growth defect to thetriple mcm5-TP mutant (data not shown).

The mcm5-TP strain also is not temperature sensitiveat 37� or cold sensitive at 16�. Western blots were per-formed on protein extracts from both MCM5 and mcm5-TP strains. Both strains had similar amounts of proteinwhen grown at either 22� or 37� and then probed withan anti-Mcm5 antibody at 22� or 37� (data not shown).Thus, the alanine mutations in the mcm5-TP strain areunlikely to result in unstable Mcm5 protein.

If the b-hairpin domains in Mcm5p were critical forDNA binding in the initiation of DNA replication, ahigher rate of loss of minichromosomes would occur inmcm5-TP as compared to MCM5. This is because lessefficient DNA binding activity should facilitate a lessefficient binding to replication origins (ARS). The sta-bility of minichromosome ARS/CEN plasmids wasmeasured in strains yRL230 and yRL236, which haveonly an MCM5 or mcm5-TP gene, respectively. This‘‘plasmid-loss’’ assay has been used effectively to exam-ine the initiation defects in other replication mutantssuch as cdc6 (Hogan and Koshland 1992) and orc2(Loo et al. 1995). Because the minichromosome hasonly one origin, reduced initiation events will result inincreased minichromosome loss. By increasing thenumber of origins, suppression of plasmid loss willoccur by mass action. In this case, plasmid pDK368-7,which has eight ARS sites, was used to produce strainsyRL231 and yRL237. As expected, the MCM5 strainsshowed a low rate of plasmid loss (,1%) per genera-tion, regardless of the number of ARS sites on the mini-chromosome. In contrast, the mcm5-TP strain yRL236showed a .32% loss rate per generation, which wassuppressed to ,1% with a minichromosome harboringeight ARS sites in strain yRL237. This phenotype issimilar to cdc6 and orc2 mutants defective in theinitiation of DNA replication (Hogan and Koshland

1992; Loo et al. 1995), but is different from a cdc17mutant (DNA polymerase a) defective in the elongationof DNA replication. The cdc17 mutant also displayed anincreased level of plasmid loss, but the phenotype wasnot suppressible by additional ARS origins on theplasmid (Hogan and Koshland 1992). From thesedata, we conclude that the mcm5-TP strain harbors a


ownloaded from



defect in the initiation phase of DNA replication, aphenotype consistent with a defect in DNA binding andfailure to set up a functional pre-RC in G1 phase.

mcm5-TP is unable to rescue the temperature-sensitive phenotype of a mcm5ts strain: Mcm5p fusionsat either the N or C terminus often damage proteinfunction (Labib et al. 2000; Nguyen et al. 2000). There-fore, an internally HA-tagged MCM5 haploid strainRSY908 was isolated from diploid strain RSY907 bytetrad analysis. Strain RSY907 had been produced bytransposon-directed insertions to produce a MCM5THATtag (Ross-MacDonald et al. 1999). We will refer to it asMCM5THA from here on. In 10 tetrads analyzed, theMCM5THA fusion segregated 2:2. All 10 MCM5THAisolates had no phenotype in that they grew at the samerate as an untagged MCM5 strain (1.5 hr doubling timeat 30� in rich YPD medium) and were not temperaturesensitive at 16� or 37�. The 93-amino-acid HA insertionis located between a-helix 4 and b-sheet 2 on the outsideof the protein based on the structure of the archaeal 3Dstructure (Fletcher et al. 2003). Because this HA tag ison the outside of the protein, it should be useful forimmunoprecipitation (see below).

Because the mcm5-TP strain grows poorly and eventu-ally gives rise to ‘‘large-colony’’ suppressors (data notshown), it was difficult to use. Therefore, a strain carry-ing a conditional mcm5ts mutation [C183Y, which wasoriginally called cdc46-1 (Chen et al. 1992)] was used forthe remaining analyses. MCM5 and CDC46 are the samegenes and we will use MCM5 only as recommended bythe Saccharomyces Genome Database (http://www.yeastgenome.org/). MCM5 gene duplications were pro-duced with the mcm5ts strain and either MCM5THA ormcm5-TPTHA in strains yRL251 and yRL253, respec-tively. In these strains, both untagged Mcm5ts and

tagged Mcm5 wild-type or Mcm5-TP mutant proteinsare produced (see below). Thus, the strains grow well atthe permissive temperature (22�) and the phenotype ofthe mcm5-TP mutant will be revealed only at the re-strictive temperature (37�). The strains were arrested inG1 phase with a-factor and then released at either thepermissive or restrictive temperatures. In the mcm5ts

strain, DNA replication is greatly delayed when grownat the restrictive temperature (Figure 2) because theMcm5ts protein cannot integrate into the Mcm2-7 pro-tein complex and drive DNA replication (Dalton andHopwood 1997). The mcm5-TP mutant is nearly in-distinguishable from the mcm5ts parental strain underrestrictive conditions (Figure 2) and therefore, is alsodefective in DNA replication. Similar to the mcm5ts

parental strain, the mcm5tsTmcm5-TP strain is leaky andforms small colonies after 3 days at 37�, while the MCM5strain forms large colonies after 1 day (data not shown).Thus, the b-hairpin mutations in mcm5-TP are detri-mental to its function and reduce its activity, whichexplains its inability to efficiently replicate DNA.

Mcm5-TP protein is incorporated into the Mcm2-7pcomplex and binds the Cdt1 protein: To determine ifthe mutant Mcm5-TP protein is able to integrate intothe hexameric Mcm2-7 complex, an anti-HA antibodywas used to precipitate the HA-tagged Mcm5p from theHA-tagged MCM5 strains grown at the restrictive tem-perature for 3 hr (37�, Figure 3). Importantly, the untag-ged mcm5ts protein was shown previously to be defectivein associating with the remaining subunits of the Mcm2-7 protein complex (Dalton and Hopwood 1997) andto prevent Mcm7 from binding to origins at the re-

Figure 2.—The mcm5ts temperature-sensitive phenotype isrescued by MCM5THA, but not by mcm5-TPTHA. FACS anal-ysis of DNA from synchronized MCM5 and mcm5-TP strains afterG1 release from a-factor. Cells were stained in propidium iodide(as described) and analyzed by FACS. The mcm5-TP mutant hasa similar FACS profile to the parental mcm5ts mutant. Note thatreplication is complete by 40 min in the mcm5tsTMCM5 strain,while both mcm5ts and mcm5tsTmcm5TTP replicate very slowly.

Figure 3.—The Mcm5-TP b-hairpin mutant protein is in-corporated into the Mcm2-7 complex and binds to theCdt1 protein loader. Immunoprecipitations were performedusing extracts from cells grown at 37� for 3 hr and the anti-HA antibody (1HA) or no antibody (beads only, �HA)and probed (‘‘probe’’) with anti-Mcm2, anti-HA, anti-Mcm5,anti-Cdt1, or anti-Mcm2-7 antibodies. ‘‘S’’ and ‘‘P’’ refer to su-pernatant and pellet fractions, respectively. Asterisks indicateeither the (*) HA-tagged or (**) native species of Mcm5pas recognized by the Mcm5 monoclonal antibody (105 or95 kDa, respectively).


ownloaded from



strictive temperature (Aparicio et al. 1997; Tanaka et al.1997). The a-HA immunoprecipitates contained com-parable Mcm2 protein from both MCM5 and mcm5-TPstrains (Figure 3). Furthermore, immunoprecipitatesfrom both MCM5 and mcm5-TP strains also contained asmall amount of Cdt1 protein, which loads the Mcm2-7complex onto chromatin and has been shown to co-immunoprecipitate with Mcm2 (Tanaka and Diffley

2002). Because a similar amount of Mcm2 protein wasshown to co-immunoprecipitate with Cdt1 protein inlog phase cells as in G1-arrested cells (Tanaka andDiffley 2002), the fact that the mutant mcm5-TP cellsbecome synchronized during this experiment does notaffect the result.

Using an antibody which recognizes a common epi-tope in all six Mcm2-7 proteins (Bowers et al. 2004),both tagged wild-type Mcm5 and mutant Mcm5-TP pro-teins also co-immunoprecipitate with the entire Mcm2-7complex (Figure 3). The a-HA antibody quantitativelyimmunoprecipitates the larger (105 kDa) Mcm5-HA pro-tein, which is immunodepleted from the extract (com-pare supernatants and pellets, Figure 3), but not thesmaller, untagged Mcm5ts protein seen in the Mcm5blot (Figure 3).

Thus, the b-hairpin mutations in mcm5-TP do notaffect the stability of the Mcm5 protein, do not interferewith incorporation of Mcm5p into the Mcm2-7p com-plex, and do not affect binding to the Cdt1 protein.Therefore, we infer that these mutations do not disruptthe formation of the Mcm2-7p complex and its ability tobind the Cdt1 loader.

We also conclude that the mcm5-TP mutation showspoor complementation of the mcm5ts mutation (Figure2), because only Mcm2-7 complexes with the Mcm5-TPprotein are formed at the restrictive temperature andthese complexes have reduced activity. We will demon-strate in Figure 4 below that the Mcm5-TP protein has areduced ability to bind origin chromatin.

mcm5-TP mutant shows reduced Mcm2p, Mcm5p,and Mcm7p binding to origin chromatin by ChIP:Chromatin immunoprecipitation (ChIP) (Meluh andKoshland 1997; Sclafani et al. 2002) was used todetermine conclusively that the b-hairpin mutationswere causing Mcm5-TP protein to bind DNA/chroma-tin at origins less efficiently. Again, mcm5ts duplicationstrains with either MCM5THA or mcm5-TPTHA wereused. Origin loading was followed over time in synchro-nized cells from G2/M to G1 phase, during which theMcm2-7p complex loads onto origins (Aparicio et al.1997; Tanaka et al. 1997). Cells were arrested at G2/Musing nocodazole, then shifted to 37� to inactivate mcm5ts.Under these restrictive conditions the only Mcm5 pro-tein in the Mcm2-7 complex is either tagged wild-typeMcm5 or tagged mutant Mcm5-TP protein. After noco-dazole arrest (Figure 4A), nocodazole was washed out,and the cells were released to G1 (37�) using a-factor(aF). Unlike the transition from G1 to S phase (Figure

3), only subtle differences were seen between the MCM5and mcm5-TP strains during the transition from G2/Mto G1 (Figure 4A). At 30 min, there is a slight delay in thetransition in the mcm5-TP strain compared to the MCM5strain. This is consistent with the fact that the Mcm2-7pcomplex is not required at this stage of the cell cycle(Forsburg 2004).

At the restrictive temperature, only the HA-taggedMcm5 wild-type or Mcm5-TP mutant protein will be inthe Mcm2-7p complex because the Mcm5ts protein isinactive. In the MCM5THA strain, a robust PCR signalfor ARS1 was detected in Mcm5 (HA), Mcm2, andMcm7 (Figure 4B) immunoprecipitates, which peakedat�30–40 min after nocodazole release. In contrast, thesignal was reduced 5- to 10-fold in the mutant mcm5-TPTHA strain (Figure 4B). When the cells were arrestedin mitosis with nocodazole, the signal returned to base-line as expected. No signal was seen when the antibodywas omitted as a negative control (data not shown).Similar results were found at origins ARS501 and ARS305(Figure 4, C and D, respectively), although a higherbackground was observed at ARS305 in nocodazole(Figure 4D). A non-origin region that is 8 kb upstreamof ARS305 (ARS305 1 8 kb) was used as anothernegative control (Aparicio et al. 1997), and no signif-icant ChIP signal was observed in this non-origin region(Figure 4E).

At the permissive temperature (22�), the situation isdifferent because both Mcm5ts and HA-tagged Mcm5or Mcm5-TP proteins are expected to be in Mcm2-7complexes. When the anti-HA antibody is used, onlyMcm2-7 complexes containing the HA-tagged proteinare immunoprecipitated (Figure 3). In the case of theMcm5-TP protein complexes, very little would be boundto origins as found using anti-HA antibody (Figure 4).However, when we use anti-Mcm2 or anti-Mcm7 anti-bodies, Mcm2-7 complexes containing a mixture ofboth tagged (Mcm5 and Mcm5-TP) and untagged pro-teins (Mcm5ts) would be immunoprecipitated. In thecase of Mcm5ts and Mcm5-TP complexes, we wouldexpect that only 50%, that is, the Mcm5ts complexes,would be bound to the origin as was found (Figure 4).

From these data, we conclude that the b-hairpindomains in Mcm5p are critical for binding of the entireMcm2-7p complex to chromosomal origins of DNAreplication.

b-Hairpin mutations in mcm4 and mcm5 are synthet-ically lethal: To begin an analysis of the b-hairpindomains in the Mcm4 protein (Figure 1, C and D), weused a similar strategy as for Mcm5 protein (materials

and methods). Four basic residues in the regionbetween b-sheets 9 and 10 were mutated to alanines toproduce the mcm4-4A allele (R445A K454A K458AH456A, depicted in red in Figure 1C). Again, eventhough we have mutated only 4/6 basic residues in thisregion, our hypothesis is that just reducing the basiccharge of the region will have consequences and yield a


ownloaded from



Figure 4.—The mcm5-TP strain shows severely reduced loading of Mcm2p, Mcm5p, and Mcm7p at replication origins. Cellswere grown to log phase (22�), arrested in mitosis with nocodazole (Noc), shifted to 37� to inactivate endogenous mcm5ts,and then released into G1 in the presence of a-factor. Antibodies against Mcm5p (a-HA), Mcm2p, and Mcm7p were used forChIP. ChIP DNA was analyzed by semiquantitative PCR using primers specific to different genomic regions (A) Cells were stainedin propidium iodide (as described in materials and methods) and analyzed by FACS. Quantification of PCR results for repli-cation origins (B) ARS1, (C) ARS501, (D) ARS305, and (E) the non-ARS region, ARS305 1 8 kb. Shaded bars represent resultsusing the MCM5 strain, open bars represent results from the mcm5-TP mutant. PCR signals were compared and quantified byImageQuant v5.2 as described in materials and methods.


ownloaded from



mutant phenotype. Strains were produced that havenull mutations at the endogenous locus (mcm5D andmcm4ThisG) and wild-type or mutant genes integratedat another location (leu2TLEU2 mcm4 and trp1TTRP1mcm5). Strain RSY1240 (mcm5D trp1TTRP1 mcm5-TPmcm4ThisG (pMCM4 URA3) or strain RSY1241 mcm5D

trp1TTRP1 MCM5 mcm4ThisG (pMCM4 URA3) weretransformed with plasmids pRAS691 (LEU2 mcm4-4A)or pRAS693 (LEU2 MCM4) targeted to integrate at theleu2 locus. Loss of the pMCM4 URA3 plasmid will onlyoccur if the integrated mcm4 plasmid can complementthe mcm4ThisG deficiency. Of the four combinations,only the mcm4-4A mcm5-TP double mutant was not re-covered on 5-FOA plates at 22�. In addition, the mcm4-4Asingle mutant (strain RSY1266) was temperature sen-sitive and did not form colonies at 37�. We concludethat the mcm5-TP and mcm4-4A mutants may have de-fects in similar cellular processes, most likely, binding toorigins.

DISCUSSION

Using a structure/function approach, we have iden-tified functionally conserved domains in eukaryoticMcm proteins using the atomic structure of MtMcm asa structural model and yeast as a functional model.Previously, we used this approach to provide a molecularmechanism to explain the bypass of DDK function bythe mcm5-bob1 mutation (P83L) (Fletcher et al. 2003).In that case, yeast genetics was used to identify theimportant residue (P83) and then the MtMCM struc-ture was used to determine the mechanism. In thisreport, we used the MtMCM structure to identify impor-tant residues and then used yeast genetics to determinethe effects of their mutation on function in vivo.

Our results clearly indicate that the b-hairpin domainof the yeast Mcm5 protein is important for originbinding and the initiation of DNA replication. Althoughwe have not directly measured DNA binding by Mcm5protein, we infer from previous in vitro analyzes ofarchaeal Mcm proteins (Fletcher et al. 2003; McGeoch

et al. 2005) and because all eukaryotic Mcm2-7 proteinshave similarity to b-hairpin domains (Fletcher et al.2003) that the DNA binding function of the b-hairpindomains of the six Mcm2-7 eukaryotic proteins has beenfunctionally conserved throughout evolution.

Both archaeal and eukaryotic MCM proteins have twosets of conserved b-hairpins (McGeoch et al. 2005): theN-terminal b-hairpins, which are analyzed in this report,and the smaller C-terminal b-hairpins. In the archaealMtMCM protein, mutation of the N-terminal b-hairpinsreduced binding to both ssDNA and dsDNA in vitro(Fletcher et al. 2005). In the archaeal SsoMCM proteinfrom Sulfolobus solfataricus, mutation of the N-terminalb-hairpins reduced DNA binding by eightfold in vitro(McGeoch et al. 2005), while mutation of the C-terminal

b-hairpins reduced DNA binding by only 2.5-fold. TotalDNA binding was abolished only when both sets ofb-hairpins were mutated. In their model (McGeoch et al.2005), the N-terminal b-hairpins are more importantfor binding the helicase onto DNA, while the C-terminalb-hairpins are used to translocate the helicase along theDNA. Our results are consistent with this model in thatmutation of the N-terminal b-hairpins in yeast Mcm5presults in a severe defect in Mcm2-7 loading onto originsin G1 phase of the cell cycle (Figure 4) and affectsinitiation of DNA replication. SF3 viral helicases suchas SV40 T antigen and HPV E1 do not contain theN-terminal b-hairpins as they bind DNA in a mannersimilar to that of a transcription factor (reviewed inSclafani et al. 2004). However, these viral proteinscontain C-terminal hairpins important for transloca-tion (Li et al. 2003; Gai et al. 2004). In this regard, thearchaeal helicases are a better model for eukaryoticMcm2-7 than the viral proteins.

The mutation in the mcm5ts strain used in thesestudies lies within the zinc-finger domain (C183Y), adomain hypothesized to mediate hexamer–hexamerinteractions within the Mcm2-7p complex (Dalton

and Hopwood 1997; You et al. 2002; Fletcher et al.2005). Additionally, interactions between Mcm proteinsin the single hexamer have previously been shown tobe mediated by the catalytic arginine hairpins and theP-loop domains of the next corresponding Mcm pro-tein (Davey et al. 2003). In the mcm5ts mutant at therestrictive temperature, the Mcm2-7 complex does notform (Dalton and Hopwood 1997), which explainswhy it cannot bind origins (Aparicio et al. 1997; Tanaka

et al. 1997). In contrast, the mcm5-TP mutant protein ispart of the Mcm2-7 complex (Figure 3), can bind to theCdt1 Mcm2-7 protein loader (Figure 3), but is unable tobind origins (Figure 4). These results support the ideathat the b-hairpin mutations are not in regions ofMcm5p that are important for Mcm2-7 subunit protein–protein interactions (Davey et al. 2003).

Only subsets of eukaryotic Mcm proteins, specificallythe Mcm4/6/7 complex, have been shown to possessDNA binding and/or helicase activities (Ishimi 1997;You et al. 1999; Lee and Hurwitz 2000). Any purifiedMcm complexes containing Mcm5, or Mcm2/Mcm3proteins, are inactive in binding DNA in vitro; thus,Mcm4/6/7 and Mcm2/3/5 complexes may representcatalytic and regulatory trimers, respectively (Lee andHurwitz 2000; Schwacha and Bell 2001). Theseobservations also make it difficult to measure the DNAbinding activity of Mcm5p in vitro. Thus, we exploited aunique HA tag within Mcm5 (Ross-MacDonald et al.1999) to query the DNA binding abilities of the Mcmcomplex in vivo using ChIP analysis. While other Mcmproteins have been shown by ChIP to bind origins(Aparicio et al. 1997; Tanaka et al. 1997), Mcm5p hasonly been shown to bind bulk chromatin (Weinreich

et al. 1999). We provide evidence for a specific interaction


ownloaded from



between origin chromatin and Mcm5p in vivo. We alsodemonstrate that the conserved b-hairpin domains ofMcm5p are involved in mediating the origin bindingactivity of the entire Mcm2-7p complex, as has been seenfor the archaeal MtMcm (Fletcher et al. 2003) (Figure4). Previously, we have also used the archaeal structuralmodel for demonstrating the regulatory role of Mcm5p(Hoang et al. 2007). Thus, Mcm5p likely has more thanjust a simple regulatory function, but actively partici-pates in binding to origins of replication.

Does the Mcm2-7 complex bind dsDNA at the origin?From the channel dimensions of the MtMcm helicase,we calculated that �70 bp would be protected by thebinding of a Mcm2-7 double hexamer (Fletcher et al.2003). Additionally, �80 bp of origin DNA is protectedby bound Mcm2-7 complexes in frog extracts (Edwards

et al. 2002). As yeast origins are in intergenic regionsof DNA devoid of nucleosomes (Thoma et al. 1984;Venditti et al. 1994) and remain double stranded evenafter the Mcm2-7 complex has loaded in G1 arrestedcells (Geraghty et al. 2000), we can speculate that yeastMcm2-7 is binding dsDNA at origins in the central chan-nel via the conserved b-hairpins.

It is important to note that the mutations made inMtMcm (Fletcher et al. 2003) and SsoMcm (McGeoch

et al. 2005) b-hairpin domains were present at each ofthe six b-hairpins facing the positively charged centralchannel. Because the eukaryotic Mcm2-7p complex con-sists of heterohexamers (unlike MtMcm and SsoMcm),b-hairpin mutations in a single Mcm subunit (e.g.,Mcm5p in this report) disrupt origin binding activityin only one of the possible six N-terminal b-hairpinspresent in the positively charged channel. Perhapscoordinated DNA binding by b-hairpin domains of allsix Mcm2-7 proteins is needed for efficient binding.Introduction of a b-hairpin mutation in a second Mcmsubunit (Mcm4p in this report) may completely destroythe coordination producing a lethal situation. Similar toour results, recombinant yeast MCM complexes con-taining a single ATPase mutant subunit are reduced inactivity by 6- to 20-fold, which implies that coordinationby all six MCM subunits is needed for full activity(Schwacha and Bell 2001). Coordination of both DNAbinding and ATPase activities explains why all six Mcm2-7psubunits are required in vivo and in vitro for DNA replica-tion (Forsburg 2004). Coordinated interactions amongall six Mcm protein members may be required for fullcatalytic activity in vivo as proposed (Schwacha and Bell

2001) and as demonstrated here for origin bindingactivity. These results should be applicable to othereukaryotic systems because of the evolutionary conser-vation of both structure and function.

We thank Paul Megee for his ChIP expertise, Stephen Dalton forplasmids, and Karen Helm and Mike Ashton in the University ofColorado Cancer Center Flow Cytometry Core Facility. We also thankXiaojiang Chen and Rui Zhao for help with the structure-aidedalignments for yeast and archaeal Mcm proteins. This work was

supported by a Public Health Service award from the NationalInstitutes of Health to R.A.S. (GM-35078) and a National Researchservice award fellowship from the National Institutes of Health toR.P.L. (GM-070403).

LITERATURE CITED

Aiyar, A., Y. Xiang and J. Leis, 1996 Site-directed mutagenesis us-ing overlap extension PCR. Methods Mol. Biol. 57: 177–191.

Alani, E., L. Cao and N. Kleckner, 1987 A method for gene disrup-tion that allows repeated use of URA3 selection in the construc-tion of multiply disrupted yeast strains. Genetics 116: 541–545.

Aparicio, O. M., D. M. Weinstein and S. P. Bell, 1997 Componentsand dynamics of DNA replication complexes in S. cerevisiae: redis-tribution of Mcm proteins and Cdc45p during S phase. Cell 91:59–69.

Bell, S. P., and A. Dutta, 2002 DNA replication in eukaryotic cells.Annu. Rev. Biochem. 71: 333–374.

Bennett-Lovsey, R. M., A. D. Herbert, M. J. Sternberg and L. A.Kelley, 2008 Exploring the extremes of sequence/structurespace with ensemble fold recognition in the program Phyre. Pro-teins 70: 611–625.

Bochman, M. L., and A. Schwacha, 2007 Differences in the single-stranded DNA binding activities of MCM2–7 and MCM467:MCM2 and MCM5 define a slow ATP-dependent step. J. Biol.Chem. 282: 33795–33804.

Bowers, J. L., J. C. Randell, S. Chen and S. P. Bell, 2004 ATP hy-drolysis by ORC catalyzes reiterative Mcm2–7 assembly at a de-fined origin of replication. Mol. Cell 16: 967–978.

Chen, Y., K. M. Hennessy, D. Botstein and B. K. Tye, 1992 CDC46/MCM5, a yeast protein whose subcellular localization is cell-cycleregulated, is involved in DNA replication at autonomously repli-cating sequences. Proc. Natl. Acad. Sci. USA 89: 10459–10463.

Dalton, S., and B. Hopwood, 1997 Characterization of Cdc47p-minichromosome maintenance complexes in Saccharomyces cerevi-siae: identification of Cdc45p as a subunit. Mol. Cell. Biol. 17:5867–5875.

Davey, M. J., C. Indiani and M. O’Donnell, 2003 Reconstitution ofthe Mcm2–7p heterohexamer, subunit arrangement, and ATPsite architecture. J. Biol. Chem. 278: 4491–4499.

Edwards, M. C., A. V. Tutter, C. Cvetic, C. H. Gilbert, T. A.Prokhorova et al., 2002 MCM2–7 complexes bind chromatinin a distributed pattern surrounding the origin recognition com-plex in Xenopus egg extracts. J. Biol. Chem. 277: 33049–33057.

Fletcher, R. J., B. E. Bishop, R. P. Leon, R. A. Sclafani, C. M. Ogata

et al., 2003 The structure and function of MCM from archeal M.thermoautotrophicum. Nat. Struct. Biol. 10: 160–167.

Fletcher, R. J., J. Shen, Y. Gomez-Llorente, C. S. Martin, J. M. Carazo

et al., 2005 Double hexamer disruption and biochemical activ-ities of Methanobacterium thermoautotrophicum MCM. J. Biol. Chem.280: 42405–42410.

Forsburg, S. L., 2004 Eukaryotic Mcm proteins: beyond replicationinitiation. Microbiol. Mol. Biol. Rev. 68: 109–131.

Gai, D., R. Zhao, D. Li, C. V. Finkielstein and X. S. Chen,2004 Mechanisms of conformational change for a replicativehexameric helicase of SV40 large tumor antigen. Cell 119: 47–60.

Geraghty, D. S., M. Ding, N. H. Heintz and D. S. Pederson,2000 Premature structural changes at replication origins in ayeast minichromosome maintenance (MCM) mutant. J. Biol.Chem. 275: 18011–18021.

Hardy, C. F., O. Dryga, S. Seematter, P. M. Pahl and R. A. Sclafani,1997 mcm5/cdc46-bob1 bypasses the requirement for the S phaseactivator Cdc7p. Proc. Natl. Acad. Sci. USA 94: 3151–3155.

Hoang, M. L., R. P. Leon, L. Pessoa-Brandao, S. Hunt, M. K.Raghuraman et al., 2007 Structural changes in Mcm5 proteinbypass Cdc7-Dbf4 function and reduce replication origin effi-ciency in Saccharomyces cerevisiae. Mol. Cell. Biol. 27: 7594–7602.

Hogan, E., and D. Koshland, 1992 Addition of extra origins of rep-lication to a minichromosome suppresses its mitotic loss in cdc6and cdc14 mutants of Saccharomyces cerevisiae. Proc. Natl. Acad. Sci.USA 89: 3098–3102.

Ishimi, Y., 1997 A DNA helicase activity is associated with an MCM4,-6, and -7 protein complex. J. Biol. Chem. 272: 24508–24513.


ownloaded from



Ishimi, Y., Y. Komamura, Z. You and H. Kimura, 1998 Biochemicalfunction of mouse minichromosome maintenance 2 protein.J. Biol. Chem. 273: 8369–8375.

Labib, K., J. A. Tercero and J. F. Diffley, 2000 UninterruptedMCM2–7 function required for DNA replication fork progres-sion. Science 288: 1643–1647.

Lee, J. K., and J. Hurwitz, 2000 Isolation and characterization ofvarious complexes of the minichromosome maintenance proteinsof Schizosaccharomyces pombe. J. Biol. Chem. 275: 18871–18878.

Lei, M., 2005 The Mcm complex: its role in DNA replication and im-plications for cancer therapy. Curr. Cancer Drug Targets 5: 365–380.

Li, D., R. Zhao, W. Lilyestrom, D. Gai, R. Zhang et al., 2003 Struc-ture of the replicative helicase of the oncoprotein SV40 large tu-mor antigen. Nature 423: 512–518.

Loo, S., C. A. Fox, J. Rine, R. Kobayashi, B. Stillman et al.,1995 The origin recognition complex in silencing, cell cycleprogression, and DNA replication. Mol. Biol. Cell 6: 741–756.

McGeoch, A. T., M. A. Trakselis, R. A. Laskey and S. D. Bell,2005 Organization of the archaeal MCM complex on DNAand implications for the helicase mechanism. Nat. Struct. Mol.Biol. 12: 756–762.

Meluh, P. B., and D. Koshland, 1997 Budding yeast centromerecomposition and assembly as revealed by in vivo cross-linking.Genes Dev. 11: 3401–3412.

Nguyen, V. Q., C. Co, K. Irie and J. J. Li, 2000 Clb/Cdc28 kinasespromote nuclear export of the replication initiator proteinsMcm2–7. Curr. Biol. 10: 195–205.

Ostroff, R. M., and R. A. Sclafani, 1995 Cell cycle regulation ofinduced mutagenesis in yeast. Mutat. Res. 329: 143–152.

Pessoa-Brandao, L., and R. A. Sclafani, 2004 CDC7/DBF4 func-tions in the translesion synthesis branch of the RAD6 epistasisgroup in Saccharomyces cerevisiae. Genetics 167: 1597–1610.

Randell, J. C., J. L. Bowers, H. K. Rodriguez and S. P. Bell,2006 Sequential ATP hydrolysis by Cdc6 and ORC directs load-ing of the Mcm2–7 helicase. Mol. Cell 21: 29–39.

Ross-MacDonald, P., P. S. Coelho, T. Roemer, S. Agarwal, A.Kumar et al., 1999 Large-scale analysis of the yeast genome bytransposon tagging and gene disruption. Nature 402: 413–418.

Schwacha, A., and S. P. Bell, 2001 Interactions between twocatalytically distinct MCM subgroups are essential for coordi-nated ATP hydrolysis and DNA replication. Mol. Cell 8: 1093–1104.

Sclafani, R. A., and T. M. Holzen, 2007 Cell cycle regulation ofDNA replication. Annu. Rev. Genet. 41: 237–280.

Sclafani, R. A., M. Patterson, J. Rosamond and W. L. Fangman,1988 Differential regulation of the yeast CDC7 gene during mi-tosis and meiosis. Mol. Cell. Biol. 8: 293–300.

Sclafani, R. A., M. Tecklenburg and A. Pierce, 2002 The mcm5-bob1 bypass of Cdc7p/Dbf4p in DNA replication depends onboth Cdk1-independent and Cdk1-dependent steps in Saccharo-myces cerevisiae. Genetics 161: 47–57.

Sclafani, R. A., R. J. Fletcher and X. S. Chen, 2004 Two heads arebetter than one: regulation of DNA replication by hexameric hel-icases. Genes Dev. 18: 2039–2045.

Sheu, Y. J., and B. Stillman, 2006 Cdc7-Dbf4 phosphorylates MCMproteins via a docking site-mediated mechanism to promote Sphase progression. Mol. Cell 24: 101–113.

Speck, C., and B. Stillman, 2007 Cdc6 ATPase activity regulatesORC x Cdc6 stability and the selection of specific DNA sequencesas origins of DNA replication. J. Biol. Chem. 282: 11705–11714.

Tanaka, S., and J. F. Diffley, 2002 Interdependent nuclear accu-mulation of budding yeast Cdt1 and Mcm2–7 during G1 phase.Nat. Cell Biol. 4: 198–207.

Tanaka, T., D. Knapp and K. Nasmyth, 1997 Loading of an Mcmprotein onto DNA replication origins is regulated by Cdc6pand CDKs. Cell 90: 649–660.

Tanaka, S., T. Umemori, K. Hirai, S. Muramatsu, Y. Kamimura et al.,2007 CDK-dependent phosphorylation of Sld2 and Sld3initiates DNA replication in budding yeast. Nature 445: 328–332.

Thoma, F., L. W. Bergman and R. T. Simpson, 1984 Nuclease digestionof circular TRP1ARS1 chromatin reveals positioned nucleosomesseparated by nuclease-sensitive regions. J. Mol. Biol. 177: 715–733.

Tye, B. K., 1999 Mcm proteins in DNA replication. Annu. Rev. Bio-chem. 68: 649–686.

Venditti, P., G. Costanzo, R. Negri and G. Camilloni, 1994 ABFIcontributes to the chromatin organization of Saccharomyces cerevi-siae ARS1 B-domain. Biochim. Biophys. Acta 1219: 677–689.

Weinreich, M., C. Liang and B. Stillman, 1999 The Cdc6p nucle-otide-binding motif is required for loading Mcm proteins ontochromatin. Proc. Natl. Acad. Sci. USA 96: 441–446.

You, Z., Y. Komamura and Y. Ishimi, 1999 Biochemical analysis ofthe intrinsic Mcm4-Mcm6-Mcm7 DNA helicase activity. Mol. Cell.Biol. 19: 8003–8015.

You, Z., Y. Ishimi, H. Masai and F. Hanaoka, 2002 Roles of Mcm7and Mcm4 subunits in the DNA helicase activity of the mouseMcm4/6/7 complex. J. Biol. Chem. 277: 42471–42479.

Zegerman, P., and J. F. Diffley, 2007 Phosphorylation of Sld2 andSld3 by cyclin-dependent kinases promotes DNA replication inbudding yeast. Nature 445: 281–285.

Communicating editor: N. M. Hollingsworth


ownloaded from



functional conservation of b-hairpin dna binding - genetics

Documents