BioOne sees sustainable scholarly publishing as an inherently collaborative enterprise connecting authors, nonprofit publishers, academic institutions, researchlibraries, and research funders in the common goal of maximizing access to critical research.

Full Genome Sequences of Two Reticuloendotheliosis Viruses ContaminatingCommercial VaccinesAuthor(s): Qinfang Liu, Jixun Zhao, Jingliang Su, Juan Pu, Guozhong Zhang, and Jinhua LiuSource: Avian Diseases, 53(3):341-346. 2009.Published By: American Association of Avian PathologistsDOI: http://dx.doi.org/10.1637/8579-010609-Reg.1URL: http://www.bioone.org/doi/full/10.1637/8579-010609-Reg.1

BioOne (www.bioone.org) is a nonprofit, online aggregation of core research in the biological, ecological, andenvironmental sciences. BioOne provides a sustainable online platform for over 170 journals and books publishedby nonprofit societies, associations, museums, institutions, and presses.

Your use of this PDF, the BioOne Web site, and all posted and associated content indicates your acceptance ofBioOne’s Terms of Use, available at www.bioone.org/page/terms_of_use.

Usage of BioOne content is strictly limited to personal, educational, and non-commercial use. Commercialinquiries or rights and permissions requests should be directed to the individual publisher as copyright holder.

Full Genome Sequences of Two Reticuloendotheliosis Viruses ContaminatingCommercial Vaccines

Qinfang Liu, Jixun Zhao, Jingliang Su, Juan Pu, Guozhong Zhang,A and Jinhua Liu

Department of Preventive Veterinary Medicine, College of Veterinary Medicine, China Agricultural University, Beijing 100193, PR China

Received 13 January 2009; Accepted and published ahead of print 16 March 2009

SUMMARY. Reticuloendotheliosis virus (REV) fragments are a common contaminant in some commercial vaccines such asfowl poxvirus (FPV) and Marek’s disease virus. However, only those strains integrating or containing a near-intact REV provirusare more likely to cause problems in the field. We confirm here, by PCR assays and animal experiments, that vaccines against FPVand herpes virus of turkeys were contaminated with full genome sequences of REV. Further, we determined the complete proviralsequence of two REV isolates from contaminated vaccines. Two REV isolates (REV-99 and REV-06) present in the vaccines wereboth replication competent, and their proviral genome was 8286 nucleotides in length with two identical long terminal repeats(LTR). The complete genome in these two REV isolates shared 99.8% identity to APC-566 and fowl poxvirus REV proviral inserts(FPV-REV). REV-99 and REV-06 LTR showed over 99% identity to chicken syncytial virus (CSV), but an identity of only 75.8% and 78.0%, respectively, to SNV. Alignments with other available REV gag, pol, and env sequences revealed high similarity at thenucleotide level. The results further indicated that the prototype CSV may be the most-important REV contaminant in thecommercial vaccines, and distinct genotypes of REVs may cocirculate in chicken flocks of China at the present time.

RESUMEN. Secuencias genomicas completas de dos virus de la reticuloendoteliosis que se detectaron como contaminantes devacunas comerciales.

Fragmentos del virus de la reticuloendoteliosis se encuentran como contaminantes comunes en algunas vacunas comercialescomo en las vacunas contra el virus de la viruela aviar y de la enfermedad de Marek. Sin embargo, solamente aquellas cepas dereticuloendoteliosis con provirus integrados o casi intactos son las que presentan mayor probabilidad de causar problemas en elcampo. En este estudio, se confirmo mediante la reaccion en cadena de la polimerasa (con las siglas en ingles PCR) y conexperimentos en animales que las vacunas contra la viruela aviar y contra el herpesvirus de pavos estaban contaminadas consecuencias genomicas completas del virus de la reticuloendoteliosis. Posteriormente, se determino la secuencia proviral completa dedos aislamientos del virus de reticuloendoteliosis obtenidos de vacunas contaminadas. Dos aislamientos de este virus, (REV-99 yREV-06) que estaban presentes en las vacunas, demostraron tener capacidad de replicacion y su genoma proviral tenıa una longitudde 8286 nucleotidos con dos secuencias repetidas terminales largas (LTR), que eran identicas. El genoma completo de estosaislamientos de la reticuloendoteliosis mostro una identidad de 99.8% con el virus de la reticuloendoteliosis designado APC-566 ycon los insertos provirales de reticuloendoteliosis del virus de la viruela aviar (FPV-REV). Las secuencias repetidas terminales largasde los virus REV-99 y REV-06 mostraron una identidad de alrededor 99% con el virus sincitial del pollo, pero solo una identidadde 75.8% y 78.0%, respectivamente con el virus de la necrosis esplenica (con las siglas en ingles SNV). La alineacion con otrassecuencias disponibles de los genes gag, pol y env del virus de reticuloendoteliosis revelaron alta similitud en las secuencias denucleotidos. Estos resultados indicaron que el virus prototipo sincitial del pollo puede ser el virus de reticuloendoteliosiscontaminante mas importante en las vacunas comerciales y que distintos genotipos del virus de reticuloendoteliosis pueden estarcirculando simultaneamente en parvadas de pollos en China actualmente.

Key words: reticuloendotheliosis virus, vaccine, contaminant, genome, analysis

Abbreviations: bp 5 base pair; CEF 5 chicken embryo fibroblast; CSV 5 chicken syncytial virus; DPI 5 day postinoculation;ELISA 5 enzyme-linked immunosorbent assay; FPV 5 fowl poxvirus; HVT 5 herpes virus of turkeys; kb 5 kilobases; LTR 5 longterminal repeat; MDV 5 Marek’s disease virus; ND 5 Newcastle disease; PBS 5 phosphate buffered saline; PCR 5 polymerasechain reaction; RE 5 reticuloendotheliosis; REV 5 reticuloendotheliosis virus; SNV 5 spleen necrosis virus; SPF 5 specific-pathogen free

Reticuloendotheliosis is a tumorigenic and immunosuppressivedisease caused by the reticuloendotheliosis virus (REV). REVs are agroup of pathogenic avian retroviruses; the representative strains ofREV include the defective REV-T and the nondefective REV-A, thespleen necrosis virus (SNV), duck infectious anemia virus, and chicksyncytial virus (CSV) (23). REV strains have a wide avian host rangethat includes chickens, turkeys, ducks, geese, pheasants, peafowl,Japanese quail, and prairie chickens (4,11,24).

The REV genome is a positive-sense, single-stranded RNA. Thecomplete genome of a nondefective strain is approximately 9.0kilobases (kb) long, and the defective strains are only 5.7 kb long.The genome has terminally redundant sequences. These terminally

redundant sequences have long terminal repeats (LTR) which areabout 600 nucleotides in length. The viral genome encodes threemain open reading frames: the gag, pol, and env (3,12,23).

The REV strains can cause a variety of nonneoplastic lesions inchickens and ducks, collectively designated as the runting diseasesyndrome; two types of chronic lymphomatous disease in chickensand other poultry; and an acute reticulum cell neoplasm(reticuloendotheliosis) (18). Although serologic evidence of REVinfection is detected in a significant proportion of commercial layer,broiler, and turkey flocks, the flocks usually exhibit no disease ordeleterious effects on performance.

REV has been found as a contaminant in commercial vaccines,and its genome could integrate, on occasion, into the Marek’s diseasevirus (MDV) or fowl poxvirus (FPV) genome (8,10,13,14,16,21). InChina, evidence of the widespread occurrence of REV-sequenceACorresponding author: E-mail: ZGZ98@263.NET

AVIAN DISEASES 53:341–346, 2009

341

insertions in some vaccine strains has increased in recent years.However, only the integrating or contaminating strains, with near-intact REV provirus, are more likely to cause problems in the field(9).

This study had two objectives. Firstly, by employing PCR assaysand animal experiments, we wanted to confirm that the FPV orMDV vaccine we used was contaminated with REV and wouldresult in clinical diseases. Secondly, we wanted to obtain more-definitive characterizations of two REVs in contaminated vaccines bysequencing and analyzing their complete genome sequences.

MATERIALS AND METHODS

Clinical samples and background. Case 1: After inoculation with acell-associated herpes virus of turkeys (HVT) vaccine at day 1, a broilerchicken flock showed poor growth and increased mortality at 20–40days. The average weight of the diseased chickens was obviously lowerthan those of the nonimmunized chickens. Atrophy of bursa of Fabriciusand thymus, as well as proventriculitis, were observed during grosspathologic examination of tissues from the diseased chickens. REVinfection was presumed. The tissue samples, and the HVT vaccines usedin the flock, were collected for further detection.

Case 2: The poor growth and increased mortality occurred in thechicken flocks at 30 days old, after the immunization with FPV cellvaccine at 15 days old. The average weight of the diseased chickens wasabout 30% lower than those of the nonimmunized chickens. Atrophy ofbursa of Fabricius and thymus, and proventriculitis, were observedduring gross pathologic examination of tissues. REV infection waspresumed. The tissue samples, sera, and three batches of FPV vaccinesused in the flocks were collected for further detection.

Virus. The reference strain of REV HA9901 was kindly provided byProf. Z. Z. Cui, College of Veterinary Medicine, Shandong AgriculturalUniversity.

Enzyme-linked immunosorbent assay (ELISA). The serum sampleswere assayed for REV antibody using a commercial antibody ELISA kit(IDEXX, Westbrook, Maine), and titers were calculated as described bythe manufacturer instructions.

Animal experiments. Experiment 1: One-day-old specific-pathogenfree (SPF) chickens were divided into two groups. All the chickens wereraised in isolators. The inoculated group was inoculated subcutaneouslywith 0.2 ml of the HVT vaccine (about 2 doses). In the control group,chicks were inoculated with 0.2 ml of sterilized phosphate bufferedsaline (PBS). All of the birds were observed twice daily for clinical signsfor 50 days. The chickens were euthanatized and necropsied at 50 dayspostinoculation (DPI). The sera were collected for detection of REV-specific antibody.

Experiment 2: 10-day-old SPF chickens were divided into two groups.All the chickens were raised in isolators. The inoculated group wasinoculated by wing-web stab with 0.05 ml of the FPV vaccine (about 2doses). In the control group, chicks were inoculated with 0.05 ml of

sterilized PBS. The birds were observed twice daily for clinical signs for30 days. Five chickens from each group were euthanatized andnecropsied at 20 DPI and 30 DPI, respectively. The sera were collectedfor detection of REV-specific antibody.

Primer design. Based on the nucleotide sequences from GenBank(GenBank accession numbers DQ387450), a pair of diagnostic primerswas designed and used to amplify the LTR sequence; eight pairs ofprimers were designed and used to amplify the complete genome ofREV. Primer sequences are listed in Table 1.

Polymerase chain reaction (PCR). Total genomic DNA of thevaccines or tissues was extracted using a Wizard Genomic DNAPurification Kit (Promega, Madison, WI). The PCRs were performed in50-ml reaction volume containing 10 mM each of four dNTPs, 20 pmolof each primer, 5 ml of 103 PCR reaction buffer, 1.5 mM magnesiumchloride, 1U Taq DNA polymerase, and 2 ml of DNA as a template.The PCR profiles involved an initial denaturation for 5 min at 95 C,followed by 35 cycles of denaturation at 95 C for 30 sec, annealing at 53C for 40 sec, and polymerization at 72 C for 2 min. The finalpolymerization step was performed at 72 C for 10 min. The PCRproducts were analyzed on a 1.0% agarose gel.

DNA cloning and sequencing. The amplified PCR products werepurified using PCR Purification Kits (Omega, Norcross, GA) and werethen cloned into pGEM-T easy vector (Promega), as recommended bythe manufacturer. The recombinant vector was sequenced by ShanghaiSangon Biological Engineering Technology and Services Co., Ltd. Thesequences were assembled with DNAstar computer software (DNAstarInc., Madison, WI).

Phylogenetic analysis of genomic sequence. Phylogenetic compar-ison and analysis was carried out using PHYLIP software (http://www.ddbj.nig.ac.jp/Welcome-j.html). The phylogenetic tree was constructedusing TREEVIE (version 1.40, Roderic D. M. Page, 1997).

Nucleotide sequences of reference REV strains included in thecomparisons were available in GenBank under the following accessionnumbers: CSV (M22223, DQ237904, DQ237905), REV-A (S70398,DQ237900), SNV (DQ003591), HA9901 (NC_006934), APC566(DQ387450), TX-04 (DQ237908, DQ237909), FPV-REV (AF246698),and MDV-REV (S82226).

RESULTS

Serology. With ELISA, REV-specific antibody was detected insera from three flocks in case 2. The results showed that 50–90% ofthe sera tested positive for REV in all the flocks, as shown inTable 2. The positive percentage of antibody against REV increasedwith the incremental age of the chickens.

REV LTR PCR. Six batches of HVT or FPV vaccines, and fourtissue samples, were examined by PCR for REV LTR. An amplifiedtarget REV–LTR sequence with a molecular size of 291 base pairs(bp) was identified in four of the six batches of vaccines and in all ofthe four tissue samples, as shown in Fig. 1. Vaccines C2, V35, V37,

Table 1. Primers used in the study.

Primers LocationA Upstream primer Downstream primer Length/bp

DiagnosticprimerB P0 7996–8286 CCA ATG GTT GTA AAG GGC CCC CCA AAT GTT GTA CCG 291

Sequencingprimer

59- LTR 1–607 AATGTGGGAGGGAGCTCCG GCCGGAGTTCGAAGAAACAGTA 607P1 264–1568 CCAATGGTTGTAAAGGGCAGAT TATCCCGTTCCCCAGTTTCC 1305P2 1551–3204 GAAACTGGGGAACGGGAT AGGGGTGTATGGGTTAGGGAC 1654P3 3146–4381 AGGGAAGTAAACAAGAGGG GCCGTCAGTGAACAGAGT 1336P4 4364–5636 ACTCTGTTCACTGACGGC CTACAGGAGGCTTGAGACC 1273P5 5490–6815 TGAGAAAGACCATCGCTA AAGGGGAGGCTAAGACTG 1326P6 6798–7989 CAGTCTTAGCCTCCCCTT TCGTGTTTGCTCGTGATT 119239- LTR 7598–8286 CGTGCATCATAAAGACCCTG CCCCCAAATGTTGTACCG 689

APrimer locations were listed according to strain APC566 (DQ387450).BThe primer was designed to amplify 39- LTR of REV, in part.

342 Q. Liu et al.

and V38 were four batches of FPV vaccine that came from the samecorporation (the same vaccine strain). However, the 35th (V35),37th (V37), and 38th (V38) batches of vaccines tested were REVpositive, and no positive band could be observed from the earlier32nd (C2) batch of vaccine. These results indicated that thecommercial FPV vaccine was contaminated with REV, and infectionof the chickens might have resulted from the administration of thecontaminated FPV vaccine.

Pathogenicity tests. Ten SPF chickens inoculated with HVTvaccine (Experiment 1) showed varied body size starting at 20 DPI;two-out-of-ten were particularly small and died at 35 DPI. Themean weight of the inoculated group (458.5 6 102.5 g) wasmarkedly lower than that of the control group (830.7 6 46.2 g) at50 DPI (P , 0.05). More details are shown in Table 3.

Ten SPF chickens inoculated with FPV vaccine (Experiment 2)also showed varied body size; some were particularly small duringthe entire experiment. The mean weight of the inoculated group wasslightly lower than that of the control group at 20 DPI. At 30 DPI,the mean weight of the chickens, in both the inoculated and thecontrol group, were 466.25 6 38.4 g and 497.5 6 45.5 g,respectively. The mean weight of the bursa of Fabricius (1.9 6 0.3 g)and thymus (1.8 6 0.4 g) of the inoculated group was lower than

that of the control group (2.3 6 0.2 g and 2.2 6 0.3 g; Table 3).The FPV vaccine reproduced the typical syndromes that are similarto those clinical symptoms seen in experimental chickens.

Complete genome sequences of two contaminated REV strains.By using the genomic DNA of the two REV-contaminated vaccinesas templates, eight overlapping DNA fragments were amplified withthe expected sizes for the eight different pairs of primers. All of theoverlapping large fragments were sequenced and assembled usingDNAstar computer software to determine the complete proviralnucleotide sequence of the two REV stains (designated REV-99 andREV-06). Both of the two REV isolates were comprised of 8286 bp,with two identical LTRs and a complete set of genes including gag,gag-pol, and env. The result indicated that the two REVcontaminants belonged to the replication-competent strains.

Comparisons of the complete genome sequences for REV-99,REV-06, and other REV strains. The complete genome of the twoREV isolates shared 99.8% identity with APC-566 (2) and FPV-REV (20). The phylogenetic relationship of the genome nucleotidesequences of the two strains (REV-99, REV-06) to other REVs isillustrated in Fig. 2A.

LTR. The LTR of REV was the most-divergent region,containing various insertions and deletions among REV-A, CSV,and SNV. The proviral sequences of both of the two REV isolatescontained two identical 59- LTR and 39-LTR, 545 bp in length, andhad typical retroviral U3-R-U5 organization. The percent ofnucleotide sequence identities are summarized in Table 4. Thetwo REV (REV-99, REV-06) LTRs showed over 99% identity toCSV, MDV-REV, FPV-REV, and APC-566, but an identity of only75.8% and 78.0%, respectively, to SNV.

Similar to the identity analyses, phylogenetic analyses of thenucleotide sequences of LTR also indicated that the two REVs(REV-99, REV-06) clustered together with CSV, MDV-REV, FPV-REV, and APC-566, and the SNV appeared to be distinctlydivergent, as shown in Fig. 2B. The LTR contained various repeatsequences that were different in length; the LTR of REV-99 andREV-06 exhibited the same deletions and insertions as the APC-566,CSV, MDV-REV, and FPV-REV when compared with REV-A,HA9901, and SNV.

gag, pol, and env. As previously reported, the protein-codinggroup-specific antigen (gag), the polymerase (pol), and the envelope(env) genes are well conserved among all REV strains (3). The gag,pol, and env of REV-99 and REV-06 share a high nucleotide-sequence homology of 99.7%, 99.78%, and 99.89%, respectively.The alignment of two REVs (REV-99, REV-06) with the availableREV gag, pol, and env sequences revealed a high similarity at thenucleotide level, as shown in Table 4. The phylogenetic relationshipof the REV pol and env nucleotide sequences is illustrated in Fig. 2Cand 2D.

The gag-pol was expressed by a translational read-throughmechanism by a UAG termination codon at the 39 end of the polgene. The gag gene encoded four structural proteins: p12, p18, p30,and p10. The env protein included two peptides: the gp90 surface

Table 2. The serologic positivity of REV antibody in three commercial flocks vaccinated with the FPV vaccines.A

Flock 1 Flock 2 Flock 3

Age of chicken (days)B: 55 76 49 95 154

REV antibodyC 16/22 26/30 9/18 25/30 27/30Percentage of positivity (%) 72.7 86.7 50.0 83.3 90.0

AAll the flocks were inoculated the 35th FPV vaccine.BAll the chickens were inoculated at 28 days of age with a single dose.CNumber seroconverted/number detected.

Fig. 1. Amplification of a 291-bp fragment of REV LTR. M, DNAladder; V1, the suspicious HVT vaccine; V35, 37, 38, the suspiciousFPV vaccine; S1, the spleen tissue sample from the diseased flockinoculated with the suspicious HVT vaccine; S2, the spleen tissuesample from the diseased flock inoculated with the suspicious FPVvaccine; S3, the liver tissue sample from the diseased flock inoculatedwith the suspicious FPV vaccine; S4, the proventriculus tissue samplefrom the diseased flock inoculated with the suspicious FPV vaccine; C,the control vaccine; P1 and P2, positive control; N1, negative control.

Two REVs in contaminated vaccines 343

Table 3. Results for animal experiments.

ExperimentA Age DoseB Vaccine

Body weight (g)C Tissue weight (g)

Mortality AntibodyF20 DPID 30 DPI 50 DPI BursaE Thymus

1 Inoculation 1 2 HVT NDG ND 458.5 6 102.5a ND ND 2/10 7/10Control 1 / H / ND ND 830.7 6 46.2a ND ND 0/10 0/10

2 Inoculation 10 2 FPV 373.0 6 65.2 466.3 6 38.4 ND 1.9 6 0.3 1.8 6 0.4 0/10 2/10Control 10 / / 391.0 6 42.0 497.5 6 45.5 ND 2.3 6 0.2 2.2 6 0.3 0/10 0/10

ASPF chickens were used in two experiments, ten chickens per group.BDose per chick.CData are summarized with means 6 standard deviations, comparisons between groups were performed using the statistical software packages

SPSS 12.0. P , 0.05 was considered significant; a indicated significant deviation.DDay postinoculation.EBursa of Fabricius.FNumber seroconverted/number inoculated, detected by a commercial REV ELISA kit.GND 5 no data.H/ 5 no treatment.

Fig. 2. (A) Phylogenetic trees showing the relationship among the complete genome; (B) LTR; (C) polymerase; and (D) envelope nucleotidesequences of the REV strains generated by the neighbor-joining method with 1000 bootstrap replicates. The virus sequenced in the present study isin bold italics. The horizontal distances are proportional to the minimum number of nucleotide differences required to join nodes and sequences.

344 Q. Liu et al.

unit and the gp20 transmembrane unit; the gp90 was considered theimmunodominant protein.

DISCUSSION

Although reticuloendotheliosis (RE) is not a severe, acuteinfectious disease for poultry as are Newcastle disease (ND) andhighly pathogenic avian influenza, it could also cause great economiclosses that range from runting disease syndrome to chronic neoplasiaand immunosuppression (15,17,18,19). Descendants of seropositiveflocks are even prohibited from export to certain countries.

REV is also a contaminant in commercial vaccines, and an REVoutbreak could occur if chickens are vaccinated with REV-contaminated vaccines (1,5,6,7,8). At present, RE has capturedincreasing attention from researchers and farmers in China becauseof its damage to poultry flocks, especially as a result of theapplication of REV-contaminated vaccines. In this study, weconfirmed that two batches of commercial vaccines were contam-inated with REVs, and they induced the occurrence of the disease, asshown by PCR and animal studies. Chicken experiments showedthat the contaminated FPV vaccine could possibly induce theimmunosuppressive response, because the weight of lymphoidorgans (such as the bursa of Fabricius and the thymus) was 20–60% smaller than that of the control group at 30 DPI, with thevaccines. The seropositive proportion (20%) was lower than that ofclinical observations in the study. There are two explanations forthis: One explanation is that the duration of the chicken experimentwas not long enough. Another explanation is that viral transmissionin the field should be easier than that occurring under laboratoryconditions. With the development of molecular techniques invaccine production, more FPV vaccines that express various foreignantigens have been used to battle against viral diseases such asNewcastle disease, infectious bursal disease, infectious laryngotra-cheitis, avian influenza, and so on. If the cells or embryonated eggswere contaminated with REV or other extraneous virus during theproduction process, catastrophic consequences might occur due tothe unqualified vaccines. The accident investigated here stronglysuggests that quality control and certification of exogenous, virus-free vaccines are critically important in assuring the biosafety ofanimal vaccines. In addition, a quality monitoring system of vaccinesshould be a priority in China.

Our results also showed that the 35th, 37th, and 38th batches ofFPV vaccines were contaminated with REV, but no REV wasdetected in the 32nd batch. These findings were consistent with thefact that no REV lesions or high mortality occurred in the flocksvaccinated with the 32nd batch of FPV vaccine. Although we didnot examine the seed viruses, the present results suggested that the

chicken embryo fibroblasts (CEF) used for production of the vaccinewere contaminated with REV. At that time, primary materials suchas CEF, duck embryo fibroblast, and embryonated eggs were widelyused for producing chicken vaccines. The present findings highlightthe importance of quality control of the cells and embryonated eggsused for the production of vaccine.

The complete proviral genome of REV-99 and REV-06, whichwere contaminated in the commercial vaccines, were first determinedin this paper. The two REV isolates shared the identical geneticorganization consistent with gamma-retroviruses. The completegenome analysis indicated that the REV-1999 and REV-2006 shareda 99.8% nucleotide sequence identity, and both of them werereplication-competent. Phylogenetic analysis showed that the twoREVs had the closest relationship with APC-566, an isolate from theendangered Attwater’s prairie chicken (Tympanuchus cupido) (2), andwith fowl poxvirus REV proviral inserts (20). The results furthersuggested that REV-99 and REV-06 were highly similar to eachother, although they were contaminated in different kind of vaccinesand had come from different regions and times.

As regards alignment with other REVs, as seen in Table 4, the twoREV isolates showed over 99.0% nucleotide sequence homologywith the prototype CSV. The phylogenetic tree also indicated thatthe two REVs shared the closest relationship with the prototypeCSV, while the REV-A, SNV appeared to be distinctly divergent(Fig. 2). Therefore, the prototype CSV may be the most importantREV genotype contaminated in the commercial vaccines. Inaddition, the two REV isolates did have a distant relationship withHA9901, a Chinese isolate that may result in immunorepression inbroilers (22). These findings indicate that distinct genotypes ofREVs may cocirculate in the chicken flocks of China.

REFERENCES

1. Bagust, T. J., T. M. Grimes, and D. P. Dennett. Infection studies ona reticuloendotheliosis virus contaminant of a commercial Marek’s diseasevaccine. Aust. Vet. J. 55:153–157. 1979.

2. Barbosa, T., G. Zavala, S. Cheng, and P. Villegas. Full genomesequence and some biological properties of reticuloendotheliosis virus strainAPC-566 isolated from endangered Attwater’s prairie chickens. Virus Res.124:68–77. 2007.

3. Bohls, R. L., J. A. Linares, S. L. Gross, P. J. Ferro, N. J. Silvy, and E.W. Collisson. Phylogenetic analyses indicate little variation amongreticuloendotheliosis viruses infecting avian species, including the endan-gered Attwater’s prairie chicken. Virus Res. 119:187–194. 2006.

4. Chen, P. Y., Z. Cui, L. F. Lee, and R. L. Witter. Serologic differencesamong nondefective reticuloendotheliosis viruses. Arch. Virol. 93:233–246.1987.

5. Diallo, I. S., M. A. Mackenzie, P. B. Spradbrow, and W. F.Robinson. Field isolates of fowlpox virus contaminated with reticuloendo-theliosis virus. Avian Pathol. 27:60–66. 1998.

Table 4. Percent nucleotide identities in REV-99, REV-06, and other reticuloendotheliosis viruses. Sequences with .99% identity are indicatedin bold type.

REV-06 REV-99

LTR gag env pol LTR gag env pol

REV-06 99.8 99.7 99.9 99.8SNV 78.0 96.8 96.0 96.7 75.8 96.8 96.0 96.6REV-A 92.6 NAA 96.7 98.4 89.1 NA 96.7 98.4HA9901 89.6 97.7 97.2 98.2 89.5 97.7 97.2 98.1APC566 99.6 99.8 99.9 99.8 99.8 99.8 99.8 99.8CSV 99.0 NA 99.3 99.4 99.6 NA 99.5 99.4FPV-REV 99.4 99.7 99.8 99.8 99.6 99.7 99.9 99.8MDV-REV 99.4 NA NA NA 99.6 NA NA NA

ANA 5 not analyzed.

Two REVs in contaminated vaccines 345

6. Fadly, A., and M. C. Garcia. Detection of reticuloendotheliosis virusin live virus vaccines of poultry. Dev. Biol. (Basel) 126:301–305. 2006.

7. Fadly, A. M., and R. L. Witter. Comparative evaluation of in vitroand in vivo assays for the detection of reticuloendotheliosis virus as acontaminant in a live virus vaccine of poultry. Avian Dis. 41:695–701. 1997.

8. Fadly, A. M., R. L. Witter, E. J. Smith, R. F. Silva, W. M. Reed, F. J.Hoerr, and M. R. Putnam. An outbreak of lymphomas in commercialbroiler breeder chickens vaccinated with a fowlpox vaccine contaminatedwith reticuloendotheliosis virus. Avian Pathol. 25:35–47. 1996.

9. Garcıa, M., N. Narang, W. M. Reed, and A. M. Fadly. Molecularcharacterization of reticuloendotheliosis virus insertions in the genome offield and vaccine strains of fowl poxvirus. Avian Dis. 47:343–354. 2003.

10. Hertig, C., B. E. H. Coupar, A. R. Gould, and D. B. Boyler. Fieldand vaccine strains of fowlpox virus carry integrated sequences from theavian retrovirus, reticuloendotheliosis virus. Virology 235:367–376. 1997.

11. Hoelzer, J. D., R. B. Franklin, and H. R. Bose, Jr. Transformation byreticuloendotheliosis virus: development of a focus assay and isolation of anontransforming virus. Virology 93:20–30. 1979.

12. Hu, S. S., M. M. Lai, T. C. Wong, R. S. Cohen, and M. Sevoian.Avian reticuloendotheliosis virus: characterization of genome structure byheteroduplex mapping. J. Virol. 37:899–907. 1981.

13. Isfort, R. J., R. Witter, and H. J. Kung. Retrovirus insertion intoherpesviruses. Trends Microbiol. 2:174–177. 1994.

14. Koyoma, H., Y. Suzuki, Y. Ohwada, and Y. Saito. Reticuloendothe-liosis group virus pathogenic to chicken isolated from material infected withturkey herpes virus (HVT). Avian Dis. 20:429–434. 1997.

15. Maldonado, R. L., and H. R. Bose, Jr. Separation of reticuloendo-theliosis virus from avian tumor viruses. J. Virol. 8:813–815. 1971.

16. Moore, K. M., J. R. Davis, T. Sato, and A. Yasuda. Reticuloendo-theliosis virus (REV) long terminal repeats incorporated in the genomes ofcommercial fowl poxvirus vaccines and pigeon poxviruses without indicationof the presence of infectious REV. Avian Dis. 44:827–841. 2000.

17. Mussman, H. C., and M. J. Twiehaus. Pathogenesis of reticuloen-dothelial virus disease in chicks—an acute runting syndrome. Avian Dis.15:483–502. 1971.

18. Payne, L. N. Retrovirus-induced disease in poultry. Poult. Sci.77:1204–1212. 1998.

19. Rup, B. J., J. L. Spence, J. D. Hoelzer, R. B. Lewis, C. R. Carpenter,A. S. Rubin, and H. R. Bose Jr. Immunosuppression induced by avianreticuloendotheliosis virus: mechanism of induction of the suppressor cell. J.Immunol. 123:1362–1370. 1979.

20. Singh, P., W. M. Schnitzlein, and D. N. Tripathy. Reticuloendo-theliosis virus sequences within the genomes of field strains of fowlpox virusdisplay variability. J. Virol. 77:5855–5862. 2003.

21. Tadese, T., S. Fitzgerald, and W. M. Reed. Detection anddifferentiation of re-emerging fowlpox virus (FWPV) strains carryingintegrated reticuloendotheliosis virus (FWPV-REV) by real-time PCR.Vet. Microbiol. 127:39–49. 2008.

22. Wang, Y., Z. Cui, and S. Jiang. Sequence analysis for the completeproviral genome of reticuloendotheliosis virus Chinese strain HA9901. Sci.China C Life Sci. 49:149–157. 2006.

23. Witter, R. L., and A. L. Fadly. Reticuloendotheliosis. In: Diseases ofpoultry, 11th ed. Saif, Y. M., J. Barnes, J. Glisson, L. Macdougal, and D.Swayne, eds. Iowa State University Press, Ames, IA. pp. 517–535. 2003.

24. Zavala, G., S. Cheng, T. Barbosa, and H. Haefele. Enzooticreticuloendotheliosis in the endangered Attwater’s and greater prairiechickens. Avian Dis. 50:520–525. 2006.

ACKNOWLEDGMENTS

This study was supported by the National Natural ScientificFoundation (30599431, 30471282), the National Basic ResearchProgram (973) (2005CB523003), and a Grant-in-Aid for ScientificResearch from the Ministry of Education (NCET-05-0123).

346 Q. Liu et al.