full article

©2005 FASEB

The FASEB Journal express article 10.1096/fj.04-2377fje. Published online January 10, 2005.

The arachidonic acid-binding protein S100A8/A9 promotes NADPH oxidase activation by interaction with p67phox and Rac-2 Claus Kerkhoff,*,‡ Wolfgang Nacken,*,‡ Malgorzata Benedyk,* Marie Claire Dagher,† Claudia Sopalla,*,‡ and Jacques Doussiere†

*Institute of Experimental Dermatology, University of Münster, Münster, Germany; †Laboratoire de Biochimie et Biophysique des Systèmes Intégrés, UMR 5092 CEA-CNRS-UJF, Département Réponse et Dynamique Cellulaires, Grenoble, France; and ‡Interdisciplinary Center for Clinical Research (IZKF), Münster, Germany

Corresponding author: Claus Kerkhoff, Ph.D., Institute of Experimental Dermatology, Röntgenstr. 21, 48149 Münster, Germany. E-mail: [email protected]

ABSTRACT

The Ca2+- and arachidonic acid-binding S100A8/A9 protein complex was recently identified by in vitro studies as a novel partner of the phagocyte NADPH oxidase. The present study demonstrated its functional relevance by the impaired oxidase activity in neutrophil-like NB4 cells, after specific blockage of S100A9 expression, and bone marrow polymorphonuclear neutrophils from S100A9−/− mice. The impaired oxidase activation could also be mimicked in a cell-free system by pretreatment of neutrophil cytosol with an S100A9-specific antibody. Further analyses gave insights into the molecular mechanisms by which S100A8/A9 promoted NADPH oxidase activation. In vitro analysis of oxidase activation as well as protein-protein interaction studies revealed that S100A8 is the privileged interaction partner for the NADPH oxidase complex since it bound to p67phox and Rac, whereas S100A9 did interact with neither p67phox nor p47phox. Moreover, S100A8/A9 transferred the cofactor arachidonic acid to NADPH oxidase as shown by the impotence of a mutant S100A8/A9 complex unable to bind arachidonic acid to enhance NADPH oxidase activity. It is concluded that S100A8/A9 plays an important role in phagocyte NADPH oxidase activation.

Key words: neutrophils ● cytosolic phox proteins ● MRP8/14 ● superoxide O2.- ● gene silencing

he NADPH oxidase of phagocytes is a multisubunit enzyme complex that produces the superoxide anion (O2

.-) (1). This system is activated by a variety of stimuli for the destruction of pathogens, but it also exerts toxic effects in most inflammatory processes

(2). Individuals deficient in superoxide production due to a genetic lesion in any of four components of this system (p22phox, gp91phox, p47phox, or p67phox) experience severe recurrent infections, often from catalase-positive microbes. This condition is known as chronic granulomatous disease (3, 4).

T

of 28(page number not for citation purposes)

The NADPH oxidase consists of six subunits that are partitioned between different subcellular locations in the resting state. Two of these subunits, p22phox and gp91phox, are integral membrane proteins and form a heterodimeric flavocytochrome, also known as cytochrome b558, which constitutes the catalytic core of the enzyme. The remaining oxidase components reside in the cytosol and include the small GTPase Rac as well as a complex of p40phox, p47phox, and p67phox. Activation of the NADPH oxidase is initiated by phosphorylation of phox proteins, which is believed to induce conformational changes that subsequently lead to rearrangements affecting both intra- and intermolecular interactions within the cytosolic p40-p47-p67phox complex. These events culminate in the translocation of this complex to the membrane and association with both Rac-GTP and cytochrome b558 to form the active enzyme (5).

In previous studies, we showed that the Ca2+- and arachidonic acid (AA-) binding S100A8/A9 protein complex enhanced the NADPH oxidase activation in a cell-free system comprising neutrophil membranes, recombinant cytosolic factors of oxidase activation (p47phox, p67phox and GTPγS preloaded Rac-2), and AA. The enhancing effect of S100A8/A9 on the NADPH oxidase activation has been ascribed to the binding of the S100A8/A9 heterodimer to cytosolic oxidase activating factors, in particular to p67phox and Rac-2 (6, 7). S100A8/A9 interacts with the NADPH oxidase complex and probably enhances the enzyme activity by transferring the cofactor AA, thus stabilizing the activated conformation of the enzyme.

S100A8 and S100A9 belong to the S100 family of calcium binding proteins (for review, see refs 8, 9). Their expression is restricted to a specific stage of myeloid differentiation and is probably driven by a recently characterized regulatory element (10). S100A8 and S100A9 are predominantly localized in the cytoplasm. Upon elevation of the intracellular calcium level, they are translocated from the cytosol to the cytoskeleton and the plasma membrane (11–13). Although the exact functions of these proteins remain unknown, they are normally associated as heteromeric complexes, which are able to bind polyunsaturated fatty acids in a calcium-dependent manner (14, 15), whereas the individual S100 proteins do not bind fatty acids. The unique C-tail of S100A9, containing the three consecutive histidine residues (His103-His105), is involved in the binding of the fatty acid carboxyl-group to the protein complex (16). The binding of calcium to the two EF hands, of high and low affinity, respectively, of each S100 protein, is the prerequisite for the binding of AA to the complex S100A8/A9 (15). Moreover, the estimated calcium concentration required to induce fatty acid binding is within the physiological range (14). The S100A8/A9 protein complex accounts for the entire AA binding capacity of the neutrophil cytosol (14), indicating that S100A8/A9 plays an essential role in the cellular AA metabolism. S100A8/A9 may serve either as a transport vehicle for AA to neighboring cells at inflammatory loci (17) or to transfer AA to both AA-dependent enzymes and AA-consuming pathways.

Interestingly, AA is indispensable for in vivo and in vitro NADPH oxidase activation. This was demonstrated by invalidation of the cytosolic phospholipase A2 with antisense RNA in myeloid PLB-985 cells. The PMA-induced O2

.- generation, abolished in invalidated cells, was restored by addition of AA (18). Furthermore, AA induces a significant structural change in cytochrome b558 (19, 20). Therefore, the aim of the present study was to establish the functional role of S100A8/A9 in the activation of the NADPH oxidase and to investigate the molecular mechanisms by which S100A8/A9 promoted NADPH oxidase activation. We demonstrated the relevance of S100A8/A9 in NADPH oxidase activation by (1) the specific blockage of S100A9


expression in all-trans-retinoic acid (ATRA)-treated NB4 cells using morpholino antisense oligonucleotides and (2) the measurement of oxidative burst in bone marrow polymorphonuclear neutrophils (PMNs) from S100A9−/− mice. Further, we provide strong evidence that S100A8/A9 acts by binding to cytosolic factors of oxidase activation and by delivering AA to the membrane-bound flavocytochrome b.

MATERIALS AND METHODS

Culture of NB4 cells and induction of differentiation

The NB4 acute promyelocytic leukemia cells, capable of differentiating into nonmalignant neutrophils with ATRA, were obtained from the American Type Culture Collection. The cells were maintained in suspension in RPMI medium supplemented with 10% fetal calf bovine serum and kept at 37°C in a 5% CO2 atmosphere. The cells were passaged by dilution in fresh medium to a density of ~0.2 × 106 cells/ml. Before induction of differentiation by ATRA, the cells were maintained at a logarithmic growth rate and seeded at a density of 0.2 × 106 cells/ml. ATRA was added at a final concentration of 1 µM by dilution from a 10 mM stock solution prepared in Me2SO. Control cells were treated with a similar dilution of Me2SO, which had no effect on the differentiation or the rate of cell division.

Inhibition of S100A9 expression by antisense oligonucleotides

Morpholino antisense and sense oligonucleotides were synthesized by Gene Tools (Philomath, OR) to target the sequence of human S100A9 mRNA (GenBankTM accession number NM_002965) (21). We selected the sequence 5′-AAGTCATCGTCTTGCACTCTGT-3′, which targets the sequence -18 thru +7 relative to the first ATG. The sequence has minimal secondary structure and the lowest self-complementarity, based on the GC content. The invert of the antisense (sense) (5′-TGTCTCACGTTCTGCTACTGAA-3′) was used as control. Equimolar concentrations (1.4 µM) of the oligonucleotides and ethoxylated polyethylenimine (EPEI) were first combined and incubated for 20 min at room temperature, and then serum-free RPMI medium (Invitrogen) was added. NB4 cells were suspended in this solution at 1.0 × 106/ml and incubated for 3 h at 37°C in a 5% CO2 atmosphere. The cells were then centrifuged at 1,000 rpm for 5 min, resuspended in RPMI with 10% serum at 0.2 × 106/ml, and returned to the incubator. After treatment with the oligonucleotides for different times as indicated, the cells were incubated for 3 days in the presence of ATRA (1.0 µM, Sigma) and finally harvested for both Western blot analysis and measurement of NADPH oxidase activity.

Determination of mRNA expression by quantitative PCR

To test whether S100A9 gene silencing affected the expression of phox proteins during differentiation, gene expression analysis was performed using real-time PCR (GeneAmp 5700 Sequence Detection System, PE Applied Biosystems). Isolation of total RNA from isolated cells was carried out using the RNA isolation kit (Qiagen) according to the manufacturer’s instructions. Table 1 shows the human amplification primers used. The primers were obtained from MWG.


Measurement of NADPH oxidase by the nitroblue tetrazolium (NBT) method

At the indicated times of continuous exposure to ATRA, the NB4 cells were pelleted by centrifugation at 700 g for 5 min. NADPH oxidase activity of NB4 cells was measured by adding 1 ml of cell suspension (0.5-2×106 cells) to a solution containing 2 mg/ml of NBT and 20 ng/ml of phorbol myristate acetate (PMA) phosphate-buffered saline. The incubation was allowed to proceed for 1 h at 37°C and was stopped by adding 0.4 ml cold 2 M HCl. The formazan product was obtained by centrifugation of the sample at 700 g for 10 min. The supernatant was discarded, and the formazan was dissolved in 1 ml of Me2SO. The absorbance of the solution was measured at 590 nm. The data are expressed as absorbance units/106 cells.

Animals

S100A9−/− mice were generated as described earlier (22). Both the S100A9+/+ (wild-type) and S100A9-deficient animals were housed under specific pathogen-free conditions according to federal and state regulations and studied from 6 to 12 wk of age.

Measurement of intracellular reactive oxygen species production

The production of intracellular reactive oxygen species like superoxide and hydrogen peroxide was determined by measuring changes in the fluorescence of 2´,7´-dichlorofluorescein diacetate (DCFH-DA, Molecular Probes), an oxidation-sensitive fluorescence probe (23). Briefly, the cell suspension was incubated in fresh serum-free RPMI 1640 with 5 µM DCFH-DA at room temperature for 40 min. The loaded cells were then washed twice with Hanks’ balanced salt solution containing 140 mg/l CaCl2 and 200 mg/l MgSO4*7H2O (Biochrom, Germany); 5 × 106 cells were then placed in a cuvette in a thermostatically controlled cell holder at 37°C and stirred continuously. Fluorescence was excited at 488 nm, and emission was recorded at 530 nm. The change in fluorescence intensity was monitored by a spectrofluorometer (Fluoromax, Jobin Yvon GmbH) over a time period of 10 min. After 400 s, PMA (1 µM) was added to elicit the generation of reactive oxygen species. At the end of the experiment, 0.1% Triton and 100 µM H2O2 were added to verify that the increase in fluorescence with time correlates with the production of reactive oxygen species and was not limitative. The rate of increase before stimulation was subtracted from the rate of increase after stimulation to give the rate of increase due to induction by the stimulating agent. This value was taken as a relative measure of the activity of the NADPH oxidase complex.

Preparation of plasma membranes, cytosol, and native S100A8/A9

A particulate fraction enriched in plasma membrane, termed neutrophil membrane, and a soluble fraction, termed neutrophil cytosol, were prepared by density gradient fractionation of a sonicated homogenate of resting bovine neutrophils in a saline phosphate buffer (PBS), consisting of 2.7 mM KCl, 136.7 mM NaCl, 1.5 mM KH2PO4, and 8.1 mM Na2HPO4, pH 7.4 (24). The amount of S100A8/A9 in the membrane fraction of resting neutrophils was found to be negligible as analyzed by Western blot analysis.

The bovine S100A8/A9 protein complex was purified from bovine neutrophil cytosol as described earlier (6). The cytosolic fraction was supplemented with 1 M KCl to favor the


detachment of cytosolic factors of oxidase activation from the S100 complex. The absence of Rac-2, p67phox, or p47phox in the purified fraction was confirmed by Western blot analysis.

The human S100A8/A9 protein complex was purified as described by van den Bos et al. (25) with some modifications from human neutrophils prepared from leukocyte rich blood fractions ("buffy coat") according to Müller et al. (26). Before use, the proteins were re-chromatographed by anion-exchange chromatography using a UnoQ column (Bio-Rad, München, Germany).

The protein concentration in the various biological fractions was determined by the bicinchoninic acid reagent method (Bio-Rad) using bovine serum albumin as standard.

Generation of the recombinant cytosolic phox proteins

The cDNA coding for human p47phox was cloned from a cDNA library as described previously (27). The plasmid for expression of p67phox was provided by Dr. Wientjes (University College, London). Rac-2 cDNA was cloned from a two-hybrid library as described previously (28). The various cDNAs were amplified by PCR and cloned into the appropriate expression vectors using specific primers with specific restriction sites. All constructs were tested by sequencing.

His6-tagged p47phox and His6-tagged p67phox were subcloned in the pET-15b plasmid (Novagen) and expressed in Escherichia coli strain BL21(DE3). The recombinant proteins were purified on Nickel beads (Probond, Invitrogen). Before use, the recombinant proteins were subjected to gel filtration on a Superdex 75 column (Amersham Pharmacia Biotech) in 20 mM HEPES pH 7.5, 100 mM NaCl, and 0.2 mM DTT.

Glutathione-S-transferase (GST)-Rac-2 and GST-p67phox were expressed from pGEX-2T plasmids (Amersham Pharmacia Biotech) in the E. coli BL21(DE3). Positive clones were grown up to A600 = 0.6 and subsequently induced by 1 mM isopropyl thio-β-D-galactopyranoside for 3 h at 37°C for GST-Rac-2 and for 5 h at 25°C for GST-p67phox, respectively. Cell pellets were resuspended in TBS (20 mM Tris-HCl, pH 7.4, 150 mM NaCl), sonified, frozen, and stored at -20°C. Then GST-p67phox and GST-Rac-2 were purified by affinity chromatography on glutathione-Sepharose beads (Amersham Pharmacia Biotech). After being washed extensively, recombinant proteins p67phox and Rac-2 were eluted from the beads by thrombin cleavage. Briefly, the recombinant proteins were incubated with glutathione-Sepharose beads at 4°C in a buffer of 20 mM Tris-HCl, pH 8.0, 100 mM NaCl, and thrombin (Sigma). Thrombin was then inactivated by 1 mM diisopropyl fluorophosphate after 16 h for Rac-2 and after 3 h for p67phox, respectively. In some experiments, GST-recombinant proteins were eluted from the affinity column by 100 mM glutathione before cleavage. Glutathione was then eliminated by dialysis. The purity of all recombinant proteins was assessed by SDS-PAGE (>90%).

Generation of the recombinant S100 proteins

His6-tagged S100A8 and S100A9 as well as GST fusion protein S100A8 were prepared as described earlier (15). The mutant S100A9 proteins S100A9(1-100) and S100A9(His103,104,105K106A9) were generated as described earlier (16). The recombinant proteins were renatured on TALON affinity matrix (Clontech) by washing with buffers


containing decreasing concentrations of urea. Finally, recombinant proteins were eluted with TBS containing 300 mM imidazole.

For reconstitution, the purified recombinant human S100A8 and S100A9 proteins were mixed in PBS supplemented with 1 µM CaCl2 at a molar ratio of 1:1. The protein concentration was adjusted to 1 µM. Before use, the mixture was incubated for 5 min at 20°C followed by an additional incubation for 1 h at 0°C. The formation of the S100A8/A9 protein complex was completed within the incubation period. If calcium was undesirable in the experimental medium, 1 mM EGTA was added.

GST-S100A8 fusion protein was soluble in E. coli and was purified without denaturation by affinity chromatography using glutathione-Sepharose (Amersham Pharmacia Biotech). Subsequently, glutathione was removed by dialysis and purity of the recombinant proteins was demonstrated by SDS-PAGE.

Anti-S100A9 specific antibody

The S100A9-specific antibody is an affinity purified rabbit polyclonal antibody raised against the His6-tagged murine S100A9. This antibody recognizes both mouse S100A9 and bovine S100A9 with similar efficiency.

Assay of NADPH oxidase activity in the cell-free and semirecombinant systems

In the cell-free system, the assay was carried out as follows: in a final volume of 20 µl, bovine neutrophil plasma membranes (6.5 µg protein) were mixed with cytosol at a protein ratio of 1:10 and the mixture was supplemented with 20 µM GTPγS (Roche), 0.5 mM ATP, 2.5 mM MgSO4, 0.5 µM calcium, and different amounts of AA (ranging from 0 to 48 pmol, Sigma). Full activation was attained in <6-8 min at room temperature (20°C). The rate of the elicited O2

.- production was determined in microtiter plates by the rate of reduction of cytochrome c (125 µM, Sigma) in 200 µl PBS supplemented with 300 µM NADPH (Roche). The reduction of cytochrome c was 95-98% sensitive to superoxide dismutase (SOD).

In the semirecombinant system, a similar procedure was used except that bovine neutrophil cytosol was replaced by a 1:1:1 (mol/mol/mol) mixture of the recombinant human cytosolic phox proteins (p67phox, p47phox, and GTPγS loaded Rac-2), using 3 pmol p67phox per µg of membrane protein. GTPγS and ATP were omitted in the activation step.

Rac-2 was preloaded with GTPγS by a 10 min incubation period at 20°C in the presence of 15 µM GTPγS and 4 mM EDTA. Incubation was terminated by adding 10 mM MgSO4.

To compare the capacities of wild-type S100A8/A9 and the mutant S100A8/A9 protein complexes in the semirecombinant system to enhance O2

.- production by bovine neutrophil membranes, S100A8 and the different S100A9 mutants were mixed at a molar ratio of 1:1 and incubated for 5 min at room temperature in presence of 1 µM CaCl2 to favor formation of the protein complex. The reconstituted protein complexes or purified bovine S100A8/A9 were added to the mixture of recombinant human cytosolic phox proteins (p67phox, p47phox, and GTPγS preloaded Rac-2) at a molar ratio of 1:1, followed by addition of bovine neutrophil membranes.


The oxidase activity then was elicited by a 10 min incubation in presence of varying AA concentrations.

Pull-down assay

Protein-protein interactions were analyzed by a pull-down assay. Briefly, 10 µg of each cytosolic phox protein were incubated with either 10 µg GST-S100A8-fusion protein or a mixture of 10 µg GST-S100A8 and 10 µg his-tagged S100A9 in interaction buffer (TBS buffer supplemented with 1 mg/ml BSA) for 1 h at room temperature in a total volume of 500 µl. Before use, glutathione-Sepharose was washed three times in TBS, 1% BSA, and 25 µl of the bed volume was added to the reaction. After 1 h, the reaction was stopped by centrifugation at 10,000 g for 5 min at room temperature, and the glutathione-Sepharose was washed three times with 10 volumes of washing buffer (TBS buffer supplemented with 1 mg/ml BSA and 0.05% NP-40). Finally, SDS sample buffer was added to the glutathione-Sepharose, the mixture was heated to 95°C for 5 min, and the proteins were subjected to 15% SDS-PAGE (29). Western blot analysis was performed by using standard protocols.

For the analysis of protein-protein interaction of either Rac-1 or Rac-2 with the S100 proteins, analogous studies were performed. GST-fusion proteins of either Rac-1 or Rac-2 were mixed with His6-tagged S100 proteins.

To evaluate whether S100 proteins interact with the complex of the cytosolic phox proteins and the Rac proteins, 10 µg GST-fusion proteins of either Rac-1 or Rac-2 were mixed with p67phox, p47phox, and the His6-tagged S100 proteins as indicated.

RESULTS AND DISCUSSION

Gene silencing of S100A9 decreases NADPH oxidase activation in neutrophil-like NB4 cells

Treatment of acute promyelocytic leukemia NB4 cells with ATRA induces differentiation into granulocytes (30), which possess many of the functional characteristics of normal peripheral blood granulocytes, including chemotaxis, phagocytosis, and the generation of superoxide anion O2

.- (31). Accompanying differentiation, ATRA also induces the expression of S100A8 and S100A9 in NB4 cells as shown in initial experiments (Fig. 1A and B, first and second lanes). Due to our recent finding that a protein complex formed by S100A8 and S100A9 potentiates PMA-inducible NADPH oxidase activity of neutrophils as well as the in vitro-activation of the oxidase (6, 7), we used NB4 cells as a cellular model to investigate the effect of specific blockage of S100A9 expression, using morpholino antisense oligonucleotides, upon PMA-inducible NADPH oxidase activity. NB4 cells were pretreated with either antisense or sense oligonucleotides for 24 h, followed by incubation with ATRA for 3 days. Then, aliquots of the NB4 cells were analyzed by Western blotting using specific polyclonal antibodies against S100A9 and S100A8, as well as for NADPH oxidase activity. The generation of the superoxide anions was monitored with NBT, a water-soluble dye, which is converted to insoluble intracellular blue formazan by phagocytozing neutrophils (32).

Figure 1A shows that preincubation with antisense oligonucleotides for 24 h reduced expression of S100A9 to levels similar to those of the control cells not treated with ATRA. Expression of S100A9 induced by ATRA was not affected in cells preincubated with either the sense


oligonucleotides or just the carrier (ethoxylated polyethylenimine, EPEI), indicating that gene silencing of S100A9 was specific. Furthermore, we tested whether S100A9 gene silencing affected the expression of the various phox proteins by quantitative PCR (Taqman) analysis. Addition of ATRA induced the progressive expression and accumulation of the tested phox ptoteins (p22phox, gp91phox, p47phox, p67phox, and Rac-2) with the exception of Rac-1. These results are in accordance to N’Diaye et al. (30) with the exception of Rac-2. They found no up-regulation of Rac-2 during differentiation. However, neither S100A9 antisense nor S100A9 sense oligonucleotides affected the level of transcripts of the phox proteins in NB4 cells exposed to ATRA (data not shown).

Interestingly, S100A8, the heterodimerization partner of S100A9, could not be detected in cells preincubated with antisense S100A9 (Fig. 1B). This finding is in agreement with the observation that PMNs from S100A9 ko mice lack S100A8 protein, although Northern blotting and RT-PCR analysis showed the presence of the S100A8 mRNA transcripts in various organs from S100A9 ko mice (22). The strong down-regulation of S100A8 protein is assumed to rely on a yet unknown posttranscriptional mechanism.

The treatment with antisense oligonucleotides reduced the superoxide generation in PMA-stimulated NB4 cells to the half of that of the PMA-stimulated NB4 cells treated with sense oligonucleotides (Fig. 1C). Similar, the respiratory burst triggered by the physiological agonists LPS/fMLP was also significantly decreased in antisense-treated cells (Fig. 1D). These data clearly demonstrated that S100A8/A9 is involved in the NADPH oxidase activation in intact cells. This enhancing activity of S100A8/A9 is in agreement with a report of Berthier et al. (33), who showed that complementation of B lymphocytes with S100A8 and S100A9 by gene transfection was sufficient to increase by about two the oxidase activity in those cells naturally deficient in S100 proteins.

Oxidative burst is altered in S100A9 ko mice

As mentioned above, bone marrow PMNs from S100A9-/- mice do not express either S100A9 or S100A8 (22). Therefore, we compared the ability of bone marrow PMNs from either S100A9+/+ or S100A9-/- mice to produce reactive oxygen species (ROS) in response to PMA. The ROS production was continuously monitored using the 2´,7´-dichlorofluorescein (DCF) fluorescence (23).

As shown in Fig. 2A, incubation of PMNs with PMA resulted in a time-dependent increase in DCF fluorescence related to ROS production. The maximal DCF fluorescence increase was 2.0-fold lower in PMNs from S100A9−/− mice than for PMNs from S100A9+/+ mice. A statistical analysis revealed that the difference was highly significant (n=6; P<0.004; Fig. 2B).

Next, analogous experiments were performed using platelet-activating factor (PAF) as a physiological inducer of oxidative burst (34). In accordance to PMA stimulation, PMNs from S100A9−/− mice showed a significant reduced ROS generation after PAF stimulation compared with PMNs from wild-type mice (n=6; P<0.05; Fig. 2C).

These data are in contrast to a recent report of Hobbs et al. (35). They observed no difference in the ability of neutrophils (or monocytes) from S100A9+/+ and S100A9−/− mice to generate


superoxides. This discrepancy to our results might be due to either different experimental protocols or methods used. However, the impaired NADPH oxidase activity in PMNs from S100A9−/− mice (compared with wild-type mice) was confirmed by using isoluminol amplified chemiluminescence (36) as well as Amplex Red assay (data not shown).

These findings are consistent with the reduced NADPH oxidase activity in neutrophil-like NB4 cells, after specific blockage of S100A9 expression. Thus, these data increased the significance of the physiological role of S100A8/A9 in the NADPH oxidase activation.

S100A8/A9 represents the cytosolic factor, which enhances NADPH oxidase in the cell-free oxidase activation system

In intact cells, however, it is difficult to investigate the molecular mechanisms by which S100A8/A9 promoted NADPH oxidase activation. Therefore, we had to use cell-free oxidase activation systems.

First, we compared two different types of cell-free oxidase activation system: One containing the cytosolic S100 protein complex, referred to as cell-free system, comprised cytosol and membranes of resting bovine neutrophils. The other devoid of S100 proteins, referred to as semirecombinant system, comprised neutrophil membranes and human recombinant cytosolic phox proteins p67phox, p47phox, and Rac-2. A Western blot analysis confirmed that only minor amounts of S100A8/A9 were present in the membrane fraction of resting neutrophils (inset Fig. 3). Since the oxidase activity elicited in cell-free systems depends on AA and the presence of AA binding proteins, such as the S100 complex (6, 7), the oxidase activity elicited in the two systems was expressed as a function of AA concentration.

As shown in Fig. 3A, the oxidase activity elicited in the cell-free system (left panel) was twofold greater than in the semirecombinant system (right panel). The optimal arachidonic acid concentration resulting to maximal oxidase activation was significantly higher in the cell-free system (1.7±0.2 µmol AA/mg membrane protein) than in the semirecombinant system (0.4±0.1 µmol AA / mg membrane protein; n=7 experiments; P<0.05).

Assuming that NADPH oxidase activating factors represent 0.13-0.2% of the cytosolic proteins (37), the molar ratio of membrane flavocytochrome b to cytosolic factors in the cell-free system was estimated to be in the range of 1:1 to 1:3, compared with 1:10 in the semirecombinant system. Taking this into account, the cell-free system exhibited about a 10-fold greater efficiency in NADPH oxidase activation than the semirecombinant system. Because S100A8/A9 was absent in the semirecombinant system, whereas this protein complex is abundant in the neutrophil cytosol (38) and accounts for the entire AA binding capacity of the neutrophil cytosol (14), the comparison of the two systems strongly suggested that the AA binding complex S100A8/A9 was able to favor NADPH oxidase activation.

To test whether S100A8/A9 represents the enhancing factor of NADPH oxidase activation in the cell-free system, we next treated the bovine cytosol with a polyclonal S100A9-specific antibody before its addition to the cell-free system. As a control, neutrophil membranes were treated with the same amount of the antibody and then added to nontreated cytosol. The oxidase activity elicited was expressed as a function of the AA concentration added to the system.


Figure 3B, left panel, shows a typical experiment in which the NADPH oxidase activity elicited was 2.5-fold decreased if the cytosol was pretreated with the anti-S100A9 antibody. In parallel, the AA concentration required to the maximal oxidase activity decreased. When neutrophil membranes were preincubated with the antibody, only a slight inhibition of the oxidase activity occurred. On the one hand, this slight inhibition probably reflects the partial binding of the antibody to the cytosolic S100A8/A9, during the incubation required to the full activation of the oxidase. Otherwise, the slight inhibition showed that the anti-S100A9 antibody by itself did not inhibit or scavenge O2

.- production.

The inhibition of the NADPH oxidase by the anti-S100A9 antibody was dose dependent, and a maximal inhibition of 60% of oxidase activity was determined at the plateau (Fig. 3B, right panel). The anti-S100A9 antibody used was higly specific since only one protein was recognized in the neutrophil cytosol (Fig. 3, inset). In addition, treatment of the neutrophil cytosol or neutrophil membranes with a preimmune serum, before the cell-free oxidase activation, was without significant effect on the elicited oxidase activity (data not shown). These data give strong evidence that S100A8/A9 plays the role of an enhancing factor for NADPH oxidase activation in the cell-free system.

S100A8/A9 enhances NADPH oxidase by transferring AA

The molecular mechanisms underlying the enhancing effect of S100A8/A9 on NADPH oxidase activity are not well known. S100A8/A9 specifically binds AA in a calcium-dependent manner (14), and AA is indispensable for in vivo and in vitro oxidase activation (18–20, 39). Thus, the molecular mechanisms might rely on the transfer of AA to the flavocytochrome b558 (gp91phox or Nox2). Alternatively, after binding of calcium, S100 proteins interact with target proteins, thereby modulating the enzyme activity of their target protein. Therefore, S100A8/A9 could also have modulatory activity on the NADPH oxidase complex by binding to the phox proteins, thus increasing their activating potency. However, both hypotheses are not exclusive from each other.

To verify whether the enhancing effect of S100A8/A9 on oxidase activation depends on the binding of AA, two reconstituted S100A8/A9 complexes from human recombinant proteins, both unable to bind AA as reported earlier (16), were added to the semirecombinant system, comprising bovine neutrophil membranes, the cytosolic phox proteins p67phox and p47phox, GTPγS-loaded Rac-2, and the optimal amount of AA (7). One complex was formed by wild-type human S100A8 and S100A9(H103,104,105,K106A), the other by wild-type human S100A8 and a deletion mutant S100A9(1-100). As controls, bovine as well as human S100A8/A9 was added to the semirecombinant system.

As shown in Fig. 4, bovine as well as human S100A8/A9 enhanced the NADPH oxidase activity by ~1.6-fold and 1.5-fold, respectively. In contrast, the two mutant S100A8/A9 complexes, unable to bind AA, only exhibited either a slightly enhanced NADPH oxidase activity or a slightly decreased NADPH oxidase activity, respectively. These data clearly indicate that binding of AA to S100A8/A9 represents an important molecular mechanism by which S100A8/A9 facilitates NADPH oxidase activation, probably by transferring AA to the NADPH oxidase complex. This is in accordance to earlier reports showing that AA is an essential cofactor of oxidase activation (18–20). Moreover, S100A8/A9 accounts for the entire AA binding capacity of the neutrophil cytosol (14). The assumption that transfer of AA to flavocytochrome b


by S100A8/A9 plays a role in NADPH oxidase activation is confirmed by a report of Roulin et al. (40). They showed that S100A8/A9 shuttles AA between the cytosol and the plasma membrane upon neutrophil stimulation.

S100A8/A9 enhances NADPH oxidase only in the presence of the cytosolic phox proteins

In previous studies, we reported that S100A8/A9 associates with cytosolic phox proteins. In contrast, Berthier et al. (33) reported that S100A8/A9 enhances NADPH oxidase activation via direct interaction with cytochrome b558. To elucidate whether the effect of S100A8/A9 was mediated either through interaction with cytosolic phox proteins or with the membrane-bound flavocytochrome b, bovine S100A8/A9 was mixed with bovine neutrophil membranes in the absence or presence of the cytosolic phox proteins, supplied by a limited amount of cytosol, and the NADPH oxidase was activated by addition of GTPγS and AA (Fig. 5).

The elicited NADPH oxidase activity was nearly undetectable in neutrophil membranes if neither S100 proteins nor cytosolic phox proteins were present. Addition of bovine S100A8/A9 alone to neutrophil membranes, even in a large excess with respect to the flavocytochrome b, failed to induce any increase in NADPH oxidase activity. A limited amount of cytosolic phox proteins added alone to neutrophil membranes resulted to a limited NADPH oxidase activity. Addition of S100A8/A9 in the presence of the limited amount of cytosolic phox proteins resulted to a four- to fivefold increase in the NADPH oxidase activity elicited. These data clearly indicate that the effect of S100A8/A9 was predominantly mediated via interaction with the cytosolic phox proteins, probably by favoring the formation of the NADPH oxidase complex.

Next, we investigated to which phox protein(s) the S100 proteins were bound. To the mixture of neutrophil membranes and recombinant cytosolic phox proteins (semirecombinant system), either human recombinant S100A8 or S100A9 was added at various concentrations. Then, oxidase activity was elicited by GTPγS and AA. In a control assay, oxidase activation was carried out in the absence of the S100 proteins. The rationale for this experiment is given by the fact that S100A8 and S100A9 (normally associated as heteromeric complexes) are present as individual proteins under specific inflammatory conditions (41–43).

As shown in Fig. 6, S100A9 only slightly affected oxidase activity, whereas S100A8 decreased the oxidase activity elicited in a dose-dependent manner. The IC50 value corresponded to a molar ratio of S100A8 to p67phox of 3:1. A similar ratio was observed previously for p67phox and S100A8/A9 to obtain a Michaelis-Menten kinetic of oxidase activation (7). As expected, both S100 proteins did not significantly alter the optimal AA concentration (data not shown), since individual S100 proteins do not bind AA (14). From these data, we suggested that S100A8 but not S100A9 binds to cytosolic phox proteins.

It is worthwhile mentioning that the mechanism of interaction with cytosolic oxidase components might be different in the S100 complex.

Pull-down assay with Rac-1, Rac-2, the phox proteins, and S100A8/A9

To confirm the specific interactions of S100 proteins with cytosolic phox proteins we used the in vitro pull-down assay, with glutathione-Sepharose to bind GST fusion proteins and magnetic


beads for the binding of His-tagged proteins. Proteins interacting with either His-tagged or GST fusion proteins were analyzed by gel electrophoresis, followed by Western-blot analysis using suitable specific antibodies. The studied proteins did not bind to the affinity matrix either in the absence of the GST fusion proteins or in the presence of GST alone, a finding that excluded possible nonspecific binding (data not shown).

Both the full-length p67phox, and the deletion mutants p67phox-Nter and p67phox-Cter, bound to the glutathione-Sepharose loaded with either GST-S100A8 alone or the reconstituted complex GST-S1008/hisS100A9 (Fig. 7A). In analogous experiments using magnetic beads loaded with His6-tagged S100A9, we did not observe any binding of p67phox proteins (data not shown). Therefore, we conclude that p67phox proteins interacted with the protein complex S100A8/A9 via the S100A8 subunit. In contrast, p47phox did not interact with either His6-tagged S100A9 (data not shown), GST-S100A8 alone, or the reconstituted complex GST-S1008/hisS100A9 (Fig. 7A).

The protein-protein interaction of Rac with S100 proteins was investigated using GST fusion proteins of either Rac-1 or Rac-2 and the His6-tagged S100 proteins. In these experiments, we determined that both GST-Rac-1 and GST-Rac-2 interacted with His6-tagged S100A8 alone as well as the His6-tagged S100A8/S100A9 protein complex (Fig. 7B). Interestingly, in contrast to p67phox, the Rac proteins also interacted with His6-tagged S100A9 alone (Fig. 7C). The protein-protein interaction studies revealed that S100A8 is the privileged interaction partner for the NADPH oxidase complex since it bound to p67phox and the Rac proteins, whereas S100A9 bound only to Rac. This finding confirmed the ability of the S100A8/A9 complex to bind to the complex of cytosolic factors of NADPH oxidase activation (p67phox, p47phox and Rac).

Hypothetical model of S100A8/A9 interaction with NADPH oxidase

Recently, Berthier et al. (33) demonstrated that complementation of B lymphocytes with S100A8 and S100A9 by gene transfection was sufficient to increase the PMA-elicitable oxidase activity in these cells naturally deficient in S100 proteins. This finding is consistent with our investigations that PMNs from S100A9−/− mice as well as neutrophil-like NB4 cells, after preincubation with S100A9-specific antisense oligonucleotides, have an impaired NADPH oxidase activity. However, the authors proposed a model by which S100A8/A9 enhances NADPH oxidase activation via direct interaction with cytochrome b558. In contrast, our study gave strong evidence that S100A8/A9 enhances NADPH oxidase by transfer of AA and interaction with cytosolic phox proteins.

As demonstrated by the impotence of mutant S100A8/A9 complexes, unable to bind AA, to enhance NADPH oxidase activity in a cell-free system, the modulatory effect of S100A8/A9 on NADPH oxidase is related to binding and transfer of AA. The essential role of AA as cofactor for NADPH oxidase activity has been long noted (44–46). AA takes part in the oxidase activation process by favoring a structural change in the hemes of cytochrome b558 (19, 39), and the fatty acid is released from membrane lipids by the action of cytosolic phospholipase A2 after cellular activation (18). Interestingly, it has been shown earlier that the stimulatory effect of AA depends on the presence of cytosol, and the cytosolic cofactors appear to be neutrophil-specific and heat-labile proteins (47–49). The S100A8/A9 protein complex is mainly expressed in myeloid cells (8, 9), it is abundant in the human neutrophil cytosol (38), and it accounts for the entire AA binding capacity (14). Although the link between AA binding by S100A8/A9 and


participation of AA in NADPH oxidase activation is strong, other pathways by which AA takes part in the oxidase activation process may also exist. For example, it has been shown that the translocation of Rac to the membrane is markedly augmented by GTP-γS in combination with AA (50).

NADPH oxidase activation requires translocation of the cytosolic subunits to the cell membrane after stimulation. Cytoskeletal proteins might be involved in the translocation since it has been demonstrated that they interact with cytosolic phox proteins (51–53). Moreover, cytoskeletal reorganization is involved in NADPH oxidase activation, thereby restricting superoxide generation to the phagocytic vacuole (54–56). Interestingly, the small GTP binding protein p21rac, which is essential for oxidase in the cell-free activation of NADPH oxidase (57), also initiates membrane ruffling in fibroblasts (58). Similar to the cytosolic subunits, S100A8 and S100A9 are translocated to membrane and cytoskeleton upon cellular activation (12). The two S100 proteins associate with proteins of the type III intermediate filaments, which play a prominent role during activation of phagocytes (59). The close association of S100A8/A9 with cytoskeleton structures is also confirmed by the recent finding that the protein complex is involved in the reorganization of the epithelial cytoskeleton (60).

Recently, we observed the floation of S100A8 and S100A9 toward the low-buoyancy top of the sucrose gradient after cellular activation, probably demonstrating their association with low density detergent-resistant membranes (DRMs) (61). This is an interesting observation since it has been recently reported that the NADPH oxidase complex is assembled in cholesterol-enriched membrane microdomains (lipid rafts) (62). Consistent with these findings, it has been reported that S100 protein translocation is accompanied with AA transport (14, 40).

A model of oxidase assembly has been put forward in which phox activation, resulting in superoxide production, is probably the consequence of a conformational change in gp91phox, caused by the interaction of cytochrome b558 with one or several of the cytosolic oxidase components (reviewed by ref 5). Herein, p67phox functions as the “activator,” whereas p47phox (due to binding to p22phox (63, 64)) and Rac (due to tether p67phox to the membrane; refs 65–67) serve as “organizers.” Interaction of p47phox with p22phox has recently been sustained by the structural determination of the tandem SH3 domains of p47phox (68). Based on our findings, we proposed a working model (Fig. 8) in which S100A8/A9 is involved in the enhanced phagocyte NADPH oxidase activation by transferring AA to gp91phox during interactions with two cytosolic factors of oxidase activation, p67phox and Rac-2. Binding of AA to gp91phox induces a structural change in cytochrome b558, which results to the final formation of the active complex.

In conclusion, we established in the present study the functional role of S100A8/A9 during NADPH oxidase activation in intact cells and analyzed the molecular mechanisms by which S100A8/A9 promoted NADPH oxidase activation. Thus, this study gives new insights into the NADPH oxidase activation and links an important feature of phagocytes with proteins abundant in phagocytes.

ACKNOWLEDGMENTS

We thank Klaus Tenbrock for critical reading of the manuscript and Andrea Dick and Heike Hater for excellent technical assistance. This work was supported by grants from Deutsche


Forschungsgemeinschaft (DFG) project KE 820/2-1, Interdisziplinäres Zentrum für Klinische Forschung (IZKF) of the University of Muenster, Project C23, and by funds from the French Centre National de la Recherche Scientifique, the Commissariat à l’Energie atomique, and the Université Joseph Fourier-Grenoble I.

REFERENCES

1. Nauseef, W. M. (1999) The NADPH-dependent oxidase of phagocytes. Proc. Assoc. Am. Physicians 111, 373–382

2. Segal, B. H., Leto, T. L., Gallin, J. I., Malech, H. L., and Holland, S. M. (2000) Genetic, biochemical, and clinical features of chronic granulomatous disease. Medicine 79, 170–200

3. Vignais, P. V. (2002) The superoxide-generating NADPH oxidase: structural aspects and activation mechanism. Cell. Mol. Life Sci. 59, 1428–1459

4. Geiszt, M., Kapus, A., and Ligeti, E. (2001) Chronic granulomatous disease: more than the lack of superoxide? J. Leukoc. Biol. 69, 191–196

5. Lambeth, J. D. (2004) NOX enzymes and the biology of reactive oxygen. Nat. Rev. Immunol. 4, 181–189

6. Doussiere, J., Bouzidi, F., and Vignais, P. V. (2001) A phenylarsine oxide-binding protein of neutrophil cytosol, which belongs to the S100 family, potentiates NADPH oxidase activation. Biochem. Biophys. Res. Commun. 285, 1317–1320

7. Doussiere, J., Bouzidi, F., and Vignais, P. V. (2002) The S100A8/A9 protein as a partner for the cytosolic factors of NADPH oxidase activation in neutrophils. Eur. J. Biochem. 269, 3246–3255

8. Kerkhoff, C., Klempt, M., and Sorg, C. (1998) Novel insights into structure and functions of S100A8 and S100A9. Biochim. Biophys. Acta 1448, 200–211

9. Nacken, W., Roth, J., Sorg, C., Kerkhoff, C. (2003) S100A9: a myeloid S100 representative as a prominent player in innate immunity. Microsc. Res. Tech. 60, 569-580

10. Kerkhoff, C., Hofmann, H. A., Vormoor, J., Melkonyan, H., Roth, J., Sorg, C., and Klempt, M. (2002) Binding of two nuclear complexes to a novel regulatory element within the human S100A9 promoter drives the S100A9 gene expression. J. Biol. Chem. 277, 41879–41887

11. Lemarchand, P., Vaglio, M., Mauel, J., and Markert, M. (1992) Translocation of a small cytosolic calcium-binding protein (MRP-8) to plasma membrane correlates with human neutrophil activation. J. Biol. Chem. 267, 19379–19382

12. Roth, J., Burwinkel, F., van den Bos, C., Goebeler, M., Vollmer, E., and Sorg, C. (1993) MRP8 and MRP14, S-100-like proteins associated with myeloid differentiation, are


translocated to plasma membrane and intermediate filaments in a calcium-dependent manner. Blood 82, 1875–1883

13. Guignard, F., Mauel, J., and Markert, M. (1996) Phosphorylation of myeloid-related proteins MRP-14 and MRP-8 during human neutrophil activation. Eur. J. Biochem. 241, 265–271

14. Kerkhoff, C., Klempt, M., Kaever, V., and Sorg, C. (1999) The two calcium-binding proteins S100A8 and S100A9 are involved in the metabolism of arachidonic acid in human neutrophils. J. Biol. Chem. 274, 32672–32679

15. Kerkhoff, C., Vogl, T., Nacken, W., Sopalla, C., and Sorg, C. (1999) Zinc-binding reverses the calcium-induced arachidonic acid-binding capacity of the S100A8/A9 protein complex. FEBS Lett. 460, 134–138

16. Sopalla, C., Leukert, N., Sorg, C., and Kerkhoff, C. (2002) Evidence of the involvement of the unique C-tail of S100A9 in the binding of arachidonic acid to the heterocomplex S100A8/A9. Biol. Chem. 383, 1895–1905

17. Kerkhoff, C., Sorg, C., Tandon, N. N., and Nacken, W. (2001) Interaction of S100A8/S100A9-arachidonic acid complexes with the scavenger receptor CD36 may facilitate fatty acid uptake by endothelial cells. Biochemistry 40, 241–248

18. Dana, R., Leto, T. L., Malech, H. L., and Levy, R. (1998) Essential requirement of cytosolic phospholipase A2 for activation of the phagocyte NADPH oxidase. J. Biol. Chem. 273, 441–445

19. Doussiere, J., Gaillard, J., and Vignais, P. V. (1996) Electron transfer across the O2- generating flavocytochrome b of neutrophils. Evidence for a transition from a low-spin state to a high-spin state of the heme iron component. Biochemistry 35, 13400–13410

20. Doussiere, J., Gaillard, J., and Vignais, P. V. (1999) The heme component of the neutrophil NADPH oxidase complex is a target for aryliodonium compounds. Biochemistry 38, 16394–16406

21. Odink, K., Cerletti, N., Bruggen, J., Clerc, R. G., Tarcsay, L., Zwadlo, G., Gerhards, G., Schlegel, R., and Sorg, C. (1987) Two calcium-binding proteins in infiltrate macrophages of rheumatoid arthritis. Nature 330, 80–82

22. Manitz, M.-P., Basil, H., Seeliger, S., Strey, A., Skryabin, B. V., Gunzer, M., Frings, W., Schönlau, F., Roth, J., Sorg, C., et al. (2003) Loss of S100A9 (MRP14) results in reduced Interleukin-8-induced CD11b surface expression, a polarized microfilament system, and diminished responsiveness to chemoattractants in vitro. Mol. Cell. Biol. 23, 1034–1043

23. Wan, C. P., Myung, E., and Lau, B. H. (1993) An automated micro-fluorometric assay for monitoring oxidative burst activity of phagocytes. J. Immunol. Methods 159, 131–138

24. Doussiere, J., Poinas, A., Blais, C., and Vignais, P. V. (1998) Phenylarsine oxide as an inhibitor of the activation of the neutrophil NADPH oxidase. Identification of the beta


subunit of the flavocytochrome b component of the NADPH oxidase as a target site for phenylarsine oxide by photoaffinity labeling and photoinactivation. Eur. J. Biochem. 251, 649–658

25. van den Bos, C., Rammes, A., Vogl, T., Boynton, R., Zaia, J., Sorg, C., and Roth, J. (1998) Copurification of P6, MRP8, and MRP14 from human granulocytes and separation of individual proteins. Protein Expr. Purif. 13, 313–318

26. Muller, G., Kerkhoff, C., Hankowitz, J., Pataki, M., Kovacs, E., Lackner, K. J., and Schmitz, G. (1993) Effects of purinergic agents on human mononuclear phagocytes are differentiation dependent. Implications for atherogenesis. Arterioscler. Thromb. 13, 1317–1326

27. Fuchs, A., Dagher, M.-C., Jouan, A., and Vignais, P. V. (1994) Activation of the O2-generating NADPH oxidase in a semi-recombinant cell-free system. Assessment of the function of Rac in the activation process. Eur. J. Biochem. 226, 587–595

28. Faure, J., and Dagher, M.-C. (2001) Interactions between Rho GTPases and Rho GDP dissociation inhibitor (Rho-GDI). Biochimie 83, 409–414

29. Laemmli, U. K. (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, 680–685

30. N’Diaye, E. N., Vaissiere, C., Gonzalez-Christen, J., Gregoire, C., Le Cabec, V., and Maridonneau-Parini, I. (1997) Expression of NADPH oxidase is induced by all-trans retinoic acid but not by phorbol myristate acetate and 1,25 dihydroxyvitamin D3 in the human promyelocytic cell line NB4. Leukemia 11, 2131-2136

31. Vaissiere, C., Le Cabec, V., and Maridonneau-Parini, I. (1999) NADPH oxidase is functionally assembled in specific granules during activation of human neutrophils. J. Leukoc. Biol. 65, 629–634

32. Green, T. R., and Pratt, K. L. (1990) Detection and isolation of the NADPH-binding protein of the NADPH:O2 oxidoreductase complex of human neutrophils. J. Biol. Chem. 265, 19324–19349

33. Berthier, S., Paclet, M. H., Lerouge, S., Roux, F., Vergnaud, S., Coleman, A. W., and Morel, F. (2003) Changing the conformation state of cytochrome b558 initiates NADPH oxidase activation: MRP8/MRP14 regulation. J. Biol. Chem. 278, 25499–25508

34. Kato, M., Kimura, H., Motegi, Y., Tachibana, A., Minakami, H., Morikawa, A., and Kita, H. (2002) Platelet-activating factor activates two distinct effector pathways in human eosinophils. J. Immunol. 169, 5252–5259

35. Hobbs, J. A., May, R., Tanousis, K., McNeill, E., Mathies, M., Gebhardt, C., Henderson, R., Robinson, M. J., and Hogg, N. (2003) Myeloid cell function in MRP-14 (S100A9) null mice. Mol. Cell. Biol. 23, 2564–2576


36. Liu, L., Dahlgren, C., Elwing, H., and Lundqvist, H. (1996) A simple chemiluminescence assay for the determination of reactive oxygen species produced by human neutrophils. J. Immunol. Methods 192, 173–178

37. Jouan, A., Pilloud-Dagher, M. C., Fuchs, A., and Vignais, P. V. (1993) A generally applicable ELISA for the detection and quantitation of the cytosolic factors of NADPH-oxidase activation in neutrophils. Anal. Biochem. 214, 252–259

38. Edgeworth, J., Gorman, M., Bennett, R., Freemont, P., and Hogg, N. (1991) Identification of p8,14 as a highly abundant heterodimeric calcium binding protein complex of myeloid cells. J. Biol. Chem. 266, 7706–7713

39. Foubert, T. R., Burritt, J. B., Taylor, R. M., and Jesaitis, A. J. (2002) Structural changes are induced in human neutrophil cytochrome b by NADPH oxidase activators, LDS, SDS, and arachidonate: intermolecular resonance energy transfer between trisulfopyrenyl-wheat germ agglutinin and cytochrome b(558). Biochim. Biophys. Acta 1567, 221–231

40. Roulin, K., Hagens, G., Hotz, R., Saurat, J. H., Veerkamp, J. H., and Siegenthaler, G. (1999) The fatty acid-binding heterocomplex FA-p34 formed by S100A8 and S100A9 is the major fatty acid carrier in neutrophils and translocates from the cytosol to the membrane upon stimulation. Exp. Cell Res. 247, 410–421

41. Goebeler, M., Roth, J., Burwinkel, F., Vollmer, E., Bocker, W., and Sorg, C. (1994) Expression and complex formation of S100-like proteins MRP8 and MRP14 by macrophages during renal allograft rejection. Transplantation 58, 355–361

42. Burkhardt, K., Bosnecker, A., Hillebrand, G., Hofmann, G. O., Schneeberger, H., Burmeister, G., Land, W., and Gurland, H. J. (1995) MRP8/14-positive macrophages as early acute cellular rejection markers, and soluble MRP8/14 and increased expression of adhesion molecules following renal transplantation. Transplant. Proc. 27, 890–891

43. Frosch, M., Vogl, T., Waldherr, R., Sorg, C., Sunderkotter, C., and Roth, J. (2004) Expression of MRP8 and MRP14 by macrophages is a marker for severe forms of glomerulonephritis. J. Leukoc. Biol. 75, 198–206

44. Bromberg, Y., and Pick, E. (1984) Unsaturated fatty acids stimulate NADPH-dependent superoxide production by cell-free system derived from macrophages. Cell. Immunol. 88, 213–221

45. McPhail, L. C., Shirley, P. S., Clayton, C. C., and Snyderman, R. (1985) Activation of the respiratory burst enzyme from human neutrophils in a cell-free system. Evidence for a soluble cofactor. J. Clin. Invest. 75, 1735–1739

46. Curnutte, J. T. (1985) Activation of human neutrophil nicotinamide adenine dinucleotide phosphate, reduced (triphosphopyridine nucleotide, reduced) oxidase by arachidonic acid in a cell-free system. J. Clin. Invest. 75, 1740–1743


47. Seifert, R., and Schultz, G. (1987) Fatty-acid-induced activation of NADPH oxidase in plasma membranes of human neutrophils depends on neutrophil cytosol and is potentiated by stable guanine nucleotides. Eur. J. Biochem. 162, 563–569

48. Sakata, A., Ida, E., Tominaga, M., and Onoue, K. (1987) Arachidonic acid acts as an intracellular activator of NADPH-oxidase in Fc gamma receptor-mediated superoxide generation in macrophages. J. Immunol. 138, 4353–4359

49. Ligeti, E., Doussiere, J., and Vignais, P. V. (1988) Activation of the O2.--generating oxidase

in plasma membrane from bovine polymorphonuclear neutrophils by arachidonic acid, a cytosolic factor of protein nature, and nonhydrolyzable analogues of GTP. Biochemistry 27, 193–200

50. Sawai, T., Asada, M., Nunoi, H., Matsuda, I., Ando, S., Sasaki, T., Kaibuchi, K., Takai, Y., and Katayama, K. (1993) Combination of arachidonic acid and guanosine 5′-O-(3-thiotriphosphate) induce translocation of rac p21s to membrane and activation of NADPH oxidase in a cell-free system. Biochem. Biophys. Res. Commun. 195, 264–269

51. Shalom-Barak, T., and Knaus, U. G. (2002) A p21- activated kinase-controlled metabolic switch up-regulates phagocyte NADPH oxidase. J. Biol. Chem. 277, 40659–40665

52. Wientjes, F. B., Reeves, E. P., Soskic, V., Furthmayr, H., and Segal, A. W. (2001) The NADPH oxidase components p47(phox) and p40(phox) bind to moesin through their PX domain. Biochem. Biophys. Res. Commun. 289, 382–388

53. Grogan, A., Reeves, E., Keep, N., Wientjes, F., Totty, N. F., Burlingame, A. L., Hsuan, J. J., and Segal, A. W. (1997) Cytosolic phox proteins interact with and regulate the assembly of coronin in neutrophils. J. Cell Sci. 110, 3071–3081

54. Valerius, N. H., Stendahl, O., Hartwig, J. H., and Stossel, T. P. (1981) Distribution of actin-binding protein and myosin in polymorphonuclear leukocytes during locomotion and phagocytosis. Cell 24, 195–202

55. Howard, T. H., and Wang, D. (1987) Calcium ionophore, phorbol ester and chemotactic peptide-induced cytoskeleton reorganization in human neutrophils. J. Clin. Invest. 79, 1359–1364

56. Woodman, R. C., Ruedi, J. M., Jesaitis, A. J., Okamura, N., Quinn, M. T., Smith, R. M., Curnutte, J. T., and Babior, B. M. (1991) Respiratory burst oxidase and three of four oxidase-related polypeptides are associated with the cytoskeleton of human neutrophils. J. Clin. Invest. 87, 1345–1351

57. Abo, A., Boyhan, A., West, I., Thrasher, A. J., and Segal, A. W. (1992) Reconstitution of neutrophil NADPH oxidase activity in the cell-free system by four components: p67-phox, p47-phox, p21rac1, and cytochrome b-245. J. Biol. Chem. 267, 16767–16770


58. Ridley, A. J., Paterson, H. F., Johnston, C. L., Diekmann, D., and Hall, A. (1992) The small GTP-binding protein rac regulates growth factor-induced membrane ruffling. Cell 70, 401–410

59. Steinert, P. M., and Roop, D. R. (1988) Molecular and cellular biology of intermediate filaments. Annu. Rev. Biochem. 57, 593–625

60. Thorey, I. S., Roth, J., Regenbogen, J., Halle, J. P., Bittner, M., Vogl, T., Kaesler, S., Bugnon, P., Reitmaier, B., Durka, S., et al. (2001) The Ca2+-binding proteins S100A8 and S100A9 are encoded by novel injury-regulated genes. J. Biol. Chem. 276, 35818–35825

61. Nacken, W., Sorg, C., and Kerkhoff, C. (2004) The myeloid expressed EF-hand proteins display a diverse pattern of lipid raft association. FEBS Lett. 572, 289–293

62. Vilhardt, F., and van Deurs, B. (2004) The phagocyte NADPH oxidase depends on cholesterol-enriched membrane microdomains for assembly. EMBO J. 23, 739–748

63. Sumimoto, H., Kage, Y., Nunoi, H., Sasaki, H., Nose, T., Fukumaki, Y., Ohno, M., Minakami, S., and Takeshige, K. (1994) Role of Src homology 3 domains in assembly and activation of the phagocyte NADPH oxidase. Proc. Natl. Acad. Sci. USA 91, 5345–5349

64. Sumimoto, H., Hata, K., Mizuki, K., Ito, T., Kage, Y., Sakaki, Y., Fukumaki, Y., Nakamura, M., and Takeshige, K. (1996) Assembly and activation of the phagocyte NADPH oxidase. Specific interaction of the N-terminal Src homology 3 domain of p47phox with p22phox is required for activation of the NADPH oxidase. J. Biol. Chem. 271, 22152–22158

65. Koga, H., Terasawa, H., Nunoi, H., Takeshige, K., Inagaki, F., and Sumimoto, H. (1999) Tetratricopeptide repeat (TPR) motifs of p67(phox) participate in interaction with the small GTPase Rac and activation of the phagocyte NADPH oxidase. J. Biol. Chem. 274, 25051–25060

66. Lapouge, K., Smith, S. J., Walker, P. A., Gamblin, S. J., Smerdon, S. J., and Rittinger, K. (2000) Structure of the TPR domain of p67phox in complex with Rac-GTP. Mol. Cell 6, 899–907

67. Gorzalczany, Y., Sigal, N., Itan, M., Lotan, O., and Pick, E. (2000) Targeting of Rac1 to the phagocyte membrane is sufficient for the induction of NADPH oxidase assembly. J. Biol. Chem. 275, 40073–40081

68. Yuzawa, S., Suzuki, N. N., Fujioka, Y., Ogura, K., Sumimoto, H., and Inagaki, F. (2004) A molecular mechanism for autoinhibition of the tandem SH3 domains of p47phox, the regulatory subunit of the phagocyte NADPH oxidase. Genes Cells 9, 443–456

Received May 27, 2004; accepted November 18, 2004.


Table 1 PCR primers for phox proteins and control gene

Gene GenBank accession #

Forward primer Reverse primer

gp91phox NM_000397 tggagttgtcatcacgctgtg ctgcccacgtacaattcgttc p22phox NM_000101 ggtgcctactccattgtggc accgagagcaggagatgcag p47phox NM_000265 gatggcaagagtaccgcgac tgacagaaccaccaaccgc p67phox M32011 agctcagtgttcccatgccc caccagctcattgctgtccc Rac1 NM_198829 tccgtgcaaagtggtatcctg cggatcgcttcgtcaaacac Rac2 NM_002872 acggacgtcttcctcatctgc ttctcgatggtgtccttgtcg GAPDH NM_002046 gcaaattccatggcaccgt gccccacttgattttggagg


Fig. 1

Figure 1. Gene silencing of S100A9 and its effect on NADPH oxidase activation. Sense and antisense oligonucleotides in the vehicle ethoxylated polyethylenimine (EPEI) were prepared as described in Materials and Methods and incubated with NB4 cells for 24 h, followed by an incubation for 3 days with 1 µM ATRA. Cells were harvested and analyzed for S100A9 and S100A8 expression as well as for NADPH oxidase activity. A, B) For Western Blot analysis, SDS sample buffer was added to aliquots of the cells, the mixture was heated to 95°C for 5 min, and the proteins were subjected to 16.5% SDS-PAGE. The Western blot analysis was performed using either S100A9-specific (A) or S100A8-specific (B) antibodies. C, D) The NADPH oxidase activity induced by either 100 nM PMA (C) or 100 ng/ml LPS/6 µM fMLP (D) was determined by the formation of the formazan product, as described in Materials and Methods. Data are expressed as absorbance units/106 cells; n = 3 experiments. Probability values of P < 0.05 were considered to represent significant differences.


Fig. 2

Figure 2. NADPH oxidase activity of PMNs either from S100A9−/− or S100A9+/+ mice. A) Overlay of 2 typical experiments. Increase in DCF fluorescence of wild-type cells is significantly stronger after PMA stimulation than that of S100A9−/− cells. B, C) Net increase in DCF fluorescence per 100 s, after stimulation with either PMA (B) or PAF (C). The generation of reactive oxygen species is reduced >2-fold in S100A9−/− neutrophils, when compared with wild-type neutrophils. The significance of the difference between the mean was calculated by a Student's t test; n = 7 for PMA and n = 6 for PAF. Probability values of P < 0.004 (for PMA) and P < 0.05 (for PAF) were considered to represent significant differences.


Fig. 3

Figure 3. NADPH oxidase activation either in cell-free system or semirecombinant system. A) The NADPH oxidase of bovine neutrophil membranes (6.5 µg membrane protein in 20 µl PBS) was activated either in the presence of 65 µg of bovine neutrophil cytosol containing S100A8/A9 (cell-free system, left panel) or in the absence of S100A8/A9 (semi-recombinant system, right panel), by a mixture of recombinant cytosolic phox proteins (p47phox, p67phox, and GTPγS-loaded Rac-2). The oxidase activation in both systems was carried out with different AA concentrations as indicated. The activity elicited after 10 min incubation at 20°C was assayed as the rate of cytochrome c reduction sensitive to SOD (for further details see Materials and Methods), and is expressed as a function of the AA concentration. The data represent a typical experiment conducted three times with similar results. The inset shows the Western Blot analysis of bovine neutrophil membranes (a) and bovine neutrophil cytosol (b), using the anti-S100A9 antibody. B) Left panel: before NADPH oxidase activation, either the neutrophil membranes (�) or the neutrophil cytosol (�) was treated with 65 µg S100A9-specific antibody. The experimental conditions were similar to those described in A. In control (�), neither the neutrophil membranes nor the neutrophil cytosol were treated with S100A9-specific antibody. The data represent a typical experiment conducted 3 times with similar results. Right panel: before NADPH oxidase activation, the neutrophil cytosol was treated with increasing concentrations of S100A9-specific antibody as indicated. The experimental conditions were similar to those described in A. The maximal oxidase activity (at an AA concentration of 1.2 µmol/mg membrane protein) is expressed as percentage of the control activity as a function of antibody concentration used. Values are means (± SD) of 3 independent experiments. For points lacking an error bar, the SD was less than the size of the symbol used.


Fig. 4

Figure 4. Effect of either wild-type or mutant S100A8/A9 protein complexes on NADPH oxidase activation in the semirecombinant system. The NADPH oxidase of bovine neutrophil membranes (6 µg protein) was activated in the semi-recombinant system with the optimal concentration of AA (giving the maximal activity as shown in Figure 3A either in the absence of S100 proteins (control) or in presence of various S100A8/A9 complexes as indicated. The bovine S100A8/A9 complex was purified from bovine neutrophil cytosol as earlier reported (6); the human S100A8/A9 complexes were reconstituted using wild-type recombinant S100A8 and the different recombinant S100A9 proteins (wild-type, S100A9(H103,104,105K106A), or S100A9(1-100); see Materials and Methods). The mol ratio of S100 proteins to p67phox was adjusted to 1:1, and the oxidase activity is expressed as % deviation from control. Bars are SD calculated from 7 experiments for control and bovine S100A8/A9 and from 3 experiments in other conditions.


Fig. 5

Figure 5. Effect of purified bovine S100A8/A9 upon NADPH oxidase in the absence of cytosolic phox proteins. Bovine neutrophil membranes (6 µg protein containing 3 pmol flavocytochrome b in 20 µl PBS) were incubated for 5 min at room temperature, in the absence (�) or presence (�) of 300 pmol S100A8/A9, and then GTPγS and various concentrations of AA were added and the incubation pursued for additional 10 min. In parallel, analogous experiments were performed in the presence of a limited amount of neutrophil cytosol (7 µg protein containing the cytosolic phox proteins), either in the absence (�) or in presence of 300 pmol exogenous S100A8/A9 (�). The ratio of cytosol to membrane protein was adjusted to 1:1.7, to elicit only a little oxidase activity in the cell-free system. The bars represent the standard deviation calculated from 3 experiments. For points lacking an error bar, SD was less than the size of the symbol used. Cphox = cytosolic phox proteins


Fig. 6

Figure 6. Inhibition of the NADPH oxidase activation by S100A8. The NADPH oxidase of bovine neutrophil membranes (6 µg protein) was activated in the semirecombinant system, using the optimal AA concentration (see Figure 3), in the presence of various amounts of S100A8 ( , ) or S100A9 ( , ) ranging from 0 to 5-fold the amount of p67phox (for further details see Materials and Methods). Before addition of AA the S100 proteins were pre-incubated in the cell-free medium for 5 min at room temperature, either in the absence (1 mM EGTA; , ) or presence of 1 µM calcium ( , ). Bars are SD calculated from 4 experiments.


Fig. 7

Figure 7. Protein-protein interaction assay of the S100 proteins with p67phox (A), p47phox (A), and Rac-1 and Rac-2 (B, C). Before addition of glutathione-sepharose, the GST fusion protein was incubated with various protein combinations for 1h at room temperature as indicated. The glutathione-sepharose was washed, followed by the addition of SDS sample buffer. Then the suspension was heated to 95°C, and the proteins were subjected to 15% SDS-PAGE followed by Western-blot analysis. A) GST-S100A8 was incubated with either p67phox, p67phoxN-ter, p67phoxC-ter, or p47phox in the presence and absence of His6-tagged S100A9. The Western-blot analysis was performed using either human p67phox-specific or human p47phox-specific antibody . B) Either GST-Rac-1 or GST-Rac-2 was incubated with His6-tagged S100A8 in the presence and absence of His6-tagged S100A9. Western blot analysis was performed using either human S100A8- or S100A9-specific antibody. C) Either GST-Rac-1 or GST-Rac-2 was incubated with His6-tagged S100A9. Western blot analysis was performed using human S100A9-specific antibody.


Fig. 8

Figure 8. Model proposing a dual role for S100A8/A9 in activating the neutrophil NADPH oxidase. Ligation of specific cell surface receptors leads to phosphorylation of p47phox, translocation of p47phox/p67phox, activation and membrane translocation of the GTPase Rac. Rac-GTP is a component of the active oxidase complex, binding to both p67phox and gp91phox. In this model, S100A8/A9 is involved in NADPH oxidase activation by transferring AA to gp91phox during interactions with p67phox and Rac. Binding of AA to gp91phox induces a structural change in cytochrome b558, which results to the final formation of the active complex. A8, S100A8; A9, S100A9; AA, arachidonic acid.


full article

Health & Medicine