filmarray: automated pcr. genetics in the real world how are genetics used in real world...

34
FilmArray: Automated PCR

Upload: beverley-neal

Post on 24-Dec-2015

215 views

Category:

Documents


0 download

TRANSCRIPT

Page 1: FilmArray: Automated PCR. Genetics In the Real World  How are genetics used in real world applications?  What can an undergrad student do with knowledge

FilmArray: Automated PCR

Page 2: FilmArray: Automated PCR. Genetics In the Real World  How are genetics used in real world applications?  What can an undergrad student do with knowledge

Genetics In the Real World

How are genetics used in real world applications?

What can an undergrad student do with knowledge gained from Biology?

Page 3: FilmArray: Automated PCR. Genetics In the Real World  How are genetics used in real world applications?  What can an undergrad student do with knowledge

PCR: A Quick Review

Polymerase Chain reaction:Quiz: what do you know?

Page 4: FilmArray: Automated PCR. Genetics In the Real World  How are genetics used in real world applications?  What can an undergrad student do with knowledge

Components of PCR

AGGTGTCCGCGATAGACGATAGCGAGTAGCAGAGGTTTAGA

3’ 5’Template DNA

TCCACAGGCGCTATCTGCT AT C

Primer

A

AA

T

T

T

5’ 3’

C

C

C

C

G

G

G

Free nucleotides

C

G

Taq polymerase

Buffers

Page 5: FilmArray: Automated PCR. Genetics In the Real World  How are genetics used in real world applications?  What can an undergrad student do with knowledge

PCR Process

-Heat denatures template strand

-Forward and reverse primers are annealed to single stranded DNA

-Taq polymerizes dNTP’s to elongate the replicated strand.

Page 6: FilmArray: Automated PCR. Genetics In the Real World  How are genetics used in real world applications?  What can an undergrad student do with knowledge

PCR Amplification

Original DNA Copy

5 cycles of PCR amplify 1 copy into 32………and so on

Page 7: FilmArray: Automated PCR. Genetics In the Real World  How are genetics used in real world applications?  What can an undergrad student do with knowledge

Instruments for Viewing PCR Results

•Gel Electrophoresis and Camera image of agarose gel

Page 8: FilmArray: Automated PCR. Genetics In the Real World  How are genetics used in real world applications?  What can an undergrad student do with knowledge

PCR in the Classroom

How long does PCR take?

Page 9: FilmArray: Automated PCR. Genetics In the Real World  How are genetics used in real world applications?  What can an undergrad student do with knowledge

Improving the Process: PCR today

New Concepts Biotechnology industry utilizes

many new improvements in conducting and analyzing the PCR process

Page 10: FilmArray: Automated PCR. Genetics In the Real World  How are genetics used in real world applications?  What can an undergrad student do with knowledge

Fluorescent DNA: DNA Binding Molecules

Fluorescent molecules that bind to double stranded DNA help make it visible. Works like ethidium bromide in gel electrophoresis

CGTTAGCACAGTACAGACGCAATCGTGTCATGTCTG

+

CGTTAGCACAGTACAGACGCAATCGTGTCATGTCTG

=

Page 11: FilmArray: Automated PCR. Genetics In the Real World  How are genetics used in real world applications?  What can an undergrad student do with knowledge

Visible RealmGreater Than 10 Billion Copies

Camera Records a Fluorescent Image Every Cycle

PCR Cycle 1 5 10 15 20 25 30 40

Num

ber of DN

A C

opies

Page 12: FilmArray: Automated PCR. Genetics In the Real World  How are genetics used in real world applications?  What can an undergrad student do with knowledge

Real-Time PCR

Uses a camera and

Software to plot

fluorescence during PCR

Page 13: FilmArray: Automated PCR. Genetics In the Real World  How are genetics used in real world applications?  What can an undergrad student do with knowledge

Nested PCR Nested reaction includes:

1. outer PCR (PCR1)2. dilution3. inner PCR (PCR2)

*allows for more specific amplification of selected organisms

Page 14: FilmArray: Automated PCR. Genetics In the Real World  How are genetics used in real world applications?  What can an undergrad student do with knowledge

Nested RT-PCR Primer Designs

Outer RT-PCR

Inner PCR

200bp

90bp

Virus Genome

Page 15: FilmArray: Automated PCR. Genetics In the Real World  How are genetics used in real world applications?  What can an undergrad student do with knowledge

Multiplex Assays

Uses multiple primers in one reaction to amplify several different DNA templates present in a sample

i.e.: clinical sample run on a panel of 20 organisms to determine presence ofinfection

Page 16: FilmArray: Automated PCR. Genetics In the Real World  How are genetics used in real world applications?  What can an undergrad student do with knowledge

Schematic of Nested Multiplex PCR

Secondary PCR

Dilute 100 fold

1F 1R

2R

3R

5R

6R

3F

2F

6F

4F

5F

4R

Primary RT-PCR

Page 17: FilmArray: Automated PCR. Genetics In the Real World  How are genetics used in real world applications?  What can an undergrad student do with knowledge

Primer Design

Primer of 17 base pairs has 1 in 10 billion chance of laying down on human genome. Design never goes below 17 bp (usually 18-20bp)

AGGTGTCCGCGATAGACGATAGCGAGTAGCAGAGGTTTAGA

AGGCGCTATCTGCT ATC

5’ 3’

3’ 5

Page 18: FilmArray: Automated PCR. Genetics In the Real World  How are genetics used in real world applications?  What can an undergrad student do with knowledge

Our Project: FilmArray

Page 19: FilmArray: Automated PCR. Genetics In the Real World  How are genetics used in real world applications?  What can an undergrad student do with knowledge

Collaboration

Chemists: PCR reactions occurring in the pouch

Engineers: Pouch development and Instrument development

Software: Communication from instrument to computer, analysis of data

Film Array instrument allows for automated PCR with results in approximately 1 hour

Page 20: FilmArray: Automated PCR. Genetics In the Real World  How are genetics used in real world applications?  What can an undergrad student do with knowledge

FilmArray Pouch Cell

LysisPCR1

PCR2MagBead

Capture

DiluteWash

Pouch substitutes pipettes and tubes for mixing

substitutes chemist on a bench-top

FLASH ANIMATION

Page 21: FilmArray: Automated PCR. Genetics In the Real World  How are genetics used in real world applications?  What can an undergrad student do with knowledge

FilmArray Beta Prototype

Substitutes mechanical actions of chemist and bench-top instruments (bead whacker=vortex, mag. beads and blisters=filter tubes and centrifuge, peltier=thermo block, array=DNA detection

Page 22: FilmArray: Automated PCR. Genetics In the Real World  How are genetics used in real world applications?  What can an undergrad student do with knowledge

Run Protocol

1st PCR

DNA Melt

2nd PCR

There are two Peltier Thermocyclers

The software displays the temperature during each PCR and the melt

Green indicates camera acquisitions:

Once per PCR2 cycle 2500 in the 5 min

melt

Page 23: FilmArray: Automated PCR. Genetics In the Real World  How are genetics used in real world applications?  What can an undergrad student do with knowledge

Example of Results

Software makes call, positive or negative result

2nd PCR Post PCR Melt

PCR1 Control PCR2 Control Sc DNA assay Sc RNA assay

Sp DNA AssaySp RNA Assay

Page 24: FilmArray: Automated PCR. Genetics In the Real World  How are genetics used in real world applications?  What can an undergrad student do with knowledge

Film Array Utilizes

Faster Process Sample utilization: 120 1uL

reactions = 1/10 price Pre amplification (PCR 1=

enrichment) amplifies enough to cover entire array every well

Some micro-array processes have difficulty having enough sample for every well

Page 25: FilmArray: Automated PCR. Genetics In the Real World  How are genetics used in real world applications?  What can an undergrad student do with knowledge

Risks of PCR

Contamination is a HUGE risk factor Nesting not to popular because of

how easily you can contaminate your assays

False positives look the same as true positives

The pouch is an all enclosed environment that eliminates the risk of contamination

Page 26: FilmArray: Automated PCR. Genetics In the Real World  How are genetics used in real world applications?  What can an undergrad student do with knowledge

Reagent Lyophilization

All reagents in the pouch or lyophilized (freeze dried) so all that is needed is water

Freeze Dried reagents can have a shelf life of approximately 1 year

Wet Bench Top reagents have short shelf life

Proteins are protected with “cake” so they don’t die

Page 27: FilmArray: Automated PCR. Genetics In the Real World  How are genetics used in real world applications?  What can an undergrad student do with knowledge

Film Array Applications: Projects Under Development

Respiratory Panel: Clinical Samples Febrile Infant Risk Stratification Tool

(FIRST): bacterial identification for infant fever

Biothreat Pouch:Department of Defense

Methicillin Resistant Staph. aureus detection:characterizing outbreaks of Staph infection in the hospital and community

Tuberculosis Screening

Page 28: FilmArray: Automated PCR. Genetics In the Real World  How are genetics used in real world applications?  What can an undergrad student do with knowledge

Respiratory Panel

Resp. Panel screens samples for 16 viruses or bacteria in 1 hour

PIV1 HNPIV2 FGPIV3 FGPIV4 FGFluB HARSV MGFluA MA Pan

HA H3HA H5HA H5NA N1NA N2

Adenovirus HexEnterovirus 3' UTR HRV

Coronavirus Pol 229ENG 229EPol OC43NG OC43Pol HKU1NG HKU1Pol NL63NG NL63NG SARSPL SARS

hMPV NGPol

Bocavirus NP-1NS-1

B. pertutsis ToxinM. pneumoniae gyrBM. pneumoniae ToxinC. pneumoniae gyrBOut control AtD08Dilution cont AtR04PCR2 Control AtR04RNA Process SpR05DNA Process SpD02

Page 29: FilmArray: Automated PCR. Genetics In the Real World  How are genetics used in real world applications?  What can an undergrad student do with knowledge

Micro-array: Automated Pipetting

Page 30: FilmArray: Automated PCR. Genetics In the Real World  How are genetics used in real world applications?  What can an undergrad student do with knowledge

Spots Primersin specific layout

Film Array 1 2 3 4 5 6 7 8 9 10

a rpoB1Spne AtR04 FluAN1NA05 RSVMG0 FluBHA01 AtD02

b FluAH3Ha04 AdHex-iF1R1 ScD05 AtD08 AdHex-iF2R1

c PIV3FG01 FluBHA01 AdHex-iF1R2 gyrB3Mpne PIV1HN01 ScD05

d AdHex-iF2R2 rpoB1Spyo FluANaN206 RSVMG0 gyrB3Mpne

e FluAHA1 AdHex-iF2R1 PIV1HN01 PIV2FG02 CoVOC43NG07 FluAHA1 AdHex-iF1R1f ScR03 AtD08 PIV2FG02 AtD08 AtD02 AdHex-iF2R2 AtD08 FluAH3Ha04 rpoB1Spne

g PIV1HN01 FluANaN206 ScD05 FluAN1NA05 rpoB1Spne CoV229EPL01 PIV3FG01

h AdHex-iF1R1 FluAH3Ha04 RSVMG0 FluBHA01 ScR03 FluAHA1 CoV229EPL01 AdHex-iF2R1 PIV2FG02

I CoV229EPL01 ScD05 rpoB1Spne AdHex-iF2R2 AdHex-iF1R2 ScR03 PIV3FG01 AtR04 ScR03

j rpoB1Spyo gyrB3Mpne PIV3FG01 rpoB1Spyo AtR04 PIV2FG02 RSVMG0 FluAN1NA05 FluANaN206

k AdHex-iF2R2CoVOC43NG07 PIV1HN01 AtR04 CoVOC43NG07 FluAN1NA05 gyrB3Mpne CoV229EPL01 AdHex-iF1R2 rpoB1Spyo

l AtD02 AdHex-iF1R2 FluAHA1 AdHex-iF1R1 FluANaN206 AdHex-iF2R1 CoVOC43NG07 FluAH3Ha04 FluBHA01 AtD02

Page 31: FilmArray: Automated PCR. Genetics In the Real World  How are genetics used in real world applications?  What can an undergrad student do with knowledge

Kody (BioChemistry Intern)

Pouch Production Freeze Dry Reagents Reagent QC Primer Validation and Tracking Assay Optimization Pouch/Protocol Optimization Build and Update Database

Page 32: FilmArray: Automated PCR. Genetics In the Real World  How are genetics used in real world applications?  What can an undergrad student do with knowledge

Meghan (Research Associate I)

NanoPlotter validation and QC Film Array instrument optimization Assist with pouch production

Page 33: FilmArray: Automated PCR. Genetics In the Real World  How are genetics used in real world applications?  What can an undergrad student do with knowledge

Idaho Technology Broad range of projects Great experience, resume builder Offers career opportunities,

internships, and benefitsVisit:http://www.idahotech.com/work_with_us/

Join the ITI Team

                                                    

 

Page 34: FilmArray: Automated PCR. Genetics In the Real World  How are genetics used in real world applications?  What can an undergrad student do with knowledge

Questions?