fall 2016 new products - molecular modeling · fall 2016 new science olympiad protein modeling...

Fall 2014Fall 2014

...where molecules become real TM

Fall 2016

New Science Olympiad Protein Modeling Event Kits Page 20

Water Kit© Page 3

Substrate Specifi city Field Test Kit©

Page 8

CRISPR/Cas9 Mini Model 0

Improved Adenosine Triphosphate Mini Model

Page 14

Neuron Modeling Kit© Page 19

Flow of Genetic Information Kit© Page 13

Amino Acid Starter Kit©

Page 7DNA Discovery Kit©

Page 11

Enzymes in Action Kit©

Page 8Phospholipid & Membrane Transport Kit©

Page 5

Our Customers' Favorite Products

David Goodsell Cellular Landscapes Page 15

New Products

3dmoleculardesigns.com

Substrate Specifi city

CRISPR/Cas9 Mini ModelImproved Adenosine Improved Adenosine Improved

Neuron Modeling Kit©

Our Customers' Favorite Products

© Amino Acid Starter Kit©



2

3D Molecular Designs utilizes magnets in many products to help students understand the inter- and intra-molecular forces in the molecular world. In compliance with the Consumer Product Safety Improvement Act of 2008, 3DMD adds the warnings below to our products and encourages the safe use of our products in classrooms and other science education settings. Please contact us if you have questions or concerns.

WARNING: SMALL MAGNETS WARNING: CHOKING HAZARD CAUTION:This product contains small magnets. Swallowed magnets can stick together across intestines causing serious infections and death. Seek immediate medical attention if magnets are swallowed or inhaled.

This product contains small parts and should be kept out of the reach of children under the age of 3, because the parts or their pieces may present a choking hazard to small children.

This is a science education product, not a toy. It is not intended for children under 8 years old.

! !

Science Olympiad Protein Modeling Event Pre-Build Kit and Practice Kit ......................................................... 20

Project-Based Learning ActivitiesNeurotransmitters Module: The Beery Twins’ Story©

Human Sepiapterin Reductase mRNA Gene Map© and Mini Model and Dopamine and Serotonin Biosynthesis Models .......... 18

KitsWater Kit© ........................................................................................ 3Phospholipid & Membrane Transport Kit© ...................................... 5ß-Globin Folding Kit© ...................................................................... 6Amino Acid Starter Kit© ................................................................... 7Enzymes in Action Kit© and Substrate Specifi city Field Test Kit© . 8Insulin mRNA to Protein Kit© .......................................................... 9DNA Discovery Kit© and DNA Starter Kit© ................................... 11Flow of Genetic Information Kit© ................................................... 13Neuron Modeling Kit and Alpha Helix & Beta Sheet Construction Kit© ......................................................................... 19Science Olympiad Protein Modeling Event Kits............................... 20

Plaster and Nylon Models and Mini ModelsSodium Channel, Aquaporin Channel, Potassium Channel and Potassium Channel with Scorpion Toxin ...................................... 4 ß-Globin ............................................................................................ 6Acetylcholinesterase Active Site Cubes ............................................ 8Insulin ................................................................................................ 9Hemoglobin, DNA and CRISPR/Cas9 ............................................. 10Adenosine Triphosphate ...................................................................14 Nucleosome, Ribosomes and Transfer RNA .................................... 16Antibody, Hemagglutinin and Infl uenza Virus Capsules .............................................................. 17Dopamine and Serotonin Biosynthesis Models and Sepiapterin Reductase ...................................................................................... 18Alpha Helix & Beta Sheet ................................................................ 19Green Fluorescent Protein and Zinc Finger ..................................... 20

PostersAmino Acid Starter Kit Poster©......................................................... 7Insulin Poster©................................................................................... 9Hemoglobin Poster© ........................................................................ 10Genetic Codon Posters© ................................................................... 14David Goodsell Cellular Landscapes: Tour of a Human Cell©, Mitochondria Poster©, E. coli Poster© and Neuromuscular Synapse Poster© .................. 15

PRODUCT BY CATEGORYWater and MembraneWater Kit© and NaCl Lattice© .......................................................... 3Channel Mini Models: Sodium Channel, Aquaporin Channel, Potassium Channel and Potassium Channel with Scorpion Toxin ........................................................ 4Phospholipid & Membrane Transport Kit© and Phospholipid Modeling Set© ......................................................... 5Molecules of Life Collection© .......................................................... 12Water Tattoos .…………………………………………………….... 21

DNADNA and CRISPR/Cas9 Mini Models.............................................. 10DNA Discovery Kit© and DNA Starter Kit© ................................... 11Molecules of Life Collection© .......................................................... 12Flow of Genetic Information Kit© and Demo DNA Nucleotides© ................................................................. 13Adenosine Triphosphate Mini Model ................................................. 14Ribosomes and Transfer RNA Mini Models ..................................... 16 Amino Acids and Protein Structure ß-Globin Folding Kit©, Prefolded Model and ß-Globin Mini Models ................................................................... 6Amino Acid Starter Kit© and Amino Acid Starter Kit Poster© ......................................................................... 7Insulin mRNA to Protein Kit©, Insulin Poster© and Insulin Mini Model ........................................................................ 9Molecules of Life Collection© .......................................................... 12Genetic Codon Posters© and Amino Acid Building Block Models .. 14Alpha Helix & Beta Sheet Construction Kit© and Alpha Helix & Beta Sheet Models ................................................ 19Zinc Finger Mini Model .................................................................... 20Modeling Mini Toobers ..................................................................... 21

Enzymes Amino Acid Starter Kit© ................................................................... 7Enzymes in Action Kit©, Substrate Specifi city Field Test Kit© and Acetylcholinesterase Active Site Cubes© ............................... 8

ß-Globin ß-Globin Folding Kit©, ß-Globin Mini Models and Map of the Human ß-Globin Gene©.............................................. 6Hemoglobin Nylon Model and Poster© ............................................ 10

Practice of ScienceThe Data Dilemma© and Mystery Tube© ........................................ 21



Fall 2016

3

Your students will discover the cubic nature of salt crystals, effi cient lattice packing, high melting temperature, brittleness, cleavage planes and more with these models. Each ion model has 6 embedded magnets to simulate ionic bonding. The 4x4x4 lattice contains 64 ions (32 sodium and 32 chloride) and the 3x3x3 lattice contains 27 ions (13 of 1 type of ion and 14 of the other). Lattices do not include 3DMD water molecules. Water molecules are sold in Water Kits© (see above).

Also see Sodium Channel and Potassium Channel Mini Models (page 4).

Water Kit©

While playing with these appealing magnetic water molecules your students will understand concepts that are often diffi cult to learn. They will explore hydrogen bonding, make ice, dissolve salt, evaporate water, explore transpiration, create ethanol and much more. Each Water Kit© cup includes pieces for 12 water molecules, 1 sodium, 1 chloride, 1 ethane and 1 hydroxyl group. All atoms are magnetized to refl ect their positive or negative charges (except for non-polar ethane). Lessons and activities are available online.

Also see Aquaporin Channel Mini Model (page 4), Phospholipid & Membrane Transport Kit© (page 5), and Water Tattoos (page 21).

10-Cup Set $385 (WK-10) • 8-Cup Set $308 (WK-08) • 6-Cup Set $232 (WK-06)2 to 5 Cups $42 each (WK-02) • 1-Cup $44 (WK-01)

NaCl Lattice©

4x4x4 Lattice $177 (NACL-04) 3x3x3 Lattice $82 (NACL-03)

!

!

WARNING: CHOKING HAZARD

WARNING: SMALL MAGNETS

CAUTION: Science Education ProductPlease see bottom of page 2 for details.

!

!

WARNING: CHOKING HAZARD

WARNING: SMALL MAGNETS

CAUTION: Science Education ProductPlease see bottom of page 2 for details.

3x3x3 Lattice 4x4x4 Lattice

See our Phospholipid & Membrane Transport Kit© (page 5)!



4

This model of a bacterial sodium channel shows the pore domain of the protein. The pore domain is a homo-tetramer in which 4 identical proteins come together to form the ion pore — exposed on the outside surface of the cell. The protein structure was captured in its open conformation, where your students can easily see how hydrated Na+ ions can be released into the cytoplasm after passing through the pore. Voltage-gated sodium channels play a critical role in generating the action potential in signaling neurons. As they open — in response to a stimulus — sodium ions enter the cell, leading to depolarization and a propagation of the action potential.

Also see Water Kit© and NaCl Lattice© (page 3).

Sodium Channel Mini Model

Potassium Channel Mini Model

3.75” Plaster Model $95 (SCMM)

The potassium channel is a 4-subunit, transmembrane protein that allows the rapid passage of potassium ions — but not sodium ions — across the membrane. The protein backbones of the 4 subunits come together to form a channel, with carbonyl oxygen atoms precisely positioned in 3-D space to replace the water that normally hydrates each ion. Since there is no energetic diff erence between a hydrated potassium ion and the same ion bound in the pore of the potassium channel, the ion rapidly passes through the channel in a frictionless manner. 3.75” Plaster Model $78 (PCMM)

Also see NaCl Lattice© (page 3).

Potassium Channel Bound with Scorpion Toxin Mini ModelThese 2 models enable you to tell many stories. The green potassium channel model illustrates how this amazing protein allows the rapid transport of potassium channel ions while simultaneously preventing the fl ow of smaller sodium ions. The yellow scorpion toxin model (from the Chinese scorpion Buthus martensi) shows how disulfi de bonds stabilize the structure of this small protein, how some proteins interact to form multi-protein complexes, and how a strategically placed lysine side chain of the magnet-docked scorpion toxin plugs the channel through which potassium ions normally fl ow. The model also displays additional amino acid side chains that are important in stabilizing the interaction between these 2 proteins.5'' Plaster Model $87 (PCSMM)

Mini models are made of plaster by 3-D printing and should be handled with care. Models will break if dropped, held tightly or handled roughly.

Channel Protein Mini Models

Aquaporin Channel Mini Model

The Aquaporin Mini Model opens to show water molecules rolling over in their passage through the channel.

Aquaporin — a membrane-spanning protein — is responsible for moving water across a lipid bilayer. Its structure consists of 6 alpha helices and 2 half alpha helices that form an hourglass shape through which water molecules move one at a time. Two asparagine amino acids are strategically positioned near the center of the hourglass and provide selectivity to this channel, allowing only water molecules pass through. 3.75” Plaster Model $77 (ACMM)

Also see Water Kit© (page 3).

Channel protein mini models are built at the same scale.



Fall 2016

5

These Molymod phospholipid models enable your students to explore the amphipathic structure of phospholipids, the most abundant lipids in membranes. The set contains all of the atoms and bonds needed to construct fi ve phospholipids: phosphatidylcholine, phosphatidylserine, phosphatidylinositol, phosphatidylethanolamine and sphingomyelin, and compare and contrast the chemical make-up of their hydrophilic heads and hydrophobic tails. The phospholipid models can be used separately or with the Phospholipid & Membrane Transport Kit©.Phospholipid Modeling Set $507 (PLMS-01)Phosphatidylcholine $114 (PLMS-A) Phosphatidylserine $109 (PLMS-B)Phosphatidylinositol $119 (PLMS-C) Phosphatidylethanolamine $106 (PLMS-D)Sphingomyelin $118 (PLMS-E)

Also see Water Kit© (page 3) and Phospholipid & Membrane Transport Kit© (above).

Phospholipid & Membrane Transport Kit©

Phospholipid Modeling Set

Let your students discover the spontaneous formation of membranes for themselves, using this new kit that features the amphipathic structure of phospholipids, with their hydrophilic heads and hydrophobic tails. Your students will explore the chemical structure of a phospholipid and then construct a phospholipid monolayer, a micelle and a bilayer, leading to an understanding of the plasma membrane structure. Additional components of this kit allow students to construct lipid bilayers and consider the role of transport proteins in moving ions and small molecules across membranes. Lessons and activities are available online.1-Group Set $38 (PMTK-01)

3-Group Set $99 (PMTK-03)

Also see Water Kit© (page 3). ! WARNING: CHOKING HAZARDCAUTION: Science Education Product Please see bottom of page 2 for details.

! WARNING: CHOKING HAZARDCAUTION: Science Education Product Please see bottom of page 2 for details.

Phosphatidylcholine Sphingomyelin

PhosphatidylserinePhosphatidylethanolamine

Phosphatidylinositol

Indicates Double Bond

Phospholipid Structure

Phosphorylated Na+/K+ Pump Liposome



6

β-Globin Folding Kit©

Proteins become real in your students’ hands as they fold 3 mini toober β-globin fragments and discover the primary, secondary and tertiary structure in this model. Maps guide your students in folding the mini toobers into β-globin’s 3-D shape. Use the folded mini toober model of β-globin to discuss protein structure, the important role of hemoglobin in oxygen transport and the lasting eff ects of a single amino acid mutation on a protein. The kit includes mini toobers, folding map guides, amino acid side chains, heme group, iron atom, oxygen atoms and an assortment of parts to mark and connect the fragments. Teacher notes and student handouts are available online. The folding kit can be used successfully by 6 to 9 students working in 3 teams. Folding Kit $118 (BGFK)

Prefolded Model $120 (BGM)

It’s best if your students fi rst use the Amino Acid Starter Kit© (page 7) before using the β-Globin Folding Kit©. Also see Map of the Human β-Globin Gene© (below). The prefolded model can be used as a same-scale model when using the β-Globin Folding Kit© or to teach concepts noted above.

β-Globin Mini Modelsβ-globin, a small protein (146 amino acids), transports oxygen throughout our bodies. Our 2 β-Globin Mini

Models feature the heme group with its iron atom which binds oxygen, the location of the sickle cell mutation and selected charged, hydrophobic and hydrophilic side chains. The model on the left can be used as an accurate, smaller-scale template when using the β-Globin Folding Kit© (above). The 3 colors correspond to the 3 fragments in the β-Globin Folding Kit©. Side chains on the model on the right indicate mutations that are noted on the Teacher Map of the Human β-Globin Gene©

(below). The 3 colors of the alpha carbon backbone correspond to the 3 exons in the gene. Mini models are made of plaster by 3-D printing and should be handled with care.

Models will break if dropped, held tightly or handled roughly.

4” Plaster Model $74 (BGMMFK) • 4” Plaster Model $74 (BGMMPBI)

Also see β-Globin Folding Kit© (above) and Teacher Map of the Human β-Globin Gene© (below).


Use with β-Globin Folding Kit©

β

gene. Models will break if dropped, held tightly or handled roughly.

Use with β-Globin

Use with Map of the Human β-Globin Gene©

Use with Map of the Human

A 3DMD BioInformatics Activity©

Map of the Human β-Globin Gene©

1 Student and 1 Teacher Map Combo $40 (BGGM-01S-01T) • 3 Student and 1 Teacher Map Combo $60 (BGGM-03S-01T)12 Student and 1 Teacher Map Combo $145 (BGGM-12S-01T)

Don’t just tell your students about triplet codons, reading frames or introns and exons. Let them discover these eukaryotic gene features as they explore the Map of the Human β-Globin Gene©. Starting with the protein sequence, students work backward to discover the β-globin gene. Student maps can be used by individuals or small groups and are available in sets of 1, 3 or 12.

One teacher's map comes with every combo. The teacher's map features highlighted reading frames and mutation sites. Teachers' notes, instructions and student handout are provided online. All maps are laminated.

Don’t just tell your students about triplet codons, reading frames or introns and exons. Let them discover these eukaryotic gene features as they

Reduced level of β-Globin protein is made due to inefficient donor splice site (β+ thalassemia).

I C F * H N C V H * Q P Q T D T M V H L T P E E K S A V T A L W G K V N V D E V G G E A L G R L V S R L Q D R F K E T N R N W A C G D R E D S W V S D R H * L S L P I G L F S H P * A A G G L P L D P E V L * V L W G S V H S * C C Y G Q P * G E G S W Q E S A R C L * * W P G S P G Q P Q G H L C H T E * A A L * Q A A R G S * E L Q G E S M G P L M F S F P F F S M V K F M S * E G E K * Q G T V * N G K Q T N D C I S V E V S G S F * F L L F A V H N N C F L L F N S C F L F F S S P Q F L L L Y L M P * H C V * Q K E I S L R Y I K * L K K K L Y T V C L V H Y Y L E Y M C A Y L H I H N L P T L F S F I F N * Y I I I I H I Y G L K C N V L I C V H I L T K S G * F C I C N F K K C F L L L I Y F F V Y L I S N T F P N L F L S G Q * * Y N V S C L F A P F * R I T V I I S G L R Q * Q Y F C I * I F L H I N C N * C K R F H I A N S S Y N P A T I L L L F Y G W D K A G L F * V Q A R P F C * S C S Y L L S S S H S S W A T C W S V C W P I T L A K N S P H Q C R L P I R K W W L V W L M P W P T S I T K L A F L L S N F Y * R F L C H L L L T Q L C S L A T S N R H H G A P D S * G E V C R Y C P V G Q G E R G * S W W * G P G Q V G I K V T R Q V * G D Q * K L G M W R Q R R L L G F * * A L T L S A Y W S I F P P L G C W W S T L G P R G S L S P L G I C P L L M L L W A T L R * R L M A R K C S V P L V M A W L T W T T S R A P L P H * V S C T V T S C T W I L R T S G * V Y G T L D V F F P L L F Y G * V H V I G R G E V T G Y S L E W E T D E * L H Q C G S L R I V L V S F I C C S * Q L F S F V * F L L S F F F F S A I F T I I L N A L T L C I T K G N I S E I H * V T * K K T L H S L P S T L L F G I Y V C L F A Y S * S P Y F I F F Y F * L I H N H Y T Y L W V K V * C F N M C T H I D Q I R V I L H L * F * K M L S S F N I L F C L S Y F * Y F P * S L S F R A I M I Q C I M P L C T I L K N N S D N F W V K A I A I F L H I N I S A Y K L * L M * E V S Y C * * Q L Q S S Y H S A F I L W L G * G W I I L S P S * A L L L I M F I P L I F L P Q L L G N V L V C V L A H H F G K E F T P P V Q A A Y Q K V V A G V A N A L A H K Y H * A R F L A V Q F L L K V P L T F A S D T T V F T S N L K Q T P W C T * L L R R S L P L L P C G A R * T W M K L V V R P W A G W Y Q G Y K T G L R R P I E T G H V E T E K T L G F L I G T D S L C L L V Y F P T L R L L V V Y P W T Q R F F E S F G D L S T P D A V M G N P K V K A H G K K V L G A F S D G L A H L D N L K G T F A T L S E L H C D K L H V D P E N F R V S L W D P * C F L S P S F L W L S S C H R K G R S N R V Q F R M G N R R M I A S V W K S Q D R F S F F Y L L F I T I V F F C L I L A F F F F L L R N F Y Y Y T * C L N I V Y N K R K Y L * D T L S N L K K N F T Q S A * Y I T I W N I C V L I C I F I I S L L Y F L L F L I D T * S L Y I F M G * S V M F * Y V Y T Y * P N Q G N F A F V I L K N A F F F * Y T F L F I L F L I L S L I S F F Q G N N D T M Y H A S L H H S K E * Q * * F L G * G N S N I S A Y K Y F C I * I V T D V R G F I L L I A A T I Q L P F C F Y F M V G I R L D Y S E S K L G P F A N H V H T S Y L P P T A P G Q R A G L C A G P S L W Q R I H P T S A G C L S E S G G W C G * C P G P Q V S L S S L S C C P I S I K G S F V

I C F * H N C V H * Q P Q T D T M V H L T P E E K S A V T A L W G K V N V D E V G G E A L G R L V S R L Q D R F K E T N R N W A C G D R E D S W V S D R H * L S L P I G L F S H P * A A G G L P L D P E V L * V L W G S V H S * C C Y G Q P * G E G S W Q E S A R C L * * W P G S P G Q P Q G H L C H T E * A A L * Q A A R G S * E L Q G E S M G P L M F S F P F F S M V K F M S * E G E K * Q G T V * N G K Q T N D C I S V E V S G S F * F L L F A V H N N C F L L F N S C F L F F S S P Q F L L L Y L M P * H G

R

( )

AGCCAGTGCCAGAAGAGCCAAGGACAGGTACGGCTGTCATCACTTAGACCTCACCCTGTGGAGCCACACCCTAGGGTTGGCCAATCTACTCCCAGGAGCAGGGAGGGCAGGAGCCAGGGCTGGGCATAAAAGTCAGGGCAGAGCCATCTATTGCTT

( )( )( )

S Q C Q K S Q G Q V R L S S L R P H P V E P H P R V G Q S T P R S R E G R S Q G W A * K S G Q S H L L L

YYYYYYYYYNCAG

---+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+62150 62200 62250 62300 62350 62400 62450

abc

3 Forward readingframes

β-Globin mRNAbegins here.

1 2 3 4 5 6 7 8 9 10 20 30

T

V

62265

A

62279

A A

62283 62388

EXON I

INTRON EXONG

Acceptor Splice Site

40 50

EXON II

INTRON I

62206

Donor Splice Site

EXON INTRONCAAG GU

AG

Consensus Acceptor Splice Site

ConsensusDonor Splice SiteNote: all introns begin with GU and end with AG.

AGCCAGTGCCAGAAGAGCCAAGGACAGGTACGGCTGTCATCACTTAGACCTCACCCTGTGGAGCCACACCCTAGGGTTGGCCAATCTACTCCCAGGAGCAGGGAGGGCAGGAGCCAGGGCTGGGCATAAAAGTCAGGGCAGAGCCATCTATTGCTT AGCCAGTGCCAGAAGAGCCAAGGACAGGTACGGCTGTCATCACTTAGACCTCACCCTGTGGAGCCACACCCTAGGGTTGGCCAATCTACTCCCAGGAGCAGGGAGGGCAGGAGCCAGGGCTGGGCATAAAAGTCAGGGCAGAGCCATCTATTGCTT AGCCAGTGCCAGAAGAGCCAAGGACAGGTACGGCTGTCATCACTTAGACCTCACCCTGTGGAGCCACACCCTAGGGTTGGCCAATCTACTCCCAGGAGCAGGGAGGGCAGGAGCCAGGGCTGGGCATAAAAGTCAGGGCAGAGCCATCTATTGCTT

A S A R R A K D R Y G C H H L D L T L W S H T L G L A N L L P G A G R A G A R A G H K S Q G R A I Y C L P V P E E P R T G T A V I T * T S P C G A T P * G W P I Y S Q E Q G G Q E P G L G I K V R A E P S I A Y

TCGGTCACGGTCTTCTCGGTTCCTGTCCATGCCGACAGTAGTGAATCTGGAGTGGGACACCTCGGTGTGGGATCCCAACCGGTTAGATGAGGGTCCTCGTCCCTCCCGTCCTCGGTCCCGACCCGTATTTTCAGTCCCGTCTCGGTAGATAACGAA ---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+---------+------

AGCCAGTGCCAGAAGAGCCAAGGACAGGTACGGCTGTCATCACTTAGACCTCACCCTGTGGAGCCACACCCTAGGGTTGGCCAATCTACTCCCAGGAGCAGGGAGGGCAGGAGCCAGGGCTGGGCATAAAAGTCAGGGCAGAGCCATCTATTGCTT621006205062000

61981 TGTAAACGAAGACTGTGTTGACACAAGTGATCGTTGGAGTTTGTCTGTGGTACCACGTGGACTGAGGACTCCTCTTCAGACGGCAATGACGGGACACCCCGTTCCACTTGCACCTACTTCAACCACCACTCCGGGACCCGTCCAACCATAGTTCCAATGTTCTGTCCAAATTCCTCTGGTTATCTTTGACCCGTACACCTCTGTCTCTTCTGAGAACCCAAAGACTATCCGTGACTGAGAGAGACGGATAACCAGATAAAAGGGTGGGAATCCGACGACCACCAGATGGGAACCTGGGTCTCCAAGAAACTCAGGAAACCCCTAGACAGGTGAGGACTACGACAATACCCGTTGGGATTCCACTTCCGAGTACCGTTCTTTCACGAGCCACGGAAATCACTACCGGACCGAGTGGACCTGTTGGAGTTCCCGTGGAAACGGTGTGACTCACTCGACGTGACACTGTTCGACGTGCACCTAGGACTCTTGAAGTCCCACTCAGATACCCTGGGAACTACAAAAGAAAGGGGAAGAAAAGATACCAATTCAAGTACAGTATCCTTCCCCTCTTCATTGTCCCATGTCAAATCTTACCCTTTGTCTGCTTACTAACGTAGTCACACCTTCAGAGTCCTAGCAAAATCAAAGAAAATAAACGACAAGTATTGTTAACAAAAGAAAACAAATTAAGAACGAAAGAAAAAAAAAGAAGAGGCGTTAAAAATGATAATATGAATTACGGAATTGTAACACATATTGTTTTCCTTTATAGAGACTCTATGTAATTCATTGAATTTTTTTTTGAAATGTGTCAGACGGATCATGTAATGATAAACCTTATATACACACGAATAAACGTATAAGTATTAGAGGGATGAAATAAAAGAAAATAAAAATTAACTATGTATTAGTAATATGTATAAATACCCAATTTCACATTACAAAATTATACACATGTGTATAACTGGTTTAGTCCCATTAAAACGTAAACATTAAAATTTTTTACGAAAGAAGAAAATTATATGAAAAAACAAATAGAATAAAGATTATGAAAGGGATTAGAGAAAGAAAGTCCCGTTATTACTATGTTACATAGTACGGAGAAACGTGGTAAGATTTCTTATTGTCACTATTAAAGACCCAATTCCGTTATCGTTATAAAGACGTATATTTATAAAGACGTATATTTAACATTGACTACATTCTCCAAAGTATAACGATTATCGTCGATGTTAGGTCGATGGTAAGACGAAAATAAAATACCAACCCTATTCCGACCTAATAAGACTCAGGTTCGATCCGGGAAAACGATTAGTACAAGTATGGAGAATAGAAGGAGGGTGTCGAGGACCCGTTGCACGACCAGACACACGACCGGGTAGTGAAACCGTTTCTTAAGTGGGGTGGTCACGTCCGACGGATAGTCTTTCACCACCGACCACACCGATTACGGGACCGGGTGTTCATAGTGATTCGAGCGAAAGAACGACAGGTTAAAGATAATTTCCAAGGAAACAAGGGATT

-75 CAAT Box -25 TATA Box

ConsensusCAAT Box GG C

T CAATCT ( )ConsensusTATA Box TATA A

T A TA

Promoter Region

ACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACCATGGTGCACCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGCAGGTTGGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAAACTGGGCATGTGGAGACAGAGAAGACTCTTGGGTTTCTGATAGGCACTGACTCTCTCTGCCTATTGGTCTATTTTCCCACCCTTAGGCTGCTGGTGGTCTACCCTTGGACCCAGAGGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATGCTGTTATGGGCAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGGTGCCTTTAGTGATGGCCTGGCTCACCTGGACAACCTCAAGGGCACCTTTGCCACACTGAGTGAGCTGCACTGTGACAAGCTGCACGTGGATCCTGAGAACTTCAGGGTGAGTCTATGGGACCCTTGATGTTTTCTTTCCCCTTCTTTTCTATGGTTAAGTTCATGTCATAGGAAGGGGAGAAGTAACAGGGTACAGTTTAGAATGGGAAACAGACGAATGATTGCATCAGTGTGGAAGTCTCAGGATCGTTTTAGTTTCTTTTATTTGCTGTTCATAACAATTGTTTTCTTTTGTTTAATTCTTGCTTTCTTTTTTTTTCTTCTCCGCAATTTTTACTATTATACTTAATGCCTTAACATTGTGTATAACAAAAGGAAATATCTCTGAGATACATTAAGTAACTTAAAAAAAAACTTTACACAGTCTGCCTAGTACATTACTATTTGGAATATATGTGTGCTTATTTGCATATTCATAATCTCCCTACTTTATTTTCTTTTATTTTTAATTGATACATAATCATTATACATATTTATGGGTTAAAGTGTAATGTTTTAATATGTGTACACATATTGACCAAATCAGGGTAATTTTGCATTTGTAATTTTAAAAAATGCTTTCTTCTTTTAATATACTTTTTTGTTTATCTTATTTCTAATACTTTCCCTAATCTCTTTCTTTCAGGGCAATAATGATACAATGTATCATGCCTCTTTGCACCATTCTAAAGAATAACAGTGATAATTTCTGGGTTAAGGCAATAGCAATATTTCTGCATATAAATATTTCTGCATATAAATTGTAACTGATGTAAGAGGTTTCATATTGCTAATAGCAGCTACAATCCAGCTACCATTCTGCTTTTATTTTATGGTTGGGATAAGGCTGGATTATTCTGAGTCCAAGCTAGGCCCTTTTGCTAATCATGTTCATACCTCTTATCTTCCTCCCACAGCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCATCACTTTGGCAAAGAATTCACCCCACCAGTGCAGGCTGCCTATCAGAAAGTGGTGGCTGGTGTGGCTAATGCCCTGGCCCACAAGTATCACTAAGCTCGCTTTCTTGCTGTCCAATTTCTATTAAAGGTTCCTTTGTTCCCTAA

A

The first methionine amino acid iscleaved from the β-Globin protein

soon after its synthesis.This negatively charged glutamic acid (E) is replaced by a hydrophobic valine (V) in sickle cell anemia.



Fall 2016

7

Amino Acid Starter Kit©

Your students will explore the primary, secondary and tertiary structure of proteins with this captivating kit. They will learn the chemical properties of the 20 amino acid side chains through a dual coloring scheme — a colored clip at the base of each side chain indicates chemical properties while embedded colored balls in side chain models show atomic structure. Understanding protein structure begins with this unique combination of atomic and chemical properties of the amino acids. Through the kit’s engaging, hands-on activities your students will gain a basic knowledge of protein folding before discovering the importance of secondary structure and active sites with additional folding activities.

Each 1-group set includes 1 chemical properties circle, 1 amino acid side chain list, 22 amino acids, 1 4-foot mini toober, 15 plastic clips and 6 hydrogen bond connectors. Multiply each item by 3, 5 or 6 for the 3-group, 5-group and 6-group sets. Teacher notes, student handouts and interactive Jmol visualization tools are available online.

Project Lead the Way© selected the Amino Acid Starter Kit© for its BioMedical Sciences™ Program.

6-Group Set $314 (AASK-06) 5-Group Set $263 (AASK-05)

3-Group Set $164 (AASK-03)

1-Group Set $61 (AASK-01)

To increase your students’ understanding of proteins, see the ß-Globin Folding Kit© and Map of the Human ß-Globin Gene© (page 6), Insulin mRNA to Protein Kit© (page 9), Ribosome Mini Models (page 16), Tour of a Human Cell©, Mitochondria Poster©, E. Coli Poster© and Neuromuscular Synapse Poster© (page 15), Amino Acid Starter Kit Poster© (below) and Genetic Codon Posters© (page 14).

The Amino Acid Starter Kit Poster© allows students to connect the chemical structure of each amino acid side chain — as it is commonly represented in textbooks — with the physical models of each side chain supplied in the Amino Acid Starter Kit©. The poster features a dual color scheme. First, each atom of the side chain is color-coded according to atom type (red for oxygen, blue for nitrogen, gray for carbon and yellow for sulfur). Second, the base of each side chain is color-coded to refl ect the overall chemical property of the side chain (yellow for hydrophobic side chains, red for acidic side chains, blue for basic side chains, white for hydrophilic but uncharged side chains and green for cysteines). Amino Acid Starter Kit Poster© $24 (AASKP)

Also see Amino Acid Starter Kit© (above) and Genetic Codon Posters© (page 14).

Active SiteTertiary Structure Secondary Structure

Amino Acid Starter Kit Poster©

Easel not included.Additional side chains shown




8

Take your students beyond the simple lock-and-key concept of enzyme action with this dynamic, multifunctional kit. Color-coded foam pieces represent enzymes, a variety of substrates and inhibitors. Your students will use this kit to discover the specifi city of substrate binding, how enzymes catalyze either catabolic or anabolic reactions and the eff ect of various inhibitors on enzyme action.

Each Enzymes In Action Kit© 1-group set contains 10 foam pieces (2 gray, 2 green, 2 orange,1 red, 1 tan, 1 purple and 1 blue) and 1 sheet of stickers. Multiply each item by 3, 6 or 12 for the 3-group, 6-group and 12-group sets. Teacher notes and student handouts are available online. Also see Substrate Specifi city Field Test Kit© (below). 12-Group Set $106 (EAK-12) • 6-Group Set $58 (EAK-06) • 3-Group Set $33 (EAK-03)

Enzymes In Action Kit©

Creating Catalytic Connections with Models


Acetylcholinesterase Active Site Cube©

Now your students can unfold an enzyme to see how the precisely positioned active site amino acids bind to specifi c substrates to catalyze a reaction. As your students open the active site cube they will see how the tightly-packed amino acid side chains bind the substrate (acetylcholine) and discover how 3 amino acids collaborate to cleave the neurotransmitter. Your students will explore how an insecticide targets the enzyme in mosquitoes and discover what happens when a mutation blocks the insecticide from binding to the enzyme. This has led to the emergence of insecticide-resistant mosquitoes. The substrate, insecticide and mutant amino acid side chain bind to the enzyme with magnets. The model is made of plaster by 3-D printing and should be handled with care. It will break if dropped.

Help your students achieve that "aha moment" with this simple but elegant kit that demonstrates the highly-specifi c interaction between a substrate and an enzyme. With the Substrate Specifi city Field Test Kit© students will:

5” Plaster Cube Model $950 (ACHASC-5)

3” Plaster Cube Model $475 (ACHASC-3)Not eligible for discounts

Ser 238His 480 Glu 367

Acetylcholine(substrate)

Insecticide A mutant side chain

! !WARNING: CHOKING HAZARD WARNING: SMALL MAGNETSCAUTION: Science Education Product Please see bottom of page 2 for details.

Substrate Specifi city Field Test Kit©


• Use color-coded functional groups to construct a substrate and examine its chemical properties.

• Use a mini toober to engineer an enzyme active site specifi c to the substrate constructed.

• Explore diff erent types of specifi city including stereochemical specifi city and absolute specifi city.

• Discover how subtle changes in enzyme structure can potentially have a signifi cant impact on substrate binding in the active site.

Lessons and activities are available online.Also see Enzymes In Action Kit© (above).Substrate Specifi city Field Test Kit $38 (SSK-FTK-01)



Fall 2016

9

Insulin mRNA to Protein Kit©

A 3DMD BioInformatics and Mini Toober Folding Activity©

The Insulin mRNA to Protein Kit© helps your students understand that the specifi c sequence of amino acids in a protein is encoded by the specifi c sequence of nucleotides in the corresponding gene. After using the BioInformatics Map to search for the nucleotide sequence that encodes the amino acid sequence of insulin, your students will fold a physical model of the 3-D structure of the insulin protein, using mini toobers (1 for the A-chain and 1 for the B-chain) and a folding map.

Each 1-group set includes student mRNA map, student folding map, 2 mini toobers, side chains, plastic clips, support posts, endcaps and an assortment of parts to mark and connect the chains. Multiply each item by 3 or 6 for the 3-group and 6-group sets (each set also includes 1 teacher mRNA map). Teacher notes, student handouts and interactive Jmol visualization tools are available online.

It’s best if your students fi rst use the Amino Acid Starter Kit© (page 7) before using the Insulin mRNA to Protein Kit©. Also see Insulin Mini Model and Insulin Poster© (below), ß-Globin Folding Kit© (page 6) and Genetic Codon Posters© (page 14).

6-Group Set $260 (INSFK-06) 3-Group Set $140 (INSFK-03) 1-Group Set $54 (INSFK-01)

Insulin Mini ModelThis alpha carbon backbone model of insulin, a 51-amino acid peptide hormone, features 2 chains (A is purple and B is orange) joined by three disulfi de bonds. This model is useful in teaching basic principles of protein structure — including quaternary structure. Mini models are made of plaster by 3-D printing and should be handled with care. Models will break if dropped, held tightly or handled roughly. 4” Plaster Model $77 (IFKMM)

This mini model can be used as an accurate smaller scale template when using the Insulin mRNA to Protein Kit© (above).

By using the insulin protein as a starting point, teachers can weave together a broad range of biology topics including the fl ow of genetic information, biochemistry and protein structure, cellular organelles, anatomy, physiology and cell biology of glucose homeostasis, energy metabolism, the endocrine and digestive systems, recombinant DNA technologies and new approaches to monitor blood glucose levels and control diabetes. Also see Insulin mRNA to Protein Kit© (above). Insulin Poster $21 (INSP)

Insulin Poster©




10

CRISPR/Cas9 Mini Model

DNA Mini ModelThis model immediately engages your students in thinking about the structure of DNA. You can guide a discussion of the nature of models — and the usefulness of multiple representations of any molecular structure. The DNA Mini Model represents the classic DNA double helix in 4 formats. The bottom section of the model shows a surface format emphasizing major and minor grooves. Moving up, all atoms are in a CPK colored spacefi lled format. The next section shows the 4 nitrogenous bases in a CPK wireframe format. In the top section of the model, each of the 4 bases is colored with a solid color.

Give your students a hands-on exploration of the next generation in genetic engineering! We are thrilled to be able to off er an aff ordable version of the 3D-printed Cas9 component of the CRISPR gene editing technology. Jennifer Doudna, PhD, Professor at UC-Berkeley and Executive Director of the Innovative Genomics Initiative (IGI), is one of the pioneers of the CRISPR/Cas9 technique, which allows researchers to make specifi c changes to the genetic code of cells and organisms. 3D Molecular Designs designed and built the model for Dr. Doudna with Jacob Corn, PhD, Scientifi c Director of the IGI. The front segment detaches from the model, allowing students a closer look at the guide RNA and two strands of DNA inside.

8” Plaster Model with Base $145 (DNA4FMM)

5" Plaster Model $246 (CC9MM)

11" Nylon Model $1,450 (NCC9M)Not eligible for discounts

If you could have only one model with which to teach proteins, this is it — a durable, hand-painted nylon model of hemoglobin. This quaternary complex includes 2 α-chains and 2 ß-chains. One of the ß-chains is magnet-docked so it can be removed for closer examination. The heme group and its oxygen on the removable ß-globin are also magnet-docked. The glutamic acid side chain at position 6 of the ß-globin chain can be exchanged for a valine side chain — representing the change in the ß-globin protein that leads to sickle cell anemia.

Hemoglobin Nylon Model

6.5” Hemoglobin $750 (NHGM)Not eligible for discounts

From exploring the question, "Why do we breathe?" to illustrating the structure of hemoglobin, the cause of sickle cell anemia and the physiology of oxygen transport, our colorful Hemoglobin Poster© will spark new inquiry among your students. Best used as a companion guide for 3DMD’s Hemoglobin Nylon Model (above), β-Globin Folding Kit©, Map of the Human B-Globin Gene© and β-Globin Mini Models (page 6), the poster can also stand alone to help facilitate meaningful discussions about hemoglobin.

Hemoglobin Poster©

Hemoglobin Poster© (21" x 22") $21 (HGP)


New

Mini models are made of plaster by 3-D printing and should be handled with care. Models will break if

dropped, held tightly or handled roughly. Nylon models are more resilient than plaster models,

but will break if held tightly or handled roughly.

WARNING: SMALL MAGNETS Please see bottom of page 2 for details.



Fall 2016

11

DNA Starter Kit©

Triphosphate Expansion Pack

DNA Discovery Kit©

Engage your students with this interactive, foam model of double-stranded DNA and single-stranded RNA. The DNA Starter Kit© is a schematic model that transforms from the familiar ladder shape to the double helix with a twist. Your students can explore the structure of color-coded DNA bases showing purines and pyrimidines connected to a continuous sugar-phosphate backbone. Then they can explore the process of DNA replication and transcription. Using individual nucleotide monophosphates, they can synthesize a new strand of DNA — 1 base at a time — showing the semi-conservative replication of DNA. Finally, they can synthesize mRNA to show the process of transcription.

Each 1-group set includes 51 bases (12 red adenine, 12 yellow thymine, 12 blue cytosine, 12 green guanine, 3 white uracil), 4 continuous gray backbones, 24 gray sugar-phosphates and 12 lavender sugar-phosphates.

2-Group Set $55 (DNASK-02) • 1-Group Set $30 (DNASK-01)

Each pack $11 (DNASK-PEP)



Let your students discover the structure of DNA — just as Watson and Crick did. The DNA Discovery Kit© combines magnets with accurate 3-D nucleotides which make the kit self-instructive. As your students discover A-T and G-C base pairs, they will feel the hydrogen bonding. Teacher-developed and fi eld-tested, the 12 Base Pair Set contains 6 A-T and 6 G-C base pairs, display stand and 2 mini toobers. Extensive activities, materials and background information are available online. The 2 Base Pair Set includes 1 A-T and 1 G-C base pair.

Project Lead the Way© selected the DNA Discovery Kit© for its BioMedical Sciences™ Program.

12 Base Pairs (Classroom Set) $279 (DNA-12)

2 Base Pairs (A-T and G-C) $47 (DNA-02)

Also see Nucleosome, Ribosome and tRNA Mini Models (page 16), Tour of a Human Cell© (page 15) and Adenosine Triphosphate (ATP) Mini Model (page 14).

You can turn the nucleotide monophosphates in the basic DNA Starter Kit© into nucleotide triphosphates with the pieces in this expansion pack. The extra phosphates allow your students to model the action of the DNA polymerase as it cleaves the triphosphate and joins the nucleotide monophosphate to the growing DNA strand in replication. Triphosphates can also be used in transcription and to model ATP. Each pack includes 48 phosphate pieces and 48 connectors.



12

Water can exist in any one of three states — a gas, liquid or solid (ice). At 0o C (32o Fahrenheit) the thermal motion of the water molecules slows to the point that stable hydrogen bonds form between the molecules and an ice lattice forms. Ice �oats since ice lattices are less dense than liquid water. This causes lakes to freeze from the top down, insulating the life beneath. Water molecules can form more than a dozen crystalline structures depending on temperature and pressure; however, nearly all ice on the Earth's surface and in its atmosphere is a hexagonal phase denoted as ice Ih.

DNA is a long, linear polymer of four di�erent nucleotides — adenine, thymine, guanine and cytosine (A,T,G,C). The sequence of these four nucleotides in your DNA speci�es the sequence of amino acids in your proteins. Your DNA exists as a double helix. Two complementary strands of DNA wrap around each other to form a right-handed double helix. This double helix contains complementary A-T and G-C base pairs. In 2001, researchers determined the exact nucleotide sequence of the 3.2 billion base pairs of the human genome.

ICE STRUCTURES

CELL MEMBRANES

COMPLEX CARBOHYDRATES

DOUBLE-STRANDED DNA

Phospholipid bilayers form cell membranes to separate

the inside of your cells from the outside. The hydrophobic nature

of a phospholipid bilayer prevents the free movement of most small

molecules into and out of your cells. Proteins embedded in cell membranes

allow ions and small molecules to pass through the membrane. Each protein has a

speci�c shape that allows it to pass a speci�c molecule — such as water — into or out of the cell.

Plants use glucose units to build two di�erent linear polymers — either starch or cellulose. You, as a human

being, have an enzyme (protein) that cuts o� the individual glucose units of starch — but not cellulose — so that glucose

can be oxidized to release its energy. When you eat a meal, some of the glucose is stored in a branched polymer called

glycogen. Glycogen rapidly releases glucose to provide energy between meals.

Nucleotides are the building blocks of your DNA and RNA. There are four nucleotides in DNA, each composed of a base — adenine (A), thymine (T), guanine (G) or cytosine (C) — a

deoxyribose sugar, and a phosphate group. In RNA, the deoxyribose is replaced by ribose, and the thymine base is replaced by uracil. In both DNA and RNA, enzymes called polymerases join the monomer nucleotides together to make long polymers. Cells use the unique sequence of nucleotides in DNA as a code

to build the correct sequence of amino acids in a protein.

Carbohydrates — also called sugars — are energy-rich molecules that provide fuel for your body. Glucose is a carbohydrate that plants build from carbon dioxide and energy from the sun in a process called photosynthesis. The energy stored in carbohydrates is released when organisms break down food during cellular respiration. This energy is captured as ATP and used to power life processes.

Phospholipids are unusual molecules with two distinct properties. One portion of the molecule is a long water-avoiding (hydrophobic) carbon tail. The other portion is a water-seeking (hydrophilic) phosphate group. In your cells, phospholipid molecules spontaneously assemble into a lipid bilayer with the hydrophobic carbon tails buried and hidden from the polar water molecules. The polar phosphate portion of the phospholipids are on the surface, exposed to water.

AMINO ACIDS

WATER

NUCLEOTIDE

CARBOHYDRATE

LIPID

Magnified 20 Million Times

The yellow dot highlights the sixth carbon in each glucose.

Starch

Cellulose

Glycogen

HO

PROTEINSYour body produces approximately 50,000 di�erent proteins, each with a speci�c shape that allows it to perform a speci�c function. Aquaporins are channel proteins that facilitate the selective di�usion of water in single �le across a cell membrane. Thirteen variants of aquaporin have been identi�ed in humans. Each is composed of 250-300 amino acids. Two polar asparagine amino acids located near the center of the channel guide the water molecules rapidly through the membrane.

Amino acids are the monomer building blocks of proteins. There are 20 amino acids — each with a di�erent shape and chemical property. As they join together in a distinct sequence — speci�ed by your DNA — they spontaneously fold into a compact shape following basic principles of chemistry and physics.

Life happens in water. The human body is about 70% water. This unique polar solvent provides

the medium in which the macromolecules of your cells �oat. Biomolecules interact with

each other in your cells following basic principles of chemistry and physics.

To see water molecules passing through the channel, �nd the green monomer and gently separate its section from the rest of the model.

*Not all hydrogens are shown on these images.

Phosphorous

Nitrogen

Sulfur Hydrogen*

Color Key

Carbon

Oxygen

Indicates one monomer within the polymer

cbm.msoe.edu

Use the Molecules of Life Placemat and the accompanying models to explore the following concepts:

Each of the structures featured is essential to sustain life.Large biological polymers — DNA, proteins, starch, glycogen and cellulose, and membranes — are composed of smaller “building block” monomers — nucleotides, amino acids, glucose and phospholipids.Aquaporin and other proteins embed in the cell membrane to allow water and other molecules or ions to pass in and out of the cell. Hold the aquaporin and cell membrane models next to each other, as you discuss water transport through the cell membrane. All monomers and polymers featured on the placemat and in the models are shown at the same scale. They are magni�ed 20 million times.The size of an atom is the same in all molecules in which it is present. For example, oxygen, shown in red, is the same size whether it is in a nucleotide, amino acid, sugar, phospholipid or water.

Introduction Exploration

Copyright 3D Molecular Designs - All Rights Reserved - 2009, 2015 Version 4.5

Four classes of biomolecules – proteins, nucleic acids, carbohydrates and lipids – are found in living cells. Proteins, nucleic acids and carbohydrates are macromolecules comprised of a small number of monomeric subunits: amino acids, nucleotides and monosaccharides, respectively. Since they interact in an aqueous environment, we have included water as one of the Molecules of Life. Lipids are a diverse group of molecules that interact with each other through “hydrostatic interactions” rather than covalent bonds, and generally are not large enough to be considered macromolecules.

Remember that these structures are dynamic and �exible, not rigid like the plaster models included in the Molecules of Life Collection©. When teaching the concepts related to the Molecules of Life featured above, you may want to use 3D Molecular Designs’ Water Kit©, DNA Discovery Kit©, Flow of Genetic Information Kit©, Amino Acid Starter Kit©, and Phospholipid & Membrane Transport Kit©.



BUILDING BLOCKS

Water

Molecules of Life Collection©

The Molecules of Life Collection© features plaster models of the 4major types of biomolecules — nucleic acids, proteins, lipids and carbohydrates. Since the biomolecules exist and interact in an aqueous environment, water is also included. Two single building block models go with each biomolecule. A major teaching point is that large complex biomolecules are made of small, simple building block units. All models are built to the same scale — 20 million times their real size.

The models sit on a 24” x 22” placemat that includes a description of each structure. Individual 8.5" x 11" student workstation mats are available online to download and print.

The entire set includes 17 models: DNA, adenosine monophosphate, aquaporin, asparagine, cell membrane, phospholipid, starch, glycogen, cellulose, glucose, ice structure and water molecule. Mini models are made of plaster by 3-D printing and should be handled with care. Models will break if dropped, held tightly or handled roughly.

Molecules of Life Collection© (17 plaster models and placemat)Molecules of Life Collection© is not eligible for discounts

Molecules of Life Monomer Set© (2 models of each monomer)

DNA (2 monomers and 1 polymer)

Carbohydrate (2 monomers and 3 polymers)

Lipid (2 phospholipids and 1 lipid bilayer)

Protein (2 monomers and 1 polymer)

Ice (2 monomers and 1 polymer)

Molecules of Life Placemat© (without models)

Adenosine TriphosphateThis model is built to the same scale but is not part of the Molecules of Life Collection©. It must be purchased separately.

$550 (MLC)

$60 (MLC-AM)

$185 (MLC-D) $106 (MLC-S)

$297 (MLC-L)

$206 (MLC-P)

$34 (MLC-I)

$21 (MLC-PM)

$16 (MLC-ATP)

Protein

CarbohydrateLipid DNA

Ice Molecules of LifeMonomer Set

Molecules of Life

Glycogen

Cellulose

Starch

The aquaporin model opens to show water molecules rolling over in their passage through the channel.

Hold the aquaporin and lipid models next to each other as you discuss how proteins embed in cell membranes to allow water and other molecules or ions to pass in and out of the cell.

The aquaporin Adenosine Triphosphate




Fall 2016

13

This is the must-have kit 3DMD customers have been asking for! Our new Flow of Genetic Information Kit© will fi rst allow your students to: • Model DNA replication using color-coded, foam

nucleotides and a placemat. • Model RNA transcription as they copy one strand of

DNA into mRNA using an RNA polymerase. • Model translation/protein synthesis as they decode the

mRNA into protein on the ribosome placemat. Lessons and activities are available online.

1-Group Set $114 (FGIK-01)

3-Group Set $308 (FGIK-03) 6-Group Set $552 (FGIK-06)

Additional DNA & RNA Nucleotide Set $23 (FGIK-ANS)Side Chain Expansion Pack $27 (FGIK-SCEP)

Also see DNA Discovery Kit© and DNA Starter Kit© (page 11), DNA Mini Model (page 10), Molecules of Life© (page 12) andTour of a Human Cell© (page 15).

Flow of Genetic Information Kit©



Demo DNA Nucleotides©

The sky is the limit to what you can teach using these new large-scale, color-coded foam nucleotides. Begin by teaching the complementary A-T and C-G base pairs and the antiparallel nature of double-stranded DNA. Move on to the fl ow of genetic information as you teach the basic processes of semiconservative DNA replication and mRNA transcription. You can then stretch your students by introducing PCR (polymerase chain reaction) and the Sanger DNA sequencing method — and much more. One set contains 80 nucleotides: 20 As, 20 Ts, 20 Cs and 20 Gs.Demo DNA Nucleotides© $43 (DDNS-01)

Also see DNA Discovery Kit© and DNA Starter Kit© (page 11), DNA Mini Model (page 10), Molecules of Life© (page 12) andTour of a Human Cell© (page 15).



14

3DMD Genetic Codon Posters©

The Genetic Codon Chart© and Genetic Codon Circle© can be used in conjunction with 3DMD’s popular Amino Acid Starter Kit©, β-Globin Folding Kit© and Insulin mRNA to Protein Kit© — which introduce your students to a standard color scheme: hydrophobic amino acids are yellow, polar amino acids are white, acidic amino acids are red, basic amino acids are blue and cysteines are green. By applying this same color scheme to the codon posters, your students can easily build a seamless connection between the triplet codon in mRNA and the chemical property of the amino acid it encodes.

Genetic Codon Chart© (24” x 30”) $24 each (GCCA) Genetic Codon Circle© (30” x 24”) $24 each (GCCB)

Best when used with the Amino Acid Starter Kit© and Amino Acid Starter Kit Poster© (Page 7), β-Globin Folding Kit© and Map of the Human B-Globin Gene (page 6), Insulin mRNA to Protein Kit© (page 9) and Flow of Genetic Information Kit© (page 13).

The Genetic Codon Circle©

The Genetic Codon Chart©

Adenosine Triphosphate Mini ModelTake your exploration of energy metabolism to the next level with our improved, 3D-printed plaster model of adenosine triphosphate (ATP) - the universal currency of energy. The model is based on the atomic coordinates of this important nucleotide. Both the second and third phosphates are joined to the model with magnets - allowing students to easily move from AMP (adenosine monophosphate) to ADP (adenosine diphosphate) and ATP. This simple model will change the way your students think about glycolysis and the citric acid cycle.4” Plaster Model $57 (ATPMM)

Also see DNA Discovery Kit© (page 11).


Models are made of plaster by 3-D printing and should be handled with care. They will break if dropped, held tightly or handled roughly. Nylon models are more resilient than plaster models, but will break if held tightly or handled roughly.

Amino Acid Building Block ModelsThese Amino Acid Building Block Models from Molymod enable your students to explore the basic structure of amino acids — the building blocks of proteins. The kit contains all of the atoms and bonds needed to construct 2 models of a generic amino acid. Side chains are represented by the green spheres. The 2 amino acids can be joined by a peptide bond to make a dipeptide — splitting out a water molecule. Activities for using the models are available online.Amino Acid Building Block Models $30 (AABB)

Also see Amino Acid Starter Kit© (page 7).! WARNING: CHOKING HAZARD

CAUTION: Science Education Product Please see bottom of page 2 for details.

Improved



Fall 2016

15

In the Mitochondria Poster© (top left) your students will see the large protein complexes of the electron transport chain which create the electrochemical gradient that powers ATP synthase to build ATP. ATP is then transported out of the mitochondrion by the adenine nucleotide translocator and diff uses through the channels in the VDAC protein in the outer membrane.

The E. coli Poster© (right) illustrates the inside of an E. coli cell — magnifi ed 1 million times. The molecular complexity of this bacterial cell is emphasized in this image which features a large fl agellum and the motor proteins that power its rotation and a variety of transmembrane proteins that function in transporting molecules into and out of the cell. Also shown are the ribosomes and associated proteins that support bacterial protein synthesis and the DNA, along with the DNA and RNA polymerases that function in replication and transcription.

The Neuromuscular Synapse Poster© (bottom left) illustrates the molecular interactions found at a neuromuscular synapse — where vesicles fi lled with the neurotransmitter, acetylcholine, are fusing with the membrane of the pre-synaptic neuron. Following vesicle fusion, the acetylcholine diff uses across the synaptic space to bind to acetylcholine receptors found in the membrane of the muscle cell. Acetylcholinesterase is entangled in the synaptic space, where it breaks down the neurotrnsmitter, ending neuronal signaling.

David Goodsell Cellular Landscapes

Mitochondria, E. coli and Neuromuscular Synapse Posters

E. coli Poster©

Mitochondria Poster©

Neuromuscular Synapse Poster©

David Goodsell, PhD, scientist, author and artist of all things small, creates cellular landscapes that accurately illustrate the size, shape and distribution of proteins in their natural environment of the cell. These unique images connect the molecular world, inferred by X-ray crystallography and NMR spectroscopy, with the cellular world, observed by light and electron microscopy.

These laminated prints of Goodsell’s stunning water color paintings illustrate biology in a dimension not seen in other instructional tools. Adjacent text identifi es the structures and explains their functions. Whether teaching the fl ow of genetic information, the many jobs of proteins, energy metabolism or the immunology of a fl u shot, these landscapes may be the missing piece in your current collection of instructional tools.

Tour of a Human Cell© Detail

The Tour of a Human Cell Panorama© will take your students from the nucleus to the outer cell membrane. In the nucleus, DNA is wrapped around histones forming nucleosomes. RNA polymerase unwraps the DNA and makes mRNA which is delivered through nuclear pore complexes to ribosomes where antibody proteins are made and delivered into the endoplasmic reticulum. Vesicles carry the protein through the Golgi and kinesin motor proteins pull the antibodies to the cell membrane — a wonderful example of the immunology of your fl u shot.

Tour of a Human Cell Grand Panorama© 23” x 11’ $88 (DGTHC-GP) • Tour of a Human Cell Panorama© 11” x 70” $40 (DGTHC-P)

Mitochondria Poster © 23” x 30” $29 (DGMP) • E. coli Poster © 23” x 30” $29 (DGECP) Neuromuscular Synapse Poster © 23” x 30” $29 (DGNSP)

Also see Tour of a Human Cell© (above), the DNA Discovery Kit© and DNA Starter Kit© (page 11) and the following mini models: Nucleosome, Ribosomes and tRNA (page 16), Antibody, Hemagglutinin and Infl uenzaVirus Capsule (page 17).



16

Nucleosome Mini ModelThe nucleosome is the most basic, repeating structural unit of chromosomes. Its central protein core has 8 histones (2 copies each of H2A, H2B, H3 and H4) and 145 base pairs of double-stranded DNA. The N-terminal end of each histone has many positively-charged amino acids that interact with the negatively-charged phosphate backbone of DNA. This model reveals that histones interact only with the minor groove of DNA. The major groove is then available for sequence-specifi c DNA binding proteins, such as Zif 268. 4” Plaster Model $199 (NCSMM)

Also see Zinc Finger Mini Model (page 20), Tour of a Human Cell© (page 15), DNA Discovery Kit© and DNA Starter Kit© (page 11).

Large and Small Ribosome Mini ModelsVenkatraman Ramakrishnan, Thomas A. Steitz and Ada E. Yonath won the Nobel Prize in Chemistry in 2009 for studies of the structure and function of the ribosome. (nobelprize.org)

Protein synthesis becomes understandable as your students see the 3 tRNAs of the small (30S) subunit and how they fi t into the cavity of the large subunit (50S) to synthesize proteins. In the large subunit, they will see the single adenosine base (yellow) that catalyzes peptide bond formation during protein synthesis. The large subunit of a bacterial ribosome is a protein-RNA complex composed of 34 proteins and 2 rRNAs (23S and 5S). The rRNA folds into this specifi c 3-D structure, with the proteins serving as the mortar between RNAs. The newly synthesized protein exits the ribosome through a visible channel that extends from the catalytic adenosine to the surface of the ribosome.

The small subunit (30S) of the bacterial ribosome is a protein-rRNA complex composed of 21 proteins and a single RNA (16S). It folds into a specifi c 3-D structure and is stabilized by associated proteins. In this spacefi lled model, two tRNAs (green) dock with their 3’ends close together — ready for peptide bond formation.Pair $358 (R5030SMM) • 4” 50S Ribosome $214 (R50SMM) • 4” 30S Ribosome $184 (R30SMM)

Also see Flow of Genetic Information Kit© (page 13) and Tour of a Human Cell© (page 15).

Transfer RNA Mini ModelsTransfer RNA (tRNA) is a short RNA molecule (76 nucleotides) that delivers amino acids to the ribosome, where they join to a growing chain during protein synthesis. Transfer RNAs fold into 3-D structures, stabilized by hydrogen bonding between complementary bases. In this model, the phosphate backbone of the tRNA is white, the 4 bases are red, the anticodon is blue and the 3’-end (where the amino acid is bound) is yellow. 3.5” Plaster Model $76 (TRNAMM)

3” Nylon Model $175 (NTRNAM)

Nylon tRNARNA folds into complex 3D shapes — just like proteins. This nylon model of tRNA shows the details of this complex 3-D structure — complete with the A-T and G-C base-pairs that stabilize the structure. The model allows students to explore the anti-codon of the tRNA, and the 3' end of tRNA where the charged amino acid is added.

Also see DNA Discovery Kit© and DNA Starter Kit© (page 11), Flow of Genetic Information Kit© (page 13) and Tour of a Human Cell© (page 15).




Fall 2016

17

Also see Tour of a Human Cell© (page 15). Use Nucleosome, Ribosomes, tRNA, Antibody, Hemagglutinin and Infl uenza Virus Capsule with the Tour of a Human Cell© (page 15) to tell the story of a fl u shot in action.


Antibody Mini Models

3.25” Plaster Antibody $70 (ANTMM) • 5” Nylon Antibody $275 (NANTM)

Nylon Antibody

Hemagglutinin Mini ModelThe hemagglutinin protein (HA) of the infl uenza virus plays a critical role in the infection process. These models show the dramatically diff erent shapes of the hemagglutinin HA2 protein at pH 7 and at pH 5. These models will allow you to tell an amazing molecular story — of how the virus takes advantage of the dramatic decrease in pH following the uptake of the virus by receptor-mediated endocytosis. Models magnet-dock onto the base and can be removed for closer examination. Color coding enables students to clearly see the conformational changes that the protein undergoes. This model can be used in conjunction with the Tour of the Human Cell© (page 15) that illustrates a ß-cell that has been stimulated to produce antibodies in response to the fl u vaccine. 6.5” Tall Plaster Mini Model $86 (HAMM)

Antibodies are composed of 12 immunoglobulin folds; 4 in each heavy chain (yellow in the model) and 2 in each light chain (red in the model). The antigen binding site of an antibody is composed of the ends of 2 immunoglobulin folds (1 yellow heavy chain and 1 red light chain) that are positioned at the tips of the Y-shaped antibody. With this model, you can introduce students to concepts of protein structure and function while teaching the immune system.

Infl uenza Virus CapsulesInfl uenza is an RNA virus with a roughly spherical lipid envelope, which is colored yellow on our schematic model. The outside of the virus capsule is covered with 3 specifi c proteins: hemagglutinin (HA, purple), neuraminidase (NA, pink) and the M2 channel (blue). These 3 proteins are involved in virus docking, endocytosis and fusion of the viral membrane to the host cell, the release of newly

budded virus from infected cells, and acidifi cation of the virus core and release of the segmented viral RNA. The specifi c sub-types and combinations of the hemagglutinin (H) and neuraminidase (N) on the surface of the virus capsule categorize the strain of the virus. The viral RNA is represented by 8 segments of RNA — some colored red and some colored yellow — to represent a re-assorted virus emerging from a host cell simultaneously infected with a swine fl u virus and an avian fl u virus (H1N1 swine fl u).

6'' Plaster Model $600 (IVCM6) • 4” Plaster Mini Model $450 (IVCM4)6" Plaster Model is not eligible for discounts

4" Infl uenza Virus Capsule

RNA is represented by 8 segments of RNA — some colored red and some 6" Infl uenza Virus Capsule

Plaster Antibody



18

A Project-Based Learning ActivityEngage your students and cover a wide-range of science topics with the true story of California twins Noah and Alexis Beery, who have gene variants that cause them to have life-threatening low levels of three neurotransmitters. Whole genome sequencing in 2010 identifi ed a mutation in the gene that encodes the sepiapterin reductase enzyme, leading to a molecular diagnosis and successful treatment.

This gene map presents the nucleotide sequence of the messenger RNA encoding sepiapterin reductase – the enzyme that was shown to be defective in Noah and Alexis Beery. The map documents the molecular consequence of two diff erent mutations in this gene that were responsible for the neurotransmitter defi ciencies experienced by the Beery twins. Teacher notes and student handouts are available online.

These models show how two amino acids (tyrosine and tryptophan) are converted into two neurotransmitters (dopamine and serotonin) by two consecutive enzyme-catalyzed reactions. Magnet-docked hydroxyl groups, carboxylate groups and hydrogens allow each model to be quickly converted from amino acid to neurotransmitter in two easy steps. Placemats and supporting materials are available online.

Show your students a physical representation of the twins’ genetic mutations and neurotransmitter defi ciencies with the Sepiapterin Reductase Mini Model. Three small, magnet-docked sections of the model are removable, revealing the two mutations that the twins inherited from their parents and the cofactor needed for the production of the neurotransmitters. A placemat and other supporting materials are available online.

Models are made of plaster by 3-D printing and should be handled with care. Models will break if dropped, held tightly or handled roughly.

1 Student and 1 Teacher Human SPR mRNA Gene Map $33 (SPRGM-01S-01T) 3 Student and 1 Teacher Human SPR mRNA Gene Map $59 (SPRGM-03S-01T)6 Student and 1 Teacher Human SPR mRNA Gene Map $97 (SPRGM-06S-01T)

3” Dopamine Biosynthesis Model $37 (DBMM) • 3” Serotonin Biosynthesis Model $39 (SBMM)

Sepiapterin Reductase Mini Model $106 (SPRMM)

The gene map, Sepiaterin Reductase Mini Model and biosynthesis models may be used separately or together to meet the needs of your classroom.

Dopamine Biosynthesis Model Serotonin Biosynthesis Model

Human Sepiapterin Reductase mRNA Gene Map©

Neurotransmitters Module: The Beery Twins’ Story©

Sepiapterin Reductase Mini Model

Dopamine and Serotonin Biosynthesis Models

Dad's Mutation

Mom's Mutation

Cofactor



Fall 2016

19

Alpha Helix & Beta Sheet Construction Kit©

This kit allows your students to build each of 2 important protein secondary structures — an alpha helix and a beta sheet. After joining together the magnetic backbone amino acid units to form the 2 structures, your students will actually feel the stabilizing eff ect of the hydrogen bonds as they are added to the backbone units. Then your students can add amino acid side chains, modeling specifi c alpha helices and beta sheets.

Alpha Helix & Beta Sheet Construction Kit© $495 (AHBSCK)

Also see Alpha Helix & Beta Sheet Models (above), β-Globin Mini Models (page 6) and Green Fluorescent Protein Mini Model (page 20).

4.5” Alpha Helix without Side Chains $75 (AH) • 4.75” Alpha Helix with Side Chains $128 (AHS)

6.5” Beta Sheet without Side Chains $130 (BS) • 7” Beta Sheet with Side Chains $225 (BSS)

Neuron Modeling Kit© $39 (NMK-01)

Alpha Helixwithout Side Chains

Beta Sheetwithout Side Chains

Alpha Helixwith Side Chains

Beta Sheetwith Side Chains

Alpha Helix & Beta Sheet ModelsThe alpha helix and the beta sheet represent the 2 important protein structural elements of secondary protein structure. We feature 4 models for your students to explore — 2 alpha helix and 2 beta sheet models.

Both alpha sheet plaster models are derived from helix E of the β-globin (amino acids 58-74) protein, which consists predominantly of alpha helices. Both beta sheet plaster models are derived from amino acids 14-32 and 120-127 of green fl uorescent protein. Two strands are parallel and 2 strands are anti-parallel.

Also see β-Globin Mini Models (page 6), Green Fluorescent Protein Mini Model (page 20) and Alpha Helix & Beta Sheet Construction Kit (below).


Neuron Modeling Kit©New!

Captivate your classroom and explore multiple concepts with our large and small foam neuron models! Students can use the Neuron Modeling Kit© to: • Construct a model and identify parts of a multipolar neuron. • Distinguish between multipolar neurons, bipolar neurons,

unipolar neurons and interneurons, and determine their location and function in the human body.

• Use myelin sheath pieces to show diff erences between two types of neuroglia in the central and peripheral nervous systems.

• Construct simple and complex neural pathways and examine the eff ect on neuronal fi ring at excitatory and inhibitory synapses.

Lessons and activites are available online.

Models are made of plaster in ball and stick format and follows the standard CPK color scheme. They will break if dropped, held tightly or handled roughly.



20

Green Fluorescent Protein Mini ModelGreen Fluorescent Protein (GFP) is responsible for the green bioluminescence of many marine organisms, including Pacifi c Northwest jellyfi sh. Its structure consists of an 11-stranded beta barrel surrounding a central alpha helix containing the fl uorophore that emits light. The backbone is color-coded for students to follow the folding of the protein from its amino- to its carboxy-terminus. It is an excellent tool when teaching protein structure and biotechnology. 3” Plaster Model $87 (GFPMM) Also see Amino Acid Starter Kit© (page 7).

Zinc Finger Mini ModelA zinc fi nger is a short (~30 amino acid) protein motif that is often found in proteins that bind to DNA. Zif268 is a DNA binding protein that contains 3 consecutive zinc fi ngers. Proteins with zinc fi ngers are one of the largest families of proteins found in the human genome. Each zinc fi nger consists of a two-stranded beta sheet and a short alpha helix. Its structure is stabilized by 2 cysteines and 2 histidines that bind to a single zinc atom. 3.5” Plaster Model $48 (ZFMM)Also see Amino Acid Starter Kit© (page 7).

Pre-Build Kit $31 (SOPB17) • Practice Kit $23 (SOPK17)Practice Judging Model $40 (SOPJM) Pre-Build Kit and Amino Acid Starter Kit© Bundle $78.20 (SOAA)


Science Olympiad Protein Modeling Event KitsAlthough the Protein Modeling Event will not be off ered at the National Science Olympiad Tournament in 2017 or 2018, it is continuing as a trial event for the next two years. This year’s challenge explores two proteins found on the surface of the infl uenza virus. Hemagglutinin (HA) is the most important player in the infectious ability of infl uenza. Neurominidase is an important target for antiviral medications. Visit cbm/msoe/edu/scienceOlympiad for resources to help hone your protein structure and modeling skills.

The materials in the Pre-Build Kit can be reused for each competition this season. The Practice Kit simulates the competition environment and is modeled after the 2015-2016 Regional On-Site Competition. Order Pre-Build and Practice Kits by January 15, 2017 and save 15%! The best preparation for understanding protein structure and function is our Amino Acid Starter Kit©. Purchase our Pre-Build Kit and Amino Acid Starter Kit© Bundle for $78.20 and save 15% (regularly priced $92)! Please confi rm that your Regional and State Science Olympiad are holding protein modeling events before purchasing kits. Handling fees will apply for any returns to 3D Molecular Designs.

Tournament directors and event supervisors, visit 3dmoleculardesigns.com/Science-Olympiad-Protein-Modeling-Kits.htm for information about ordering Invitational On-Site Kits and Invitational Test Materials (plaster models and exam materials). Sign up at cbm/msoe/edu/scienceOlympiad to receive Regional and State On-Site Kits, Exams and Judging Materials free of charge.

Mini models are made of plaster by 3-D printing and should be handled with care. Models will break if dropped, held tightly or handled roughly.



Fall 2016

21

The Mystery Tube© introduces your students to the practice of science. Research scientists frequently face the challenge of examining an object or organism without taking it apart. As your students fi rst pull the cord on one end and the other end pulls into the tube, they may think the solution is easy. But wait, as they continue their investigation, they will be challenged to describe a model for the inner workings of the Mystery Tube© and provide supporting evidence to defend their hypothesis. Teacher notes and student handouts are available online.

The Data Dilemma©

While using The Data Dilemma© your students will experience the dilemma scientists face when new data indicates the mental model of the object they are researching needs to be modifi ed. As each new data set is introduced and your students form a series of new models — using foam tangram pieces — your students will learn that the practice of science is an ongoing process, not a set of facts published in a textbook or online. How many possible models can your students fi nd? Teacher notes are available online.

12-Puzzle Set $24 (DD-12)

Mystery Tube©

12-Tube Set $104 (MTAB-12) • 6-Tube Set $56 (MTAB-06) • 2-Tube Set $21 (MTAB-02)

A Black Box Activity

Modeling as a Practice of Science



The Next Generation Science Education Standards emphasize the important role of modeling — both as an authentic practice of science and as an important learning tool for students. 3D Molecular Designs off ers 2 instructional tools, The Data Dilemma© and the Mystery Tube©, to engage students in an active modeling experience, while introducing them to the practice of science.

Versatile mini toobers provide hands-on learning experiences in many science disciplines. Biology and chemistry students can model DNA or create protein structures while following the principles of chemistry. Physics students can explore sound and other waves. The fl exible foam mini toobers have a soft wire core and are 4’ long. One red and one blue end cap is included with each mini toober. Use end caps to designate N terminus and C terminus in protein-folding or 3’ and 5’ ends in DNA model. Push Pins Are Not Included. 3DMD’s protein folding activity is available online. 4’ Toober $9.25 each (MTBR-01)

Also see Amino Acid Starter Kit© (page 7).

Modeling Mini Toobers

Water TattoosWith these fun Water Tattoos you can simultaneously reward your students and reinforce concepts related to the three states of water. Each set contains 50 Water Vapor Tattoos, 50 Liquid Water Tattoos and 50 Frozen Water Tattoos.

States of Water Tattoos Set $29 (SWTS)



22

3D Molecular Designs’ kits and models focus on core ideas and cross-cutting concepts in biology, chemistry, physical and life sciences. Products, lessons and activities fi t STEM curriculum that blend science, technology, engineering and math – and curriculum designed to support Next Generation Science Standards (NGSS), which emphasize the important role of models (and modeling) as an authentic practice of scientists and engineers. Connections to the NGSS Framework for K-12 Science Education Practices: Crosscutting Concepts, and Core Ideas can be found with the teacher resources for each product at 3dmoleculardesigns.com/Teacher-Resources.htm.

STEM and Next Generation Science Standards

Wish ListPage No. Product Code Product Name Price Quantity Total

Place your order online with a credit card or a purchase order at shop3dmoleculardesigns.com, email [email protected], fax 414-774-3435 or call 414-774-6562. Please provide your tax exempt number if applicable.Find and print our order form at 3dmoleculardesigns.com/catalog. We are happy to provide quotes. You can generate your own quote by adding items to your shopping cart and entering your shipping address. Or, send us an email or give us a call.Shipping rates vary based on box size, weight and destination. We can provide either United Parcel Service or U.S. Postal Service for delivery, to help sure the most cost-eff ective and reliable service possible. Customers in Canada should contact us for shipping costs. 3D Molecular Designs cannot ship to all countries.

Email NewsletterSign up to receive our monthly email newsletter and stay up-to-date about 3D Molecular Designs' latest products and events!

Stay Connected

We Appreciate Your Feedback!Please let others know how our products worked for your students. Visit our website, choose the kit, model or poster you'd like to review and scroll to the bottom of the page to add your feedback. Have you developed a great activity for one of our kits or models? Consider sharing your lessons, assessments and videos with us so we can share them with other teachers!



Fall 2016

23

• Discover how the resting potential of a neuron is established.• Demonstrate the propagation of an action potential down an axon.

• Simulate the action of the sodium-potassium pump in resetting the resting potential.

• Explore the eff ects of neurotransmitters, acetylcholine, dopamine and GABA on a post synaptic neuron.

• Model cholinergic, dopaminergic and GABAergic synapses.• Compare and contrast metabotropic and ionotropic receptors.• Analyze the impact of various substances such as nicotine, cocaine, sarin gas and propofol on neuronal signaling.

• And much, much more!

An instruction guide will be provided, along with teacher notes, student handouts and other supporting documents.

Look for the Synapse Construction Field Test Kit on our website and in our Spring 2017 catalog!

Synapse Construction Field Test Kit©Coming in Spring 2017!

Presynaptic NeuronPresynaptic Neuron

PROFESSIONAL DEVELOPMENT OPPORTUNITIES

Work with the organization behind some of your favorite 3DMD products to:

Help create innovative instructional materials that make the molecular world come alive for students.

Gain the experience to con� dently use active-learning tools in your classroom.

3D Molecular Designs’ sister organization – the Milwaukee School of Engineering (MSOE) Center for BioMolecular Modeling (CBM) – o� ers summer professional development courses that connect the big ideas of chemistry and biology with stories of current research, using physical models of proteins and other molecular structures. CBM sta� guide teachers in the exploration of hands-on teaching tools. Workshop participants also help re� ne instructional materials that are still in development.*

*Also look for CBM and 3DMD workshops at regional and national science education conferences throughout the year.

Visit cbm.msoe.edu for more information about the CBM and the professional development courses they o� er.

Center for BioMolecular Modeling1025 N. Broadway Street

Milwaukee, WI 53202-3109(414) 227-7529

Take our popular Phospholipid & Membrane Transport Kit© (page 5) to the next level and engage your classroom with hands-on modeling of neuronal communication! Students can use the colorful foam pieces in the Synapse Construction Field Test Kit© to:



24

Dynamic DNA KitIf only your students had this revolutionary new DNA kit… If only we had the funding to make the molds!

Let’s make this Dynamic DNA Kit a reality! Join our crowdfunding campaign in March 2017.Watch our website, newsletter and social media for launch details!

dynamicdnakit.com

Your students can discover:• Accurate DNA• Accurate RNA• Nucleotide base pairing• Functional groups• Semi-conservative replication• Continuous & discontinuous strands

• RNA transcription• 5' to 3' synthesis• Major and minor grooves• Phosphodiester bonding• DNA packaging• Adenosine triphosphate

Your students can discover:

And much more!

fall 2016 new products - molecular modeling · fall 2016 new science olympiad protein modeling...

Documents