faculty of resource science and technology izwan (2019... · 2019. 8. 1. · 2.2 distribution of...

264
Historical Perspective, Distribution, Ecology and Population Genetics of Saltwater Crocodile (Crocodylus porosus Schneider, 1801) in Sarawak, Malaysian Borneo Mohd Izwan Zulaini bin Abdul Gani Doctor of Philosophy 2019 Faculty of Resource Science and Technology

Upload: others

Post on 01-Sep-2020

1 views

Category:

Documents


0 download

TRANSCRIPT

Page 1: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

Historical Perspective, Distribution, Ecology and Population Genetics

of Saltwater Crocodile (Crocodylus porosus Schneider, 1801) in

Sarawak, Malaysian Borneo

Mohd Izwan Zulaini bin Abdul Gani

Doctor of Philosophy

2019

Faculty of Resource Science and Technology

Page 2: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

Historical Perspective, Distribution, Ecology and Population Genetics of

Saltwater Crocodile (Crocodylus porosus Schneider, 1801) in Sarawak,

Malaysian Borneo

Mohd Izwan Zulaini bin Abdul Gani

A thesis submitted

In fulfillment of the requirements for the degree of Doctor of Philosophy

(Zoology)

Faculty of Resource Science and Technology

UNIVERSITI MALAYSIA SARAWAK

2019

Page 3: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

i

DECLARATION

I hereby declare that the thesis has not been accepted for any degree and is not concurrently

submitted in candidature of any other degree.

………………………………………….

Mohd Izwan Zulaini bin Abdul Gani

15010191

Date:

Page 4: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

ii

ACKNOWLEDGEMENT

First of all, I would like to thank God for always giving me the strength and blessing during

all these challenging times, as well as my beloved parents, Abdul Gani Abdullah and

Nasabah Ismawi, all family members and friends for giving me motivation and moral

support to finish my research. I gratefully acknowledge my supervisor Associate Prof. Dr.

Ruhana Hassan for her continual encouragement, enthusiasm and support throughout my

degree, and for providing constructive comments on all that I have written. I would like to

express heartfelt thanks to my co-supervisor Mr. Rambli Ahmad for his invaluable advices

that had greatly helped me to improve my research.

In addition, I also would like to convey my gratitude to Mr. Oswald Braken Tisen, Mr.

Engkamat Lading, Mr. Christoper Kri, Mr. Paschal Dagang, SWAT members and other

staffs of Sarawak Forestry Corporation Bhd. (SFC) and Forest Department of Sarawak

(FDS) for providing supports during crocodile samplings and other technical aspects of the

study. A special thanks to Dr. Rossazana for advices on currency matters and also to fellow

colleagues in the Molecular Aquatic Laboratory for helping me in the field surveys as well

as to the lab assistants for helping to prepare the equipment before going to the field.

Finally, I would like to express my special gratitude to the University Malaysia Sarawak

(UNIMAS) for providing funds for this research through Dana Pelajar Ph.D. Grant no.

F07/DPP53/1282/2015(28) and also the FDS for granting permit NCCD.907.4.4(jld.12)-193

and Permit No. NPW.907.4.4(JLD.14)-149 to conduct research on the crocodiles in

Sarawak. Last but not least, thanks to Ministry of Higher Education for financing my study

under MyPhD Scholarship Program.

Page 5: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

iii

ABSTRACT

This study is designed to gather information on historical exploitation and ongoing HCC;

recent distribution and ecology of crocodile and genetic relationship of crocodile population

in Sarawak, to aid sustainable crocodile management and finding solutions for mitigating

the HCC. Historical data saw a connection between the exploitation of crocodile with

decreasing trend of HCC in Sarawak from the Rajah Brooke era (1900 – 1941) until the post-

war period (1946 – 1979), and an increasing trend of HCC from 1980 until 2017 in response

to the recovery of the animal populations. Since 1900, crocodile attacks had been occurred

in 22 major river basins (RB) in Sarawak, suggesting that the reptile has been widely

dispersed throughout all major river basins in the state. For 118 years (1900 – 2017), the

highest number of crocodile attacks were recorded in Lupar RB (22.2%) and the attacks had

happened up to the inland areas of Belaga and Pelagus in Rajang RB. Further analysis of

incidents show crocodile attacks were associated with the human activities pattern, where

more attacks involved male victims (84.4%) and adults from age 31 to 40 years old (19.3%).

The data also revealed that crocodile attacks in Sarawak could happen anytime regardless of

the time, month, season, lunar cycle or tidal. However, more attacks were recorded during

the daylight, in the months of March and April, during the Northeast monsoon, at the nights

of the first quarter of the lunar cycle and at the time of high tide. Furthermore, fishing

(25.2%) and bathing (24.4%) possess the highest risk of crocodile attack in Sarawak, clearly

showed that crocodiles are more likely to attack when the victim is in water. Crocodile

survey in selected tributaries in Rajang RB showed the distribution of the reptiles throughout

the river basin with higher crocodile density at the lower region, the highest density was in

Igan River (1.37 individuals/km); while in the middle and upper regions had recorded

Page 6: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

iv

relatively low density with the lowest density recorded was in Katibas River (0.06

individuals/km) and no crocodile was spotted in Kanowit River. Four out of eight surveyed

rivers in Rajang RB recorded increase in the density of crocodile compare to previous survey

suggesting that the crocodile population in the river basin is experiencing recovery. The

presence of crocodile in different regions (lower, middle and upper) of Rajang RB indicated

that C. porosus in Sarawak live in wide range of habitats; from large salt water river system

and small tidal tributaries (near to estuary) in lower region into hypo-saline or fresh water

non-tidal tributaries in the middle and upper regions. Variation in term of density and

distribution of crocodile between the different regions are mainly influenced by the saline

characteristic of the river, habitats and the abundance of food sources for crocodile. Based

on the analysis of DNA microsatellite sequence data, distinctive subpopulations of C.

porosus according to geographical area (river basin) could be observed. High gene flow (Nm)

among the crocodile subpopulations suggests frequent movements of the reptile happen

across the river basins throughout Sarawak. In general, populations of C. porosus in Sarawak

are experiencing expansion as supported by the mismatch distribution and evolutionary

neutrality test data, suggesting that populations of crocodile in Sarawak are panmictic

population. The findings of the present study imply that increasing of crocodile attacks is

associated with the recovery and increased distribution of the reptile in Sarawak, thus

crocodile management should emphasis on mitigating HCC and simultaneously continue the

efforts for conservation of crocodile and its habitat.

Keywords: Crocodylus porosus, human-crocodile conflict, recovery, expansion.

Page 7: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

v

Perpektif Sejarah, Taburan, Ekologi dan Genetik Populasi Buaya Air Masin

(Crocodylus porosus Schneider, 1801) di Sarawak, Borneo, Malaysia

ABSTRAK

Kajian ini direka untuk mengumpul maklumat berkaitan sejarah eksploitasi dan KMB;

taburan terkini populasi dan ekologi buaya serta hubungan genetik antara populasi buaya

di Sarawak, untuk membantu pengurusan buaya secara lestari serta mencari solusi untuk

mengurangkan KMB. Data sejarah memperlihatkan hubungkait antara eksploitasi buaya

dengan tahap penurunan bilangan kes KMB di Sarawak dari era Rajah Brooke (1900 –

1941) sehingga ke tempoh selepas perang (1946 – 1979), dan tahap peningkatan bilangan

kes KMB dari 1980 sehingga 2017 hasil tindakbalas daripada pemulihan populasi buaya.

Semenjak tahun 1900, serangan buaya telah berlaku di 22 sungai utama di Sarawak,

menunjukkan taburan luas reptilia tersebut di semua sungai utama di negeri ini. Dalam

tempoh 118 tahun (1900 – 2017), serangan buaya tertinggi dicatatkan di Lembangan Sungai

Lupar (22.2%) dan serangan telah berlaku sehingga ke kawasan pedalam Belaga dan

Pelagus di Lembangan Sungai Rajang. Analisis lanjut insiden menunjukkan serangan buaya

berkaitan dengan corak aktiviti manusia, dimana lebih banyak serangan melibatkan mangsa

lelaki (84.4%) dan individu dewasa berumur dari 31 sehingga 40 tahun (19.3%). Data juga

mendedahkan bahawa serangan buaya di Sarawak boleh berlaku bila-bila masa tanpa

mengira masa, bulan, musim, kitaran bulan atau pasang surut air. Walau bagaimanapun,

lebih banyak serangan telah direkodkan pada waktu siang, di bulan Mac dan April, semasa

musim monsun Timur Laut, pada malam suku pertama kitaran bulan dan ketika air pasang.

Aktiviti memancing (25.2%) and mandi di sungai (24.4%) mempunyai risiko serangan buaya

yang tertinggi menunjukkan buaya lebih suka menyerang ketika mangsa berada di air.

Survei buaya di sungai-sungai terpilih di Lembangan Sungai Rajang mendapati reptilia

tersebut mendiami pelbagai habitat di sepanjang sungai, dengan kepadatan lebih tinggi di

Page 8: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

vi

bahagian hilir, tertinggi dicatatkan di Sungai Igan (1.37 individu/km); sementara itu di

bahagian tengah dan hulu mencatatkan kepadatan yang lebih rendah dengan catatan

terendah di Sungai Katibas (0.06 individu/km) dan tiada buaya dijumpai di Sungai Kanowit.

Empat daripada lapan sungai yang disurvei di Lembagan Sungai Rajang mencatatkan

peningkatan kepadatan buaya berbanding dengan survei terdahulu, menunjukkan bahawa

populasi buaya di sungai ini sedang mengalami pemulihan. Kehadiran buaya di bahagian

berbeza (bahagian hilir, tengah dan hulu) di Lembagan Sungai Rajang menunjukkan C.

porosus, hidup di pelbagai habitat; dari sungai besar dan anak sungai (berhampiran muara)

air masin di bahagian hilir sehinggalah kepada anak sungai air tawar yang tidak

dipengaruhi pasang surut di bahagian tengah dan hulu lembagan sungai tersebut.

Kepelbagaian dari segi kepadatan dan taburan di antara bahagian-bahagian berbeza

adalah banyak dipengaruhi oleh ciri kemasinan sungai, habitat dan kelimpahan sumber

makanan untuk buaya. Berdasarkan analisis data jujukan DNA mirosatelit, subpopulasi C.

porosus berdasarkan kawasan geografi (lembangan sungai) dapat diperhatikan. Aliran gen

tinggi (Nm) di kalangan subpopulasi buaya mencadangkan terdapat pergerakan yang kerap

oleh reptilia tersebut di antara sungai-sungai di seluruh Sarawak. Secara umumnya,

populasi C. porosus di Sarawak mengalami pengembangan populasi disokong oleh data

ujian mismatch distribution dan evolutionary neutrality, yang juga mencadangkan bahawa

populasi buaya di Sarawak adalah populasi yang panmictic. Penemuan kajian ini boleh

diterjemahkan sebagai wujud kaitan antara peningkatan serangan buaya dengan pemulihan

dan peningkatan taburan populasi reptilia tersebut di Sarawak, oleh itu pengurusan buaya

perlu memberi penekanan kepada usaha-usaha mengurangkan KMB namun pada masa

yang sama tetap meneruskan usaha untuk pemuliharaan buaya dan habitatnya.

Kata kunci: Crocodylus porosus, konflik manusia dan buaya, pemulihan, pengembangan

Page 9: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

vii

TABLE OF CONTENTS

Page

DECLARATION i

ACKNOWLEDGEMENT ii

ABSTRACT iii

ABSTRAK v

TABLE OF CONTENTS vii

LIST OF TABLES xii

LIST OF FIGURES xv

LIST OF ABBREVIATIONS xix

CHAPTER 1: GENERAL INTRODUCTION 1

1.1 Background 1

1.2 Problem statements 4

1.3 Objectives 7

1.4 Hypotheses 8

CHAPTER 2: LITERATURE REVIEW 10

2.1 Evolutionary history and classification of crocodiles 10

Page 10: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

viii

2.2 Distribution of crocodiles 13

2.3 Crocodylus porosus 14

2.3.1 Taxonomy 14

2.3.2 Habitat and distribution of C. porosus in Sarawak 16

2.3.3 Morphology and physiology of C. porosus 18

2.3.4 Historical literature about crocodile in Sarawak 26

2.3.5 Threats and conservation 29

2.3.6 Ecological and social importance of crocodiles 33

2.4 Human-crocodile conflicts (HCC) 35

2.5 Population ecology of crocodiles 37

2.6 Population genetics and its importance 39

2.7 Genetic studies of crocodiles

40

CHAPTER 3: REVIEW OF CROCODILE STATUS AND HUMAN-

CROCODILE CONFLICTS IN SARAWAK FROM 1900

UNTIL 2017

42

3.1 Introduction 42

3.2 Materials and Methods 44

3.2.1 Study area 44

Page 11: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

ix

3.2.2 Information gathering and analyses 48

3.3 Results and Discussion 52

3.3.1 White Rajah era (1900-1941) 52

3.3.2 Post- war period (1946-1979) 63

3.3.3 Period when wild crocodile populations depleted and the law was

introduced to protect them from hunting (1980-1999)

64

3.3.4 Millennia era (2000-2017) 66

3.3.5 One hundred and eighteen (118) years comparison of human-

crocodile conflicts

80

3.4 Conclusion 89

CHAPTER 4: DISTRIBUTION AND ECOLOGY OF SALTWATER

CROCODILE, Crocodylus porosus IN RAJANG RIVER

BASIN, CENTRAL SARAWAK

91

4.1 Introduction 91

4.2 Materials and Methods 95

4.2.1 Study area 95

4.2.2 Crocodile survey 97

4.2.3 River characteristics and landscapes 100

4.2.4 Selected water quality parameters 104

Page 12: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

x

4.2.5 Potential aquatic food resources for crocodiles 104

4.2.6 Data analysis 105

4.3 Results 107

4.3.1 Crocodile density 107

4.3.2 Distribution of crocodile in selected rivers of Rajang River Basin 110

4.3.3 River characteristics and landscapes 117

4.3.4 Selected water quality parameters 122

4.3.5 Aquatic food resources for crocodile 124

4.3.6 Relationship between crocodile density, habitat, water quality

parameter and the abundance of food resources for crocodiles

127

4.4 Discussion 131

4.5 Conclusion 142

CHAPTER 5: GENETIC RELATIONSHIP AMONG Crocodylus porosus

FROM DIFFERENT RIVER BASINS IN SARAWAK,

MALAYSIAN BORNEO

144

5.1 Introduction 144

5.2 Materials and Methods 147

5.2.1 Sample collection 147

5.2.2 Total genomic DNA extraction and Polymerase Chain Reaction (PCR)

amplification

152

Page 13: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

xi

5.2.3 DNA sequencing and alignment 154

5.2.4 Phylogenetic tree and NETWORK reconstruction analyses 154

5.2.5 Population genetics analyses 155

5.3 Results 156

5.3.1 Sequences characterization and Basic Local Alignment Search Tool

(BLAST) analysis

156

5.3.2 Combine genes and haplotype build 160

5.3.3 Phylogenetic analysis 162

5.3.4 NETWORK analysis 168

5.3.5 Population genetic analyses 171

5.4 Discussion 177

5.5 Conclusion 182

CHAPTER 6: GENERAL DISCUSSION 183

CHAPTER 7: CONCLUSION AND RECOMMENDATIONS 201

REFERENCES 204

APPENDICES 223

Page 14: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

xii

LIST OF TABLES

Page

Table 3.1 List of river basins in Sarawak, its main river and approximate length

(Tisen & Ahmad, 2010).

46

Table 3.2 Periods of time and sources of information on crocodile in Sarawak. 50

Table 3.3 Number and measurement of crocodiles and eggs brought to the

government and amount of bounty paid (extracted from half year

report in Sarawak gazette, 1901-1907).

54

Table 4.1 Details of surveys in eight rivers of Batang Rajang. 97

Table 4.2 Size class for crocodile survey (Bayliss, 1987; Robi, 2014). 100

Table 4.3 Field guide for river habitat assessment (modified from Barbour et

al., 1996; Iwata et al., 2003; Bolhen, 2017).

101

Table 4.4 Scores for stream habitat category (modified from Barbour et al.,

1996; Iwata et al., 2003; Bolhen, 2017).

102

Table 4.5 Characteristics observed and recorded in each river during field

sampling (Montague, 1983; Messel & Vorlicek, 1986).

103

Table 4.6 Relative density of C. porosus in eight tributaries of Rajang River

Basin.

108

Table 4.7 Comparison density of crocodile between survey in 2014 and 2017

(present study).

108

Table 4.8 Stream habitat assessment and its score for each river in study area

of Rajang River Basin.

117

Page 15: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

xiii

Table 4.9 Selected water quality parameters measured in-situ for rivers and

tributaries of Rajang River Basin.

123

Table 4.10 List of fish and invertebrates caught in Rajang River Basin that may

be the potential food source of the C. porosus.

126

Table 4.11 Pearson’s correlation between crocodile density, water quality

parameters and the abundance of food resources for crocodile

(CPUE).

128

Table 4.12 Summary for PCA analysis for the crocodile density, water quality

parameters and CPUE.

128

Table 4.13 Summary for GLM analysis for the water quality parameters, habitat

and CPUE in response with crocodile density.

130

Table 5.1 Voucher codes for samples according to sampling area. 150

Table 5.2 Microsatellite primers used in this study (Isberg et al., 2004). 153

Table 5.3 Sequence characterization for the microsatellite markers. 157

Table 5.4 Average nucleotide base composition at the 1st, 2nd and 3rd codon

position for the three microsatellite markers in this study. All

frequencies are in percentage (%).

158

Table 5.5 Basic Local Alignment Search Tool (BLAST) result. 159

Table 5.6 Haplotype identity for 22 microsatellite sequences of C. porosus. 161

Table 5.7 Measures of Nucleotide Diversity (π) and Net Nucleotide Divergence

(Da) among populations of C. porosus analysed by locations.

171

Table 5.8 Summary statistics of Microsatellite Cj16 sequences variation in five

populations of C. porosus in Sarawak.

173

Page 16: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

xiv

Table 5.9 Measures of geographical population differentiation in Crocodylus

porosus based on an analysis of Molecular Variance approach using

microsatellite sequences data.

175

Table 5.10 Genetic differentiation matrix of populations calculated by ϕST. p

values are shown in parenthesis (below the diagonal).

175

Table 5.11 Measures of Nucleotide Subdivision (Nst), Population Subdivision

(Fst) and Gene Flow (Number of Migrants, Nm) among populations

of C. porosus analyzed by locations.

176

Page 17: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

xv

LIST OF FIGURES

Page

Figure 2.1 Global crocodile species and its common name (De Silva, 2013). 12

Figure 2.2 Taxonomic hierarchy of Crocodylus porosus. 15

Figure 2.3 Head shape of C. porosus (Illustration adapted from Caldicott et al.,

2005).

18

Figure 3.1 Map of river basins in Sarawak (Map modified from Official Website

of Department of Irrigation and Drainage Sarawak, 2017).

47

Figure 3.2 Number of crocodile attacks divided into 10-year periods during the

Rajah Brooke era, 1900-1941.

57

Figure 3.3 (a) Percentage of attacks according to victim’s gender, (b) Percentage

of attacks according to the time when the incident occurred.

*Unknown = no information available.

58

Figure 3.4 Number of crocodile attacks from 1900-1941 according to river basin 59

Figure 3.5 Number of crocodile attacks from 1900-1941 according to month and

season when the incident occurs.

60

Figure 3.6 Types of activities of the victims when crocodile attacked (1900-

1941).

62

Figure 3.7 Number of crocodile fatal and non-fatal attacks for each year from

2000 until 2017.

68

Figure 3.8 (a) Percentage of victims according to gender; (b) Percentage of

crocodile attack cases according to time when the incident occurred

in Sarawak from 2000 - 2017.

70

Page 18: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

xvi

Figure 3.9 Proportion of the crocodile attacks in Sarawak between 2000 and

2017 plotted over the lunar cycle.

72

Figure 3.10 Proportion of the crocodile attacks in Sarawak between 2000 and

2017 plotted over the tidal cycle.

74

Figure 3.11 Number of fatal and non-fatal attacks from 2000-2017 according to

age of victims.

75

Figure 3.12 Number of crocodile attacks from 2000-2017 according to river

basin.

76

Figure 3.13 Number of crocodile attacks from 2000-2017 according to month and

season when the incident occurred.

77

Figure 3.14 Types of activities of the victims at the moment of crocodile attacked

(2000-2017).

79

Figure 3.15 Average number of crocodile attacks per year divided into 10-year

periods between 1900 and 2017 in Sarawak.

80

Figure 3.16 Number of crocodile attacks from 1900 until 2017 according to river

basin.

84

Figure 3.17 Average of monthly rainfall in Sarawak for the period 1980 - 2014

(adapted from Sa’adi et al., 2017).

86

Figure 4.1 Map of Rajang River Basin. 96

Figure 4.2 Map showing the survey area in Igan River. Each circle indicates the

location of crocodile sighted during the survey and different colours

in the circle represent different size class.

110

Page 19: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

xvii

Figure 4.3 Map showing the survey area in Belawai River. Each circle indicates

the location of crocodile sighted during the survey and different

colours in the circle represent different size class.

111

Figure 4.4 Map showing the survey area in Sarikei River and Nyelong River.

Each circle indicates the location of crocodile sighted during the

survey and different colours in the circle represent different size class.

112

Figure 4.5 Map showing the survey area in Kanowit River. No crocodile

sighting was recorded during the survey.

113

Figure 4.6 Map showing the survey area in Poi River. Each circle indicates the

location of crocodile sighted during the survey and different colours

in the circle represent different size class.

114

Figure 4.7 Map showing the survey area in Ngemah River. Each circle indicates

the location of crocodile sighted during the survey and different

colours in the circle represent different size class.

115

Figure 4.8 Map showing the survey area in Katibas River. Each circle indicates

the location of crocodile sighted during the survey and different

colours in the circle represent different size class.

116

Figure 4.9 Catch per unit effort (CPUE) at eight rivers in Rajang River Basin. 125

Figure 4.10 PCA ordination bi-plot of eight rivers of Rajang River Basin with

crocodile density, habitat, water quality parameters (Salinity, pH and

Temperature) and food resources for crocodile (CPUE).

129

Figure 5.1 Map of Sarawak showing locations of C. porosus sample collected in

the present study.

151

Page 20: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

xviii

Figure 5.2 Microsatellite-based phylogenetic relationship for 22 C. porosus in

Sarawak inferred using Neighbour-joining (NJ) analysis. Support

value next to the node are bootstrap values.

164

Figure 5.3 Microsatellite-based phylogenetic relationship for 22 C. porosus in

Sarawak inferred using Maximum Parsimony (MP) analysis. Support

value next to the node are bootstrap values.

165

Figure 5.4 Microsatellite-based phylogenetic relationship for 22 C. porosus in

Sarawak inferred using Maximum likelihood (ML) analysis. Support

value next to the node are bootstrap values.

166

Figure 5.5 Bayesian inference of the 50% majority rule consensus tree of

Combine microsattelite genes of C. porosus. Bayesian posterior

probabilities are accordingly indicated besides the branch nodes.

167

Figure 5.6 The median-joining Network generated by NETWORK software

version 5.0.0.3 illustrating the relationship of the saltwater crocodile,

C. porosus from different localities in Sarawak. Each circle

represents a haplotype and the diameter of the circle is scale to the

haplotype frequency. Different colours in the circle represent

different localities. Bold number next the lines connecting the

haplotypes indicate number of mutation step(s).

170

Figure 5.7 Mismatch distribution of C. porosus at (a) Sarawak RB, (b)

Samarahan/Sadong RB, (c) Saribas/Krian RB, (d) Rajang RB and (e)

Bintulu/Miri RB population. The dark line represents the observed

and light lines represent the expected distribution for each model.

174

Page 21: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

xix

LIST OF ABBREVIATIONS

ºC Degree Celsius

μL Microliter

AMOVA Analysis of Molecular Variance

ANOVA Analysis of Variance

bp Base pairs

CITES Convention on International Trade in Endangered Species of Wild Fauna

and Flora

cm Centimeter

DNA Deoxyribonucleic acid

FDS Forest Department of Sarawak

ft Feet

HCC Human-crocodile conflict

HL Head Length

hp Horse power

ICT Information and communication technologies

IUCN International Union for Conservation Nature

KMB Konflik manusia dan buaya

km2 Square kilometres

km Kilometer

L Liter

m Meter

mL Milliliter

Page 22: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

xx

mm Milimeter

MCF Miri Crocodile Farm

MYR Malaysian Ringgit

NEM Northeast monsoon

ppt parts per thousand

psi pounds per square inch

RB River Basin

SFC Sarawak Forestry Corporation Sdn. Bhd.

SWM Southwest monsoon

TL Total length

TTB Tumbina Park, Bintulu

UK United Kingdom

UNIMAS Universiti Malaysia Sarawak

USA United States of America

WWII World War 2

Page 23: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

1

CHAPTER 1

GENERAL INTRODUCTION

1.1 Background

The saltwater crocodile, Crocodylus porosus (Schneider, 1801) is the most geographically

widespread and the most resilient among all the crocodile species. The distribution covers

Indo-pacific region, including several countries in Southeast Asia, Australia, Papua New

Guinea, Bangladesh, India, Sri Lanka, Palau, Solomon Islands and Vanuatu (Webb et al.,

2010). This species typically occupies tidal rivers of the coastline and associated freshwater

swamps. However, C. porosus could also live in total freshwater habitats, and may move

hundreds of kilometers upstream from the sea, well beyond saline water and tidal influence.

In Malaysia, C. porosus is abundant in Sarawak and Sabah, the two states located in the

island of Borneo compared to the Peninsular (Sarawak Forestry Corporation, 2018). In

Peninsular Malaysia, C. porosus populations can be found in Rembau-Linggi Estuary (Nazli

et al., 2009) and Setui-Chalok-Bari River Basin (RB) on the east coast of Terengganu (Webb

et al., 2010). In Sabah, C. porosus inhabit Kinabatangan RB and its associated wetland

(Evans et al., 2017). Small population of crocodile had also been reported in the Klias River

(Stuebing et al., 1994), Segama River (Kaur, 2006) and Kawang River (Jet et al., 2011).

Sarawak supports the largest population of C. porosus in Malaysia, where they could be

found in almost all major river basins in the state including large or small river systems,

mangroves estuaries and inland freshwater swamps (Tisen & Ahmad, 2010; Hassan &

Page 24: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

2

Abdul-Gani, 2013; Abdul-Gani, 2014; Ali et al., 2014; Robi, 2014; Zaini et al., 2014;

Sarawak Forestry Corporation, 2018). This species are also found in Logan Bunut, the

Sarawak’s largest natural lake which drains into Teru riverine system in Miri Division (Cox

& Gombek, 1985).

Majority of the C. porosus populations in the range countries are listed in Appendix I in the

Convention on International Trade in Endangered Species of Wild Fauna and Flora (CITES)

except for the populations in Papua New Guinea, Australia, Indonesia and Malaysia (wild

harvest restricted to the state of Sarawak and a zero quota for wild specimens for the other

states of Malaysia), which are currently in Appendix II (CITES, 2018). In Appendix I,

international trade for the specimens from the wild populations are not allowed except for

those whose had been issued with permit from CITES. Meanwhile, CITES Appendix II

listing allows utilization of wild caught animals in manners not detrimental to the survival

of the species and that the specimens were legally obtained. The implementation of CITES

in Malaysia is mandated under the International Trade in Endangered Species Act 2008 [Act

686] as well as the individual state’s wildlife laws (Sarawak Forestry Corporation, 2018).

C. porosus in Malaysia is listed as a protected species under state’s wildlife laws; for the

states in peninsular Malaysia, the crocodile is protected by the Wildlife Conservation Act

2010 [Act 716], meanwhile Wild Life Protection Ordinance of Sarawak 1998 and Sabah

Wildlife Conservation Enactment 1997 protect the crocodile in Sarawak and Sabah,

respectively. These laws prohibited any activities of hunting or killing of wild crocodiles in

any states of Malaysia. In addition, any activities involving trades or import-export either in

Page 25: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

3

the form of life crocodile or crocodile-based products in Malaysia are illegal except for those

who have license and permit from the authority (Sarawak Forestry Corporation, 2018).

During the Rajah Brooke’s era in Sarawak, crocodiles were considered as pest because this

animal had terrorized people and caused much problem to the government. Thus, the

government offers bounty for each crocodile that had been caught (Hornaday, 1885). The

local community started to hunt this animal for the prize and a huge number of crocodiles

had been reported caught during the time. After the World War 2 (WWII), demand and prize

for crocodile’s skin worldwide, especially for C. porosus skin, had been increased and

consequently led to the intensive hunting of crocodiles in rivers of Sarawak. Besides hunting

for its skin, the local community in Sarawak also consumed crocodile’s meat and use its

organs and body parts for medicine to cure asthma and other sickness (Hassan & Abdul-

Gani, 2013). Hunting activities and exploitation of crocodiles in Sarawak were at its peak in

the late 80’s, leading to the reduction in the number of crocodiles in rivers of Sarawak.

According to the survey by Cox and Gombek (1985), prior to the introduction of a law that

prohibited any crocodile hunting activity, the density of crocodile in several rivers in

Sarawak were less than 1 individual/ km and in some rivers, no crocodile could be sighted.

After more than three decades protected by the laws that prohibits any hunting activities of

crocodiles in the wild, populations of C. porosus in Sarawak are recovering. Simultaneously,

the human-crocodile conflicts (HCC) in Sarawak are also on the rise, possibly due to the

growing crocodile populations as well as the expanding of human populations in the state

(Lading, 2013; Tisen et al., 2013). Increasing in the number of crocodiles in the river would

intensify competition among crocodiles for a shrinking habitat (Amarasinghe et al., 2015),

Page 26: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

4

which could lead to the expansion of crocodile population including towards further up-

river. The local people claimed that C. porosus can be seen as far as Kapit town at the Rajang

RB, which is more than 160 km from its river mouth and the waterway is not affected by the

tidal influence (Tisen & Ahmad, 2010).

1.2 Problem statements

Conflicts between human and crocodile (HCC) in Sarawak showed an increasing trend, most

notably after the year 2010 (Tisen et al., 2013; Abdul-Gani, 2014) which led to the

assumption that the recovery of crocodile population in the rivers might be one of the major

factor contributing to the problem. Meanwhile, at least eight major rivers in Sarawak

recorded a marked increase in density of crocodiles (Tisen & Ahmad, 2010; Sarawak

Forestry Corporation, 2018), hence further reaffirm the assumption. Increasing in the density

of crocodiles in the river could trigger the competition for space, food sources and mating

companions as more crocodiles are living in the limited stretch of the river. Fierce

competition among the crocodiles sometimes affect the level of aggressiveness of the animal

which could lead to attacks on human.

C. porosus, the crocodile species that is identified as the main perpetrator for almost all

attacks in Sarawak, is known for its territorial behavior which mean a crocodile especially

the adult cannot tolerate with other crocodiles or other animals including human entering its

territory (Campbell et al., 2013). A very large adult crocodile typically dominates large

section of the river that has the best spot for food hunting, basking and resting, while smaller

crocodiles that are unable to access the area guarding by the dominant crocodile usually will

Page 27: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

5

forage into other places resulting in habitat range expansion of this species (Hanson et al.,

2015). In finding new area for living, there is a possibility that this crocodile will travel

further upstream and end up staying in the upper side of the river.

Several sightings of C. porosus in the upper region of Batang Rajang (about 160 km from

river mouth and no tidal influence) rise question about the movement pattern of this animal.

The ability to travel in long range movement (Read et al., 2007; Campbell et al., 2010;

Campbell et al., 2013) and also highly adapted to new environment as it possesses functional

lingual salt glands and other organs (Grigg & Gans, 1993) could facilitate the dispersion of

C. porosus not just along the coastline of Sarawak, but also possibility towards further

upstream of large river basins. This population expansion theory has never been tested in

Sarawak, leading to the difficulties for the authority to manage crocodile populations in a

sustainable manner for the benefit of local people and the state.

Despite reports on the presence of C. porosus in the upper part of Batang Rajang, information

about the distribution, ecology and habitat of this reptile in the particular region are largely

unknown. Prior to 2010, majority of the crocodile’s survey in Sarawak focused in the rivers

within the coastal region. Cox and Gombek (1985) had first initiated preliminary surveys on

populations and distributions of C. porosus and T. schlegelii in Sarawak in mid-1980’s. The

surveys involved several large rivers in Sarawak including Samarahan River, Batang Lupar,

Batang Rajang, Baram River and Kuching mangrove wetland.

The Sarawak Forestry Corporation (SFC) and Forest Department of Sarawak (FDS) had

been conducting surveys on crocodile population in several major rivers of Sarawak since

Page 28: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

6

1994 (Tisen & Ahmad, 2010; Sarawak Forestry Corporation, 2018). However, due to the

vast areas of rivers in Sarawak and the high cost needed to conduct a survey, earlier crocodile

surveys only involved rivers in the western part of Sarawak, such as Sarawak River, Kuching

wetland, Batang Sadong, Batang Samarahan, and Batang Lupar. Only in 2012 to 2014, the

agencies have started a comprehensive state-wide crocodile surveys that cover 40 rivers

throughout Sarawak including the Rajang RB (Robi, 2014; Sarawak Forestry Corporation,

2018). Surveys by Cox and Gombek (1985) and Robi (2014) in Rajang RB reported an

increase of 2150% (from 0.02 individuals/km in 1985 to 0.43 individuals/km in 2014) in the

density of crocodiles. However, the data have set back such as survey by Cox and Gombek

(1985) only examined the lower part of the river, including tributaries such as Sarikei River,

Belawai River, Paloh River and few smaller tributaries near to the mouth of the river basin,

while survey by Robi (2014) cover up to nine rivers from lower to upper side of the river

basin. Therefore, using the Rajang RB as a model river basin, this study uses combination

of survey and genetic data to shed light on the possible expansion of crocodiles in Sarawak.

To ensure successful wildlife management, all historical information, ecological and genetic

components need to be examined (Bradshaw et al., 2006). Historical information on

crocodiles including exploitation of the animal, crocodile attacks data and distribution could

help in understanding the timeline of events related to the crocodile population in Sarawak

and the data could assist crocodile management in deciding better actions for the better future

of the reptile in the state. Genetic data are important as it allow inferences about the

geographic patterns and extent of historical isolation of one species (Moritz, 1999).

Therefore, this study is designed to assess genetic relationship among crocodile populations

in order to resolve population structure of C. porosus in Sarawak. The ecological and habitat

Page 29: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

7

data collected in this study will also help in providing clues concerning the potential

movement of crocodiles and the possible risk of danger posed by them in Rajang RB. Habitat

use by a particular species can be best understood by monitoring its movements,

which ultimately would reflect its behaviour or responses to the habitat (Taigor & Rao,

2014).

1.3 Objectives

Objectives of this study are:

i. To gather and examine the historical information on crocodile in Sarawak including

the exploitation of the animal and conflicts between human and crocodile from the

year 1900 to 2017.

ii. To analyze data on crocodile attacks incidents in Sarawak from the year 1900 to

2017.

iii. To assess the density and distribution of C. porosus in eight rivers representing the

upper, middle and lower part of Rajang River Basin.

iv. To compare the current density of C. porosus in eight selected rivers in Rajang River

Basin with previous survey.

v. To determine the crocodile habitats, selected water quality parameters and the

abundance of potential food sources for crocodile in the eight rivers of Rajang River

Basin.

Page 30: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

8

vi. To determine relationship between crocodile density and distributions with habitats,

selected water quality parameters and the abundance of food sources for crocodile.

vii. To investigate the genetic relationship among crocodile populations from 13

localities in Sarawak using DNA microsatellite marker.

viii. To examine population expansion and migrations (gene flow) between the crocodile

populations in Sarawak.

6.1 Hypotheses

At the beginning of this study, the hypotheses suggested were as follows:

Chapter 3

H0: There is no change in terms of number of human-crocodile conflicts (HCC) in Sarawak

within the period of 1900 until 2017.

Ha: There is fluctuation in terms of number of human-crocodile conflicts (HCC) in Sarawak

within the period of 1900 until 2017.

Page 31: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

9

Chapter 4

H0: There is no difference in ecological characteristics and river habitats supporting

populations of C. porosus in the estuary, middle and upper regions of Rajang River

Basin.

Ha: There are differences in ecological characteristics and river habitats supporting

populations of C. porosus in the estuary, middle and upper regions of Rajang River

Basin.

Chapter 5

H0: Microsatellite markers are unable to clarify to the population structure of C. porosus in

Sarawak and are not useful to explain the expansion of the animal population in the state.

Ha: Microsatellite markers could clarify the population structure of C. porosus in Sarawak

and could explain the expansion of the animal population in the state.

Page 32: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

10

CHAPTER 2

LITERATURE REVIEW

2.1 Evolutionary history and classification of crocodiles

All crocodiles belong to Order Crocodilia under the Class Reptilia. Reptiles first appeared

around 320 million years ago and arose directly from the amphibians, a diverse group of

animals at that time. At the time that reptiles evolved, the world's fauna consisted of

invertebrates, fish and amphibians. Between 320 and 220 million years ago, reptile came in

many different body forms where some of them were large, others were small, some

dominated the land surfaces, others the sea. This marked the "Age of Reptiles" had arrived,

and reptiles were to flourish for the next 155 million years. However, about 65 million years

ago the group suddenly suffered mass extinction, about the same period of time that saw the

end of the dinosaur. During the event, most of the known reptiles entered the fossil record.

Today’s crocodilian including crocodile, alligator, caimans and gharials are thus considered

“living fossils” that survived the mass extinction (De Silva, 2013).

Crocodilians are thought to share common ancestor with the dinosaurs and birds (Seymour

et al., 2004). The birds are said to split off from dinosaur ancestor later than the crocodiles.

This group that share the same lineages is called Archosauria. Even when looking at modern

crocodilians, their biology and behavior are closely similar to the dinosaurs. While for birds,

there are some traits shared with the crocodiles such as the presence of gastroliths in the

stomach of extant crocodilians (Brazaitis, 1969; Brazaitis & Watanabe, 2011). These are

Page 33: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

11

among the evidences that connecting crocodiles with dinosaur and birds which share

common ancestor.

According to Seymour et al. (2004), one of the oldest complete basal archosaur fossils came

from the Early Triassic, the 1.5 m long Proterosuchus, which resembled modern crocodiles.

Then it was followed by the Orthosuchus, a terrestrial crocodilian in the Middle Triassic,

which at that time became the most important predators. It was believed that all crocodilians

were terrestrial before they invaded the seas, lakes and swamps. Then came Euparkeria, a

small archosaur that is considered to be closed to the common ancestor of crocodilians and

dinosaurs (De Silva, 2013). Approaching the Middle Triassic, archosaurs split into two

lineages: Crurotarsi (crocodilians and relatives) and Ornithodira (dinosaurs, birds, pterosaurs

and relatives).

During the Tertiary periods (approximately 65 million years ago), the periods after the mass

extinction of reptiles, all surviving crocodilians were widely distributed in the world with

the help of favorable weather conditions. These crocodilians are in the Order Crocodylia,

which is divided into three discrete Families (Crocodylidae, Alligatoridae, Gavialidae),

which have been separated from each other for at least 60 million years (De Silva, 2013).

However, several factors including severe climate change has contributed to the extinction

of several species of crocodiles. According to De Silva (2013), all periods of expansion in

diversity of crocodiles in the fossil record coincided with periods of warm global

temperature, which explained why some species were extinct and also because of this,

crocodiles are restricted to certain geographical area.

Page 34: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

12

There are at least 24 species of modern crocodilian that still exist on the present day, disperse

around the world under Order Crocodylia. They are grouped under three extant families and

nine genera (Figure 2.1).

Class Reptilia

Order Crocodylia

Family Alligatoridae

Genus Alligator

A. mississippiensis - American alligator

A. sinensis - Chinese alligator

Genus Caiman – the true caimans

C. crocodilus – spectacled or common caiman

C. yacare – Yacaré caiman

C. latirostris – broad-snouted caiman

Genus Melanosuchus

M. niger – black caiman

Genus Paleosuchus – the dwarf caimans

P. palpebrosus – Cuvier’s dwarf, or dwarf caiman

P. trigonatus – Schneider’s dwarf, or smooth-fronted caiman

Family Crocodylidae

Genus Crocodylus – the true crocodiles

C. acutus – American crocodile

C. intermedius – Orinoco crocodile

C. rhombifer – Cuban crocodile

C. moreletii – Morelet’s crocodile

C. niloticus – Nile crocodile

C. siamensis – Siamese crocodile

C. palustris – mugger crocodile

C. porosus – estuarine or saltwater crocodile

C. mindorensis – Philippine crocodile

C. novaeguineae – New Guinea crocodile

C. johnstoni – Australian freshwater crocodile

C. cataphractus – African slender-snouted crocodile

Genus Mecistops – the African slender-snouted crocodiles

M. cataphractus – African slender-snouted crocodile

Genus Osteolaemus

O. tetraspis – African dwarf crocodile

Family Gavialidae – the gharials

Genus Gavialis

G. gangeticus – true or Indian gharial

Genus Tomistoma

T. schlegelii – false gharial/Malayan gharial

Figure 2.1: Global crocodile species and its common name (De Silva, 2013).

Page 35: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

13

2.2 Distribution of crocodiles

Extant modern crocodilians are distributed geographically throughout tropical, sub-tropical

and warmer temperature wetlands regions of the world (Martin, 2008). This is because

crocodiles are unable to survive and reproduce successfully in cold climates (Grigg & Gans,

1993; De Silva, 2013). However, Genus Alligator (the American alligator and Chinese

alligator) are the most cold-tolerant and are both found in the highest latitudes of any species

(Grigg & Seebacher, 2000).

Crocodiles can live in various aquatic habitats such as forest streams, rivers, marshes,

swamps and elbow lakes. They can be found in over 90 of the world's countries and islands

(Martin, 2008). Alligators and caimans (Family Alligatoridae) are found almost exclusively

in North, Central and South America. The sole exception is the Chinese alligator which is

found in the eastern China. There are a few members from the Family Crocodylidae (true

crocodiles) in the Americas, but the majority of them can be found throughout Africa and

Asia. One member of the Family Gavialidae (the Indian gharial), is found in India and

adjacent countries, while another family member, the false gharial is distributed in few

countries in the Southeast Asia (Martin, 2008).

Majority of crocodiles species are restricted to certain part of the worlds. Among them are

Chinese alligator (Alligator sinensis), can only be found in Yangtze River, China; Orinoco

crocodile (Crocodylus intermedius), in Orinoco water system in Venezuela and Colombia

and the Philippines crocodile (Crocodylus mindorensis) which live only in the archipelago

of the Philippines (Martin, 2008). In addition, some species are distributed widely and can

Page 36: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

14

be found in specific continent or region such as the Nile crocodile (Crocodylus niloticus) in

Africa, the saltwater crocodile (Crocodylus porosus) in the Indo-Pacific region or the

spectacled caiman (Caiman crocodilus) in South America.

Out of 24 species of crocodiles in the world, only two species can be found in Sarawak, the

saltwater crocodile, Crocodylus porosus and the Malayan false gharial, Tomistoma

schlegellii (Abdul-Gani, 2014; Hassan et al., 2016; Sarawak Forestry Corporation, 2018).

Both species can be easily distinguished as both crocodiles have a distinctive snout feature.

The false gharials have elongated and slender snouts compared to those of the saltwater

crocodiles, which are shorter and blunt (Grigg & Gans, 1993). Both species live in different

habitats; C. porosus mainly occupying waterway areas near to the coast, meanwhile the T.

schlegellii is can only be found in further inland freshwater rivers with peat swamps habitat

and black water (Hassan et al., 2016). C. porosus are more abundance and aggressive,

perpetrator for almost all crocodile attacks in Sarawak, compare to the T. schlegellii, hence

the literature review chapter will mainly focus on C. porosus.

2.3 Crocodylus porosus

2.3.1 Taxonomy

Crocodylus porosus SCHNEIDER 1801 was first discovered and described as new species

by a German naturalist Johann Gottlob Schneider (Schneider, 1801). This species is

classified in the Family of “true crocodile”, Crocodylidae, and Order Crocodilia (Figure 2.2).

Page 37: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

15

Kingdom Animalia

Phylum Chordata

Subphylum Vertebrata

Class Reptilia Laurenti, 1768

Order Crocodylia

Family Crocodylidae

Genus Crocodylus Laurenti, 1768

Species Crocodylus porosus Schneider, 1801

Figure 2.2: Taxonomic hierarchy of Crocodylus porosus.

Worldwide, C. porosus is commonly known as saltwater crocodile or estuarine crocodile.

The crocodile species was given a nickname “saltie” by the Australian as it is widely

distributed in the coastal areas and rivers in the Northern Territory of Australia (Webb et al.,

2010). Another name for this crocodile is “Naked-neck” crocodile, because this is the only

species without large scales on the back of its neck. With a reputation as human killer and

causing more fatalities to human when compared to the other crocodile species, C. porosus

had earned a fearsome name as the “man-eating crocodiles”.

In general, local people in Sarawak called the saltwater crocodile ‘buaya katak’ or ‘buaya

tembaga’ (translated as frog crocodile or copper crocodile, respectively), basically based on

observation that crocodiles can jump like a frog or leap out of water and also because of the

copper-like brownish colour on the body of the crocodiles found in certain rivers. In native

Iban language, the crocodile is referred as ‘baya’. Yet, when talking about crocodile in

Page 38: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

16

Sarawak, the infamously huge crocodile known as ‘Bujang Senang’, once shook fear among

people in Sarawak as many victims fall into the mouth of the crocodile, is the most

remembered crocodile by the people in the state. Historically, the name of Bujang Senang

literally means a happy bachelor came from a crocodile that inhabited Batang Lupar in Sri

Aman, Sarawak, Malaysia. The word “Bujang” in Malay means bachelor, which refers to

the crocodile while “Senang” refers to the Senang River, which is one of the tributaries in

Batang Lupar, a place where the first known attack by this crocodile had happened (Ritchie

& Jong, 2002). It had been a custom in Sarawak when a large and ferocious crocodile that

had been kill or captured to be given a name according to the name of a river where it was

found such as “Bujang Samarahan”, “Bujang Tisak” and “Bujang Seblak” (Abdul-Gani,

2014).

2.3.2 Habitat and distribution of C. porosus in Sarawak

Sarawak is situated on the north-eastern part of Borneo Island, geographically separated

from Peninsular Malaysia by the South China Sea, sharing the island with the Malaysian

state of Sabah, the Sultanate of Brunei Darulsalam and the Indonesian’s Kalimantan. The

topography of the state is generally flat closer to the coast to gently undulating hills and

rugged mountains towards the borders in the west and south (Tisen et al., 2013). The tidal

portions of the rivers are typically linked with mangrove in the coastal area and the rivers

flow through great distances over broad flood plains, giving rise to the extensive crocodile

habitats. The waterways of Sarawak are comprising of 22 major river basins and its cover

Page 39: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

17

an area of 12 million hectares, in which the saltwater crocodile, C. porosus, is reported to

occur in all of the river basins in the state (Sarawak Forestry Corporation, 2018).

In Sarawak, C. porosus are majorly abundant in the large river systems, mangrove

floodplains and inland freshwater swamps (Tisen & Ahmad, 2010). The highest crocodile

densities in Sarawak are usually found in estuary and mid-river areas of medium sized to

large rivers (Tisen & Ahmad, 2010; Abdul-Gani, 2014; Ali et al., 2014; Robi, 2014; Zaini et

al., 2014; Sarawak Forestry Corporation, 2018). Crocodiles in Sarawak particularly the

female ones prefer to build nest in small and secluded tributaries connected to the major

rivers. Juvenile crocodiles can be found abundant in these tributaries especially after the

nesting season (Abdul-Gani, 2014; Ali et al., 2014; Robi, 2014; Zaini et al., 2014).

C. porosus can be seen in Logan Bunut, the Sarawak’s largest natural lake, situated

approximately 130 km from the city of Miri (Cox & Gombek, 1985). The lake is mainly

surrounded by peat swamp and the water drains into Sungai Teru. The species have also

been spotted in several locations in the upper region of river basin, hundreds kilometers away

from sea such as Belaga in the upper Rajang RB and Kelauh, a small freshwater tributary of

Lupar RB (Tisen & Ahmad, 2010). There are also reports received by authorities about the

sighting of crocodiles in man-made waterbodies such as in water drainages, agriculture

canals, community lakes and private ponds (Sarawak Forestry Corporation, Unpublished

report).

Page 40: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

18

2.3.3 Morphology and physiology of C. porosus

The saltwater crocodile, C. porosus has a large triangular head with broad and long snout

and round eyes at the top of the head. The C. porosus is the only species without large scales

on the back of its neck, a unique feature distinct the species from other species in

Crocodylidae (Figure 2.3) (Grigg & Gans, 1993). There is a pair of ridges along the centre

of the snout and it becomes more distinct with age. The upper surface of the top jaw becomes

more shrunken in large adult males. Juveniles C. porosus have more oval scales than other

crocodile species, although belly scales are rectangular, even and relatively small (Isberg et

al., 2006). C. porosus are normally green or pale tan in colour with black stripes and spots

on the body and tail but they became paler and less colourful after reaching adult stage. This

happens because the crocodile’s body usually covered with mud, grime and algae. The

ventral surface or belly is creamy yellow to white in colour, except the tail which tends to

be greyer on the underside nearer to the tip (Grigg & Gans, 1993).

Figure 2.3: Head shape of C. porosus (Illustration adapted from Caldicott et al., 2005).

Page 41: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

19

C. porosus possess a set of 64 to 66 teeth which designed to grab and hold onto prey and the

size of the teeth can be from 10 to 13 cm long according to the size of the crocodile (O'Shea

& Halliday, 2002; Caldicott et al., 2005). They also have powerful pterygoid muscles in its

jaw which enable this crocodile species to crush hard-shell or larger preys. Saltwater

crocodiles have the strongest bite of any living animal with 3,700 pounds per square inch

(psi) bite force, even beating the bite force of the great white sharks (Erickson et al., 2012).

The crocodilian eye possesses a set of relatively large lens, retina and tapetum lucidum, all

features commonly associated with optimized sensitivity in dim light environments (Nagloo

et al., 2016). When the spotlight or flashlight directed to crocodile’s eyes, the tapetum

lucidum, will reflect distinctive orange or red color (depending on the angle and intensity of

lights) allowing crocodiles to be detected easily at night. A semi-transparent membrane, slit

pupil, control the amount of light that reaches the retina during the day as well as protected

crocodile eyes when they submerge under water (Grigg & Gans, 1993; Nagloo et al., 2016).

Among all the extant crocodilians, C. porosus is the largest living crocodile species based

on confirmed measurements and also the world's largest living reptile in terms of mass. The

species can growth up to 6 - 7 meters length and weight perhaps could reach a ton or 1,000

kg. Crocodilians display a pronounced sexual dimorphism where males grow larger and

often more rapidly than females (Grigg & Gans, 1993). Generally, the size of adult male

saltwater crocodiles is over 5 m in length, but in rare occasion they can grow bigger and their

size can reach more than 6 m. In contrary, the length of female C. porosus is relatively

smaller and the normal maximum adult size is between 2.5 m to 3 m. For the maximum

Page 42: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

20

weight, it varies according to its size. Usually, less than 5 meters adults are closer to 400 to

500 kg in weight.

The largest wild crocodile ever captured alive and properly measured is a male C. porosus

called ‘Lolong’ with a size of 6.17 m (20.24 ft) (Britton et al., 2012). The exceptionally large

saltwater crocodile was captured in September 2011 from a small creek in Mindanao island,

Philippines. Meanwhile in Sarawak, the infamous white back crocodile, Bujang Senang,

killed in early 1990’s, was measured at 5.87 m (19.24 ft) and weighed more than 2000

pounds (907.2 kg) (Ritchie & Jong, 2002). Although there are some unconfirmed reports

claimed about the sighting of huge crocodiles in the rivers of Sarawak, until now, no

crocodiles were capture or killed that a have size greater than the Bujang Senang.

Majority of crocodilians can live for a long time (Cooper-Preston & Jenkins, 1993). The

saltwater crocodiles are known to live for over 70 years and may even reach 100 years.

Crocodiles who live over 50 years are considered old. A crocodile in captivity at a farm in

Australia called “Cassius” is estimated to be 110 years old. “Cassius” was captured in 1984

from a river in the Northern Territory, Australia, has been in captivity for more than 26 years

and still alive at the farm until today. With the death of “Lolong” in 2013, “Cassius” now

has been named as the world's largest crocodile in captivity (Britton et al., 2012).

Crocodiles are amphibious animals, thus they can move both in land and in water. However,

crocodilians travel more easily in the water. The saltwater crocodile is an excellent swimmer,

under water or at water surface and sometime utilizing water current to facilitate its

movement (Campbell et al., 2010). The reptile uses its long muscular tail to propel itself in

Page 43: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

21

the water, holding the limbs at the sides. This massive tail also came in handy when crocodile

attack its preys (Grigg & Gans, 1993). Crocodile can stay under water for 4-5 hours long,

however, this ability is very much reliant on the size; larger crocodile can stay under water

longer than the small one (Rodgers et al., 2015). When submerge, crocodile's eye is covered

by the slit pupils and flaps of skin seal its nostrils and ears against water inflow. They also

can control their heart beat by virtually slowing it into 2 or 3 beats per minute so that they

can stay longer underwater without the need to come to the surface for air (Axelsson &

Franklin, 2011). On land, crocodiles have several ways of walking or gaits including the

“belly crawl”, walking in which the crocodile slides using its legs to push itself along on its

belly over a slippery mud. Another crocodile gait is high walking with the body held clear

of the ground and they can walk faster or running. They are also had been seen sliding down

steep slope at the riverbank before entering water (Grigg & Gans, 1993).

Breeding season for crocodiles typically coincide with the wet season. C. porosus in Sarawak

started to mate at the end of the dry season (Stuebing et al., 1985). During the courting

process, a male crocodile may display his dominancy and fight with other males for potential

mate before mating takes place briefly after the courtship. In general, crocodile mating

occurs entirely in the water where male and female swim together, often in circles, make

body contact frequently and rub their head over one another (Cooper-Preston & Jenkins,

1993). Stuebing et al. (1985) suggested that crocodiles in Sarawak are actively build their

nest and lay eggs in two periods of the year, from March to May and from October to

November, based on the data collected in a crocodile farm. The months of these two periods

match with the months when the transition between the two monsoon seasons (NEM and

SWM) or inter-monsoon in Sarawak. Stuebing et al. (1985) also reported that the breeding

Page 44: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

22

season of crocodiles in Sarawak concur with the prawn season, hence suggest that the

abundance of prawn as the food supply for the crocodiles may be one of the environment

cues that trigger the breeding season.

During the nesting period, female crocodiles can travel up to hundreds kilometers to find

suitable place to build nest (Campbell et al., 2013). Crocodile’s nest is typically builds in an

open area not far from river or water sources, but in some occasions the nest were found up

to hundreds of meter from waterbody, but the access to freshwater is still available close to

the nest (Webb et al., 1983; Fukuda & Cuff, 2013; Evans et al., 2016). The female crocodile

built nest from available plants in the surrounding area especially grasses or shrub and used

mud to mound the plants together (Fukuda & Cuff, 2013). On average, a female C. porosus

could lay between 50 to 60 eggs and incubation period took about 60 to 100 days before the

eggs hatch. The sex of the hatchling is determined by the temperature of the nest; if the nest

temperature is around 32°C to 33°C, the egg is most likely hatch as male, whereas when

temperature above or below that, female will be produced (Cooper-Preston & Jenkins, 1993).

In wild population, only about 25% off the eggs will hatch and less than 1% of hatchlings

will survive to reach maturity. Others might be killed by other animals including human or

other crocodiles. After hatch, young crocodile tends to stay near to its nest for few months.

Adult females are said to remain near the nest up to several months, assisting hatchlings out

from the nests and protecting them from predators (Webb et al., 1977).

Crocodilians are carnivorous and opportunistic predators (Webb et al., 1991). They eat a

wide range of preys depend on their developmental stage, habitats and potential prey

diversity. C. porosus, from hatchling to adult, eat primarily at the water edge, however, the

Page 45: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

23

size of preys varies according the crocodile age. Young and small crocodiles eat small

animals like fish, crabs, prawns, frogs and insects. When they grow bigger the crocodiles are

capable to hunt and eat larger preys like turtles, mammals, snakes, primates, wild pigs and

livestock (Webb et al., 1991; Hanson et al., 2015). Stuebing et al. (1985) have listed potential

preys of C. porosus in rivers of Sarawak, particularly Batang Lupar. Younger C. porosus

feeds majorly on Penaeus and Caridina prawns, while larger adult diet varies from aquatic

preys like fish and crabs into large terrestrial vertebrate such as tortoise, monkey or other

animals that come to drink at the river’s edge (Stuebing et al., 1985).

Saltwater crocodiles especially the adults hunt their preys alone and as a nocturnal animals,

they are mostly active hunting preys at night (Emerling, 2017; Evans et al., 2017). They tend

to ‘sit and wait’ in shallow water or at water edge for suitable prey to come within striking

distance (Caldicott et al., 2005). Sometimes, the crocodile submerges underwater to sneak

near the potential prey. Once in the range the crocodile rapidly attacks the prey with powerful

bite and immobilise it before it is swallowed. A large prey may be stored until it starts to

disintegrate before it consumes by the crocodile (Grigg & Gans, 1993). Crocodiles swallow

stones frequently but the purpose of this action or the function of the gastroliths are still

unclear. Some researchers said that the stone are ingested incidentally and serve no function.

Others suggest that stones have an important role in buoyancy and digestion (Brazaitis, 1969;

Cooper-Preston & Jenkins, 1993; Grigg & Gans, 1993). It is believed that a gastrolith can

remain inside the crocodile’s stomach for years.

C. porosus is highly territorial animal. Large male adult crocodiles may able to monopolize

specific parts of the river that provide them with access to key resources, such as riverbanks,

Page 46: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

24

foods and mates (Hanson et al., 2015). The crocodiles often cannot tolerate with anything

that tried to trespass and they can be quite violent in defending their territories or nests during

the breeding season. Crocodilians are ectothermic where they exploit the external

environment to regulate body temperature through behaviours such as basking, movement

in and out of water, and mouth gaping (Cooper-Preston & Jenkins, 1993). In colder months,

the saltwater crocodile typically spends the morning basking under the sun. When their body

became too hot, the crocodile will move into the water or sometimes they seem to noticeably

avoid the sun and use the shade of mangroves when out of the water (Evans et al., 2017). In

warmer months, the saltwater crocodile avoids heat by remaining in the water during the day

and comes up on the banks at night, often burying itself in the mud of tidal areas. During

basking, crocodile open their mouths in a behaviour called “mouth gaping” in order to reduce

impact of heat on its brain (Grigg & Gans, 1993).

Ambient temperature is among the strong factor that could influence the distribution of

ectothermic animals like crocodiles as the temperature affects the behaviour and physiology

of crocodiles. The saltwater crocodile can tolerate with a wide range of water temperature,

but the optimal temperature for crocodile is around 28 0C to 30 0C (Rodgers et al., 2015).

When the temperature is outside of the optimal range, crocodiles commonly seek to maintain

body temperatures through behaviours such as basking, shade-seeking, and shifts into and

out of water (Grigg & Gans, 1993). The temperature is also a determinant for breeding and

nesting season. Heavy rains and rapid increase in the temperature in the late dry season to

the early wet season seems to trigger reproductive activities in C. porosus (Stuebing et al.,

1985). The temperature in Sarawak is relatively uniform throughout the year with an average

daily temperature ranging from 23oC during the early hours of the morning to 32oC during

Page 47: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

25

the day, but the average temperatures could vary between SWM and NEM (Sa’adi et al.,

2017).

Whereas most of crocodilians species are found in fresh water, C. porosus occur routinely

in hyperosmotic estuarine habitats and the species respond behaviourally to changes in

environmental salinity. The presence of lingual salt glands in C. porosus plays a crucial role

in osmoregulation that allows the species to live in saline water (Cramp et al., 2008).

Movement between marine habitat and freshwater is thought to be common in C. porosus,

particularly nomadic male juveniles or female crocodiles during nesting (Campbell et al.,

2013). Although crocodile prefers to build nest in freshwater habitat, C. porosus is also able

to nesting in hypo-saline habitats in estuary or coastal floodplain (Fukuda & Cuff, 2013).

Even, hatchlings of C. porosus are also able to survive and grow without access to fresh

water (Cramp et al., 2008). The influence of salinity on the abundance and distribution of

crocodile is also related to the waterbody habitat and riverbank vegetation. Brackish water

bodies such as saline floodplain and mangroves near to estuaries are the common habitat for

C. porosus in Sarawak (Tisen & Ahmad, 2010; Sarawak Forestry Corporation, 2018), and

these habitats support diverse fauna including fish, crustaceans, insects, mammals and birds

(Nagelkerken et al., 2008). Hence, a high productivity in the habitats may contribute to the

higher abundance of crocodiles.

Page 48: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

26

2.3.4 Historical literature about crocodile in Sarawak

Historical information regarding crocodiles in the island of Borneo, particularly Sarawak

can be found in records or journals by European explorers who had visited this part of the

world. Majority of them came after the arrival of an English adventurer, James Brooke in

1839 who was helping the Sultan of Brunei in quelling a local rebellion in Sarawak and later

on he was awarded the territory. He then proclaimed himself as the Rajah of Sarawak and

started to rule the north-western territory of Borneo. As the result of the political stability

and also with the supports and invitation from the Rajah himself, soon it began to attract,

among others, the natural historians, botanist and collectors of the flora and fauna came to

Sarawak.

Among the first checklist of animals in Borneo appeared in an appendix of a book published

in 1848 by Hugh Low. Hugh Low, a botanist from Scotland, who was known as a person

closed and admirer of Rajah Brooke wrote the checklist of animals he found during his stay

in Sarawak. The species checklist listed a number of mammals, birds, fish, insects,

amphibians and also reptiles (Low, 1848). Among the reptiles listed by Huge Low are two

species of crocodiles, Crocodilus (Gavialis) schlegelii MÜLLER 1838 and Crocodilus

biporcatus CUVIER 1807, which are later known by then name Tomistoma schlegelii and

Crocodylus porosus, respectively (Low, 1848).

In 1868, an Italian botanist, Odoardo Beccari arrived in Sarawak to collect samples for his

botanical collections and during his visit, he had made some significant collections of

amphibians and reptiles. In one of his trips to the interior of Borneo, Beccari had reported

Page 49: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

27

that he found a polustrine crocodile, possibly the enigmatic and mysterious Crocodylus

raninus Muller & Schlegel, 1844 (refer as Boaya Katak or frog crocodile by Beccari) in

Kanowit River (Beccari, 1904). However, he never mentioned if a specimen was actually

secured.

Of all the visits by well-known naturalists to Borneo, Sir Alfred Russel Wallace perhaps is

the most celebrated collector. According to Das (2004), Wallace arrived in Sarawak after his

visit to Singapore on 1st November 1856 and left Sarawak on 25th January 1856. His visit to

Sarawak was recorded in his famous work, The Malay Archipelago (Wallace, 1869).

Wallace’s collecting activities in Sarawak only covered Sadong River area (Simunjan and

Sadong) and his main primary targets are insects and orang utan, also known as “Mias” in

the book. From the information told by the Dayaks community in that area, Mias are very

strong that no animals dare to attack them except for two, the crocodile and the phyton

(Wallace, 1869). In the book, Wallace once saw a crocodile tried to seize Mias when the

animal went to seek foods on the riverbank but with his strong hands and feet the Mias was

able to beat the crocodile out and killed it.

The establishment of Sarawak Museum in 1886 by Rajah Brooke that further flourished and

developed much interest on studying and collecting specimens of flora and fauna in Sarawak.

It was believed that Sir Alfred Russel Wallace had influenced Rajah Brooke to establish the

museum with the intention to collect and study the natural flora and fauna of Sarawak. Even

after the death of the first Rajah Brooke, the Sarawak Museum continued to develop further

with the encouragement of his successor, Charles Brooke and Charles Vyner Brooke (Das,

2004). They started to hire professional curators and started to publish scientific findings in

Page 50: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

28

their own publications, the Sarawak Museum Journal. The first two curators of the Sarawak

Museum were John E. A. Lewis and George Darby Haviland (1888 to 1895) where both of

them were primarily interested in botany and ornithology, hence there were not much

research and information related to crocodile in the state during that time.

It was only when Edward Barlett appointed as the curator, zoological collections in the

museum started to grow. He served with the Sarawak Museum only for two years from 1895

to 1897. His most important contribution was a 24 page accounts of crocodiles and lizards

of Borneo and all the specimens that he collected were deposited in the Sarawak Museum

(Bartlett, 1895). Interestingly in his paper, he listed a large number of lizard species that can

be found in Sarawak which eight of them described as new species. While for crocodile, he

listed two species similar to what had been described by Low (1848) earlier, Crocodylus

porosus and Tomistoma schlegelii, but in his writing, Bartlett described further details about

the distribution of the crocodiles in Sarawak during that time. According to Bartlett (1895),

C. porosus can be found abundantly along the sea coast and in all rivers of Borneo while T.

schlegelii was only restricted to the estuary and Sadong River. He also had mentioned about

Crocodylus polustris which was reported to be found in some parts of Sarawak, but he did

not find any physical difference from the specimens in the museum. One specimen of C.

porosus from Baram River and one specimen of T. schlegelii from Sadong River were kept

in the Sarawak Museum (Bartlett, 1895).

Besides attracting explorers and collectors from Europe, the richness in nature and

biodiversity found in Borneo had also attracted explorers from the American continent.

Among the early American collector who came to Borneo was William Temple Hornaday.

Page 51: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

29

Arrived in Sarawak in 1878, Hornaday concentrated all his collecting activities only in

Sarawak (Hornaday, 1885), with his primary targets were orang utan, crocodiles,

amphibians and reptiles. Hornaday expressed a great interest in crocodilians and one of his

specimens now kept in the Museum of Comparative Zoology, Harvard which was believed

to be a specimen of Crocodylus raninus. Although this specimen was retrieved by Hornday

from an unknown Borneo locality, but many presumed that the specimen was collected in

Sarawak. In his journal book, Hornaday told a story in his book about the Brooke

government waging a war to exterminate crocodiles specifically species C. porosus that

infested all the rivers of Sarawak and had been terrorizing people (Hornaday, 1885). During

that time too, Hornaday found out that true gavial (T. schlegelii) was growing to a great size

in the Sarawak River and the Rajang River. He also obtained a very large skull from the

upper Sarawak River, which he described as much rarer than the other, but did not succeed

in securing a fresh specimen.

2.3.5 Threats and conservation

When CITES was established and came into force in 1975, all populations of the saltwater

crocodile (C. porosus) were listed in Appendix II. However, in 1979, global population of

C. porosus was shifted from Appendix II to Appendix I in the CITES except for those in

Papua New Guinea, on the grounds that the species was at risk of imminent extinction due

to excessive harvesting and trade of wild crocodiles (Jalden, 2004). Few years later, in 1985,

populations of C. porosus in Australia and Indonesia had been recovering and these countries

had successfully down listed back their C. porosus population from CITES Appendix I into

Appendix II. Recently in 2016, proposal to transfer the C. porosus in Malaysia from

Page 52: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

30

Appendix I to Appendix II, with wild harvest restricted to the state of Sarawak and a zero

quota for wild specimens for the other states of Malaysia (Sabah and Peninsular Malaysia)

had been approved by the CITES (Sarawak Forestry Corporation, 2018). The International

Union for Conservation of Nature and Natural Resources (IUCN) Red List of Threaten

Species also had been categorized C. porosus as lower risk / least concerned due to the news

on the recovery of this species in several countries.

Saltwater crocodile populations in Sarawak was once seriously depleted due to unregulated

hunting and overexploitation in the late 1980’s, primarily for their lucrative hide and meat

(Cox & Gombek, 1985). Hunting and killing of crocodiles were started back during the time

when Sarawak was governed by the White Rajahs. At that periods of time, crocodiles had

been a big problem to the Brooke’s government and the animals were considered as vermin,

due to the terror that are brought by the reptile as they had killed many people in Sarawak.

Therefore, the government at that time encouraged the locals in Sarawak to hunt and kill the

crocodile and offer rewards for those who brought the animal to the government (Hornaday,

1885).

The booming of tanning industry especially after the World War 2 (WWII) had increased

the demand for crocodile skins globally (Thorbjarnarson, 1999). As the result, crocodiles

hunting in Sarawak increased as the local hunters ran for the well-paid offers by the hide

companies for the crocodile skins. Crocodile hunting activities in Sarawak are believed to

reach its peak in between 1954 to 1964 and during that period, it was estimated that more

than 80,000 crocodiles were killed and on average more than 10,000 skins were exported

from Sarawak every year (Cox & Gombek, 1985). At that time, skins export from Sarawak

Page 53: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

31

were tax exempted, hence attracted more companies including those from outside Sarawak

to involve in hide industry in the state, eventually resulted in the increasing hunting

activities. Besides hunting for skin, crocodile’s hatchlings and eggs were taken by the locals

from their nest and sold to crocodile farms.

Thereafter, the effect of unregulated hunting and overexploitation rapidly manifested

themselves. Surveys by Cox and Gombek (1985) in several major rivers and their tributaries

in Sarawak had recorded only 56 sightings of crocodile from 1,043 km survey distance,

revealing a very low density of crocodiles, ranging from 0.014 to 0.231 individual/km. In

three of the rivers surveyed, there was no sighting of crocodile at all. In response with the

depleting number of crocodile populations in Sarawak, the state government has listed both

species of crocodiles, C. porosus and T. schlegellii, as protected animals under Wild Life

Protection Ordinance 1990 in conjunction with the listing of the animals into the Appendix

I of CITES. After the law being introduced to protect the crocodiles, conservation efforts

were carried out by the relevant agencies in the state and among them by illegalise any

hunting or selling activities related to crocodiles. The government also helps the former

crocodile hunters in finding other jobs to support themselves and their families.

After three decades protected by the law, crocodile populations in Sarawak are recovering

and several rivers in the state recorded a marked increase in the density of crocodile

compared to survey result in 1985 (Hassan & Abdul-Gani, 2013; Abdul-Gani, 2014; Robi,

2014; Zaini et al., 2014). Comprehensive surveys by the relevant agencies from 2012 to 2014

reported that there were estimated more than 13,000 crocodiles live in over 40 rivers in

Sarawak (Sarawak Forestry Corporation, 2018). However, the recovery of crocodile

Page 54: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

32

population has resulted in a marked increase in conflict between human and crocodile (Tisen

et al., 2013).

In recent years, hunting pressure is not the major threat to crocodile populations in Sarawak,

instead they are facing greater threats as the reptile have come increasingly into conflict with

human because of their need for undisturbed nesting and foraging habitats (Lading, 2013).

Growing human population especially in riverbank areas has contributed to the increasing

encounters between human and crocodile, frequently lead to crocodile attacks on human. As

the response to the attack incidents, culling activities had been carried out by the related

government agencies. In the efforts to find the culprit, sometimes, large number of crocodiles

were taken out from the river to ease public concern and to ensure the safety of surrounding

community. In some cases, the relatives of the victim are taking the matter into their own

hands by hunting the crocodile using any available methods. These untrained hunters are not

only endangered themselves but also could result in the death of younger crocodiles which

are most likely not responsible for the attack.

Residential developments and land clearing for plantations areas that has been expanded in

riverbank areas could contribute to potential loss of riparian vegetation, hence destroy

natural habitats and nesting areas for crocodiles. Furthermore, constant encroachment into

crocodile habitat and high impact land use could indirectly affect the ecology of the rivers,

hence change the nature of the waterways (Fukuda et al., 2008). Man-made drainage system

for residential area and also water gate for the agricultural purpose could alter the dynamic

of water flow, leading to habitat fragmentations and at the same time could cause pollution

to the rivers as sewage are most likely be discharged into the waterways. Dam construction

Page 55: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

33

on water streams has blocked seasonal migration of aquatic species, hence limit the potential

food sources for the crocodile (Martin, 2008). Heavy pour of rain in monsoonal season in

Sarawak could increase the water level inside the dam, thus when it reaches the limit

capacity, the dam will discharge the excess water consequently increase the water level in

lower part of the river (Sa’adi et al., 2017). Flood water could destroy crocodile nests and

kill their eggs.

Increasing in human population and tourism activities near the river eventually lead to more

human activities like bathing, swimming and fishing to happen along the river during the

day and night. In addition, more people are using boats to travel from one place to another,

hence increase the traffic in the rivers. All these disturbances could affect the behaviour of

the crocodile (e.g., increase wariness or aggressiveness of crocodile) and also could drive

the animals away from the rivers (Webb & Messel, 1979; Grant & Lewis, 2010; Fukuda et

al., 2015). Meanwhile, expanding in the fishing activities could endanger crocodiles as nets

that are abundantly setup along the river could trap crocodiles especially the younger ones.

These crocodiles will end up dead entangled on the nets or kill by the fishermen (Shaney et

al., 2017).

2.3.6 Ecological and social importance of crocodiles

For centuries, the local people in Sarawak have been living side by side in harmony with the

crocodiles in riverine areas. The reptiles play parts in the oral tradition and custom of

indigenous tribes in Sarawak (Datan et al., 2012). Therefore, they are respected by the native

communities, and some still regard crocodiles as their protectors, hence the animal should

Page 56: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

34

not be disturbed or killed (Ritchie & Jong, 2002). There is a taboo among the people in

Sarawak saying that if a crocodile was disturbed or killed, it will come back to inflict revenge

on human. The story about the mighty Bujang Senang, a huge saltwater crocodile that has a

white stripe on its back and who is said to be responsible for numerous of attacks towards

local peoples and livestock in Batang Lupar in 1980’s and 1990’s, had been used to justify

the taboo. In May 21, 1992, a woman from the Iban ethnic had become the victim of this

crocodile in a tributary of Batang Lupar. A day after the attack, a group of police snipers and

Iban hunters successfully killed the crocodile after hours of struggling due to the ability of

the crocodile to dodge harpoons and bullets aim for it (Ritchie & Jong, 2002). The story had

become household words among the local people in Sarawak and some still believe that

crocodile attacks happened afterward were inflicted by the descendant of the Bujang Senang

(Ritchie & Jong, 2002).

Ecologically, crocodiles play key roles as an apex predator at the top of the food chain, thus

they help in guarding the balance in the complex web of life in wetland ecosystems by

feeding on wide range of prey (Hanson et al., 2015). The crocodiles also help in raising

genetic quality and keeping the ecosystem healthy by feeding on weak, sick and injured

animals. When a wetland habitat is healthy, the fishery is considered to be healthy too. It has

been claimed that the presence of crocodiles had brought positive impact on fisheries by

feeding on predators of commercially valuable fish such as catfish, turtle, water birds and

others (Whitaker, 1984).

Crocodiles also play important roles in boosting the economy of the local community

through eco-tourism. The eco-tourism activities like wildlife-viewing have become popular

Page 57: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

35

globally especially among new generation as people will be able to experience the thrill

watching wild animals closely in their own habitats. The presence of crocodiles in rivers in

Sarawak could be utilized by the local community to generate income, as example through

crocodile watching activities (Hassan et al., 2018). There are two crocodile farms currently

operated in Sarawak, Jong’s Crocodile Farm (in Kuching) and Miri Crocodile Farm (MCF)

own by a private company, Benaya Sdn. Bhd. Both of the farms are registered with CITES,

once primarily for the purpose of the crocodile skins production and exported to other

countries, but now majorly involved in tourism and in situ conservation as they now offer a

wide range of experiences from watching crocodiles in captivity, crocodile feeding

demonstration, research/educational displays as well as selling souvenirs to visitors.

2.4 Human-crocodile conflicts (HCC)

During the 1950’s to 1980’s, global crocodilian species are exposed to extinction due to

overexploitation and habitat loss (Martin, 2008), but protection by the international and

countries laws along with the implementation of effective conservation programs have seen

some populations in several countries achieve extensive recovery (Platt & Thorbjarnarson,

2000; Mazzotti et al., 2007; Fukuda et al., 2011; Balaguera-Reina et al., 2017). Recovery of

the crocodile’s populations had brought along a new set of problem, increasing in negative

interactions between people and crocodilians (human-crocodile conflicts, HCC) (Webb,

2008). Thus, this situation urges the crocodile managements in finding solutions to tackle

the growing problem by collecting and analysing crocodile attacks data as the data could

inform the managements about the HCC trends as well as helping them in formulating ways

to mitigate attacks of crocodile on people (Sideleau et al., 2016).

Page 58: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

36

While HCC have become an increasing issue, numerous attacks by crocodilians go

unreported or are poorly documented in many countries where crocodilians are distributed

(Sideleau & Britton, 2013). Analysis of attacks by American alligators (Alligator

mississippiensis) are well documented, although fatal attacks by the crocodile species are

uncommon due to their smaller size and more passive nature compare to other crocodilian

species (Langley, 2010; Woodward et al., 2014). On the other hand, more aggressive

crocodile species such as Nile crocodiles (Crocodylus niloticus) and saltwater crocodile (C.

porosus) are responsible for much higher fatality of human compared to the rest of

crocodilian species. It is estimated that 494 attacks by C. porosus were reported worldwide

in between January 2008 to July 2013, resulting in 285 fatalities, meanwhile, 428 attacks

resulting in 309 fatalities were attributed to C. niloticus during the same period (Sideleau &

Britton, 2013). Based on combine attack data for both species, it was found out that C.

niloticus and C. porosus had been responsible for almost 75% of all reported crocodilian

attacks and 88% of all reported crocodilian fatalities around the world.

Statistics of attacks on humans by crocodilians have been documented reasonably well in

several countries in the last few decades. In Australia, crocodile attacks from different parts

of the country including in Northern Territory and Queensland, were analysed in detail by

researchers and the data had been helpful for crocodile management in the country (Fukuda

et al., 2014; Brien et al., 2017). Moreover, attacks data from other countries were also had

been analysed and documented including in African nations such as Mozambique, South

Africa and Swaziland, and also Asian countries like Iran, Indonesia, Timor Leste, India and

Sri Lanka (Dunham et al., 2010; Pooley, 2014; Stevenson et al., 2014; Amarasinghe et al.,

2015; Ardiantiono et al., 2015; Sideleau et al., 2016; Das & Jana, 2018). Meanwhile, in

Page 59: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

37

Malaysia particularly in the state of Sarawak where most of the crocodile attacks occurred,

there is still lack of proper analysis on the HCC, although several studies had documented

attacks data that occurred in recent years (Lading, 2013; Tisen et al., 2013; Abdul-Gani,

2014). By analysing the crocodile attacks data, researchers will be able to understand the

pattern of attacks including hotspot areas, peak time or month of the attacks, victim’s gender

and age group as well as activities that associated with high risk of attack (Caldicott et al.,

2005).

2.5 Population ecology of crocodiles

Increased HCC may be related to the increasing and expanding of crocodile populations as

well as the growing human populations, urbanisation and encroachment by humans into

crocodile habitats (Webb, 2008). Fukuda et al. (2008) had examined the broad-scale

influences of the environment and anthropogenic pressures on the contemporary population

abundance of C. porosus in northern Australia. Their study identified several factors as most

likely to influence the abundance and distribution of C. porosus, among them are

temperature, salinity, riverbank vegetations, riverbank land-use and human population

density (Fukuda et al., 2008).

Human population and riverbank land-use are among the factors that have adverse impact

on the distribution and abundance of crocodiles. It is thought that increasing in human

population contributed to the increasing activities (e.g., tourism, fishing, boating etc.) in the

waterbodies and also lead to riverbank clearing for residential, industrial and agricultural

developments (Fukuda et al., 2008). Several studies suggested that these anthropogenic

Page 60: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

38

pressures appeared to keep the crocodile population low in the waterways. For example,

Read et al. (2004) suggested that intensive development and clearing of riparian vegetation

corridors for agricultural, pastoral and urban expansion had contributed to the low densities

of crocodile in Queensland, Australia. In Indonesia, a study by Shaney et al. (2017) found

out that the abundance of both crocodiles species in the country, C. porosus and T. schlegelii,

is correlated negatively with proximity to humans, even though C. porosus still could be

spotted in disturbed areas. They also claimed that common fish-trapping methods had

contributed to the less abundance of crocodiles in the waterbodies. Similar situation also had

been reported in Thailand where widespread fishing activities had affected the density and

abundance of the Siamese Crocodile, C. siamensis (Kanwatanakid-Savini et al., 2012).

Meanwhile in Sarawak, degradation of rivers due to the expansion of human population and

intensive usage of the river for fishing and transportation are among the contributing factors

to the depletion of wild crocodile population in 1950’s to 1980’s (Cox & Gombek, 1985).

Furthermore, constant encroachment into crocodile habitat and high impact land use could

indirectly affect the ecology of the rivers, hence change the nature of the waterways.

Pollution from industrial and agricultural activities could change the quality of water in the

rivers by increasing its acidity and the addition of chemical that could be harmful to the

crocodiles and their eggs. A study by Woodward et al. (2011) shows that there was negative

effect of pesticide pollution from agricultural activities towards the poor reproductivity of

American alligator (Alligator mississsippiensis) in Florida, USA. Furthermore, the

environmental pollution could also affect the abundance of preys for crocodile, hence drive

them away from the waterbodies.

Page 61: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

39

2.6 Population genetics and its importance

Population genetics is the study of genetic variation within and among the populations, and

it involves the examination and modelling of changes in the frequencies of genes and alleles

in populations over space and time (Keats & Sherman, 2013). Population genetics study also

enable us to understand the evolutionary factors that might cause the genetic variation. The

variation in genes or alleles is found throughout the genome, and by examining this genetic

diversity, evolutionary patterns can be inferred. Genetic variation within the populations and

species can be analyzed at the level of nucleotide sequences in DNA (genome analysis) and

the amino acid sequences of proteins (proteome analysis). This can now be done through

automated technology designed for genotyping and sequencing the genome and analyze

using bioinformatic software in computer. With the help of the technologies, population

geneticist is able to map and examine genetic variation within and among the populations

with histories of bottlenecks, admixture, and migration, and for advancing understanding of

wildlife (Keats & Sherman, 2013).

Management and conservation of wildlife are predicted to be more efficient with the

incorporation of population genetic information of the species (Shafiei-Astani et al., 2015).

Assessment of genetic diversity in wild population is an important step for better

understanding of the population structure and demography history, mainly through

application of genetic markers. The use of genetic markers to obtain data on genetic variation

is valuable for the species management as high genetic variation within a population reflects

a healthy population and the species is more adaptive to environmental changes, but if

otherwise, low genetic variation could lead to extinction of the species (Shafiei-Astani et al.,

Page 62: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

40

2015). Genetic markers has been used to evaluate population structure and historical

information of numerous species of animals as well as elucidate their geographical

distribution (phylogeography) (Maltagliati et al., 2010; Zainudin et al., 2010; Gehring et al.,

2012).

2.7 Genetic studies of crocodiles

For crocodilians, several common types of genetic markers had been used in genetic studies

such as mitochondrial DNA (mtDNA) and Short Sequence Repeats (SSRs) or also known

as microsatellite. However, the selection of microsatellites markers for population genetics

is preferred, since they are known to have high mutation rates that lead to higher allelic

variability and high levels of polymorphism. Microsatellite markers are ubiquitous in most

eukaryote genomes and provide hyper-variable sequenced tagged single locus markers

which capable of providing relatively contemporary estimates of migration and relatedness

among individuals (Miles et al., 2009a). For these reasons, the markers have been widely

used by many researchers to assess population structure and diversity, mating behaviour,

hybridisation, as well as dispersal systems, in a variety species of crocodile (Isberg et al.,

2004; Lewis et al., 2013; Hekkala et al., 2015; Lapbenjakul et al., 2017; Mauger et al., 2017).

At the same time, a sufficiently large source microsatellite primers for various species of

crocodiles had been constructed for research purposes and have facilitated many researches

on crocodilians genetic studies. Miles et al. (2009a) developed 253 novel polymorphic

microsatellite markers derived from the saltwater crocodile (C. porosus), and the markers

had successfully tested for cross-species amplification in 18 other species of crocodiles

Page 63: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

41

(Miles et al., 2009b). Since then, the markers had been used by researchers for genetic studies

in much less known crocodilian species such as T. schlegelii. C. rhombifer and C.

intermedius (Bashyal et al., 2014; Shafiei-Astani et al., 2015).

In Sarawak, although several genetic studies have provided some clues about the population

structure of C. porosus, however these aspects remain unclear. Studies using Cytochrome b

and 12S Ribosomal gene were unable to resolve genetic structure among population from

different areas in Sarawak (Shoon, 2009; Abdullah, 2010). Further analysis then utilized

nuclear gene markers such as randomly amplified polymorphic DNA (RAPD) and

microsatellite, and successfully identified genetic differentiation in saltwater crocodile

sample from Miri, Sibu and Bako (Kasim, 2011; Sulaiman, 2011). However, Sulaiman

(2011) and Kasim (2011) only used small sample size (one or two samples from each

locality), hence the result might be less reliable. Meanwhile, a recent study by Abdul-Gani

(2014) used more samples from localities representing western (Bako), central (Sibu) and

northern (Miri) part of Sarawak and able to map genetic structure among the populations

using microsatellite genes. However, there are questions about the genetic of crocodile

populations in areas in between the three parts of the state. Population genetic analyses of

crocodile populations in the three parts of Sarawak reveal genetic bottlenecks that had been

occurred in the populations, probably due to overexploitation in 1950’s to 1980’s and also

high gene flow among the population, suggesting frequent migration of the reptile

throughout the state (Abdul-Gani, 2014).

Page 64: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

42

CHAPTER 3

REVIEW OF CROCODILE STATUS AND HUMAN-CROCODILE CONFLICTS

IN SARAWAK FROM 1900 UNTIL 2017

3.1 Introduction

Crocodiles have been long living in rivers of Sarawak even before the arrival of James

Brooke. This can be proven by the presence of ‘Baya Tanah’, crocodile’s effigies or earthen

crocodile replicas, found in Engkilili, Skrang, Kanowit and Kapit. These effigies are

believed to be between 50 to 200 years old (Datan et al., 2012). The Baya Tanah played an

important role in the lives of native Iban farmers in the past, who held ‘mali umai’ ceremony

(ritual at paddy farms) in October or November each year. The main purpose for the

construction of the Baya Tanah is for the protection of the paddy farms against pests, rodents

and locusts. Crocodiles are regarded as special animals by the Ibans, especially those who

are still practising traditional beliefs. It is believed that the spirits of crocodiles will arise and

devour all the pests in the paddy field after the ‘mali umai’ ceremony and the Ibans are not

allowed to leave their longhouses for three nights as the spirit will harm them if they do so

(Datan et al., 2012).

However, the earliest documentation and the historical information regarding crocodile in

north-western of Borneo or Sarawak only came after the territory rule by the first White

Rajah, James Brooke. After Sarawak had been awarded to him in 1841, the Englishmen

brought peace and political stability to the state by ending the resistance and piracy (Baring-

Gould & Bampfylde, 1909). Soon it began to attract, among others, the historians, botanists

Page 65: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

43

and collectors of the flora and fauna to come to visit Sarawak. A number of famous explorers

cum naturalists also had been invited and welcomed with great hospitality by the Rajah

himself to see the richness of biodiversity in Sarawak (Low, 1848; Wallace, 1869). Many

explorations by these collectors had been mentioned in The Sarawak Gazette, however not

much in details being provided as what had been written by the explorers in their books.

Charles Brooke, the second Rajah of Sarawak had established The Government Printing

Office of Sarawak in 1870 and one of its first publications was The Sarawak Gazette. This

publication was intended to promulgate the Rajah’s orders and reports from outstation

officers. The first issue of Sarawak Gazette was on 26th August 1870, with only three pages

leaflet. Later in late 1800’s, this publication had increased in the number of printed pages as

many other issues and news being reported including matters related with administrations,

trade, agriculture, sport, law, commodity prices as well as reports from each division in

Sarawak. The Sarawak Gazette was an essential source of historical information on Sarawak

affairs, but the publication was suspended during the Japanese occupation (1942 until 1946).

Information on crocodiles in Sarawak can be found in the Sarawak Gazette such as crocodile

skin trade, bounty payment for killing crocodiles and cases of crocodile attacks on people.

Thus, this chapter examine the information on crocodiles from the year 1900 until 2017,

gathered from the Sarawak Gazette and other sources. The information is valuable to assess

the historical distribution of crocodile in Sarawak as well as to investigate the possible

expansion of the animal in the major river basins in the state. In addition, analysis of

crocodile attacks in Sarawak could identify trends of human crocodile conflicts (HCC) in

the state which could provide clues for formulating ways to solve the HCC in the future.

Page 66: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

44

Therefore, the objectives of this chapter are;

i. To gather and examine the historical information on crocodile in Sarawak including

the exploitation of the animal and conflicts between human and crocodile from the

year 1900 to 2017.

ii. To analyze data on crocodile attacks incidents in Sarawak from the year 1900 to

2017.

3.2 Materials and Methods

3.2.1 Study area

Sarawak is one of the two Malaysian states located in the north-western part of the Borneo

Island, the third largest island in the world. The state of Sarawak is neighbouring with

another Malaysian state in Borneo, Sabah and the state also bordering to a small nation of

Brunei and an Indonesian province of Kalimantan (Figure 3.1). Sarawak has an area of

124,450 square kilometers (km2), located immediately north of the equator between latitude

0º0’ and 5ºN and longitude 109º 36’ and 115º 40’. The coastal line of Sarawak stretches over

700 km along the north-eastern coast of the island of Borneo and the inland is generally over

300 m above sea levels with certain areas exceeding 1,200 m, particularly the mountainous

area in central region of the Borneo that form border between Sarawak and Kalimantan.

Sarawak has a tropical rainforest climate, with annual rainfall ranging between 3,300 mm

near the coastland and 4,600 mm further inland (Sa’adi et al., 2017). Average temperature

in Sarawak is around 26 ºC, but it can vary according to location. Highland areas like Bario

Page 67: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

45

in north-eastern corner of Sarawak where the place lying at an altitude of about 1,100 m

above sea level, the temperature in that place is a bit lower. The state experiences two

monsoonal seasons (Northeast and Southwest monsoons) and two shorter periods of inter-

monsoon seasons. The Northeast monsoon (NEM) is more prominent because of the sudden

surge in the rainfall amounts, which typically occurs from months of November until March.

Meanwhile, the Southwest monsoon (SWM) extends from April to September is on the

contrary associated with relatively dry period and less rainy days during the active monsoon

months. The inter-monsoon periods occur during the transition between the two monsoon

seasons and it usually happen in April and October respectively (Sa’adi et al., 2017). Despite

the monsoon seasons, the climate in Sarawak remains fairly stable with rain occurrence

throughout the year.

As the largest state in Malaysia, Sarawak has a vast area of waterways, comprising of 22

major river basins that originating from highland in the centre of Borneo and flow across the

state into South China Sea (Figure 3.1). Out of all river basins in Sarawak, two river basins

have a distance more than 500 km in length including Rajang River which is the longest

river in Malaysia (Table 3.1). Another important river basin in Sarawak are Samarahan,

Sarawak River, Sadong, Lupar, Saribas, Baram and Limbang. There are also large number

of tributaries, mangrove and peat swamp areas that are linked to the major river basins

throughout Sarawak such as Kuching wetland in Sarawak RB and Belawai mangroves delta

in Rajang RB.

Page 68: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

46

Table 3.1: List of river basins in Sarawak, its main river and approximate length (Tisen &

Ahmad, 2010).

No Basin Main River Length, km

1 Kayan Batang Kayan 125

2 Sarawak Sungai Sarawak 120

3 Samarahan Batang Samarahan 115

4 Sadong Batang Sadong 150

5 Lupar Batang Lupar 275

6 Saribas Batang Saribas 160

7 Krian Sungai Krian 120

8 Rajang Batang Rajang 760

9 Oya Batang Oya 240

10 Mukah Batang Mukah 205

11 Balingian Batang Balingian 160

12 Tatau Batang Tatau 270

13 Kemena Batang Kemena 190

14 Similajau Sungai Similajau 65

15 Suai Batang Suai 130

16 Niah Sungai Niah 105

17 Sibuti Sungai Sibuti 80

18 Baram Batang Baram 635

19 Limbang Sungai Limbang 275

20 Trusan Batang Trusan 205

21 Lawas Batang Lawas 75

22 Miri Sungai Miri 56

*“Batang”, refer as a large river by local people in Sarawak.

Page 69: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

47

Figure 3.1: Map of river basins in Sarawak (Map modified from Official Website of Department of Irrigation and Drainage Sarawak,

2017).

Kalimantan

(Indonesia)

Sabah

Brunei

Sarawak

Page 70: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

48

3.2.2 Information gathering and analyses

The Sarawak Gazette was published on monthly basis except from 1908-1920 whereas it

was published twice monthly. It contained source materials on economic history, coastal

trade returns, commodity prices, agricultural information, mineral and oil production

statistics, anthropology and archaeology. The publications of Sarawak Gazette were

suspended during the war time (Japanese occupation) in 1942. The Sarawak Gazette resumed

its publication after the end Japanese occupation in 1946 and the publication still continue

until now. However, since the transition of administration from the Brooke Government to

Crown Colony and later, forming Malaysia with Malaya and Sabah in 1964, the Sarawak

Gazette had changed and now it covers various topics and events that occurred in Sarawak

including government and administration, district annual reports, travelling reports,

confrontation and the emergency period, development, peoples and culture, history, towns,

education, agriculture, medical and health, natural history and wildlife, environment and

forestry, tourism, sports, music, law, aspects of religious life and perspectives from the

young. Due to strong competition with other media, today the role of The Sarawak Gazette

as mass media had become less important.

In this study, a total of 613 volumes of the Sarawak Gazette publications from 1900 to 1941

were examined in the Sarawak Museum archive. Certain volumes, from 1907 to 1941 (not

all available), can also be accessed online through e-Sarawak Gazette website

(http://www.pustaka-sarawak.com/gazette/home.php). However, the Sarawak Gazette

volumes for the years 1923, 1930 and 1940 were absent (not available in the Sarawak

Page 71: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

49

Museum archive). All the volumes were read thoroughly and information regarding

crocodiles in Sarawak were collected and recorded.

Besides the Sarawak Gazette, the information on crocodile in Sarawak especially crocodile

attacks incidents were accessed from other sources such as records kept by local agencies,

publications like books and journals, media (newspapers, online news and social media

platform) and through an online database known as CrocBITE (http://www.crocodile-

attack.info). The CrocBITE is an online database of recording attacks by crocodilians on

humans worldwide, developed by researchers from Charles Darwin University. The main

goal of the database is to improve understanding on the crocodile attacks trend for safety of

humans as wells as to assist conservation of crocodilians by providing data for research

purpose. New cases of crocodile attacks are being added to the database by contributors,

mostly officials or researchers from the countries or regions where the attacks occurred.

Information related to crocodile in Sarawak from 1900 until 2017 was divided into four

periods of time as in Table 3.2.

Page 72: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

50

Table 3.2: Periods of time and sources of information on crocodile in Sarawak from 1900

until 2017.

Years Period Sources

1900 – 1941 White Rajahs era • Sarawak Gazette

• Books, journals, e.g.:

i) Two years in the jungle. The experiences of

a hunter and naturalist in India, Ceylon, the

Malay Peninsula and Borneo by Hornaday

(1885)

ii) My Life in Sarawak, by The Ranee of

Sarawak by Brooke (1913)

iii) A History of Sarawak under its Two White

Rajahs, 1839-1908 by Baring-Gould and

Bampfylde (1909)

1946 – 1979 Post-war period • Sarawak Gazette

• Books, journals, e.g.:

i) A preliminary survey of the crocodile

resources in Sarawak, East Malaysia by

Cox and Gombek (1985)

ii) Man-eating Crocodiles of Borneo by

Ritchie and Jong (2002)

1980 – 1999 Period when wild

crocodile

populations depleted

and the law was

introduced to protect

them from hunting

• Reports from crocodile management agencies

(e.g., SFC, FDS)

• CrocBITE database

• Books, journals e.g.:

i) A preliminary survey of the crocodile

resources in Sarawak, East Malaysia by

Cox and Gombek (1985)

ii) Man-eating Crocodiles of Borneo by

Ritchie and Jong (2002)

2000 - 2017 Millennia era • Reports from crocodile management agencies

(e.g., SFC, FDS)

• CrocBITE database

• Online and mass media (newspaper, online

news portal etc.)

Page 73: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

51

All incidents of crocodile attacks reported in Sarawak from 1900 until 2017 were compiled

into database created in Microsoft Excel. The details of the victims were collected when

available including their sex, age, activity of victim during the incident, time of attack, and

outcome from the attack incidents (fatal or non-fatal). Geographic information such as

location and river basin where the incident happened as well as the month when the attack

occurred were determined from the sources. Information on the tide of the river when the

incident occurred were collected from the sources, but if the information was absent the tide

was estimated from the Sarawak tide tables (2000 to 2017) based on the time and locations

of the attacks. For attacks that occurred at night from year 2000 to 2017, information about

moon phase on the date of the incidents were also collected from website

(https://www.timeanddate.com/moon/malaysia/kuching) and the Sarawak tide table. The

moon phase was defined as four moon phases of seven-day period blocks. For instance, a

`new moon' phase was defined as the period from three days prior to new moon to three days

after new moon. A similar seven-day block was used for full moon, first and third (last)

quarter of moon. All the incidents were considered unprovoked attacks and only attacks

confirm caused by the crocodile were included in this analysis.

Minitab 17 (Minitab Inc., USA) and OriginPro 9.0 (OriginLab Corporation, USA) were used

in this study for statistical analyses and preparation of figures based on the attack data. For

statistical analyses, crocodile attacks were grouped into 10-year periods between 1900 and

2017, except for 2010 – 2017, grouped as one period. Then, the average attack per years

(mean attacks) was calculated in each period and plotted in a graph along with standard

deviation. The trend of the crocodile attacks in Sarawak from 1900 until 2017 were examined

by fitting linear regression to the mean attacks (average attacks per year) for each period

Page 74: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

52

(Fukuda et al., 2014). Statistical analysis of T-test and ANOVA were used to compare

variation of attacks in between river basin and months as well as to compare mean attacks

between two monsoon seasons (SWM and NEM). Chi-square tests of independence (χ2)

were applied to see whether moon phase and tidal cycle had influence on frequency of

crocodile attacks in Sarawak using Minitab 17 (Minitab Inc., USA).

3.3 Results and Discussion

3.3.1 White Rajah era (1900-1941)

During the reign of Rajah Brooke in Sarawak, crocodiles were considered as pest by the

government. William Hornaday, an American collector, in his book told stories about the

government waging a war of extermination against crocodiles specifically C. porosus that

infested all the rivers of Sarawak territory and had terrorized people during his visit to

Sarawak (Hornaday, 1885). According to him, in 1878 alone a total of 266 crocodiles had

been caught from Samarahan River and Sarawak River (Hornaday, 1885). The Ranee of

Sarawak, Margaret Brooke also mentioned in her book about the numerous loss of life

caused by crocodile and she herself experienced the terror of the creature as a man was

attacked in front of her eyes (Brooke, 1913).

To encourage people in Sarawak to catch crocodiles, the government offered rewards for

every crocodile that had been captured (Baring-Gould & Bampfylde, 1909). In order to claim

the reward, each crocodile that had been captured or killed must be brought to the

government or they must provide the crocodile’s skin (from back of its head to the end of its

Page 75: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

53

tail) as proofs. The government will measure the crocodile or the skin and for each foot

(approx. 30 cm), they will pay 36 cents. In addition, the government also paid money to

people that brought crocodile eggs to them. Extra rewards were given for those who had

successfully captured crocodiles that were responsible for attacking people.

Table 3.3 shows the number of crocodiles and eggs that have been brought to the government

and amount of money paid for bounty from 1901 to 1907. There is no specific detail on

species of crocodile in the reports, however it is believed that the crocodiles were C. porosus.

It was estimated that at least 1,244 crocodiles and 187 eggs were brought to the government

from 1900 to 1907. There is an increase trend in terms of number of crocodiles captured at

that period of time, except from 1903 until 1905, where the number dropped from 181

crocodiles and 36 eggs to 121 crocodiles and 29 eggs. The data also shows contrast trends

between the number of crocodiles captured with the cumulative measurement of the

crocodile, as well as the amount of reward money in certain years. As an example, in 1901,

a total of 124 crocodiles were presented to the government with cumulative measurement of

721’4” and total bounty of S$ 259.68, while in 1902, higher number of crocodiles were

brought in, 133 crocodiles, but with less cumulative measurement (664’14”) and total bounty

(S$ 239.46). This data suggest that a higher number of large crocodiles were caught in 1901

compared to in 1902. This document evidently shows a relatively large number of crocodiles

was taken out from the rivers during that time. The amount of money spent by the Brooke

government to pay local hunter for catching crocodile in Sarawak from 1901 to 1907 were

estimated to be around MYR 268,245.05 to MYR 610,935.36 in current day currency.

Page 76: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

54

Table 3.3: Number and measurement of crocodiles and eggs brought to the government

and amount of bounty paid (extracted from half year report in Sarawak Gazette, 1901-

1907).

Year Number of

crocodiles /

eggs collected

Cumulative

measurement,

inches

Amount of

money

paid, S$*a

Value in current

day (estimation),

MYR*b

January-June 1901 70 crocodiles 358’3” S$128.97 MYR167,652.15

July-December 1901 54 crocodiles 363’1” S$130.71 MYR171,634.20

Total 1901 124 crocodiles 721’4” S$259.68 MYR341,006.81

January-June 1902 61 crocodiles 327’6” S$117.90 MYR154,817.86

July-December 1902 72 crocodiles 337’8” S$121.56 MYR159,611.19

Total 1902 133 crocodiles 664’14” S$239.46 MYR314,471.50

January-June 1903 101 crocodiles 472’11” S$170.25 MYR221,172.54

July-December 1903 98 crocodiles,

23 eggs

514’2” S$185.79 MYR241,389.34

Total 1903 199 crocodiles,

23 eggs 986’13” S$356.04 MYR462,589.95

January-June 1904 123 crocodiles 564’10” S$203.34 MYR264,207.44

July-December 1904 58 crocodiles,

36 eggs

335’5” S$121.11 MYR157,355.36

Total 1904 181 crocodiles,

36 eggs 899’15” S$324.45 MYR421,552.22

January-June 1905 59 crocodiles 269’0” S$96.84 MYR125,831.74

July-December 1905 62 crocodiles,

29 eggs

302’1” S$109.62 MYR142,432.62

Total 1905 121 crocodiles,

29 eggs

571’1” S$206.46 MYR268,245.05

January-June 1906 70 crocodiles 322’9” S$116.19 MYR150,968.56

July-December 1906 143 crocodiles 394’4” S$141.96 MYR184,457.00

Total 1906 213 crocodiles 716’13” S$258.75 MYR336,204.24

January-June 1907 162 crocodiles,

50 eggs

707’6” S$256.20 MYR329,333.81

July-December 1907 111 crocodiles,

44 eggs

604’11” S$219.09 MYR281,636.99

Total 1907 273 crocodiles,

99 eggs

1311’17” S$475.29 MYR610,935.36

TOTAL 1901-1907 1,244

crocodiles,

187 eggs

5,868’77” S$2,120.13 MYR2,755,005.13

*a S$, Sarawak dollar, the currency used in Sarawak at the period of time.

*b Estimations for value of bounty paid in current day were calculated using United Kingdom (UK)

Inflation Calculator website (https://www.officialdata.org/1900-GBP-in-2017?amount=1) based

on formula by UK Office for National Statistics (2019). Currency exchange for Sarawak Dollar

(S$) and British Pound (£) at the period of time (1901-1907) were based on information by

Kemmerer (1904). Currency converter website (https://www.xe.com/currencyconverter) was

used for converting the current value from British Pound (£) to Malaysian Ringgit (MYR).

Page 77: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

55

Rewards for catching crocodiles had attracted many people in Sarawak to involve in hunting

the reptile, which led to the bloom of professional crocodile catchers. Crocodile catchers in

Sarawak were known as Pengalir or crocodile charmer, as most of them use some sort of

chanting alongside with tools such as hook or trap to captured crocodile (Cox & Gombek,

1985). Some of the professional crocodile catchers were very good in their work and they

could capture up to 60 crocodiles in a month (Sarawak Gazette, July 1, 1929). Crocodile

hunting activities in the early 1900 were mainly occurred in Samarahan, Lupar, Sadong,

Krian and Bakong rivers. The Brooke government during that time sometimes employed

professional crocodile catchers to hunt crocodiles that had killed the public.

In the early 1900’s to 1930’s, not many people were interested in harvesting crocodile skins

as the skin was not as important or lucrative as today. Thus, crocodiles that had been brought

to the government were destroyed including their skin. Only flesh or meats were sold to

those who were interested to buy such as the Japanese people (Ritchie & Jong, 2002). When

the wars started in Europe and other regions in 1930’s and 1940’s, the demand for crocodile

skin increased. The huge number of crocodiles living in the river of Sarawak had attracted

foreign companies involvement in harvesting crocodiles activities from rivers. For instance,

in a report from Sarawak Gazette (June 1, 1933), an agent from Eastern Tanneries requested

permission from Brooke government to catch crocodiles in rivers between Bintulu to Miri

and Baram. To ensure a plentiful supply for the company, they also employed local people

to catch the crocodiles and willing to pay more money for high quality crocodiles skin that

were brought to them from those rivers. The price for the skin at this time was approximately

40 cents per inch, while for meat and gallbladders the price was around 50 cents per kilogram

Page 78: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

56

(Cox & Gombek, 1985). Crocodile gallbladders were mainly used by people at that time for

medicinal purposes (Cox & Gombek, 1985).

Riverine communities in Sarawak during the era of Rajah Brooke lived in terror of killer

crocodile especially the one that had once having tasted human flesh (Brooke, 1913). From

1900 to 1941, a total number of 232 cases of crocodile attacks were reported in the Sarawak

Gazette. During this period of time, on average 5 cases of crocodile attack occurred every

year. Almost three quarter (73.7%) of the cases claimed the life of the victims while 26.3%

survived from the attack. In some of the cases, victims who survived after the attacks were

severely wounded and without immediate proper treatment, the victims later ended up dead

due to the injuries. During that period of time, hospitals or medical facilities were only

available in towns. In rural areas, people who needed immediate medical attention like

victims of crocodile attacks, has to travel to the towns and it usually took a long time to reach

the facilities.

The limitations of any data set must be considered and, as noted earlier, reports of crocodile

attack on human in Sarawak during the colonial era of Rajah Brooke (1900-1941) had likely

been influenced by the reports of the assigned district officers. Brooke government assigned

outstation officers into every district in Sarawak territory and among their tasks were to

monitor and report things that happened in their areas. Cases of crocodile attack could be

higher than this, as there is a possibility that some cases had not been reported in the Sarawak

Gazette.

Page 79: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

57

The highest number of crocodile attack cases had been recorded from 1900 to 1909 with 68

cases (Figure 3.2). The number of crocodile attacks in Sarawak showed decreasing trend in

the following years, recorded 65 cases from 1910 to 1919 and 53 cases from 1920 to 1929.

The lowest number of crocodile attack was recorded from 1930 to 1941, with only 46 cases.

In general, less frequency of crocodile attack typically associated with the fewer number of

crocodiles in the river (Fukuda et al., 2011). Thus, it is very likely that the introduction of

reward system had caused relatively large number of crocodiles being taken out of the rivers,

and this could be the reason of the decreasing trend in crocodile attacks in Sarawak.

1900 - 1909 1910 - 1919 1920 - 1929 1930 - 1941

0

10

20

30

40

50

60

70

80

90

100

Num

ber

of

case

Year

Total case

Non-fatal

Fatal

Figure 3.2: Number of crocodile attacks divided into 10-year periods during the Rajah

Brooke era, 1900-1941.

Page 80: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

58

The analysis of attacks reveals that more male victims (67.7%) were involved in the

crocodile attacks in Sarawak during the period of time compared to female (25.9%) (Figure

3.3a) and attacks occurred more common during daylight (55.2%) compared to night (7.3%)

(Figure 3.3b);

Figure 3.3: (a) Percentage of attacks according to victim’s gender, (b) Percentage of

attacks according to the time when the incident occurred. *Unknown = no information

available.

From 1900 to 1941, crocodile attacks occurred in 20 out of 22 major river basins in Sarawak

(Figure 3.4). The highest number of crocodile attacks were reported in the Rajang RB with

35 cases (15.1%). The second and third highest number of crocodile attacks were recorded

in Lupar RB and Baram RB with 28 cases (12.1%) and 25 cases (10.8%), respectively. The

lowest number of crocodile attack was in Similajau RB and Niah RB, where both of the river

basins recorded only one case (0.4%). There was no report of crocodile attack from Suai RB

and Sibuti RB in Sarawak Gazette from 1900 to 1941 (Figure 3.4). The Rajang RB has the

highest reports of crocodile attacks on human from 1900 to 1941 probably due to relatively

Male

67.7%

Female

25.9%

Unknown

6.5%

Day

55.2%

Night

7.3%

Unknown

37.5%

(b)(a)

Page 81: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

59

high number of human settlements that have already been established along the river at that

time. During the Rajah Brooke era, several major towns and villages could be found from

the lower region up to the upper region of the Rajang RB such as Sarikei, Sibu, Kanowit

and Kapit, and the settlements are navigable by steamers (Baring-Gould & Bampfylde,

1909). Furthermore, in early 1900’s, two outstation officers were assigned in Rajang, each

one of them was responsible to report things that happened in lower and upper regions of the

river basin, respectively. Hence, more crocodile attacks were reported from Rajang RB in

the Sarawak Gazette. Interestingly, crocodile attacks in Rajang RB at that period of time

were reported as far as Belaga and Pelagus, which is located more than 200 km distance

from its river mouth (Sarawak Gazette, November 1, 1927).

Raj

ang

Lupar

Bar

am

Kay

an

Limba

ng

Oya

Sadon

g

Kria

n

Saraw

ak

Muk

ah

Kem

ena

Sarib

as

Tatau

Samar

ahan

Bal

ingi

an

Miri

Trusa

n

Lawas

Nia

h

Simila

jau

Suai

Sibut

i 0

2

4

6

8

10

12

14

16

18

20

22

24

26

28

30

32

34

36

38

40

Nu

mb

er o

f ca

se

River Basin

Figure 3.4: Number of crocodile attacks from 1900-1941 according to river basin.

Page 82: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

60

From 1900 to 1941, incidents of crocodile attacks had occurred in monthly basis with the

highest attacks recorded in April (Figure 3.5). There were 27 cases of crocodile attacks in

April, representing 11.6% of the total cases. The second highest was in September with 22

cases (9.5%) and closely followed by May, July and October (21 cases, 9.1%). December

had recorded the least number of attacks with 12 cases (5.2%). Crocodile attacks in Sarawak

during the Rajah Brooke era occurred relatively higher during the dry season (southwest

monsoon, SWM). The SWM in Sarawak occurs approximately from April to September,

recorded 56.5% of crocodile attacks compared to the northeast monsoon (NEM), 43.5%.

Unlike SWM, rains typically occur in most of the days during NEM and the rainy season

could be lasting from October to March (Figure 3.5).

Januar

y

Febru

ary

Mar

ch

Apri

l

May

June

July

Augu

st

Septe

mber

Oct

ober

Nov

ember

Dec

ember

0

2

4

6

8

10

12

14

16

18

20

22

24

26

28

30

Nu

mb

er o

f case

Month

Total cases

Non-fatal

Fatal

Figure 3.5: Number of crocodile attacks from 1900-1941 according to month and season

when the incident occurs.

Southwest monsoon (SWM) Northeast monsoon (NEM)

Northeast monsoon (NEM)

Page 83: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

61

The highest number of victims were taken or attacked by crocodiles while they were bathing

or defecating in the river or landing stage (pangkalan) with 25.9% of the cases (Figure 3.6).

This followed by the victims that were grabbed from their boats by the crocodiles (14.7%)

and victims were taken by crocodile while fishing (6.9%). Approximately 14.2% of the

crocodile attacks happened while the victims were working or playing or fishing at

riverbanks or area near to the rivers. Victims attacked by crocodiles while swimming or

crossing the river (or small stream) recorded 3.4% of the cases. One case (0.4%) of suicide

reported where the victim threw himself into the river and was devoured by crocodile. The

activity of victims for 34.1% of the crocodile attack cases was not stated or explained in the

reports in the Sarawak Gazette from 1900 to 1941.

Page 84: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

62

Figure 3.6: Types of activities of the victims when crocodile attacked (1900-1941).

Bathing /

defecating

25.9%

Swimming /

wadding / crossing

river

3.4%

Washing /

performing

ablutions

3.4%

Fishing

6.9%

Working at

rivebank

6.0%Walking at

rivebank or road

0.4%

Playing at

riverbank / landing

stage

3.0%

Grab from boat

14.7%

Slip into water

0.4%

Boat overturn /

capsize

5.6%

Suicide

0.4%

Unknown

29.7%

Page 85: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

63

3.3.2 Post-war period (1946-1979)

After the World War II (WWII) and Japanese occupation, Sarawak was ceded to the British

government by the last Rajah Brooke and became one of their colonies. A governor was

appointed by the British to administer Sarawak before the state was given independence and

formed Malaysia with Malaya and North Borneo in 1963. Under the new government,

rewards for capturing crocodile were continued. It is believed that the activities of crocodile

hunting during this period of time were more intensive as demand for the crocodile skin

increased globally. Since WWII, demand for crocodile leather shoes, handbags, luggage,

wallets, watchbands, and other expensive luxury articles has far exceeded supply.

The crocodile trade peaked in the mid-1960s, when world markets absorbed more than 2

million crocodile skins each year (National Research Council of United State of America,

1983).

In Sarawak, hunting of crocodile already at its full swing started in 1954 with large harvests

were produced until mid-1960’s. Cox and Gombek (1985) reported that more than 10,000

skins were exported out from Sarawak annually between the years 1957 and 1961. It did not

take a long time for the effect of overhunting showed result. Skins export from Sarawak was

reported plummeted more than 90% within a decade, from 7,245 kg in 1961 to only 692 kg

in 1971 (Cox & Gombek, 1985). Sarawak skin export started to rise again around 1983-1984

primarily due to successful captive breeding by Jong Joon Soon Crocodile Farm. Jong Joon

Soon Crocodile Farm (now known as Jong’s Crocodile Farm) is the first crocodile farm

opened in Sarawak. The farm started their operation in 1963 with the first batch of 6

hatchling crocodiles acquired from the wild. In 1979, the farm move into larger area at

Page 86: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

64

Siburan, about 18 miles from Kuching and they started to breed their crocodiles. After a few

years of successful in the breeding activities, the farm had started to export crocodile skins

out of Sarawak.

There was not much information about crocodile attacks from 1947 until 1979 collected in

the present study due to unavailable records kept by the authority on this matter. After the

Sarawak Gazette resumed it publications in 1946, less coverages of crocodile attack

incidents were reported, probably due to the need of reporting other important affairs of

Sarawak or because crocodile attacks in the state were increasingly rare. The available

attacks data show not less than 31 cases of attacks were known to occur in Sarawak from

1947 until 1979, where 58% of the incidents happened in Lupar RB.

3.3.3 Period when wild crocodile populations depleted and the law was introduced

to protect them from hunting (1980-1999)

When Sarawak was under the rule of the White Rajahs and later being a colony of the British,

crocodiles were considered as vermin to the government as well as to the local people. The

crocodiles had no value and always terrorizing them, thus they wanted the animals to be

destroyed. Rewards offered for capturing the crocodiles and high demand for crocodile skins

had encouraged hunting activities. The importance of retaining the populations of crocodiles

during that time was also not recognised.

Aggressive hunting activities for the skins in Sarawak continued after the Japanese

occupation from 1950’s to 1970’s, resulting in significant depletion of crocodile populations

Page 87: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

65

(Cox & Gombek, 1985). There was also no monitoring of harvesting impact and

management plan for the species or its habitat during that period of time. It is believed that

the number of crocodiles in Sarawak was reduced tremendously and it was not easy to find

the animal in the wild during this period of time. Pak Deris, one of the known crocodile

hunter in Samarahan River revealed that it was very hard to find crocodiles in the river and

last crocodile caught by him was in 1974 (Cox & Gombek, 1985).

The first comprehensive survey of crocodile population in Sarawak was conducted by Cox

and Gombek (1985). Their surveys covered a distance of 1,043 km of main rivers including

selected tributaries in Kuching wetland area, Samarahan, Samunsam, Lupar, Baram, lower

Rajang, Suai and Limbang River. The survey results showed that the average density of

crocodile in Sarawak was at 0.054 individual per km (almost 6 crocodiles for every 100 km).

In Samarahan River, among the river where crocodiles were intensively hunt since the era

of Rajah Brooke, Cox and Gombek (1985) were surprised to find only one hatchling in the

river during their survey (71 km of survey distance). Three rivers surveyed by Cox and

Gombek (1985) recorded zero sighting of crocodile, namely Tisak, upper Lupar and middle

Baram River. They also reported that the crocodile habitats were seriously disturbed and

degraded while waterways were intensively used for fishing and transporting goods and

people. They claimed that the use of cross-netted fishing techniques caused not only

entanglement and drowning but also halt mobility and recruitment of crocodiles in the rivers.

This report led to the recommendations of the Special Select Committee for Flora and Fauna

to accord crocodile as protected animals in Sarawak under the Wild Life Protection

Ordinance in 1990, and also accordance with the listing of the animals in the Appendix I of

Page 88: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

66

CITES. Hence, starting from 1990 onwards, any hunting or selling activities related to wild

crocodiles in the state without permits are prohibited. A fine of MYR 10,000 and one year

jail will be applied to those guilty of breaking the law.

The information on crocodile attacks within the period from 1980 to 1999 were limited, due

to lack of records were collected by the authority on this matter. Incidents of crocodile

attacks were commonly been reported in the local newspapers, but it is difficult to access the

reports as majority of the reports were not been digitised, unlike today’s news where

information are easy to access as the news are both published on paper and online. Ritchie

and Jong (2002) had compiled a number of attack incidents from 1980 to 1999 in their book

and several attack cases were also added into CrocBITE database by contributors. Between

the year 1980 to 1999, not less than 39 cases of crocodile attacks were known to happened

in Sarawak, whereas most of the attacks occurred in Lupar RB (59%).

3.3.4 Millennia era (2000-2017)

After more than three decades the law was introduced (Section 3.3.3), crocodile populations

in Sarawak are on the road of recovery. Local agencies, Forestry Department of Sarawak

(FDS) and Sarawak Forestry Corporation (SFC), started patchy surveys on crocodile

populations back in 1994, covering selected rivers in Sarawak and Lupar RB (Tisen &

Ahmad, 2010). Comprehensive surveys on crocodile populations by the agencies were only

started in the years 2000 - 2001, covering more river basins in the state including Krian,

Sadong, Baram, Miri, Sibuti, Niah and Similaju. The survey results showed that the densities

of crocodiles in Sarawak were in the range of 0.1 to 1.9 individuals/km.

Page 89: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

67

From 2012 to 2014, FDS and SFC conducted intensive surveys on crocodile population

throughout Sarawak in conjunction with the intention of Sarawak government to down list

C. porosus from Appendix I into Appendix II CITES. The surveys covered a distance of

almost 2,200 km of all 22 river basins in the state, including their tributaries and small

streams. The surveys recorded the density of crocodile in the range from 0.05 to 3.37

individuals/km. From the survey, the number of crocodiles live in rivers in Sarawak was

estimated around 13,000 individuals (Sarawak Forestry Corporation, 2018).

With the development of information and communication technologies (ICT),

communications are easier and more effective. Thus, report or information on crocodile

attacks can be received faster and more accurate, compared to more than 20 or 30 years ago.

New cases of crocodile attacks in Sarawak can be reported instantly and the public could be

aware about the incidents in the same day. Every known details of the attack incidents can

be recorded in the database and the information can be used for research purposes.

From 2000 to 2017, a total of 135 cases of crocodile attack on human reported in Sarawak,

with the average of 7.5 cases per year. The number of crocodile attack cases for each year

per annual period showed a marked increase (regression analysis, DF = 1, p = 0.000 [p <

0.05], R2 = 55.5%, F = 19.92) especially between the year 2003 and 2015 (Figure 3.7).

Page 90: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

68

2000 2001 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 2012 2013 2014 2015 2016 2017

00

1

22

3

44

5

66

7

88

9

1010

11

1212

13

1414

15

1616

17

1818

19

2020N

um

ber

of

case

Year

Non-fatal

Fatal

Total

Figure 3.7: Number of crocodile fatal and non-fatal attacks for each year from 2000 until

2017.

The average of crocodile attacks in Sarawak from 2000 to 2017 (7.5 cases/year) is higher

when compared with the nearby countries or regions such as Timor Leste with the average

attacks of 6.4 cases/year in between 2007 until 2014 (Sideleau et al., 2016) and Queensland,

Australia with average 0.8 cases/year (Brien et al., 2017). In addition, the average number

of attacks in Sarawak is also not far less when compare to Sundarban, India where the

average attacks recorded 9.1 cases/year in 2000 until 2013 (Das & Jana, 2018).

C. porosus was identified as the culprit for almost all the attacks reported in Sarawak from

2000 until 2017. The crocodile attacks claimed the life of a slightly more than half (50.4%)

of the victims, while another 49.6% of the victims survived through the attacks. The fatality

Page 91: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

69

rate associated with crocodile attack in Sarawak (50.4%) is considered high compared to

nearby countries or regions. In Queensland, Australia, 34.3% of attacks by crocodile since

1971 have been fatal (Brien et al., 2017), while fatality rate of 48.8% have been reported in

Indonesia from 2000 until 2014 (Ardiantiono et al., 2015). In comparison, relatively high

fatality rate was recorded in Surdarban, India with 62.2% of attacks (Das & Jana, 2018)

and 82.2% for Timor Leste (Sideleau et al., 2016). Meanwhile in other part of the world,

fatality rates of 60% caused by saltwater crocodile and 51% caused by mugger crocodile

have been recorded in South Asia and Iran (Stevenson et al., 2014). In Mozambique,

mortality rates of 79% was observed among people attacked by crocodiles (Dunham et al.,

2010).

The frequency of male became the victims to crocodiles is higher with 84.4% when

compared to female which recorded only 15.6% from total number of crocodile attack cases

(Figure 3.8a). More male victims involved in crocodile attack in Sarawak compared to

female, most likely be attributed to the prevalence of specified gender roles within the

community in Sarawak with the occupation or activities related to water body. Occupation

or activities like fishing, collecting shrimp and crab during low tide and collecting plants or

woods (e.g., rumbia, sago) at the riverbank in Sarawak are mostly dominated by men.

Conversely in Sundarban, India where tiger prawn and crab collections are among the

important activities, there were fewer male victims of crocodile attack than females. This is

because in Sundarban, more women than men are involved in the collection of tiger prawn

and crabs (Das & Jana, 2018).

Page 92: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

70

Figure 3.8: (a) Percentage of victims according to gender; (b) Percentage of crocodile

attack cases according to time when the incident occurred in Sarawak from 2000 - 2017.

Crocodile attacks in Sarawak from 2000 until 2017 (n = 135) happened more in daylight

(58.9%) compared to night (41.1%) (Figure 3.8b). The timing of attacks seems to associate

with human activity pattern. Local people in Sarawak are more likely to use rivers for daily

chores, travel or working during daylight (Hassan & Abdul-Gani, 2013). Further analysis

shows that the highest proportion of the attacks happened in late evening to midnight,

between 1800 to 2359 hours (6.00 – 11.59 pm) with 34.8% (39 cases), closely followed the

time period between 1200 to 1959 hours (12.00 – 5.59 pm) whereas 33.0% (37 cases) of

attacks taking place in that period of time. Almost 25.9% (29 cases) of attacks occurred in

the morning from 0600 to 1159 hours (6.00 – 11.59 am), while crocodile attacks were rarely

occurred between midnight to early morning, 0000 to 0559 hours (12.00 – 5.59 am) with

only 6.3% (7 cases) (Figure 3.8b).

Although most of the activities are done during the day, some people prefer to do activities

like bathing or washing tools in the river at dusk or night. Certain activities such as fishing

Male

84.4%

Female

15.6%

(a)

0600 -

1159

hours

25.9%

1200 -

1759

hours

33.0%

1800 -

2359

hours

34.8%

0000 -

0559

hours

6.3%

(b)

Page 93: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

71

and collecting mangrove crabs could also be carried out during night. At night, human is

more vulnerable to crocodile and risk of attacks are greater compared to the daylight as

crocodile could hardly be seen by human naked eyes in the dark. On the other hand, crocodile

is a nocturnal animal and they actively hunt preys at night (Campbell et al., 2013; Emerling,

2017; Evans et al., 2017), hence contribute to the attack on human. In addition, the crocodile

has advantages in the dark situation as they possess a relatively large lens, a retina and a

tapetum lucidum in its eyes which enhance vision in dim light environments (Grigg & Gans,

1993).

Several studies have found that lunar cycle and the availability of moonlight has an influence

on wildlife activity and conflicts with humans, especially when it involves nocturnal

predators like lion and cheetah or large herbivores like elephant (Packer et al., 2011; Cozzi,

et al., 2012; Gunn et al., 2014; Lamichhane et al., 2018). In the present study, the is no

significant relationship on the frequency of attacks caused by crocodiles with the moon phase

(χ2 = 2.866, df = 3, p = 0.413[p > 0.05]) where more attacks were reported during the first

quarter of the lunar cycle with 34.8% (16 cases) of total attack incidents that were known

occurred at night (n = 46) (Figure 3.9). Attacks that occur during full moon were the second

highest with 26.1% (12 cases), followed by the new moon (21.7%, 10 cases) and the least

crocodile attacks happened in the third quarter of the lunar cycle with 17.4% (8 cases).

Therefore, there is not enough evidence to suggest that lunar cycle had influence on the

frequency of crocodile attack on human in Sarawak. Other nocturnal predators like lion and

cheetah in Africa were found more aggressive leading to more attacks on humans during the

dark nights following the full moon (Packer et al., 2011; Cozzi, et al., 2012). However, these

terrestrial animals have better chance on encountering human compare to crocodile.

Page 94: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

72

Crocodile encounter with human only happen when human go down to the river or doing

activities in the riverbank. It is not known whether the lunar cycle influence the usage of

river by people in Sarawak, but for activities like fishing, some fishermen or anglers like to

fish on the days when sunrise or sunset and moonrise or moonset coincide with new or full

moon phases. It is believed that during that periods, combine with good river condition, the

chance for the fishermen to get a good fishing catch will increase (Sulaiman, 2018).

New moon First quarter Full moon Third quarter

0.0

0.1

0.2

0.3

0.4

0.5

Prop

orti

on

of

att

ack

s

Moon phase

Figure 3.9: Proportion of the crocodile attacks in Sarawak between 2000 and 2017 plotted

over the lunar cycle.

Page 95: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

73

River tidal seems to have no influence on the frequency of crocodile attacks on people in

Sarawak as there is no significant relationship between the two variables (χ2 = 3.204, df =

3, p = 0.361 [p > 0.05]). Majority of attacks occurred when the tide in the river was high

with 43.4% or 49 cases out of total number of crocodile attacks reported in Sarawak from

2000 until 2017 (Figure 3.10). Then, it was followed by low tide where 27.4% (31 cases) of

crocodile attacks occurred in that period. Ebb tide, the period between high and

low tide during which water flows away from the shore and flood tide, the reverse flow,

occurring during rising tides from low to high tide were the third highest and the last with

15.0% (17 cases) and 14.2% (16 cases), respectively.

Although the statistical analysis showed lack of significant influence of river tidal on

frequency of attacks, high proportion of attack occurred during high tide indicating high risk

of crocodile attack during the particular period. River will be flooded with water during high

tide allowing the reptile travel further to area near to human. During the spring tides, the

water level becoming exceptionally high and the phenomenon which also known as “king

tide” when collided with heavy rain in monsoon season could lead to flood in lowland areas

(Sa’adi et al., 2017). During the flood, crocodile could swim closer to people’s houses and

potentially attacks them. There has been reports of crocodile attacks occurred during the

flood including an incident in 2016 where a man was attack by a crocodile while removing

woods under his house during flood. High frequency of attacks during high tide could also

associated with the behaviour of crocodile. A study by Mohd-Azlan et al. (2016) suggested

that crocodiles prefer to stay near riverbanks during high tides or incoming tides, therefore,

increase the possibility of crocodile encounter human. Furthermore, crocodiles are in

advantages when water level is high as the animals could easily approaching victims

Page 96: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

74

unnoticed, especially those who are doing activities in water edge or at riverbank, before the

crocodiles launch a sneak attack on the victims (Caldicott et al., 2005). During low tide,

activities like knee-deep fishing in shallow water and collecting foods or materials in the

riverbanks are common for people in Sarawak, therefore they could face danger of attacks

by crocodiles when doing those activities. The reptile could be lurking near to the victims

waiting to attack or when walking along the riverbank, they could bump into crocodiles

while the animals are resting or possibly guarding their nest.

Low tide Flood tide High tide Ebb tide

0.1

0.2

0.3

0.4

0.5

Pro

port

ion

of

att

ack

s

Tide

Figure 3.10: Proportion of the crocodile attacks in Sarawak between 2000 and 2017

plotted over the tidal cycle.

Adults (31 to 40 years old) were the most common victims to crocodile attacks with 19.3%,

followed by adult from the age of 41 to 50 years old (16.3%). Meanwhile, kids from the age

of less than 10 years old and old people (aged more than 60 years old) were the least common

Page 97: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

75

victims to crocodile attack with 5.2% of total number of cases (Figure 3.11). Higher

proportions of attacks in Sarawak involving adult (age between 31 to 40 years old and age

between 41 to 50 years old) are likely be attributed to the occupation or activities. Adult

person especially in the riverine communities typically takes the responsibility to find

income and foods for their families (Department of Statistics Malaysia, 2017), mostly with

river-related activities for example fishing using active and passive techniques. All seven

cases (100%, Figure 3.11) of crocodile attacks involving children below 10 years old were

resulting death to the victim, showing how much vulnerable this age group when they were

attacked by the crocodiles. Children usually unaware about the danger they face when come

near to the water body. Furthermore, children when were attack by crocodiles, they were

powerless to escape, even the attack came from a small crocodile (Fukuda et al., 2015).

0 - 10 11 - 20 21 - 30 31 - 40 41 - 50 51 - 60 > 60 Unknown

0

2

4

6

8

10

12

14

16

18

20

22

24

26

28

30

Non-fatal

Fatal

Nu

mb

er o

f ca

se

Age (years old)

Figure 3.11: Number of fatal and non-fatal attacks from 2000 to 2017 according to age of

victims.

Page 98: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

76

From 2000 until 2017, crocodile attacks occurred in 18 out of 22 major river basins in

Sarawak. The highest crocodile attacks were recorded in the Lupar RB with 28 cases (20.7%)

from the total number of cases, followed by the Saribas RB and Samarahan RB with 18 cases

(13.3%) and 15 cases (11.1%), respectively. The Kayan, Tatau, Limbang and Lawas RBs

recorded the lowest cases of crocodile attack with only one case (0.7%) for each river basin.

No attack was recorded in Mukah, Balingian, Trusan and Miri RBs (Figure 3.12).

Lup

ar

Sarib

as

Sam

arah

an

Sara

wak

Sado

ng

Bar

amKria

n

Rajan

gNiah

Sibu

tiSu

ai

Sim

ilajau

Kem

ena

Oya

Law

as

Lim

bang

Kay

an

Tatau

Miri

Muk

ah

Tru

san

Balin

gian

02468

10121416182022242628303234363840

Nu

mb

er o

f ca

se

River Basin

Figure 3.12: Number of crocodile attacks from 2000-2017 according to river basin.

Page 99: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

77

The peak month for a crocodile attack in Sarawak from 2000 to 2017 was in March with 23

of attacks (17%). The number of attacks in May was the second highest with 16 cases

(11.9%), followed by July (12 cases, 8.9%). October recorded the lowest number of attacks

with only 6 cases or 4.4% (Figure 3.13). Meanwhile in term of monsoon season, the attack

occurred slightly higher during the NEM (October to March), with 52.2% of the total number

of cases, while another 47.8% of crocodile attacks occurred during the SWM (April to

September).

Janu

ary

Feb

ruar

y

Mar

ch

Apr

il

May

June

July

Aug

ust

Sept

embe

r

Oct

ober

Nov

embe

r

Dec

embe

r

0

2

4

6

8

10

12

14

16

18

20

22

24

26

28

30

Nu

mb

er o

f ca

se

Month

Total cases

Non-fatal

Fatal

Figure 3.13: Number of crocodile attacks from 2000-2017 according to month and season

when the incident occurred.

Southwest monsoon (SWM) Northeast monsoon (NEM)

Northeast monsoon (NEM)

Page 100: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

78

The most common case of crocodile attacks in Sarawak from 2000 until 2017 occurred while

the victims were fishing with 25.2% from the total attacks, followed by bathing or defecating

(24.4%) and working at the riverbank (9.6%) (Figure 3.14). Besides that, crocodile attacks

were also occurred while the victims were washing or performing ablutions (wuduk) (8.1%),

grab from boat (6.7%), swimming or wadding in the river (5.2%) and playing at the riverbank

or near the river (1.5%). Meanwhile, victim slipped into water from the boat, their boat

overturned or collides and attack while walking at the riverbank recorded the least incidents,

with only one case or 0.7%. Incomplete information about the activities of the victim when

the crocodile attack comprised 17.0% of the cases occurred from 2000 to 2017.

The data also clearly shows that activities in water like fishing, swimming, bathing and

washing possess the highest risk of crocodile attacks (combine 63%, Figure 3.14) compare

to the ones on the land. Fishermen frequently use cast net (jala) as the methods of fishing

and they are commonly thrown the cast net in waist or knee-deep water during the low tide,

exposing themselves to the crocodile attack. Meanwhile, activities like swimming, bathing

or washing where the persons will be in the water completely or at the water’s edge, they are

vulnerable to an attack by crocodile as the reptiles are capable to swim or submerge

underwater and sneak near the victim undetected before they launch an attack (Caldicott et

al., 2005). In a number of reports, victims were having no idea of the presence of a crocodile

near them before the attack.

Attacks on people in boats are of particular interest. Although the number is less compared

to fishing and bathing, the incidents concerned the public as it could indicate that travelling

using boat is unsafe. People are worried about the crocodiles that responsible for attacking

Page 101: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

79

people in boat will repeat the behaviour and strike again (Ritchie & Jong, 2002). Typically,

large and aggressive crocodiles are the one who responsible for attacking people on boat as

they are capable to overturn boat or leap out of water and grab victims from boat (Caldicott

et al., 2005).

Figure 3.14: Types of activities of the victims at the moment of crocodile attacked (2000-

2017).

Bathing /

defecating

24.4%

Swimming /

wadding

5.2%

Washing /

performing

ablutions

8.1%

Waist / knee-deep

fishing

25.2%

Working at

rivebank

9.6%

Walking at

rivebank or road

0.7%

Playing at

riverbank / landing

stage

1.5%

Grab from boat

6.7%

Slip into water

0.7%

Boat overturn /

collide

0.7%

unknown

17.0%

Page 102: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

80

3.3.5 One hundred and eighteen (118) years comparison of human-crocodile conflicts

Between 1900 and 2017, there were at least 437 cases of crocodile attacks on humans

occurred throughout Sarawak. The average cases per year from 1900 until 2017 were

represented in Figure 3.15;

1900

- 19

09

1910

- 19

19

1920

- 19

29

1930

- 19

39

1940

- 19

49

1950

- 19

59

1960

- 19

69

1970

- 19

79

1980

- 19

89

1990

- 19

99

2000

- 20

09

2010

- 20

17

-2

0

2

4

6

8

10

12

14

16

Average a

ttack

s p

er y

ear

Year

Figure 3.15: Average number of crocodile attacks per year divided into 10-year periods

between 1900 and 2017 in Sarawak.

*Japanese occupy Sarawak from 1942 until 1946

DF = 1 F = 118.53 R2 = -95.2% P = 0.00

DF = 1 F = 13.59 R2 = 81.9% P = 0.03

Page 103: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

81

The average number of crocodile attacks showed a decreasing trend starting from year 1900-

1909 until 1970-1979 (regression analysis, DF = 1, p = 0.000 [p < 0.05], R2 = - 95.2%, F =

118.53) before bounce back from 1970-1979 until 2000-2017 (regression analysis, DF = 1,

p = 0.035 [p < 0.05], R2 = 81.9%, F = 13.59) (Figure 3.15). The trend seems related to the

trend of crocodile exploitation in Sarawak. The period between 1950-1959 and 1970-1979

where the lowest average number of crocodile attack per year recorded, were the time when

crocodile hunting activities in Sarawak at its peak. Over hunting of crocodiles during that

period had reduced the number of the animal in the wild. Hence, less chance for people to

encounter crocodiles which led to less number of crocodile attacks. However, starting from

1980-1989, number of reported crocodile attacks on people in the state have increased

significantly, which led to the assumption that the population of crocodile in the wild are

recovering. The law that protect crocodile from hunting introduced in early 1990’s helped

the recovery of the animal and several rivers in Sarawak had recorded noted increase in

crocodile density (Sarawak Forestry Corporation, 2018). Recovery of crocodile population

in Sarawak along with other contributing factors such as increasing in human population in

the state could be related to the increasing number of crocodile attacks. In 2010-2017, the

average number of crocodile attacks was 11 cases / year, more than twice the average of

crocodile attacks in 2000-2009 (4.7 cases / year).

The proportion of fatal attacks in Sarawak were reduced from 73.7% in 1900 – 1941 to

50.4% in 2000 – 2017, indicating the improving survival rates of the victims. According to

Caldicott et al. (2005), massive blood loss due to injury and drowning are among the cause

of death in a large number of crocodilian attacks, indicating the importance of immediate

medical treatments. Immediate medical treatments are vital for crocodile attack victims as

Page 104: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

82

the wound inflicted by the crocodile could be infected by bacteria or the victims might lose

too much blood (Caldicott et al., 2005), hence it is essential to have nearby medical facilities.

The higher rate of fatality in the 1900 – 1941 period (73.7%) compare to 2000 – 2017 period

(50.4%) reflected the lack of medical facilities and transportation at that time. During the

time of White Rajah administration (1900-1941), medical facilities were only available in

major towns such as Kuching and Sibu, thus, for people from rural areas who need for

medical attentions, they have to travel to the towns which at that time took days before

reaching hospitals (Baring-Gould & Bampfylde, 1909). Nowadays, with the availability of

medical facilities like clinics and hospitals in almost every district in Sarawak (Department

of Statistics Malaysia, 2017), crocodile attack victims were able to receive treatments faster.

Thus, this could contribute to the lower percentage of fatality among the crocodile attack

victims.

For 118 years, crocodile attacks had occurred in all 22 river basins in Sarawak, suggesting

that the crocodiles are dispersed in all river basins in the state (Figure 3.16). There is a

significant difference (p = 0.002 [p < 0.05]) between river basins in term of number of

crocodile attacks in Sarawak from 1900 until 2017, where the highest number of attacks was

recorded in Lupar RB. Batang Lupar, famously known with the story of a huge crocodile

known as Bujang Senang who is said to be responsible for a number of attacks on humans,

recorded 97 cases or 22.2% of total crocodile attacks in Sarawak. The second highest number

of crocodile attacks occurred in Rajang RB with 45 cases (10.3%), followed by Baram RB

with 38 cases (8.7%). The lowest cases of crocodile attack reported in Suai RB and Similajau

RB with only 3 cases (0.7%). Statistical analysis also showed significant correlation between

number of attacks with the length of the river (Pearson correlation = 0.454, p = 0.034 [p <

Page 105: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

83

0.05]), indicating that a large area of waterways contributes to the high number of crocodile

attacks. Large river basin that have long stretch of waterways such as Rajang RB (river

length, 760 km), Baram RB (635 km) and Lupar RB (275 km) are among the river basins

that recorded high number of crocodile attacks in Sarawak.

Two rivers, Rajang RB and Lupar RB, are the two ‘hotspot’ river basins for human-crocodile

conflicts in Sarawak since 1900. During the era of the White Rajah (1900 – 1941), the highest

crocodile attacks was recorded in the Rajang RB (15.1%), while the Lupar RB (12.1%) was

the second highest (Figure 3.4). However, the Lupar RB (20.7%) had overtaken the Rajang

RB (3.7%) as the river basin that had the highest number of attacks from the year 2000 until

2017 (Figure 3.12). Moreover, the attack data in 118 years (1900 – 2017) showed that the

total number of crocodile attacks in Lupar RB (97 cases) were more than double the number

of attacks in Rajang RB (45 cases). The high variation between the number of crocodile

attacks in Lupar RB with the rest of the river basins in Sarawak is particularly interesting,

hence further studies need to be carried out in the Lupar RB in future to investigate factors

that influence high frequency of attacks.

Page 106: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

84

Lupar

Raj

ang

Bar

am

Saraw

ak

Sarib

as

Sadon

g

Samar

ahan

Kria

n

Kay

an

Limba

ng

Oya

Kem

ena

Muk

ah

Tatau

Miri

Bal

ingi

an

Nia

h

Trusa

n

Lawas

Sibut

i

Suai

Simila

jau

0

10

20

30

40

50

60

70

80

90

100N

um

ber

of

case

River Basin

Figure 3.16: Number of crocodile attacks from 1900 until 2017 according to river basin.

The crocodile attacks cases from 1947 - 1979 and 1980-1999 did not have complete details

of the months and activities of victims. Thus, comparison only can be made between the

White Rajahs era (1900-1941) and Millennium era (2000-2017). In the 1900-1941 and 2000-

2017 periods, incidents of crocodile attacks had occurred in every month of the year with no

significant different among the months (p = 0.998 [p > 0.05]). Although the crocodile attacks

had occurred in monthly basis, the peak attacks were happened in April for 1900-1941

(Figure 3.5) and March for 2000 – 2017 (Figure 3.13), which are coincided with the end of

wet season in Sarawak. Similarly, in nearby countries such as Indonesia and Australia, more

crocodile attacks tend to happen at the end of the wet season (Fukuda et al., 2014;

Ardiantiono et al., 2015). The increasing attacks on human during the wet season most likely

associated with the breeding season of crocodiles. The crocodiles tend to be aggressive

Page 107: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

85

during mating and nesting, where the male crocodiles compete for potential mating partner,

while the female ones can be hostile to any animals or humans that try to approach or disturb

their nests (Webb et al., 1977; Campbell et al., 2013).

There is a slightly difference, although not statistically significant (p = 0.219 [p > 0.05]), in

proportion of crocodile attacks during the Southwest and Northeast monsoon seasons

between the 1900-1941 and 2000-2017 periods. From 1900 to 1941, crocodile attacks in

Sarawak occurred relatively higher in Southwest monsoon compared to Northeast monsoon

(SWM, 56.5% : NEM, 43.5%), while from 2000 until 2017, attacks occurred more in

Northeast monsoon compared to Southwest monsoon (SWM, 47.7% : NEM, 52.3%). This

slight change carries the same notion that crocodile attacks could happen anytime regardless

of the season. However, historical change in the months of each season might also explained

the difference in proportion of crocodile attacks during the NEM and SWM. According to a

study by Sa’adi et al. (2017), there is no significant shift or change in between wet and dry

season corresponds to the month of the season occurred in Sarawak. Based on the rainfall

data from 1980 to 2014 (Figure 3.17), high amounts of rainfall were recorded in Sarawak

starting from month of October until March, signalling the NEM. On the contrary, the SWM

which extends from April to September, recorded lower amount of rainfall and associated

with relatively dry period (Figure 3.17).

Page 108: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

86

Janu

ary

Febru

ary

Mar

chA

pril

May

June

July

Aug

ust

Septe

mbe

r

Oct

ober

Nov

embe

r

Dec

embe

r0

50

100

150

200

250

300

350

400

450

500R

ain

fall

(m

m)

Month

Figure 3.17: Average of monthly rainfall in Sarawak for the period 1980 - 2014 (adapted

from Sa’adi et al., 2017).

The changing pattern of crocodile attacks in the two monsoon seasons might be influenced

by the improvement in the quality of life in Sarawak. During SWM, less rain usually

occurred in most of the days in the months leading to the hotter and drier conditions (Sa’adi

et al., 2017). During the White Rajah era, majority of the people in Sarawak depended on

water from the river for daily chores like bathing and washing clothes or tools (Brooke,

1913). Another source of water is from water reservoirs like wells or lakes, but it could dried

out during dry season especially when draught happened for a long period of time, hence the

local people turn into river for water sources. The earliest water supply system in Sarawak

was established in the early 1900’s. However, at that time the water supply to houses only

available in Kuching area and the water was obtained from nearby streams (Mahyan &

Selaman, 2016). After Sarawak join others states to form Malaysia in 1960’s, the water

Page 109: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

87

supply has been expanded into other cities and the water supply connected to more areas in

Sarawak (Mahyan & Selaman, 2016). The local people also used river frequently during

SWM for traveling to other places and going out fishing as the condition is usually good for

these two activities. Dependency on the river increased the frequency of encountering with

crocodiles and it could lead to risk of attack by the animal.

In contrast, rainfalls frequently occurred during the months in NEM and the rainy season is

lasting from October to March. As the rain pour heavily, water levels in the river become

higher and rivers are usually in rough condition as the currents are running fast (Baring-

Gould & Bampfylde, 1909). These conditions are dangerous for those who used small

wooden canoes or perahu, which is comonly used by majority of riverine communities in

Sarawak at that time (Brooke, 1913), hence most people avoid using river during this time

of the year.

The data clearly show that activities in the water or at the riverbank are posing a higher risk

of crocodile attacks. Majority of the attacks in both periods (1900-1941 and 2000-2017)

happened while victims were bathing and defecating, washing or fishing in the river (or

water edge) and landing stage (pangkalan) (Figure 3.6 and 3.14). During the period of 1900

to 1941, bathing or washing in the river are common for local people who live near the river

as it is the main source of water for them. From the years 2000 until 2017, people in some

rural areas were still using water from the river for daily chores as their areas may have not

been supplied with clean pipe water yet. Based on data by Department of Statistics Malaysia

(2017), as of 2017, it is estimated that 81% of the area in Sarawak has been supplied with

treated water through pipe line system while the rest of the area are not yet connected with

Page 110: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

88

the system. Meanwhile, lack of proper bathing and toilet facilities provided by some of the

plantations owners to their workers also contributed to the crocodile attacks. In between

2000 to 2017, there are at least 8 cases of plantation workers attacked by crocodile while

bathing, washing cloths and defecating in the waterways near their dormitory were reported

in Sarawak. High percentage of attacks involving fishermen (about 25.2%) is major concern

as this indicate that there is still lack awareness among them about safety precautions and

the danger they facing especially for those who are fishing in the waist or knee deep water.

The majority of crocodile attack incidents in countries like Australia, Indonesia, Timor-

Leste, India and Sri Lanka were also occurred when the victims were in the middle of doing

water-bound activities like bathing, washing and fishing (Fukuda et al., 2014; Amarasinghe

et al., 2015; Ardiantiono et al., 2015; Sideleau et al., 2016; Das & Jana, 2018). According to

Caldicott et al. (2005), humans are most vulnerable to crocodile attack when doing activities

in the water or at water’s edge as this reptile is capable to sneak near to the victims

undetected before attack them.

Attacks on people in boats are of particular interest as the percentage decreases from 19.8%

(1900-1941) to 6.3% (2000-2017). In the White Rajahs era (1900-1941), most of people

travelled in the river using small wooden canoes (sampan or perahu). A large crocodile is

capable of grabbing victim from the sampan, in some case the reptile run rampage crushing

or overturn the sampan before seizing the victim. From 2000 until 2017, most of the people

had already used fibre or metal motorize boats and these types of boats are safer compared

to wooden sampan. However, in certain cases when the victims are careless, a crocodile was

able to leap out of water and grabbed the victim from the boat or using its powerful tails to

Page 111: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

89

knock the victims into the river. There is one bizarre case of a person intentionally jumped

into the river infest with crocodile in the Rajah Brooke era (1900-1941) and get himself

killed by the reptile (Sarawak Gazette, May 2, 1908). This one case is an exceptional,

compared to other case where crocodile aggressively attacked human.

3.4 Conclusion

From 1900 until 2017, number of human-crocodile conflicts in Sarawak were fluctuated and

based on the attacks data, it was noted that the trend of crocodile attacks on human in the

Sarawak was associated with the exploitation trend and recovery of the crocodiles in the

state. From the colonial era of Rajah Brookes (1900 - 1941) until post World War II periods

(1946 - 1979), crocodiles were hunted and heavily exploited resulting the number of the

animals in wild were depleted. In the same period, HCC in Sarawak recorded constant

decrease in number of attacks incidents. Population of crocodiles in Sarawak started to

recover after the law protected the animal was introduced in 1980’s and at the same time

frequency of crocodile attacks on human began to increase. Based on the 118 years record,

crocodile attacks had taken place in all 22 river basins in Sarawak, indicating that crocodiles

are well distributed in all river basins throughout the state since 1900. Further analysis

showed that human-crocodile conflicts pattern in Sarawak is most likely associated with

human activities pattern. The water-bound activities possess a higher risk of crocodile attack

in Sarawak compared to inland activities. Crocodile attacks occurred more during daylight

compare to night as human do most of their daily activities at that period. Meanwhile, most

common victims fall into crocodile mouth were adult men as this group of age are using

river more frequent as source of foods and incomes for their family. Furthermore, crocodile

Page 112: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

90

attacks happened in all months of the year, while monsoon season, moon phase and tidal

cycle had a minor influence on the frequency of attacks. The analysis of crocodile attacks in

Sarawak in this chapter had shed lights on the conflicts between human and crocodile in the

state, and it is hoped that the information could help in improving human safety, especially

for riverine communities.

Page 113: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

91

CHAPTER 4

DISTRIBUTION AND ECOLOGY OF SALTWATER CROCODILE, Crocodylus

porosus IN RAJANG RIVER BASIN, CENTRAL SARAWAK

4.1 Introduction

Crocodylus porosus can live in various type of habitats (Webb et al., 2010). This species,

commonly known as estuarine or saltwater crocodile due to their existence in marine

ecosystem, typically inhabit tidal rivers and small tributaries in the coastal area where

salinity changes according to seasons and the distance upstream. The C. porosus regularly

moves between rivers around the coast and in few cases they were found occupying offshore

islands (Webb et al., 2010). Interestingly, contrary to its common name ‘saltwater’ crocodile,

the crocodile species also can be found in non-tidal freshwater sections of the rivers and

inland freshwater lakes, swamps and marshes associated with rivers (Letnic et al., 2011).

One of the important major river basin (RB) in Sarawak that supports high number of

crocodiles is the Rajang RB (Sarawak Forestry Corporation, 2018). The main river of Rajang

or Batang Rajang (Batang, refer as a large river by local people in Sarawak) is the longest

river in Sarawak (and also in Malaysia) with approximate length of 760 km. The Rajang RB

originates from the Nieuwenhuis Mountain Range and the upper Kapuas Mountains in the

border of Sarawak-Kalimantan, flowing across major cities and towns such as Kapit, Song,

Kanowit, Sibu, Bintangor and Sarikei before reaching the South China Sea.

Page 114: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

92

C. porosus are abundant in the lower and middle region of Batang Rajang (Robi, 2014) but

this species could also be found in the upper region of Batang Rajang. Reports stated that C.

porosus were sighted as far as Kapit town, which is more than 200 km from Batang Rajang’s

river mouth (Tisen et al., 2013). Local people also claimed that C. porosus can be found in

several non-tidal and less saline tributaries of Batang Rajang in Kanowit and Song Districts.

Despite reports about the presence of C. porosus in the upper part of several major river

basins in Sarawak including Rajang, there is still lack of information regarding their

distribution and ecology in the area. Up to date, research on crocodile focused on coastal

region of Sarawak (Hassan & Abdul-Gani, 2013; Abdul-Gani, 2014; Zaini et al., 2014;

Azreen, 2015; Hassan et al., 2018). Cox and Gombek (1985) had first initiated preliminary

surveys on populations and distributions of C. porosus and T. schlegelii in Sarawak,

involving several major rivers including Batang Rajang. However, their survey only covered

the lower part of Batang Rajang. The local agencies, SFC and FDS has been conducting

surveys on crocodile populations in several major rivers of Sarawak since 1994. However,

due to the vast areas of rivers in Sarawak and the high cost needed to conduct the surveys,

most of the surveys only involved rivers in the western part of Sarawak (Tisen & Ahmad,

2010). Only in 2014, the agencies have started to conduct comprehensive surveys in Batang

Rajang in conjunction with state-wide crocodile population survey programs to provide

important data for CITES appendix down-listing proposal (Robi, 2014).

Sarawak’s extensive crocodile habitats are found in the mangroves estuaries and middle

region of large river system and recent surveys data showed that this area have the highest

crocodile densities (Sarawak Forestry Corporation, 2018). Fukuda et al. (2008) had outlined

Page 115: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

93

several environmental factors that could influence the abundance and distribution of

crocodile in the waterways, among them are temperature, salinity, riverbank vegetations as

well as anthropogenic pressures like riverbank land-use and human activities.

The influence of salinity on the abundance and distribution of crocodile is mainly linked to

the waterbody habitats and riverbank vegetations. Brackish waterbodies such as saline

floodplain and mangroves near to estuaries are the common habitat for C. porosus as these

habitats have high productivities and support diverse fauna of fish, crustaceans, insects,

mammals and birds (Nagelkerken et al., 2008). The C. porosus could adapt to hyperosmotic

environment with the help of functional organ, lingual salt glands (Cramp et al., 2008), and

the species regularly move between marine habitat and freshwater especially when the

season change. For ectothermic animals like crocodiles, their behaviour and physiology are

influence by ambient and water temperature. The optimal temperature for crocodile is around

28 0C to 30 0C (Rodgers et al., 2015) and when the temperature is outside of the optimal

range, crocodiles commonly seek to maintain body temperatures through behaviours such as

basking, shade-seeking, and moving in and out of water (Grigg & Gans, 1993).

Human activities and riverbank land-use could influence the distribution and abundance of

crocodile and these anthropogenic pressures appeared to keep the crocodile population low

in the waterways (Read et al., 2004; Kanwatanakid-Savini et al., 2012; Shaney et al., 2017).

Furthermore, constant encroachment into crocodile habitat and high impact land use could

indirectly affect the ecology of the rivers, hence change the nature of the waterways.

Degradation of rivers due to the expansion of human population and intensive usage of the

river for fishing and transportation are among the contributing factors to the depletion of

Page 116: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

94

wild crocodile population in 1950’s to 1980’s (Cox & Gombek, 1985). In addition, pollution

from industrial and agricultural activities could change the quality of water in the rivers and

affect the abundance of preys for crocodile, hence in a way could influence the distribution

of the crocodiles in certain areas.

Although C. porosus typically occur at very low densities in non-tidal rivers and upstream

reaches the freshwater rivers, their presence has a significant impact on the use of rivers and

riparian areas by the people and livestock. Increasing in frequency of the crocodile sightings

in the upper region of Batang Rajang for the past few years had brought concern to the people

who live near the river. The people also claimed that the crocodiles were spotted in the area

where the animal was not seen before such as in the freshwater section, several kilometers

upstream of non-tidal tributaries in upper Batang Rajang. Majority of riverine communities

in Rajang RB still rely on the river as a mean of transportation, source of food and incomes.

Therefore, the objectives of this chapter are;

1. To assess the density and distribution of C. porosus in eight rivers representing upper,

middle and lower part of Rajang River Basin.

2. To compare the current density of C. porosus in eight selected rivers in Rajang River

Basin with previous survey.

3. To determine the crocodile habitats, selected water quality parameters and the

abundant of potential food sources for crocodile in the eight rivers of Rajang River

Basin.

4. To determine relationship between crocodile density and distributions with habitats,

selected water quality parameters and the abundant of food sources for crocodile.

Page 117: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

95

4.2 Materials and Methods

4.2.1 Study area

The Rajang River Basin (RB) has drainage area of approximately 51,153 km2 and the length

of its main river, Batang Rajang is approximately 760 km. The river basin is located in

northwest of Borneo Island and in the central part of Sarawak, next to the Saribas RB and

Oya RB. The Rajang RB originates from the Nieuwenhuis Mountain Range and the upper

Kapuas Mountains in the border of Sarawak-Kalimantan. The main trunk of the Rajang

River flows a relatively straight path before begins to separate into several tributaries starting

at the approximate position of the town of Sibu. The distributaries are, from the southwest

to northeast, the Rajang, Belawai, Paloh, Lassa, and Igan and these tributaries flow directly

into South China Sea (Figure 4.1). Among the major cities and towns can be found along the

Rajang River are Kapit, Song, Kanowit, Sibu, Bintangor and Sarikei. Some other important

tributaries of Batang Rajang are the Balleh River, Balui River, Katibas River, Ngemah River

and Kanowit River. Large areas of swampy delta can be found in the lower part of Rajang

RB including in Tanjung Manis and Belawai.

The eight rivers and tributaries from upper, middle and lower region of Rajang RB were

selected in this study, namely:

1. Igan River

2. Belawai River

3. Sarikei River

4. Nyelong River

5. Kanowit River

6. Poi River

7. Ngemah River

8. Katibas River

Lower region

Middle region

Upper region

Page 118: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

96

µ0 10 20 30 405

Kilometers

Sibu

Kanowit Sarikei

Song Kapit

Igan

Belawai

Figure 4.1: Map of Rajang River Basin. (A, Kuala Igan; B, Belawai River; C, Sarikei and Nyelong River; D, Kanowit River; E, Poi River; F,

Ngemah River and G, Katibas River)

A

Middle region

B

C D

E F G

Lower region

Upper region

Figure 4.1: Map of Rajang River Basin (A, Igan River; B, Belawai River; C, Sarikei and Nyelong River; D, Kanowit

River; E, Poi River; F, Ngemah River and G, Katibas River).

Rajang River Basin

Page 119: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

97

4.2.2 Crocodile survey

Crocodile surveys in eight rivers of Rajang RB were held in Southwest Monsoon (SWM),

from the month of March to September 2017. The surveys covered the distance ranged from

10.2 km to 18.0 km, totalling 106 km of linear distance of the rivers (Table 4. 1).

Table 4.1: Details of surveys in eight rivers of Rajang River Basin.

River

Date GPS coordinates

Survey linear

distance (km)

Igan 22nd and 23rd

April 2017

*1 2°49'58.83"N, 111°40'47.36"E *2 2° 48'05.39"N, 111°44'43.05"E

10.2

Belawai 25th and 26th

April 2017

*1 2°11'39.87"N, 111°15'55.24"E *2 2° 16'05.88"N, 111°17'03.34"E

10.3

Sarikei 24th and 25th

March 2017

*1 2°8'0.1650"N, 111°30'50.51"E *2 2°2'55.13"N, 111°29'37.70"E

13.8

Nyelong 26th and 27th

March 2017

*1 2°8'4.97"N, 111°31'30.73"E *2 2° 4'5.69"N, 111°35'11.32"E

11.5

Kanowit

30th and 31st

July 2017

*1 2°5'53.16"N, 112°9'28.99"E *2 2°1'7.70"N, 112°4'28.40"E

18.0

Poi

2nd and 3rd

August 2017

*1 2°3'31.79"N, 112°16'50.19"E *2 1°59'20.00"N, 112°15'27.70"E

12.8

Ngemah 21st and 22nd

September 2017

*1 2°1'28.40"N, 112°23'52.57"E *2 1° 57'41.48"N, 112°23'53.65"E

12.4

Katibas 19th and 20th

September 2017

*1 2°0'36.13"N, 112°33'14.10"E *2 1° 54'32.78"N, 112°33'37.92"E

17.0

* GPS reading coordinates for (*1) starting point and (*2) end point of the survey

When planning a crocodile survey, several factors need to be considered before choosing the

date and time for the survey including tides, moon phase and weather. Hence, daily tides

table, information on moon phase periods and weather forecast were assessed carefully. The

survey was conducted in spring tide during full moon (or almost full moon). The spring tides

Page 120: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

98

are preferable to the neap tide because they exposed more of the riverbank for longer periods.

The survey began on a falling tide (one or two hours before the lowest tide) as this will give

the surveyor more time for scanning the bare riverbank. Maximum exposure of bare

riverbanks without vegetation during low tide are important as vegetations like nipa and

mangrove trees could shields crocodiles from surveyor’s view and spotlight (Abdul-Gani,

2014). Furthermore, a good weather condition with clear sky (although sky in some areas

were cloudy) allowed the survey to be carried out smoothly. Heavy rain could disturb the

survey process and the visibility are limited in this condition which could resulting

crocodiles miss spotted by the surveyors (Fukuda et al., 2013a).

Two days of night survey were carried out in each selected river in the Rajang RB. The

survey was started from the starting point in the downstream (the river mouth) and moved

towards the designated end point in the upstream (inland). The survey took about 2 to 4 hours

to complete, thus counter direction survey from the end point to the starting point was not

be able to carry out after the first survey as water level in the river were higher due to

incoming tide. The crocodile counting during high tide periods are typically lower as

juveniles (hatchling and yearling) normally retire amongst flooded nipa and mangroves

while the adult ones might stay in the water or in the higher ground which is more difficult

to spot (Abdul-Gani, 2014). After survey in the first night was carried out, the survey was

repeated in the next night, covered the same river stretch and distance with the first night

survey. Repetitive survey on the consecutive nights could reduce the possibility of double

counting of crocodile (Fukuda et al., 2013a). For wider rivers (>500m width) like Belawai

and Igan, each sides of the bank were surveyed separately, where the survey commenced

Page 121: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

99

from the left side of the bank, then once reached the coordinates of the end points of the

survey, the boat turned back and continued the survey along the right side of the bank.

The night spotting technique adapted from Bayliss (1987) and Fukuda et al. (2013a) was

used in the survey. The technique involved direct counting of the crocodile at night from the

boat using 12 Volt Quartz-Halogen handholds spotlight powered by 12V Fujiya NS60 car

battery. A fibreglass boat (size 5m length x 1.2m width x 0.5m height) with a single 30 horse

power (hp) engine was used during the survey, operated by an experience boatman. The boat

was cruised slowly at 10 to 15 knots throughout the survey distance. Two spotters were

assigned to scan both side of riverbank and middle of the river simultaneously, looking for

eyes shine. The crocodile’s eye usually will reflect distinctive orange or red colour when the

spotlight directed to them. The light beam directed to the glowing eyes often mesmerises

crocodile and discourage the animal from moving off. When eye shine was detected, the

spotters will slowly and quietly direct the boat towards the eye shine, allowing them to

approach the crocodile as close as possible for capturing or at least the observer can

approximate the size (total length, TL) or age cohort of the crocodiles. To minimise conflict

and bias, only one observer was given the task to estimate the size of the crocodile in all

studied rivers.

All crocodiles spotted were categorized according to size class adapted from Bayliss (1987)

and Robi (2014) (Table 4.2). If the observer is unable to accurately estimate the size class,

the sightings will be recorded as “eyes only” (EO). For crocodile that were detected

swimming in the water, estimation of TL only can be made if the whole body (from the head

to end of the tail) is visible. If only the crocodile’s head and anterior neck are visible, the

Page 122: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

100

head length (HL) / total length (TL) ratio of 1:7 were used to estimate the size of the

crocodile, meaning that TL is around 7 times of HL (Fukuda et al., 2013b). Each location

of crocodile spotted during the survey were recorded using Global Positioning System

(Garmin GPSmap 60CSX, 2005).

Table 4.2: Size class for crocodile survey (Bayliss, 1987; Robi, 2014).

Class Approximate size

(total body length, m)

Cohort

Hatchling < 0.5 Hatchling

2 0.5 – 1.0 Yearling

3 1.0 – 1.5 Sub-adult

4 1.5 – 2.0 Sub-adult

5 2.0 – 3.0 Adult

6 > 3.0 Adult

EO Eyes only Eyes only

4.2.3 River characteristics and landscapes

River characteristic surveys were conducted during daylight involving both left and right

sides of the riverbank as in Table 4.1, using stream and habitat assessment data sheets

(Barbour et al., 1996; Iwata et al., 2003; Bolhen, 2017). Five habitat parameters which are

bank vegetation, verge vegetation, in-stream cover, bank erosion and stability and the

presence of riffles, pools and bends were scored from very poor to excellent for each river.

Related form used in the survey is as in Appendix A1. The guide for scoring is shown in

Table 4.3.

Page 123: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

101

Table 4.3: Field guide for river habitat assessment (modified from Barbour et al., 1996;

Iwata et al., 2003; Bolhen, 2017).

Habitat

parameter

Habitat Survey Field Guide

Excellent

(score = 10)

Good

(score = 8)

Fair

(score = 6)

Poor

(score = 4)

Very poor

(score = 2)

A1

(Bank

vegetation)

Mainly

undisturbed

nature

vegetation.

No sign of

site

alteration.

Mainly native

vegetation.

Little

disturbance or

no sign of

recent site

disturbance.

Medium

cover,

mixed

native/

introduced.

Or one side

cleared the

other

undisturbed.

Introduced

ground cover,

little native

under storey

or over storey,

predominantly

introduced

vegetation.

Introduced

ground cover

with lots of

bare ground

occasional

tree. Also

includes site

with concrete-

lined channels.

B1

(Verge

vegetation)

Mainly

undisturbed

nature

vegetation on

both sides

river. Verge

more than 30

m wide.

Well-vegetated

wide verge

corridor.

Mainly

undisturbed

native

vegetation on

both sides of

river; some

introduced or

reduced cover

of native

vegetation.

Wide-

corridor of

mixed

native and

exotic, or

one side

cleared, and

other wide

corridor of

native

vegetation.

Very narrow

corridor of

native or

introduced

vegetation.

Bare cover or

introduced

grass cover

such as pasture

land.

C1

(in-stream

cover)

Abundant

cover.

Frequent

snags, logs or

boulders with

extensive

areas of in-

stream,

aquatic

vegetation

and

overhanging

bank.

A good cover

of snags, logs

or boulders

with

considerable

areas of in-

stream and

overhanging

vegetation.

Some snags

or boulders

present

and/or

occasional

areas of in-

stream or

overhanging

vegetation.

Only slight

cover. The

river is largely

cleared, with

occasional

snags and

very little in-

stream

vegetation.

Generally, no

overhanging

vegetation.

No cover. No

snags, boulders

submerged or

overhanging

vegetation. No

undercut

banks. Site

may have rock

or concrete

lining.

Page 124: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

102

Table 4.3 continued

D1

(Bank

erosion

and

stability)

Stable, no

erosion/

sedimentation

evident. No

undercutting

of banks,

usually

gently bank

slopes, lower

banks

covered with

roots mat

grasses, reed

or shrubs.

Only spot

erosion

occurring.

Little

undercutting

of bank, good

vegetation

cover, usually

gently bank

slopes, no

significant

damage to

bank structure.

Localized

erosion

evident. A

relatively

good

vegetation

cover. No

continuous

damage to

bank

structure or

vegetation.

Significant

active erosion

evident

especially

during high

flows.

Unstable

extensive

areas of bare

banks, little

vegetation

cover.

Extensive or

almost

continuous

erosion. Over

50% of bank

have some

form of

erosion; very

unstable with

little

vegetation

cover.

E1

(Riffles,

pools and

bends)

Wide variety

of habitats.

Riffles and

pools present

of varying

depths. Bends

present.

Good variety

of habitat -

e.g., riffles and

pools or bends

and pools.

Variation in

depth of riffle

and pool.

Some

variety of

habitat- e.g.,

occasional

riffle or

bend. Some

variation in

depth.

Only slight

variety of

habitat. All

riffle or pool

with only

slight in

depth.

Uniform

habitat.

Straight

stream, all

shallow riffle

or pool of

uniform- e.g.,

channelled

stream or

irrigation

channel.

All scores then were sum up and each river was categorized according to the total score. The

stream habitat category is shown in Table 4.4.

Table 4.4: Scores for stream habitat category (modified from Barbour et al., 1996; Iwata et

al., 2003; Bolhen, 2017).

Scores Stream Habitat Category

36 – 40 Excellent – Site in natural or virtually natural condition; excellent

condition.

29 – 35 Good – Some alteration from natural state; good condition.

20 – 28 Fair – Significant alteration from the natural state but still offering

moderate habitat; stable.

12 – 19 Poor – Significant alteration from the natural state, with reduced habitat

value; may have erosion or sedimentation problems.

8 - 11 Very poor – Very degraded, often with severe erosion or sedimentation

problems.

Page 125: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

103

Other characteristics were observed and determined during the field sampling (Montague,

1983; Messel & Vorlicek, 1986) as in Table 4.5.

Table 4.5: Characteristics observed and recorded in each river during field sampling

(Montague, 1983; Messel & Vorlicek, 1986).

Characteristic Details

i. Type of river/

water

The river surveyed was categorized either as main river, tributary

or small stream. Water type of the river was also determined either

it is salt water, brackish water, black water or freshwater.

ii. Distance from

sea

Coordinates for the river/ tributary were recorded using GPS.

These coordinates were used to estimate the distance of the

river/tributary from sea.

iii. Width and depth

of the river

Width and depth of the rivers were measured using Bushnell Elite

1500 range finder and Hondex PS-7 portable depth sounder.

iv. Tidal influence Influence of tide toward the river was determined (tidal or non-

tidal).

v. Riverbank

characteristics

Riverbank characteristics include riparian vegetation and major

forest types (mangroves, peat swamp, limestone, Kerangas, Mixed

dipterocarp forest) along the riverbank of the river were

determined and recorded including dominant plants species.

Canopy covers of the river were also observed (shaded, open, or

partly shaded/open).

vi. Land use Activities which can directly and indirectly give impact upon river

habitats such as human settlements (city, small towns, villages,

longhouses, schools), agricultural areas (estates, farms,

aquaculture plots), industrial (factory, saw mill, logging site) and

developments (bridges, boat/ferry terminal or jetty, waterfronts,

shops) were recorded in each river.

Page 126: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

104

4.2.4 Selected water quality parameters

Salinity, water temperature and pH were measured in situ using portable equipment at all

study sites (rivers and tributaries) in the Rajang RB including the intersection of tributary

from the main river up to the upper stream of the tributary. In each river, five stations were

selected for water quality assessment. The temperature and pH were measured using Hanna

HI 8314 pH meter, and salinity was measured using Atago PAL-06S refractometer. Latitude

and longitude of the site for water sampling were recorded using Global Positioning System

(Garmin GPSmap 60CSX, 2005).

4.2.5 Potential aquatic food resources for crocodiles

The abundance of possible food resources for crocodile in the river was estimated via Catch

per Unit Effort (CPUE) approach (Hassan et al., 2016). Fish captured method used three-

layer gill net (length and drop: 15m x 1.5m; stretch mesh size: 1.2 cm and 7.5 cm;

deployment time: depends on tide) had been carried out accordingly in each studied river.

The gill net was deployed for 2 to 5 hours and the duration of deployment was recorded. The

samplings were repeated three times in all of the 8 studied rivers except for Ngemah and

Katibas River where the samplings were repeated twice. Locations of the gill nets deployed

were recorded using Global Positioning System (Garmin GPSmap 60CSX, 2005). The

coordinates of the location where the gill nets were deployed are as in Appendix A5 (see

page 236).

Page 127: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

105

Fish catch were examined and identified to species level using FishBase database

(http://www.fishbase.org) and other available references (Parenti & Lim, 2005). The value

of CPUE was calculated using formula:

Catch per unit effort, CPUE = Total catch (kg)

Sampling duration (hours)

4.2.6 Data analysis

Analysis of the crocodile density followed Bayliss (1987) and Fukuda et al. (2013). The

mean relative density was calculated using formula;

Mean relative Density = 𝑛

𝑑

Where,

n = total number of crocodiles

d = total linear distance of surveyed waterway

Comparison of crocodile density in Rajang RB was carried out between the data obtained

during this study and data surveys by Robi (2014). Robi (2014) had conducted surveys in

several rivers in Rajang RB covering the same six rivers with the present study, namely Igan,

Sarikei, Nyelong, Poi, Ngemah and Katibas Rivers.

Page 128: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

106

Maps of crocodile distribution in each surveyed river were generated using ArcMap in

ArcGIS 10.2 software (ESRI Inc, USA). Each GPS coordinates of crocodile sighting were

plotted into the maps along with the locations of human settlements (towns, villages and

longhouses), agricultural areas and riverbank land use developments, e.g., bridge,

constructions, ferry terminal, logging camps etc. observed during the survey.

All ecological data collected in this study were recorded in the Microsoft Excel and used in

generating descriptive statistics (mean and standard deviation). One-way ANOVA were

performed using Minitab version 17 (Minitab Inc., USA) to determine if there is any

significant difference of the mean of selected water quality parameters among the rivers and

tributaries in the Rajang RB. If significant different is found, post-hoc based on Tukey’s was

used in the analysis to compare the variation in selected water quality parameters among the

rivers.

The principal component analysis (PCA) was performed using OriginPro version 9

(OriginLab Corporation, USA) to assess the relationship between the density of crocodile

with selected environmental variables, habitat and food abundance. To determined which

combination of variables that could have influence on the density of crocodiles, General

Linear Model (GLM) analysis was performed using Minitab version 17 (Minitab Inc., USA).

The environmental variables were represented by three physicochemical parameters namely

salinity, pH and temperature. In addition, the potential food abundance and habitat for

crocodile used data CPUE and habitat scoring recorded in the surveys were also involved in

PCA and GLM analyses.

Page 129: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

107

4.3 Results

4.3.1 Crocodile density

A total of 100 crocodiles were spotted during the surveys in eight rivers and tributaries of

Rajang RB (Table 4.6). The crocodiles were found (at least one individual) in all surveyed

rivers except for the Kanowit River where no crocodile was spotted during the two night

surveys. The highest number of crocodiles spotted in the survey was in Igan and Sarikei

River both with 14 individuals, respectively.

The highest number of crocodiles belonged to size class ‘Hatchling’ (TL < 0.5m) with 33

individuals, significantly higher (p < 0.05) compared to other size class except for the ‘Eye

Only’ (EO) (p = 1.000) and ‘Class 2’ (p = 0.166) (Table 4.6). The EO was the second highest

with 31 individuals, followed by ‘Class 2’ (0.5m < TL < 1.0m) (n = 16 individuals), ‘Class

3’ (1.0m < TL < 1.5m) (n = 12 individuals) and ‘Class 4’ (1.5m < TL < 2.0m) (n = 4

individuals). The Crocodile in Class 5 with size (TL) from 2 m – 3 m was the lowest number

of individuals sighted in this study with 3 individuals. There is no crocodile found in the

surveys has the size (TL) more than 3 m (Class 6).

The mean relative density of crocodile in the surveyed rivers (except for Kanowit River) was

ranged from 0.06 to 1.32 individuals/km (Table 4.6). Igan River recorded the highest density

of crocodile with 1.32 ± 0.07 individuals/km and significantly different (p < 0.05) with other

rivers except for Belawai River (p = 0.087). While, the lowest density of crocodile recorded

in Katibas River with the value of 0.06 ± 0.00 individuals/km, significantly different (p <

0.05) with other rivers except for Ngemah River (p = 1.000) and Poi River (p = 0.832).

Page 130: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

108

Table 4.6: Relative density of C. porosus in eight tributaries of Rajang River Basin.

River

Survey

day

Number of crocodiles

according to size class*

Total

number of

individuals

Relative

density

(individual

s/km)

Average

density

(individual

s/km)

H 2 3 4 5 6 E

O

Igan 1 3 3 3 1 1 - 3 14 1.37 1.32 ± 0.07

2 4 2 1 1 - - 5 13 1.27

Belawai 1 4 2 1 - 2 - 3 12 1.17 1.07 ± 0.14

2 5 2 1 - - - 2 10 0.97

Sarikei 1 4 3 2 2 - - 3 14 1.01 0.94 ± 0.11

2 5 2 1 - - - 4 12 0.86

Nyelong 1 2 1 1 - - - 4 8 0.69 0.74 ± 0.06

2 4 1 2 - - - 2 9 0.78

Kanowit 1 - - - - - - - 0 0 0

2 - - - - - - - 0 0

Poi 1 1 - - 1 - - - 2 0.16 0.16 ± 0.00

2 1 - - - - - 1 2 0.16

Ngemah 1 - - - - - - 1 1 0.08 0.08 ± 0.00

2 - - - - - - 1 1 0.08

Katibas 1 - - - - - - 1 1 0.06 0.06 ± 0.00

2 - - - - - - 1 1 0.06

Total 33 16 12 5 3 0 31 100

Table 4.7 summarizes data of crocodile density in Rajang RB in 2014 and the density data

recorded in the present study.

Table 4.7: Comparison density of crocodile between survey in 2014 and 2017 (present

study).

River Crocodiles density (Individuals/km)

2014* 2017

Igan 0.53 1.32

Belawai NA 1.07

Sarikei 1.26 0.94

Nyelong 1.19 0.74

Kanowit NA 0

Poi 0 0.16

Ngemah 0.07 0.08

Katibas 0.04 0.06

*Data from survey done by Robi (2014). NA, data is not available.

Page 131: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

109

In general, the rivers in the study area recorded an increase in crocodile density from 2014

to 2017 except for Sarikei and Nyelong Rivers. Comparison between the density of crocodile

in 2014 and 2017 cannot be done in Belawai and Kanowit River as both rivers were not

included in the 2014 surveys. Igan River recorded the highest increase in crocodile density

(149%) among the rivers in the study area, changing from 0.53 individuals/km in 2014 to

1.32 individuals/km in 2017. While, the lowest increase is in Ngemah River with 14%,

changing from 0.07 individuals/km in 2014 to 0.08 individuals/km in 2017 (Table 4.7). The

two rivers surveyed in Sarikei district, Sarikei and Nyelong River, recorded a decline in

crocodile densities with a reduction for about 25% in Sarikei River, from 1.26

individuals/km in 2014 to 0.94 individuals/km in 2017, and 38% in Nyelong River, from

1.19 individuals/km in 2014 to 0.74 individuals/km in 2017.

The survey in 2014 in Poi River covered up to 10.3 km in distance had recorded zero

crocodile in the river. However, the 12.8 km survey in 2017 spotted 2 crocodiles in the river

with the density of 0.16 individuals/km. Meanwhile, surveys in 2014 covered 14.6 km

distance of Ngemah River and 25 km distance of Katibas River had recorded one crocodile

was spotted in both rivers, respectively. Similarly, after three years, the same observation

was recorded, one crocodile was spotted in both of the rivers, respectively. The two rivers

that were not included in 2014 surveys recorded a density of 1.07 individuals/km in Belawai

River, while, in Kanowit River, recent survey showed negative result (no crocodile spotted).

Page 132: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

110

4.3.2 Distribution of crocodile in selected rivers of Rajang River Basin

The distribution of crocodiles spotted during the surveys in eight rivers within the Rajang

RB were shown in maps in Figure 4.2 until Figure 4.8.

Figure 4.2: Map showing the survey area in Igan River. Each circle indicates the location

of crocodile sighted during the survey and different colours in the circle represent different

size class.

Majority of the crocodiles in Igan River were spotted in areas near to the river mouth (Figure

4.2). Two of them were sighted in the area near to a sandy beach at the mouth of the river.

Three crocodiles including a sub-adult were also spotted in the muddy bank adjacent to Igan

village, which is also located at the river mouth. In addition, an adult with a size of

approximately 2-3 m, was sighted swimming in the middle of the river, about less than a

hundred meters from Igan village.

Igan

Igan River Location where the

gill net was

deployed

Page 133: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

111

Figure 4.3: Map showing the survey area in Belawai River. Each circle indicates the

location of crocodile sighted during the survey and different colours in the circle represent

different size class.

In Belawai, crocodiles were found concentrated in various spots, primarily at the area near

to the mouth of smaller tributaries or streams (Figure 4.3). All of the crocodiles were spotted

at the river bank or in shallow water at the river’s edge except for the two adult crocodiles

who were sighted in the middle of the river. Crocodiles were spotted in close proximity to

each other, comprising of at least one mature (sub-adult and adult) and several young

crocodiles (hatchlings and yearlings) or just all young crocodiles.

Belawai

Location where the

gill net was

deployed

Page 134: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

112

Figure 4.4: Map showing the survey area in Sarikei River and Nyelong River. Each circle

indicates the location of crocodile sighted during the survey and different colours in the

circle represent different size class.

In Sarikei River, a crocodile was first sighted approximately three to four kilometers from

the river mouth and no crocodiles were found in the areas near to Sarikei town (Figure 4.4).

More crocodiles were found in less human populated and development areas further

upstream. Several sightings of young crocodiles close to each other were also recorded in

one or two areas during the survey. Meanwhile in Nyelong River, at least three crocodiles

comprising of two sub-adult and a hatchling were spotted in the area near to Nyelong Bridge,

about two kilometers from the river mouth (Figure 4.4). The rest of the crocodiles were

found in further upstream. Four crocodiles were spotted in area near to oil palm plantations.

Sarikei

Nyelong River

Batang Rajang

Sarikei River Location where the

gill net was

deployed

Page 135: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

113

Figure 4.5: Map showing the survey area in Kanowit River. No crocodile sighting was

recorded during the survey.

There was no crocodile sighted in Kanowit River during the survey period (Figure 4.5).

However, this could not mean that the Kanowit River is crocodile-free. After the survey

period, a sub-adult crocodile, size about 1.5m to 2.0 m, were spotted in the Batang Rajang,

about less than one kilometer distance from mouth of Kanowit River (Figure 4.5). According

to local fishermen, they had seen crocodiles in Kanowit River, thus their claims could

provide clues about the presence of crocodiles in the river. Local fishermen use the river in

regular basis, thus they know the river very well and the possibility for them to encounter

with crocodile (if it presents in the river) is high.

Kanowit

Kanowit River Location where the

gill net was

deployed

Page 136: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

114

Figure 4.6: Map showing the survey area in Poi River. Each circle indicates the location of

crocodile sighted during the survey and different colours in the circle represent different

size class.

In contrast to the Kanowit River, two crocodiles were recorded during the surveys in Poi

River. The two crocodiles found were a hatchling and a sub-adult, spotted in less than 5 km

from the mouth of the tributary (Figure 4.6). The local fishermen also claimed that crocodiles

in Poi River are commonly found in the downstream area, not far from the mouth. It was

also noted that the hatchling spotted in the survey was in the area near to a school and a

longhouse in Poi River (Figure 4.6).

Batang Rajang

Poi River

Location where the gill

net was deployed

Page 137: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

115

Figure 4.7: Map showing the survey area in Ngemah River. Each circle indicates the

location of crocodile sighted during the survey and different colours in the circle represent

different size class.

One crocodile was recorded in Ngemah River, approximately one kilometer from its river

mouth (Figure 4.7). The surveyor was unable to estimate the size or cohort of the crocodile,

thus the crocodile falls into ‘eyes only’ category. No other crocodile was detected further

deep into the upper section of the river before reaching to the end point of the survey.

Batang Rajang

Ngemah River

Location where the gill

net was deployed

Page 138: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

116

Figure 4.8: Map showing the survey area in Katibas River. Each circle indicates the

location of crocodile sighted during the survey and different colours in the circle represent

different size class.

Similar to Ngemah River, survey in Katibas River also recorded only one sighting of

crocodile (Figure 4.8). The crocodile, which was categorized as ‘eyes only’ was spotted near

to Katibas Bridge, about two kilometers from the river mouth. There was no sign of a

crocodile in further upstream areas.

Song

Batang Rajang

Katibas River

Location where the gill

net was deployed

Page 139: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

117

4.3.3 River characteristics and landscapes

Based on the stream habitat assessment, five out of eight studied rivers were categorized as

“Fair” habitat conditions and another three rivers assessed as “Good” habitat condition

(Table 4.8). Details of river characteristics are as in Appendix A2 until A3 (see page 224 -

227).

Table 4.8: Stream habitat assessment and its score for each river in study area of Rajang

River Basin.

River River Habitat Assessment

A1 B1 C1 D1 E1 Total Score Category

Igan 6 5 3 4 3 21 Fair

Belawai 6 5 3 4 3 21 Fair

Sarikei 6 5 4 5 3 23 Fair

Nyelong 5 5 4 5 3 22 Fair

Kanowit 6 5 4 5 5 25 Fair

Poi 8 6 6 6 7 33 Good

Ngemah 7 6 6 5 6 30 Good

Katibas 7 6 5 5 6 29 Good

*(A1, Bank vegetation; B1, Verge vegetation; C1, In-stream cover, D1, Bank erosion and stability;

E1, Riffles, pools and bends)

The three rivers that were categorized as “Good” condition, Poi, Ngemah and Katibas River,

were located at the middle and upper regions of the Rajang RB. These rivers scored between

29 to 33 points which indicated that the rivers have less alteration from their natural states.

Out of 8 studied rivers, Poi, Ngemah and Katibas River are not influenced by tidal. The

rivers are dominated by a variety of habitats (riffle, pool and runs) with various depth and

width. The depths of the rivers are ranging from 5.1 m to 7.8 m (average = 6.14 ± 1.36 m)

in Poi River, 5.8 m to 7.6 m (average = 6.50 ± 0.69 m) in Ngemah River and 2.0 m to 10.8

Page 140: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

118

m (average = 5.98 ± 3.35 m) in Katibas River. Meanwhile, the widths of the rivers are

ranging from 55 m to 20 m (average = 40 ± 12.75 m) in Poi River, 170 m to 30 m (average

= 66 ± 59.10 m) in Ngemah River and 145 m to 90 m (average = 118 ± 20.80 m) in Katibas

River. The rivers have brackish type of water about several kilometers near the river mouth

before reaching the fresh water further upstream. The bottom and riverbank substrates in

these three rivers are sands, gravels and pebbles especially for the area located upstream.

While at the downstream, it was dominated by sandy and muddy type of riverbank. Riparian

vegetation along riverbanks are dominated by trees, grasses and shrubs with the presence of

overhanging vegetation in certain areas. The canopy covers for the Poi, Ngemah and Katibas

River are partly shaded especially in upstream area.

Almost all of the rivers that were categorized as “fair” habitat located in lower region of

Rajang RB (Igan, Belawai, Sarikei and Nyelong River) except for Kanowit River (middle

region). The scores for habitat condition for these rivers varied in between 20 to 25 points.

Rivers fall into this category show notable alterations from natural state but still offering

moderate and stable habitat for surrounding organisms. The highest score in this category

was Kanowit River with 25 points. Similar to its neighbouring tributary Poi River, brackish

water can be found up to several kilometers from the mouth of Kanowit River before

reaching the fresh water further upstream. The river also has diverse habitats including riffle,

pools and runs with variation in depths, ranging from 8.1 m to 12.7 m (average = 10.86 ±

2.15 m) and widths, ranging from 265 m to 60 m (average = 118 ± 83.41 m). Riverbank

characteristics and riparian vegetation in the Kanowit River are almost similar with Poi

River, except more areas at the riverbank were cleared for residential and industrial purposes

as well as for agriculture. The Kanowit River is largely cleared with only certain areas were

Page 141: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

119

covered with canopy. There are also very little in-stream vegetation can be found along the

river.

Sarikei and Nyelong River scored 23 and 22 points in stream habitat assessment,

respectively. Located at the lower region of Rajang River, the water in the rivers is brackish

with slight variety of habitats like pools and runs. The depths of the rivers are ranging from

6.7 m to 12.5 m (average = 8.32 ± 2.38 m) in Sarikei River, while the depths of Nyelong

River are ranging from 5.6 m to 10.7 m (average = 8.36 ± 1.82 m). The widths of Sarikei

River are ranging from 210 m to 40 m (average = 94 ± 68.04 m) and in Nyelong River, the

widths are ranging from 240 m to 60 m (average = 122 ± 70.59 m). Large areas at the muddy

riverbank of Sarikei and Nyelong River are covered by Nypa trees. The rivers are largely

cleared, with occasional snags and very little in-stream vegetation. Generally, both rivers

have open type of canopy and no overhanging vegetation.

The rivers that have the lowest score in stream habitat assessment are Igan and Belawai

Rivers with 21 points. Both of the rivers are located at the estuary of Rajang RB, hence

saltwater and brackish water are abundant in the rivers. Igan and Belawai Rivers have

relatively large waterway and offer relatively low number of habitats includes riffles, runs

or pools with limited variations in depths and width of the rivers. The depths of the rivers

ranging from 13.3 m to 15.8 m (average = 14.28 ± 0.96 m) and 14.3 m to 16.2 m (average =

15.20 ± 0.71 m) for Igan and Belawai River, respectively. The widths of the rivers are

ranging from 1,670 m to 915 m (average = 1238 ± 335.20 m) in Igan River, while the depths

of Belawai River are ranging from 1,400 m to 560 m (average = 862 ± 356.82 m). Pine trees,

Casuarina equisetifolia, dominated the sandy beach areas at the mouth of both rivers, while

Page 142: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

120

further upstream the riverbank was covered by mangroves vegetation and Nypa trees. Both

of the rivers also have open type of canopy, low or absent of in-stream vegetation and no

overhanging vegetation.

Human activities such as human settlement, riverbank clearance and developments can cause

directly and indirectly impact on river habitats as well as the crocodile populations. Details

of riverbank development and land use recorded during field sampling in eight studied rivers

in Rajang RB as in Appendix A3 (See page 226 - 227). Based on observations, these human

activities vary among the rivers in the study area. Several towns can be found at the river

mouth of the studied rivers such as Sarikei in Nyelong and Sarikei River, Kanowit in

Kanowit River and Song in Katibas River (Figure 4.4, Figure 4.5 and Figure 4.8). Man-made

buildings such as waterfronts, jetties, houses, shops and factories in this area are typically

built near to the river. River traffics in this area are constantly high especially during the

daylight because people prefer to use water transportation to travel to and from the town.

Remote areas especially in Kanowit (e.g., in Ulu Ngemah, Ulu Poi) and Song (e.g., in Ulu

Katibas) districts are not yet connected by roads, thus for these people boats are the only

mean of transportation to travel to another place or town. While in Sarikei, although most of

areas were connected by roads, some of the locals prefer to use boat as it is the quickest and

cheapest way to travel to the town. Boats can be seen moving in and out from jetty or boat

terminal in Kanowit, Song and Sarikei Town. In Igan River, ferries operate from early

morning until night, transporting people and vehicles crossing both sides the river.

In Igan and Belawai Rivers, several villages can be found along the rivers and fishing is

among the main activities in these villages (Figure 4.2 and Figure 4.3). Fishing activities in

Page 143: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

121

these rivers are relatively high and the fishermen typically used various types of fishing

vessels, from small single engine boats to big fishing vessels, to catch fish in the river and

coastal area. The fishermen use several methods of fishing including cast nets and gill nets,

which could be seen set up by the fishermen along the river.

Riverbank clearance for developments or agriculture activities were observed in several

rivers in the study area during the surveys. At least one concrete bridge was built across the

rivers in the study areas except for Igan and Belawai. In Kanowit, constructions of concrete

bridges occurred not far from the towns and at the time of the survey, the works had been

on-going for more than two years. The constructions of the bridges were completed at end

of 2017. There was also a logging camp sighted in Kanowit River during the survey and it

is believed that several more camps can be found further upstream. Logs from these camps

are usually transported to factories by towing boats using the river. A large-scale palm oil

plantations estate own by a private company were found in Nyelong. Several small-scale

agriculture plots planted with paddy, pepper, fruits, vegetables and other cash crops plants

could be seen near to residential areas at the bank of Sarikei, Kanowit, Poi, Ngemah and

Katibas Rivers.

Poi and Ngemah River is relatively quieter and less busy compared to other rivers in the

study area. There are less developments at the riverbanks and not many villages/longhouses

can be found along the rivers (Table Appendix A3, see page 227). In Poi River, two houses

were found about less than 5 km from river mouth, while in further upstream, not more than

6 villages/longhouses were found within the survey distance (Figure 4.6). Meanwhile in

Ngemah River, Ngemah village was located near to river mouth and not less than 5

Page 144: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

122

villages/longhouses can be found throughout the survey distance in the river (Figure 4.7).

There also one primary school located near to river in Poi and Ngemah River. The local

communities in Poi and Ngemah River are less dependent on the river for water sources and

transportation as they already have access to clean tap water and electricity and their houses

were connected to Kanowit Town and other areas via roads. Fishing activities in Kanowit,

Poi, Ngemah and Katibas Rivers are considered medium to low as the people who live near

these rivers are still depending on the river for food resources and incomes.

4.3.4 Selected water quality parameters

The detail measurements for water quality parameters and statistical analysis result are as in

Appendix A4 (see page 228 - 229). The mean values of salinity recorded for selected rivers

and tributaries of Rajang RB ranged from 19.80 ± 1.94 ppt to freshwater (no salinity reading

detected) (Table 4.9). The water in the two rivers, Ngemah and Katibas is freshwaters, which

indicated by the absence of saline water flow through the rivers. Both rivers are located at

the upper region of Rajang RB. Igan River recorded the highest salinity with mean reading

of 19.17 ppt and shows significant different (p < 0.05) with other rivers except for Belawai

River (p = 0.842).

Page 145: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

123

Table 4.9: Selected water quality parameters measured in-situ for rivers and tributaries of

Rajang River Basin.

River Salinity, ppt pH Temperature, ºC

Igan L 19.00 ± 2.54 6.42 ± 0.43 26.82 ± 0.34

Belawai L 16.26 ± 5.55 7.53 ± 0.11 29.70 ± 0.12

Sarikei L 6.06 ± 5.67 5.63 ± 0.22 29.72 ± 0.35

Nyelong L 1.99 ± 1.87 5.25 ± 0.16 29.26 ± 0.32

Kanowit M 0.88 ± 0.68 6.81 ± 0.21 27.36 ± 0.11

Poi M 0.47 ± 0.87 7.22 ± 0.15 27.24 ± 0.09

Ngemah U 0.00 ± 0.00 6.98 ± 0.07 25.44 ± 0.09

Katibas U 0.00 ± 0.00 7.02 ± 0.07 25.38 ± 0.11

*L=Lower region; M=Middle region; U=Upper region of Rajang River Basin

Five out of eight rivers showed slightly acidic condition (pH < 7) except for Belawai, Poi

and Katibas (Table 4.9). The mean value of pH for all the rivers ranged from 5.25 ± 0.16 to

7.53 ± 0.11, with the highest pH recorded at Belawai River with mean value of 7.53 and

significantly higher than pH value of other rivers (p < 0.05) except for Poi River (p = 0.300).

Meanwhile, Nyelong River is significantly more acidic than the other rivers with a mean pH

of 5.23 (p < 0.05) except for Sarikei River (p = 0.111).

The mean values of water temperature for selected rivers and tributaries of Rajang RB were

ranged from 25.38 ± 0.11 ºC to 29.72 ± 0.35 ºC (Table 4.9). Sarikei River recorded the

Page 146: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

124

highest mean of water temperature with 29.72 ºC, significantly higher compared to other

rivers (p < 0.05) except for Belawai River (p = 1.000). The mean value of water temperature

recorded at Katibas River (25.38 ºC) was significantly lower compared to other rivers (p <

0.05) except for Ngemah River (p = 1.000).

4.3.5 Aquatic food resources for crocodile

Based on Figure 4.9, the highest CPUE was recorded in Belawai River, with mean catch

0.97 ± 0.28 kg/hour and significantly higher (p < 0.05) compared to other rivers except for

Igan River (p = 0.919). In contrast, Sarikei River recorded the lowest mean catch with 0.12

± 0.07 kg/hour, but shows no significantly different (p > 0.05) with other rivers except for

Igan (p = 0.001) and Belawai (p = 0.000). The statistical analysis results as in Appendix A6

(see page 237 - 238).

Page 147: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

125

Belawai Igan Poi katibas Nyelong Ngemah Kanowit Sarikei

0.0

0.2

0.4

0.6

0.8

1.0

CP

UE

(k

g/h

ou

r)

River

Figure 4.9: Catch per unit effort (CPUE) at eight rivers in Rajang River Basin.

Table 4.9 summarizes the species list of fish and invertebrates caught during the surveys,

which were potential food sources of C. porosus in the study areas.

Page 148: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

126

Table 4.10: List of fish and invertebrates caught in Rajang River Basin that may be the potential food source of the C. porosus. (symbol +,

represent the species was caught in the river).

Family Species Local name River

Iga Bel Sar Nye Kan Poi Nge Kat

Ariidae Arius microcephalus Ikan belukang + Nemapteryx caelata Ikan duri + +

Bagridae Bagroides melapterus Ikan baung pisang + Carcharhinidae Carcharhinus borneensis Ikan yu + Chandidae Ambassis kopsii Ikan tibak belai + + + + + Cyprinidae Puntioplites bulu Ikan mengalan/ kepait + + +

Luciosoma setigerum Ikan nyua + + Engraulidae Setipinna breviceps Ikan empirang + +

Setipinna melanochir Ikan empirang sirip gelap + Setipinna taty Ikan empirang janggut + Coilia macrognathos Ikan gonjeng + +

Mugilidae Chelon subviridis Ikan belanak/kembura + Pangasiidae Pangasius micronemus Ikan buris + + + + + + Plotosidae Plotosus canius Ikan semilang + Polynemidae Eleutheronema tridactylum Ikan senangin + Pristigasteridae Ilisha elongata Ikan popot + + +

Ilisha megaloptera Ikan beliak mata + Sciaenidae Johnius spp. Ikan gelama + + + + Scatophagidae Scatophagus argus Ikan ketang + Siluridae Kryptopterus lais Ikan lais/ layah bongkok + Soleidae Archiroides melanorhynchus Ikan daun/ lidah/ sebelah + Stromateidae Pampus argenteus Ikan kilat + Trichiuridae Trichiurus lepturus Ikan timah selayur/layur + Penaeidae Penaeus spp. Udang + + + +

*Iga = kuala Igan, Bel = Belawai, Sar = Sarikei, Nye = Nyelong, Kan = Kanowit, Poi = Poi, Nge = Ngemah, Kat = Katibas River

Page 149: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

127

A total of 23 species of fishes and one type of invertebrate representing 18 different families

were caught from all the rivers in the study area in Rajang RB (Table 4.10). The highest

variety of fish species caught in a river was in Belawai River (13 species), followed by Igan

and Nyelong River where both of the rivers recorded six species of fish respectively.

Pangasius micronemus from Family Pangasiidae or locally known as “Ikan buris” have been

caught in six rivers (Sarikei, Nyelong, Kanowit, Poi, Ngemah and Katibas River) out of eight

rivers in the study area. Commercial fish species had also been caught in the surveys,

including from species Setipinna (“Ikan empirang”), Coilia macrognathos (“Ikan gonjeng”),

Ilisha elongata (“Ikan popot”) and Pampus argenteus (“Ikan kilat”). The only invertebrate

caught in the survey was from Family Penaeidae or locally known as “udang” and the prawn

was caught in Igan, Belawai, Kanowit and Poi River.

4.3.6 Relationship between crocodile density, habitat, water quality parameter and

the abundance of food resources for crocodiles

Pearson’s correlation analysis between crocodile density, water quality parameters and the

abundance of food resources for crocodile (CPUE) is shown in Table 4.11. The correlation

analysis shows that the crocodile density was significantly and positively correlated with

salinity of the river (p < 0.05). The analysis also shows positive correlation between

crocodile density with temperature and the abundant of food sources (CPUE) but not

significant. Meanwhile, habitat scoring shows significant negative correlations with the

crocodile density, while for pH the analysis was insignificantly and negatively correlated

with the crocodile density.

Page 150: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

128

Table 4.11: Pearson’s correlation between crocodile density, water quality parameters,

habitat and the abundance of food resources for crocodile (CPUE).

Salinity pH Temperature CPUE Habitat

Crocodile

Density

0.884*

(P = 0.003)

-0.350

(P = 0.395)

0.609

(P = 0.109)

0.613

(P = 0.106)

-0.816*

(P = 0.013)

*Correlation is significant at the 0.05 level (2-tailed test of significant)

The PCA analysis result of the crocodile density, water quality parameters and CPUE at all

river in the study area is best explained by principal component 1 and 2 with 59.22% and

28.71% of the variance respectively, totalling 87.95% (Table 4.12).

Table 4.12: Summary for PCA analysis for the crocodile density, water quality

parameters, habitat and CPUE.

Principal

component

Eigenvalue Percentage of

Variance

Cumulative Percentage

of Variance

1 3.553 59.22% 59.22%

2 1.722 28.71% 87.93%

Based on the PCA ordination bi-plot (Figure 4.10), salinity and CPUE have large positive

loading on principal component 1 alongside with the crocodile density, represented on the

right of the diagram. This could suggest that the salinity of the water and the abundance of

the food sources are among the main factors that influenced the density of crocodile in the

rivers. Rivers located at the mouth of Rajang RB, Belawai and Igan River, were mainly

loading close on salinity, CPUE and crocodile density (red circle).

Page 151: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

129

Figure 4.10: PCA ordination bi-plot of eight rivers of Rajang River Basin with crocodile

density, habitat, water quality parameters (Salinity, pH and Temperature) and food

resources for crocodile (CPUE).

-2 0 2

-2

0

2-0.5 0.0 0.5

-0.5

0.0

0.5

Kuala Igan

Belawai

Sarikei

Nyelong

Kanowit

Poi

Ngemah

Katibas

Crocodile Density

Salinity

pH

Temperature

CPUE

Habitat

Prin

cip

al C

om

po

ne

nt

2

Principal Component 1

Page 152: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

130

General Linear Model (GLM) analysis showed similar finding with the results in PCA

analysis. Two variables, salinity (F = 21.35, df = 1, P = 0.004) and habitat (F = 11.97, df =

1, P = 0.013) had significant influence on density of crocodile (Table 4.13). However, there

is no combination of variables that had significant influence on the density of crocodile. The

highest F-value was the combination between temperature and the abundant of food sources

(CPUE) but the value is statistically not significant (F = 7.42, df = 1, P = 0.053).

Table 4.13: Summary for GLM analysis for the water quality parameters, habitat and

CPUE in response with crocodile density.

Variables

(or combine)

F-value df P-value

Salinity 21.35 1 0.004*

Temperature 3.53 1 0.109

pH 0.84 1 0.395

CPUE 3.61 1 0.106

Habitat 11.97 1 0.013*

Salinity * Temperature 1.83 1 0.248

Salinity * pH 1.03 1 0.368

Salinity * CPUE 2.32 1 0.202

Salinity * Habitat 1.62 1 0.272

Temperature * pH 4.68 1 0.096

Temperature * CPUE 7.42 1 0.053

Temperature * Habitat 0.09 1 0.777

pH * CPUE 1.12 1 0.350

pH * Habitat 1.62 1 0.272

CPUE * Habitat 0.25 1 0.646

* Significant at P < 0.05.

Page 153: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

131

4.4 Discussion

The crocodile densities in the study areas recorded an increase between 14% to 149%

compared to Robi (2014), except for two rivers Sarikei and Nyelong. Sarikei and Nyelong

River recorded a decline in densities with a reduction between 25% to 38%. Meanwhile,

with no previous crocodile survey in Belawai and Kanowit River, density comparison could

not be done for both rivers. Therefore, the survey result for both rivers can be use as baseline

data for future survey. This study did not apply correction for visibility bias (correction

factor), therefore the results were only expressed as relative density rather than absolute

density which means that the figures only represent the number of crocodiles sighted within

the length of river surveyed, rather than the total number of crocodiles in the entire river

(Bayliss, 1987). However, relative density could help in assessing trend in crocodile

populations as the data can be compared with previous data in the same stretch of river. The

results in this study are coherent with the increasing densities recorded by SFC and FDS in

several others rivers in Sarawak such as Samunsam River, Samarahan River, Suai River,

Baram River and Limbang River (Sarawak Forestry Corporation, 2018). The rising densities

of crocodile in rivers in Sarawak are an indication of the recovery of the crocodile

populations (Fukuda et al., 2011).

The presence of crocodiles in almost all of surveyed rivers in the present study suggests that

crocodiles are well distributed throughout the Rajang RB including in the lower, middle and

upper region of the river basin. However, the density of crocodile differs according to the

regions; densities in rivers in the lower Rajang RB were ranging from 0.74 to 1.32

individuals/km, relatively higher compared to the densities of crocodile in rivers in the

Page 154: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

132

middle and upper regions (0.06 to 0.16 individuals/km). Similar results were recorded by

Robi (2014) in his survey in Rajang where density of crocodile in rivers in lower Rajang

were around 0.22 to 1.26 individuals/km, while in upper region, the densities were ranging

from 0.04 to 0.07 individuals/km. Saltwater crocodiles are typically live in saline waterways

near to the coastal areas (Webb et al., 2010), however the sighting of a crocodile in Katibas

River in Song districts, about 180 km away from the estuary of Rajang River in the present

survey, confirmed the presence of crocodiles in the tributaries of upper regions of Batang

Rajang. This scientific document confirms the local people’s claims about the presence of

crocodiles, therefore the relevant agencies should be cautious and be ready with the possible

HCC in the areas.

Recent survey in Kanowit River showed zero relative density (no crocodile spotted) and with

no survey was conducted in the river in 2014, it seems that the crocodile is probably either

absent or if present, the numbers are very low. However, this is not necessarily mean that

there are no crocodile population in Kanowit river. The result only represents the number of

crocodiles sighted within the length of river surveyed in that particular time, not the absolute

density or total population in the river. Several factors might influence the result. In addition,

based on the interviews with local fishermen, they insisted that although the crocodile is

rarely to be seen in Kanowit River lately, they believed that the crocodile is present in the

river. There is a possibility that the spotter missed out crocodiles during the survey or the

crocodiles regularly move in and out of the Kanowit River to the main river of Batang

Rajang. The crocodiles in the Kanowit River might have developed a high level or wariness,

thus they can avoid to be detected by the surveyor (Webb & Messel, 1979). The presence of

a sub-adult spotted in the main river of Batang Rajang, about one kilometer distance from

Page 155: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

133

the mouth of Kanowit River, further supported the possibility of crocodile movement in and

out of Kanowit River.

The distribution of crocodiles varies in each river. In Igan River, majority of the crocodiles

were spotted in areas near to the river mouth. According to local community in Igan village,

crocodiles were commonly found in Nypa palms areas just next to their village and they

believed that crocodiles were using that area as the resting place. The locals also claimed

that the crocodiles especially the larger ones are more likely to roam around the river near

to the village, sometimes scavenging foods leftover, animal carcasess or rubbish under

people’s houses and jetty. During the survey, a large adult was sighted in the middle of the

river approximately 50 meters from the village probably waiting for rubbish thrown by the

people (Figure 4.2). Similar situation where large adults living near human settlements were

also recorded in Bako River, western Sarawak (Hassan et al., 2018). A satellite tracking

study by Campbell et al. (2015) reveal that crocodile greater than 2.5 m in length are likely

to wander in area near to human settlement due to the curiosity or attracted to something,

possibly the smell of food leftovers or animal carcasses.

Several sightings of young crocodiles (yearlings and hatchlings) in close proximity to each

other or in clusters were recorded in Igan, Belawai, Sarikei and Nyelong River during the

surveys (Figure 4.2, Figure 4.3 and Figure 4.4). When a group of young crocodiles found in

one place, it could be a sign that nesting occurs in these particular areas and the cluster of

young crocodiles were probably from the same nest (Webb et al., 1977; Fukuda & Saalfeld,

2014). In addition, the presence of at least one adult crocodile in close proximity with the

Page 156: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

134

young crocodiles also supports the possibility that there could be a nesting area for crocodiles

in that particular area (Webb et al., 1983).

For a large rivers like Igan and Belawai, crocodiles prefer to build their nest at the riverbank

of a small tributary or stream compared to the main river to avoid their nest affected by

flooded water from the main river and also access to freshwater (Fukuda & Cuff, 2013;

Evans et al., 2016). After hatching, the hatchlings will live in the smaller tributary for few

months and when they grow bigger in size they will venture out to the main river. Along the

process, the mother stays close to guard the nest, besides assisting in excavating the nest

during hatching (Webb et al., 1983; Grigg & Gans, 1993; Evans et al., 2016). Thus, the adult

who was spotted near to the hatchlings is most likely to be a female crocodile.

In Sarikei River and Nyelong River, no crocodile was spotted in the proximity of Sarikei

town except for a group of sub-adults and hatchling roaming in the area near to a bridge in

Nyelong River. Instead, more crocodiles were found in less human populated and

development areas further upstream (Figure 4.4). The town of Sarikei, located at the mouths

of Sarikei and Nyelong River, is a high human populated area and the town is the center for

economic activities and transportation hub for the surrounding region. In this case,

disturbances from human activities along with the changes in riverbank habitat as the result

of development could hinder crocodiles from living in the waterway proximity of the town

(Fukuda et al., 2008; Shaney et al., 2017). In Nyelong River, a hatchling and yearling were

among the crocodiles spotted close to the oil palm plantations, suggesting that the crocodiles

are building nests near or inside the plantations area. This does suggest that riverbank land

Page 157: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

135

conversion into oil palm plantations is not necessarily a barrier for crocodile to nesting

(Evans et al., 2016).

It is also noted that the hatchlings spotted in the surveys were present in the area near to a

school and a longhouse in Poi River (Figure 4.6). The situation where the crocodiles are

present in areas near to schools or residential areas is common in Sarawak because the local

people and crocodiles had been sharing the rivers for centuries (Hassan & Abdul-Gani,

2013). Conflicts between human and crocodiles are rarely reported in this area, however

local communities in the area especially children need to be reminded about the danger of

crocodiles. This can be done through several initiatives by local authorities including putting

warning signboards in school and residential areas, conducting public awareness

programmes and also frequent sharing sessions between community leaders and local

authority so that any information about crocodile can be delivered in a more effective

manner.

During the surveys, there were crocodiles that have been detected through eye shine but their

body size were unable to be estimated as the crocodiles submerged quickly into the water

when the surveyors tried to approach them. The crocodiles might be alerted by the waves or

sound created by boat engine or noise from the people on the boat. The sightings were then

recorded as “Eyes only” (EO) (Bayliss, 1987). This behaviour is a sign of high wariness and

this level of wariness typically associates with larger crocodiles, mainly sub-adult and adult.

A mature crocodile develop the wariness through life experience, as an example learning

through frequent encounter with boat, escape from human harassment or hunting (Webb &

Page 158: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

136

Messel, 1979). Accordingly, the EO crocodiles seen in the Ngemah and Katibas River were

most likely mature crocodiles (sub-adult or adult).

The crocodiles found in Poi, Ngemah and Katibas Rivers shared a common pattern, all of

them were spotted in an area less than 5 km from the tributary mouth (Figure 4.6, Figure 4.7

and Figure 4.8). A sub-adult sighted in Poi River along with a small hatchling could suggest

that crocodiles in the middle and upper region of Rajang RB used tributaries along the main

river as the nesting ground. Similarly, a “eyes only” (assuming it as an adult or subadult

crocodile) found in Ngemah and Katibas River, respectively; are probably female crocodiles

and they are travelling into these tributaries for nesting. A typical mature crocodile would

prefer to live in a large river like Batang Rajang due to a large space area for living and more

foods available, but when nesting, a female crocodile prefers to choose an area with less

disturbance like in a smaller tributary or stream that have access to freshwater (Fukuda &

Cuff, 2013).

Saline characteristic of the waterway and the access to plentiful of foods area are among the

strong factors that influence the abundance of crocodiles. In Sarawak, saline mangroves

floodplains and large river systems around estuaries like Belawai and Igan Rivers in this

study are the most common habitat for C. porosus where the highest crocodile densities are

usually found in these areas (Stuebing et al., 1985; Hassan & Abdul-Gani, 2013; Abdul-

Gani, 2014; Zaini et al., 2014). Rivers in the middle and upper parts of Rajang RB (Kanowit,

Poi, Ngemah and Katibas River) show low value in salinity (Table 4.9). The hypo-saline

characteristic in these rivers is expected as they are located more than 100 km from the

mouth of Batang Rajang where there are less influence of sea water in the rivers.

Page 159: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

137

The low salinity and the absence of tidal influence could be the reason why there are less

number of crocodile found in the upper part of Batang Rajang compared to rivers in the

lower part of Rajang RB. According to Cramp et al. (2008), the estuarine crocodile, C.

porosus, displays broad euryhaline capabilities, where they could be found in waters ranging

in salinity from 0 to over 35 ‰. The presence of both freshwater and saltwater are important

to crocodiles as it influence their diet, nesting ground and behaviour, hence they regularly

move between different habitats, according to the wet and dry seasons changes (Grigg &

Gans, 1993; Fukuda & Cuff, 2013; Hanson et al., 2015; Evans et al., 2017). Tidal currents

are important to crocodiles especially for their movement in water as well as giving them

advantage when hunting for food (Grigg & Gans, 1993; Campbell et al., 2010).

The pH and water temperature readings for the Ngemah and Katibas Rivers in the present

study are similar with what have been recorded in Pelagus River (Ling et al., 2017) and

Balleh Rivers (Ling et al., 2016) in further upstream of Rajang RB. In Pelagus River, the pH

value of the streams ranged from 6.1 to 7.1, while in Balleh River the pH value was in

between 7.0 to 7.7. The temperature of water in Pelagus River and Balleh River ranged from

25.0 0C to 30.6 0C and 24.7 0C to 28.8 0C, respectively.

The river temperature could be influence by several factors including elevation, rainfalls and

seasons (Ling et al., 2016). The water temperature in rivers in the upper part of Rajang RB

(~25 0C) recorded lower reading compared to the rivers in middle (~27 0C) and lower (26 -

29 0C) part of Rajang RB (Table 4.9). During the sampling process, there was no rain were

recorded from an hour to a day prior to the sampling period except for samplings in Igan and

Katibas River. River temperature in Igan (26 0C) was recorded lower compare to the rest of

Page 160: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

138

rivers in lower region (29 0C) and the result could indicate that the rainfall event occurred a

day before sampling period had influence on the river temperature.

An estuarine crocodile can live in a wide range of water temperature, but the optimal

temperature for crocodile is ranging from 28 0C to 30 0C (Stuebing et al., 1985; Rodgers et

al., 2015). A crocodile is an ectothermic animal, thus the reptile depend on surrounding

temperature to regulate its body temperature (Grigg & Gans, 1993). Hence, the capacity of

a crocodile to dive and stay longer underwater is depending on the water temperature. The

body temperature also restricted mobility, therefore the reptile commonly seek to maintain

optimal body temperature through behaviour such as basking, moving in and out from water

or finding shade inland (Grigg & Gans, 1993).

The water temperature readings for five out of eight rivers in the study are below the optimal

temperature window for crocodile, but whether or not this condition could affect the sighting

of crocodile in those rivers is relatively unknown. Four of the rivers (Kanowit, Poi, Ngemah

and katibas) that have temperature below the optimal temperature for crocodile are in the

middle and upper region of Rajang RB and these rivers also recorded lower density of

crocodile compare to those in lower region. It seems to indicate that temperature had

influence on the distribution of crocodile in Sarawak, but yet, other factors including salinity,

habitat and the availability of food could also influence the crocodile distribution. Although

the river temperatures are below optimal, the readings are within the range that can be

tolerated by crocodile. According to Rodgers et al. (2015), estuarine crocodiles can tolerate

better to a lower temperature compared to a warmer temperature as they have the unique

capability of its organs in response to such environment.

Page 161: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

139

Out of 23 species of fishes caught in this study, 10 species were similar with what have been

recorded by Parenti and Lim (2005) and Bolhen (2017) in the Rajang RB. However, both

studies recorded fish species mainly from the upper Rajang area; Parenti and Lim (2005)

recoded fish species from Belaga, Baleh, Balui, Kapit and area around Sibu, while Bolhen

(2017) documented fish fauna from Pelagus area. Hence, this could explain why certain

species of fish caught in the present study especially the coastal water fish like Setipinna

breviceps, Coilia macrognathos, Pampus argenteus and few others, were not in the Parenti

and Lim (2005) and Bolhen (2017) fish species checklist. The species of fish caught in the

present study varies in each studied river, majorly influence by the river habitat and the type

of water in the rivers.

With the presence of crocodile in different habitats in Rajang RB, it could suggest that

crocodiles eat various species of fish or invertebrates that are available in the habitat area.

According to Hanson et al. (2015), range of prey (including fish species) for crocodiles could

vary among different habitats (e.g., coastal mangroves, freshwaters tributaries or swamps),

depends on the diversity of potential prey available in the area. A stomach contents study

by Sah and Stuebing (1996) found that C. porosus in Klias River, a river in coastal area of

Sabah, consume majorly on small fish from the Family Hemiramphidae and Engraulidae.

Both of the fish family group are common in estuarine and mangrove habitats, thus explained

why the fish species were taken frequently especially by the juvenile crocodiles. The fish

checklist data in the present study does not necessarily indicated the diet of crocodile, but it

could provide clues on potential food resources for crocodile in the various habitats. Further

studies are needed to understand the diet of crocodile in different river habitats including

study of fish and invertebrate composition as well as study of crocodile stomach contents.

Page 162: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

140

Mangroves waterways in lower Rajang (Belawai and Igan) offer more food sources for

crocodiles as compares to rivers in the other part of Rajang RB based on the CPUE results.

Although the CPUE data were collected as one-off survey and the data do not necessarily

represent the abundance of food sources for crocodile in the rivers throughout the year, the

data could show variation in the level (abundance) of food sources between rivers. The

coastal mangroves floodplains are rich in fauna including fish, insects, crustaceans,

mammals and reptiles, thus providing a variety of foods for both matured and juveniles

crocodiles (Fukuda et al., 2008; Nagelkerken et al., 2008). Crocodiles eat various type of

food, ranging from the small aquatic animals including fish, crustaceans and insects to the

large terrestrial mammal, primates and reptiles such as pigs, dogs, chickens, goats, monkeys,

snake or any animals that come near to the water (Stuebing et al., 1985). The food preference

for crocodile usually differ depending on the developmental stage, where young crocodiles

prey on smaller animals while the adults hunts for larger animals, sometimes travel further

on land to fulfill its appetite (Hanson et al., 2015). However, despite the fact that they prey

on large animals, crocodiles are rarely been seen hunting for animals that have size much

bigger than their own.

Basically, crocodiles spend most of their time in water and they also move easily in water,

thus their main diet are aquatic animals. In addition, crocodiles have limited opportunity to

prey upon the terrestrial animals (Hanson et al., 2015). The opportunity only comes when

the animals approaching the river for a drink or try to cross the water body or at any chance

the primates and any other animals slip into the water. A study by Hanson et al. (2015)

suggested that small and young crocodiles feed mainly on herbivorous aquatic animals like

small fishes, invertebrates including insects while medium to large adult crocodile eats

Page 163: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

141

similarly, but supplement their diets with slightly higher trophic level of preys in riverine

habitats such as larger predatory fishes and marine vertebrates. This supports what have been

suggested by Stuebing et al. (1985) where hatchling crocodiles particularly in Lupar River,

Sarawak, feed mostly on Paneus prawns and small crabs captured near to the water edge

while larger crocodiles prey upon larger fish and vertebrates such as tortoise, monkey and

others inland animals.

Pearson’s correlation analysis and general linear model (GLM) analysis shows significant

negative correlations between the habitat scoring data and the crocodile density (Table 4.11

and Table 4.13), however, this is not necessarily depicting that crocodiles are more abundant

in low habitat condition. The habitat assessment scoring is based on five parameters which

are bank vegetation, verge vegetation, in-stream cover, bank erosion and stability and riffles,

pools and bends. Hence, for the rivers in lower part of Rajang RB where crocodile densities

are higher, the habitat assessment scores were a bit lower compared to other rivers in the

middle and upper part of the river basin. Human disturbance and habitat degradation seem

to have a weak influence on the abundance of crocodiles among the studied rivers. In several

studies (Fukuda et al., 2008; Evans et al., 2016), the variation in land use intensity and the

human presence show only a minimum influence in the abundance of crocodiles. However,

the pattern of crocodile distribution within the studied rivers showed that crocodiles are

avoiding high riverbank development and human populated areas, for example, none or a

small number of the crocodile sighting were recorded in town proximity (Sarikei and Song)

in Sarikei, Nyelong and Katibas River. Meanwhile in Kanowit, development and industrial

activities took place not just in town area only but also further upstream, such as the

construction of a concrete bridge and the logging activity. These anthropogenic disturbances

Page 164: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

142

could affect the population of crocodile in the river resulting in no crocodile was sighted in

18 km distance of survey. Constant encroachment into crocodile habitat and high impact

land use, typically occur in developing area like in Sarikei, Kanowit and Song towns, could

affected the crocodile population, as all the activities indirectly contributes to the potential

loss of quality habitat including their feeding and nesting area and it also could change the

nature of the waterways (Fukuda et al., 2008).

4.5 Conclusion

The present study showed that the estuarine crocodiles are distributed along the lower,

middle and upper region of Rajang River Basin and the animals were sighted as far as

Katibas River, approximately 180 km from mouth of the river basin. However, the density

and distribution of crocodile differ according to the regions where the crocodile density in

lower region was higher compare to the middle and upper regions. Four out of eight studied

rivers in Rajang RB namely Igan, Poi, Ngemah and Katibas recorded increase in crocodile

density compare to the previous survey suggesting that crocodile population are

experiencing recovery. The distribution of crocodiles in the upper region was restricted to

the area of several kilometers distance from the mouth of the tributaries, suggesting that the

crocodiles might frequently move in and out from the tributaries to the main river. The water

quality, river habitats and the abundance of food for crocodiles varied between the eight

studied rivers, yet the rivers support crocodile populations. This finding suggests that

crocodiles in Sarawak can live in a wide range of habitat, from the large tidal rivers in coastal

area to the small non-tidal freshwater tributary in the upper side. Saline characteristic and

the abundance of food sources for crocodile are the strong factors that influence the density

Page 165: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

143

and distribution of crocodile in Sarawak. The presence of crocodiles in rivers near to the

residential, development and agriculture areas indicated that moderate to high human

disturbances and riverbank land-use conversion are not a barrier for crocodiles to continue

to live in the area.

Page 166: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

144

CHAPTER 5

GENETIC RELATIONSHIP AMONG Crocodylus porosus FROM DIFFERENT

RIVER BASINS IN SARAWAK, MALAYSIAN BORNEO

5.1 Introduction

Human–wildlife conflict has become a huge problem in many parts of the world and

crocodilians are among the major groups involved in such situation. In Sarawak, conflict

between human and crocodile (HCC) as discussed in Chapter 3, showed a mark increased

especially in the past 20 years and this had concerned many people. Several actions have

been made by relevant agencies to tackle the problem, including culling and translocation of

problematic crocodiles from human populated areas to sanctuaries and inhabitant mangrove

areas (Tisen & Ahmad, 2010).

In the recent development, wild crocodile harvesting activities in Sarawak has been

permitted for those who have the licence, after the status of the animal, particularly the C.

porosus species, was transferred from Appendix I to Appendix II in CITES (Sarawak

Forestry Corporation, 2018). Local authority in Sarawak hopes that regulated harvest of C.

porosus could control the wild population as their numbers in rivers are on the rise (Abdul-

Gani, 2014). However, hasty actions without proper planning and supported by research data

could risk the population of the crocodiles and this could lead to the history of

overexploitation to be repeated.

Page 167: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

145

Understanding of genetic structure of wild crocodile populations could contribute to better

conservation management of the species especially when designing population

translocations or introducing sustainable harvest programs (Russello et al., 2007; Maltagliati

et al., 2010; Lapbenjakul et al., 2017). Any programmes involving the removal of individuals

from a population like translocations and harvesting could bring a risk of disrupting breeding

and social systems which may lead to negative impact to the population (Lewis et al., 2013).

Thus, genetic relationship information could help in understating the systems. In addition,

study on population genetics could also help in identifying key point to solve the conflicts

between human and crocodile in Sarawak by identifying potential demography expansion

and migrations of the animals.

Microsatellites or also known as short sequence repeats (SSRs) are repetitive sequences of

DNA, commonly from 2 to 6 bp in length, that are mostly found in non-coding regions of

eukaryotic genome. They are known to have high mutation rates that lead to higher allelic

variability and high levels of polymorphism, making them suitable for crocodile genetic

study (Bashyal et al., 2014). Microsatellite markers has been widely used in various genetic

studies of crocodile including populations genetics, paternity study and cross-species

hybridization (Lewis et al., 2013; Bashyal et al., 2014; Hekkala et al., 2015; Lapbenjakul et

al., 2017).

By using the microsatellite markers, researchers are able to shed lights on population

structure and also elucidate phylogeography in crocodilians species. Mauger et al. (2017)

studied on the population genetic structure of the American crocodile, C. acutus, in Pacific

Costa Rica, and from their study, they suggested that the C. acutus populations in the country

Page 168: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

146

were not panmictic as shown by moderate levels of genetic diversity. The crocodile

populations in Costa Rica were also identified experiencing genetic bottleneck, most likely

due to declined in number of crocodiles as a result of hunting and illegal poaching (Mauger

et al., 2017). Other studies utilising microsatellites have been able to identify genetic

differentiation in saltwater crocodile, C. porosus, populations from the Indo-Malay

Archipelago and the Western Pacific Ocean, with support from mtDNA markers (Gratten,

2003). Meanwhile, Russello et al. (2007) had found a separate haplotype for C. porosus

population in the Pacific island country of Palau compared to those that had been identified

by Gratten (2003) in Indo-Pacific region. A population genetic study of C. porosus from the

Northern Territory of Australia using mtDNA suggested that there is little to no genetic

structure within and between populations from the region, thus further studies looking at

other sensitive marker like microsatellite in combination with mtDNA to confirm the

findings (Luck et al., 2012).

Population genetic studies on crocodiles are still lacking in Malaysia especially in Sarawak.

Preliminary genetic studies by Shoon (2009), Abdullah (2010), Sulaiman (2011), Kasim

(2011) and Abdul-Gani (2014) had suggested a distinctive but close relationship among

crocodile populations from the coastal area of western, central and northern parts of Sarawak

through combined Cytochrome b and 12S Ribosomal gene, randomly amplified

polymorphic DNA (RAPD) and microsatellite data. However, Shoon (2009), Abdullah

(2010), Sulaiman (2011) and Kasim (2011) had used small number of samples, while Abdul-

Gani (2014) only used samples from one locality representing the western, central and

northern part of Sarawak. Furthermore, there is a possible expansion of wild crocodile

Page 169: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

147

populations in Sarawak with frequent movement occurs alongside the coastal region, based

on a high migration rate in the population genetic data (Abdul-Gani, 2014).

The previous genetic studies were focused on population from the coastal area (Shoon, 2009;

Kasim, 2011; Sulaiman, 2011; Abdul-Gani, 2014), but not much information known about

those in the upper region of the river within a large river basin. In the river basins like Rajang,

Lupar and Baram, crocodiles can be found up to hundred kilometers upstream of its main

river or tributaries as shown in the findings in Chapter 3 and Chapter 4. Hence, in this

chapter, genetic relationships among C. porosus from 13 locations across Sarawak including

from the middle or upper regions of river basins were investigated using three set of

microsatellite markers (Cj101, Cj105 and Cj131). Information on the genetic diversity,

population expansion and migrations (gene flow) between the populations were also

discussed in this chapter, so that the data could be used for conservation management of the

species and also to formulate ways to minimize HCC in Sarawak.

5.2 Materials and Methods

5.2.1 Sample collection

A total of 22 wild C. porosus from 13 locations in eight river basins in Sarawak were

captured in the present study (Figure 5.1). The crocodiles were caught manually by hand,

using scoop net or cast net (for animal less than 1.5 m) as described by Abdul-Gani (2014).

For large adult crocodiles (more than 1.5 m), samplings were accompanied by a group of

experienced personels in handling problematic crocodiles in Sarawak called Swift Wildlife

Action Team (SWAT), a unit in Sarawak Forestry Corporation (SFC). Cage traps were used

Page 170: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

148

for catching larger adult crocodiles. When a crocodile caught alive, the animal was restrained

properly before taking sample in order to prevent any incident to occur during the sampling

process. Samples MR002, MR003 and MR010 were collected from Miri crocodile farm

(MCF), while samples BN001 and BN002 were obtained from Tumbina Park, Bintulu

(TPB). Samples BN001 and BN002 are originated from Kemena River Basin (RB); they

were captured and relocated by the authority into the facility due to potential threat to local

people living along the river.

Samples were collected either in the form of tissue or blood. For tissue sample, a small piece

or the whole scute was cut from the crocodile’s tail using scalpel. The tail’s scute is most

commonly sampled for crocodile DNA. Besides scutes, tissue samples can also be collected

from other parts of the crocodile’s body such as from their tail, legs and body. For blood,

samples were collected using syringe with proper handling as techniques describe by Elsey

et al. (2008).

Samples that had been collected in the field were preserved using methods as follow:

i. Tissue samples

Tissue samples were put in sealed plastic bags (kept in cold condition and

immediately stored in -800C freezer when arrived at the laboratory) or in

preservation tube contain 70% ethanol solutions.

Page 171: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

149

ii. Blood samples

For blood samples, two methods of preservation recommended by Munson

(2000) were used. The first method was by dripping drops of blood on a thick

Whatman-type filter paper or touch the filter paper directly to the freshly opened

body cavity. Then the blood spots were dried in room temperature and stored in

sealed plastic bags. The second method was by mixing the blood with a buffer

solution contained 5% EDTA in the preservation tube.

All samples were then brought back to a laboratory in the Faculty of Resource Science and

Technology, UNIMAS and kept in -800C freezer until further molecular works. Information

on the sample’s area/tributaries location, species name, type of samples and date of sampling

were recorded and vouchered accordingly (Appendix B, see page 239 - 240). Each of the

samples were coded based on the origin of the crocodile or the location where the crocodile

was caught with the number of samples.

For example:

KP 001

Number of sample from sampling

area (eg.: 001= sample number 1)

Origin of the crocodile or the

location where the crocodile was

caught (eg.: KP= Kapit River)

Page 172: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

150

All the codes for place of sampling shown in the Table 5.1.

Table 5.1: Voucher codes for samples according to sampling area.

Area Code Sampling Area River Basin

(RB)

Number of Samples

(n)

1. BG Bintangor Rajang 2

2. BK Bako Sarawak River 2

3. BN Bintulu Kemena 2

4. DB Debak Saribas 2

5. KP Kapit Rajang 1

6. MR Miri Miri 3

7. PU Pusa Saribas 1

8. RO Roban Krian 1

9. SB Sibu Rajang 2

10. SJ Simunjan Sadong 1

11. SM Samarahan Samarahan 2

12. ST Santubong Sarawak River 2

13. TA Telaga Air Sarawak River 1

TOTAL 22

Page 173: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

151

Figure 5.1: Map of Sarawak showing locations of C. porosus samples collected in the present study.

Sibu

Kapit

Bako

Roban

Santubong

Telaga

Air

Debak

Pusa

Bintangor

Simunjan

Samarahan

Bintulu

Miri

Page 174: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

152

5.2.2 Total genomic DNA extraction and Polymerase Chain reaction (PCR)

amplification

Total genomic DNA was extracted from tissues and blood sample using 2%

cetyltrimethylammonium bromide (CTAB) protocols as described by Doyle and Doyle

(1987) with some modifications as suggested by Abdul-Gani (2014). For blood samples, the

bloods were subjected to few additional preparation steps suggested by Sambrook et al.

(1989) before proceed to CTAB protocols. The additional steps were including resuspended

the fresh or frozen blood, after thawing, in the phosphate-buffer saline followed by 15

minutes centrifuge at 15,000 rpm at 4 0C. The excess supernatant was discarded and nuclei

pellets were resuspended in 2% CTAB buffer before continued with the 2% CTAB DNA

extraction protocol. DNA extraction products then were assessed on 1% Agarose gel (AGE)

to determine the presence of total genomic DNA.

Polymerase Chain Reaction (PCR) was conducted using MyCyclerTM Thermal Cycler and

microsatellites analysis were follow Isberg et al. (2004) protocols. Three microsatellite

markers were used in this study namely Cj101, Cj105 and Cj131 as shown in the Table 5.2.

Page 175: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

153

Table 5.2: Microsatellite primers used in this study (Isberg et al., 2004).

Microsatellite

primer

Microsatellite Primer sequences (5’-3’)

Cj101 ACAGGAGGAATGTCGCATAATTG (forward)

GTTTATACCGTGCCATCCAAGTTAG (reverse)

Cj105 CAACAGAAAGTGCCACCTCAAG (forward)

GTTTGATTATGAGACACCGCCACC (reverse)

Cj131 GTTTGTCTTCTTCCTCCTGTCCCTC (forward)

AAATGCTGACTCCTACGGATGG (reverse)

For every microsatellite locus, the amplification reaction total volume was 25 μl which

comprised 5 unit/ μL of Taq DNA polymerase (1.5 μL), 10X Taq Buffer with KCl (5 μL),

10 mM dNTP mix (2 μL), 10 μM of forward and reverse primer (2 μL each), 25 mM MgCl2

(2.5 μL), 1 μL DNA template and approximately 9 μL sterile distilled water. Standard PCR

thermal conditions was used with preliminary denaturation at 94°C for 3 min; then 30 cycles

of strand denaturation at 94°C for 15 sec, annealing at 58°C for 30 sec, and extension at

72°C for 50 sec; followed by a final 4 minutes extension step at 720C and finally soaked at

4°C. A negative control was included in each batch of PCR amplification, consisting of all

of the amplification reaction components except for DNA template. Once the amplification

completed, the amplification products were detected by electrophoresis on 1% Agarose gel.

Page 176: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

154

5.2.3 DNA Sequencing and alignment

The nucleotide sequences of the PCR product were determined by the DNA sequencing

service of a private sequencing company Apical Scientific Sdn. Bhd., Seri Kembangan,

Selangor, Malaysia (formerly known as First Base Laboratories Sdn Bhd). The raw DNA

sequences were subjected to nucleotide Basic Local Alignment Search Tool or BLASTn

(http://blast.ncbi.nlm.nih.gov/Blast.cgi) as suggested by Altschul et al. (1990) for

verification of the species. The raw sequence then was edited followed by alignment using

ClustalX version 2.1 (Larkin et al., 2007). The nucleotide base composition was also

calculated to estimate nucleotide richness using MEGA 7.0 (Kumar et al., 2016). The DNA

sequences of microsatellite genes using primer Cj101, Cj105 and Cj131 were tested for

analysis of compatibility of the combined data set using the Incongruence Length Difference

Test (ILD) or also known as Partition Homogeneity Test (PHT) implemented in PAUP 4.0a

162 software (Swofford, 2002).

5.2.4 Phylogenetic tree and NETWORK reconstruction analyses

Four methods of phylogenetic analysis were used in the present study namely (i) Neighbour-

Joining (NJ), (ii) Maximum-Parsimony (MP), (iii) Maximum-Likelihood (ML) implemented

in the PAUP 4.0a 162 software (Swofford, 2002) and (iv) Bayesian Inference (BI) analyses

using MR. BAYES 3.2.6 software (Huelsenbeck & Ronquist, 2001). Model test, calculated

using PAUP 4.0a 162 software (Swofford, 2002), had chosen TVM as the best substitution

model, based on the Akaike Information Criterion (AIC) and the substitution model was

used in the ML and Bayesian analyses. In Bayesian analysis, two simultaneous metropolis-

Page 177: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

155

coupled Monte-Carlo Markov Chains were ran for 380 000 generations before the

probability of splits frequencies (p) less than 0.01. Tree(s) were generated in the end of the

analysis along with posterior probabilities in each node. A sequence, Tomistoma schlegelii

clone 1008-63 microsatellite sequence (Accession no: KJ004636.1) was retrieved from The

National Center for Biotechnology Information (NCBI) GenBank database and used as

outgroup in the phylogenetic analyses.

Median-joining (MJ) network was generated by NETWORK 4.6.1.1 (Bandelt et al., 1999)

for C. porosus based on the microsatellite haplotype data generated using DNA Sequence

Polymorphism (DNASP) version 6.11.01 software (Rozas et al., 2017) to estimate the

dispersion of the species.

5.2.5 Population genetics analyses

Measures of population genetic parameters such as nucleotide diversity (π) and nucleotide

divergence (Da) were estimated from microsatellite data sequences using DNASP 6.11.01

(Rozas et al., 2017). To test relationship between the corrected genetic distances and

geographical distances, Matric Correlation Analysis (Mantel test) was performed with 1000

permutations in Arlequin version 3.5 (Excoffier & Lischer, 2010). Measures of Nucleotide

Subdivision (Nst), Population Subdivision (Fst) and Gene Flow (Number of Migrants, Nm)

among populations of C. porosus were generated using DNASP 6.11.01 (Rozas et al., 2017).

Nst value was estimated using lynch and Crease (1990), whereas estimation for Fst and Nm

value was using Hudson et al. (1992). In order to investigate demographic history and

geographical population’s differentiation, analysis of Molecular Variance (AMOVA) was

Page 178: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

156

performed. Neutrality tests by Tajima, D (Tajima, 1989) and Fu’s Fs (Fu, 1997) were carried

out to test for deviation of sequence variation from evolutionary neutrality as well as a

mismatch distribution analysis (Rogers & Harpending, 1992) to infer population expansion

event occur in the populations of C. porosus alongside Batang Rajang. All AMOVA,

neutrality test and mismatch distribution analyses were performed in Arlequin 3.5 (Excoffier

& Lischer, 2010), whereas statistical significant were tested using 1000 permutations.

5.3 Results

5.3.1 Sequences characterization and Basic Local Alignment Search Tool (BLAST)

analysis

Samples from 22 crocodiles were successfully sequenced using three microsatellite markers

(Cj101, Cj105 and Cj131), totalling 66 sequences. Amplifications using marker Cj105

showed multiple bands when viewed under 1% Agarose gel while the other two markers,

Cj101, and Cj131, show single band (Appendix C). Among the three markers, amplification

using Cj101 marker yield the longest sequence length with 312 bp, followed by Cj105 (262

bp) and Cj131 (176 bp) (Table 5.3).

Page 179: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

157

Table 5.3: Sequence characterization for the microsatellite markers.

Microsatellite

markers

Sequence

length

(base

pair, bp)

Variable

sites

Variable sites Repeat

Motif Singleton

sites

Parsimonious

informative

sites

Cj101 312 34

(10.9%)

16

(47.1%)

18

(52.9%)

CA12

Cj105 262 29

(11.1%)

13

(44.8 %)

16

(55.2 %)

CA16

Cj131 176 18

(10.2%)

9

(50.0 %)

9

(50.0 %)

CA16

Percentage of variable sites for the three markers were in the range of 11.1% to 10.2% with

the highest was Cj105 gene and the lowest was Cj131 gene (Table 5.3). Of the 34 variable

sites in Cj101 gene, 16 sites were singleton, leaving 18 or 52.9% potentially parsimoniously

informative sites. For Cj105 gene, 13 out 29 variables sites were singleton sites, while

another 16 sites (55.2%) were parsimoniously informative characters. Meanwhile, in Cj131

genes the number of sites were equal with 9 (50.0%) out 18 variable sites were singleton and

parsimoniously informative sites, respectively.

All of the genes obtained using the three microsatellite markers shared similar repetition

base, CA, but have different in number of repetition motif. Cj101 sequences have 12 times

repetition of base CA, while Cj105 and Cj131 sequences have 16 times repetition of base

CA (Table 5.3).

Page 180: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

158

The average nucleotide base composition at the 1st, 2nd and 3rd codon position for all three

genes used in this study are shown in table 5.4. Based on the nucleotide base composition,

proportion of A+T base was higher when compared to G+C base. As examples, the

proportion of nucleotide base A+T : G+C at the 1st codon position for Cj101 genes was

55.5% : 44.4%, while proportion at 2nd position was 61.5% : 38.0% and at 3rd position, the

proportion was 57.2% : 42.5%.

Table 5.4: Average nucleotide base composition at the 1st, 2nd and 3rd codon position for

the three microsatellite markers in this study. All frequencies are in percentage (%).

Codon

positions

1st 2nd 3rd

Nucleotide

base

T(U) A C G T(U) A C G T(U) A C G

Cj101 21.0 34.5 37.0 7.4 19.0 42.5 31.5 6.5 22.0 35.2 31.0 11.5

Cj105 27.0 26.2 29.6 17.6 29.0 22.6 35.3 13.5 27.0 31.6 27.4 14.0

Cj131 25.0 32.8 29.2 13.3 34.0 22.4 28.4 14.7 36.0 22.0 28.2 14.2

Species verification through BLASTn for all sequences hit at least one or several matches

in NCBI GenBank for each microsatellite genes (Table 5.5).

Page 181: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

159

Table 5.5: Basic Local Alignment Search Tool (BLAST) result.

Markers Description Accession

no.

Query

match site

E-

value

Identities

(%)

Cj101 Crocodylus porosus

clone CpDi07

microsatellite sequence

EU593280.1 Site 97 - 275 3e-17 70%

Cj105 Crocodylus porosus

isolate 7707cro ultra

conserved element locus

chr2_24748 genomic

sequence

JQ876520.1 Site 133- 184 2e-06 83%

Crocodylus porosus

isolate 8700cro ultra

conserved element locus

chr3_299 genomic

sequence

JQ877513.1 Site 117-136 8.0 95%

Cj131 Crocodylus porosus

clone CpDi54

microsatellite sequence

EU593305.1 Site 13-37 1.2 92%

Crocodylus porosus

clone CpP2201

microsatellite sequence

EU593442.1 Site 1-32 4.1 81%

For all microsatellite Cj101 genes, BLAST result showed one similar hits with a nucleotide

sequence, Crocodylus porosus clone CpDi07 microsatellite sequence (Accession no:

EU593280.1) with the bases identical up to 70% (Table 5.5). The E-value was recorded very

low with the value of 3e-17.

Meanwhile for Cj105 genes, BLAST result showed two matches with C. porosus sequences

(Table 5.5). The match sequences were Crocodylus porosus isolate 7707cro ultra conserved

element locus chr2_24748 genomic sequence (JQ876520.1) and Crocodylus porosus isolate

8700cro ultra conserved element locus chr3_299 genomic sequence (JQ877513.1) with 83%

and 95% of bases identities and E- value of 2e-06 and 8.0, respectively.

Page 182: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

160

Two matches in NCBI GenBank with microsatellite Cj131 genes in this study were recorded

and both are microsatellite sequences (Table 5.5). Crocodylus porosus clone CpDi54

microsatellite sequence (EU593305.1) is 92% identical with Cj131 genes and has a E-value

of 1.2. Another match, Crocodylus porosus clone CpP2201 microsatellite sequence

(EU593442.1), has lower identities percentage (81%) and higher E-value (4.1).

5.3.2 Combine genes and haplotype build

The three genes were combined in this following order, the Cj101 gene, base site from 1 to

312; the Cj105 gene, from base site 313 to 574 and end by the Cj131 gene, from base site

575 to 750. Prior to combining the genes, they were subjected to the Partition Homogeneity

Test (PHT) and the result showed high p-value (p = 1.00) or not significant, meaning that all

three microsatellites genes, Cj101, Cj105 and Cj131 have similar evolutionary rates (Farris

et al., 1994; Dolphin et al., 2000). Thus, the three genes can be combined for phylogenetic

reconstruction.

Using the combine genes, 21 haplotypes were identified from the 22 individuals of C.

porosus sequenced in this study (Table 5.6). Each individual of C. porosus have unique

haplotype except for samples from Sibu. Two samples from Sibu, SB001 and SB002, share

the same haplotype (Hap_1).

Page 183: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

161

Table 5.6: Haplotype identity for 22 microsatellite sequences of C. porosus.

Haplotype Haplotype

Frequency

Voucher

samples

Locality River Basin

(RB)

Hap_1 2 SB001 Sibu Rajang

SB002

Hap_2 1 KP001 Kapit

Hap_3 1 BG001 Bintangor

Hap_4 1 BG002

Hap_6 1 SM002 Samarahan Samarahan

Hap_7 1 SM001

Hap_8 1 SJ001 Simunjan Sadong

Hap_9 1 DB002 Debak Saribas

Hap_10 1 DB001

Hap_11 1 PU001 Pusa

Hap_12 1 RO001 Roban Krian

Hap_5 1 TA001 Telaga Air Sarawak River

Hap_13 1 BK001 Bako

Hap_14 1 BK005

Hap_15 1 ST001 Santubong

Hap_16 1 ST002

Hap_17 1 MR002 Miri Miri

Hap_18 1 MR010

Hap_19 1 MR003

Hap_20 1 BN002 Bintulu Kemena

Hap_21 1 BN001

Page 184: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

162

5.3.3 Phylogenetic analysis

All the four phylogenetic trees shared almost similar in topologies with slightly different in

clade positions as shown in Neighbour-joining (Figure 5.2), Maximum Parsimony (Figure

5.3), Maximum likelihood (Figure 5.4) and Bayesian (Figure 5.5). All trees revealed the

monophyl of C. porosus with the outgroup species, T. schlegelii with 100% (NJ), 100%

(MP), 100% (ML) bootstrap supports and 1.00 (Bayesian posterior probabilities, BPP).

Bootstrap values ≥ 70% were considered significant, meaning the topologies of the nodes

were regarded as sufficiently resolved, while those of 50% to 70% showed tendencies

(Huelsenbeck & Ronquist, 2001). Meanwhile for posterior probabilities in Bayesian, values

≥ 0.98 or 98% were considered as significant.

All trees exhibited the existence of geographical clade. Samples from Telaga Air (TA001),

Santubong (ST001 and ST002) and Bako (BK001 and BK005) were in the same clade

namely Clade A with bootstrap value of 81% (NJ), 91% (MP), 90% (ML) and 0.98 (BPP).

These three localities are located in Sarawak RB, in the western side of Sarawak.

SM001 and SM002 from Samarahan RB and SJ001 from Sadong RB shared the same clade

(Clade B) in all trees with bootstrap value (81%, NJ; 91%, MP; 90%, ML and 0.98, BPP),

while samples from Saribas RB (PU001, DB001 and DB002) and Krian RB (RO001) were

grouped in the same sister clade (Clade C) with strong supports (54%, NJ; 70%, MP; 71%,

ML and 0.90, BPP), showing a close relationship among the crocodiles in those

neighbouring river basins.

Page 185: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

163

Clade D consists of BG001, BG002, SB001, SB002 and KP001 were originating from

Rajang RB particularly in middle and upper regions and the monophyletic relationship

between the samples were supported by strong bootstrap values (77%, NJ; 91%, MP; 82%,

ML and 0.98, BPP). Samples from Bintulu (BN001 and BN002) and Miri (MR002, MR003

and MR010) were grouped in a clade (Clade E) with bootstrap values of 77% (NJ), 90%

(MP), 96% (ML) and 0.93 (BPP).

Page 186: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

164

Figure 5.2: Microsatellite-based phylogenetic relationship for 22 C. porosus in Sarawak

inferred using Neighbour-joining (NJ) analysis. Support value next to the node are

bootstrap values.

MR002

MR010

MR003

BN002

BN001

BK001

BK005

ST001

ST002

TA001

SM001

SJ001

SM002

DB002

DB001

PU001

RO001

SB001

SB002

KP001

BG001

BG002

T.schlegelii

0.01 substitutions/site

77

77

76

81

90

77

54

57

100

54

E

a

A

a

B

a

C

a

D

a

Page 187: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

165

Figure 5.3: Microsatellite-based phylogenetic relationship for 22 C. porosus in Sarawak

inferred using Maximum Parsimony (MP) analysis. Support value next to the node are

bootstrap values.

MR002

MR010

MR003

BN002

BN001

SB001

SB002

KP001

BG001

BG002

BK001

BK005

ST001

ST002

TA001

SM002

SM001

SJ001

DB002

DB001

PU001

RO001

T.schlegelii

5 changes

83

90

77

91

79

87

91

70

100

E

a

D

a

A

a

B

a

C

a

Page 188: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

166

Figure 5.4: Microsatellite-based phylogenetic relationship for 22 C. porosus in Sarawak

inferred using Maximum likelihood (ML) analysis. Support value next to the node are

bootstrap values.

MR002

MR010

MR003

BN002

BN001

SB001

SB002

KP001

BG001

BG002

BK001

BK005

ST001

ST002

TA001

SM002

SM001

SJ001

DB002

DB001

PU001

RO001

T.schlegelii

0.01 substitutions/site

93

100

96

71

70

90

94

82

94

71

E

a

D

a

A

a

B

a

C

Page 189: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

167

Figure 5.5: Bayesian inference of the 50% majority rule consensus tree of Combine

microsattelite genes of C. porosus. Bayesian posterior probabilities are accordingly

indicated besides the branch nodes.

0.9

5

0.93

0.81

0.98

0.99

0.90

0.95

0.98

0.98

1.00

1.00

A

B

C

D

E

Page 190: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

168

5.3.4 NETWORK Analysis

The median-joining network for haplotypes of C. porosus showed distinct clusters based on

geographical areas, which indicates a high level of haplotype diversity (Figure 5.6). Five

groups of haplotypes clustered together or haplogroup were identified in the Network figure,

each representing different river basins and this was consistent with the topologies of the

phylogenetic trees (Figure 5.2 – 5.5). All C. porosus haplotypes from Sarawak RB (Hap_5,

Hap_13, Hap_14, Hap_15 and Hap_16) clustered in a group that was distinct from

haplotypes from Samarahan/Sadong RB (Hap_6, Hap_7 and Hap_8) by at least 5 mutational

steps. Meanwhile, Samarahan/Sadong haplotype cluster was separated with haplotypes from

Saribas/Krian RB (Hap_9, Hap_10, Hap_11 and Hap_12) in central region of Sarawak by at

least 5 mutational steps (Figure 5.6).

Saribas/Krian cluster of haplotypes were connected to a median vector (node A) by 2

mutation steps before the line connected to a cluster consist of haplotypes from C. porosus

sampled in middle part of Rajang RB with 3 mutational steps, totalling 5 mutational steps

differentiate between the two clusters (Figure 5.6). The node A could possibly infer the

missing haplotype representing population of C. porosus from lower region of Rajang RB,

which was unable unsampled in this study. A single haplotype from Kapit (Hap_2) was

isolated from the haplotypes of middle Rajang by 10 mutational steps, indicating high

genetic divergence between population in the middle and upper parts of Rajang RB (Figure

5.6).

Page 191: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

169

Haplotypes from Bintulu (Hap_20 and Hap_21) and Miri (Hap_17, Hap_18 and Hap_19) in

northern of Sarawak formed a cluster each, differentiated by 3 mutational steps (Figure 5.6).

Furthermore, distance between haplotype clusters represented the populations of C. porosus

in the northern of Sarawak (Bintulu and Miri clusters) and clusters in central region of

Sarawak (Saribas/Krian and Rajang clusters) were at least 11 mutational steps.

Page 192: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

170

Figure 5.6: The median-joining Network generated by NETWORK software version 5.0.0.3 illustrating the relationship of the saltwater

crocodile, C. porosus from different localities in Sarawak. Each circle represents a haplotype and the diameter of the circle is scale to the

haplotype frequency. Different colours in the circle represent different localities. Bold number next the lines connecting the haplotypes

indicate number of mutation step(s).

Miri Bintulu

Saribas/Krian

Samarahan/Sadong

Sarawak River

(Kuching)

Middle

Rajang

Upper

Rajang

Node A

Page 193: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

171

5.3.5 Population Genetic Analyses

Nucleotide diversity (π) among five populations of C. porosus in Sarawak were low with

values ranging from 1.0% to 2.7%, while net nucleotide divergence (Da) varies in between

0.7% to 3.3%, suggesting small genetic differentiation among the populations (Table 5.7).

Table 5.7: Measures of Nucleotide Diversity (π) and Net Nucleotide Divergence (Da)

among populations of C. porosus analysed by locations.

Locality Approx.

Distance

(km)

Nucleotide Diversity

(π)a,b

Net Nucleotide Divergence

(Da)

Sarawak River -

Samarahan/Sadong

69.4 0.01111 0.00795

Sarawak River -

Saribas/Krian

123.2 0.01763 0.01529

Sarawak River -

Rajang

271.0 0.02169 0.02246

Sarawak River –

Bintulu/Miri

532.3 0.02700 0.03358

Samarahan/Sadong

- Saribas/Krian

53.8 0.01044 0.00708

Samarahan/Sadong

– Rajang

201.6 0.01465 0.01454

Samarahan/Sadong

- Bintulu/Miri

462.9 0.01906 0.02517

Saribas/Krian -

Rajang

147.8 0.01268 0.00770

Saribas/Krian -

Bintulu/Miri

409.1 0.01917 0.02112

Rajang -

Bintulu/Miri

341.7 0.02035 0.02279

aEstimated using the Kimura 2-parameter distance (Kimura, 1980). bsites with gaps were

completely excluded.

Nucleotide diversity and net nucleotide divergence values were lower in populations from

western (Sg. Sarawak and Samarahan/Sadong) and central (Saribas/Krian and Rajang) of

Sarawak compare to population from northern (Bintulu/Miri). Between those populations

Page 194: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

172

and Bintulu/Miri population, Da values were much higher (2.1% - 3.3%). On the other hand,

Da values in between populations from western and central were ranging from 0.7% to 2.2%

(Table 5.7).

This information seems to indicate isolation by distance occurred to the populations of C.

porosus in Sarawak. However, mantel test showed a lack of significant relationship (only at

p < 0.5) between net nucleotide divergence (Da) and geographic distance among the five

populations of C. porosus in Sarawak (r = 0.957, p = 0.007, 1000 permutations). The mantel

test result revealed that isolation by distance was not applicable to the populations of C.

porosus in Sarawak, meaning that geographical distance is not necessarily influence the

migrations of the crocodile across the state.

The mismatch distribution of pairwise nucleotide among the microsatellite sequences data

for all the populations or each population, support population expansion hypotheses

following the expected distribution under the sudden expansion model and also the spatial

expansion model. This was indicated by the small sum of squared deviations (SSD) values

ranging from 0.05 – 0.16 for sudden expansion and 0.04 – 0.17 for spatial expansion with

lack of significance (sudden, p = 0.10 – 0.63; spatial, p = 0.28 – 0.86). In addition, values of

Harpending’s raggedness index (r) were also recorded low, ranging from 0.14 to 0.44 for

both expansion models and the analysis result showed lack of significant, p > 0.05 (Table

5.8), inferred as unimodal mismatch distribution in the C. porosus population. However,

scatterplots of mismatch distribution for each population (Figure 5.7a – Figure 5.7e) showed

multiple peaks in all populations, generally interpreted as multimodal mismatch distribution.

Page 195: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

173

Table 5.8: Summary statistics of Microsatellite Cj16 sequences variation in five

populations of C. porosus in Sarawak.

Populations N H D Fs Sudden expansion Spatial expansion

SSD r SSD r

Sarawak RB 5 5 -0.28

(p=0.50)

1.06

(p=0.15)

0.09

(p=0.10)

0.16

(p=0.82)

0.07

(p=0.36)

0.16

(p=0.83)

Samarahan/

Sadong RB

3 3 0.00

(p=1.00)

-0.08

(p=0.23)

0.16

(p=0.63)

0.44

(p=1.00)

0.17

(p=0.86)

0.44

(p=1.00)

Saribas /

Krian RB

4 4 -0.56

(p=0.43)

-0.36

(p=0.24)

0.08

(p=0.50)

0.22

(p=0.84)

0.08

(p=0.76)

0.22

(p=0.90)

Rajang RB 5 4 -0.78

(p=0.31)

0.78

(p=0.57)

0.13

(p=0.32)

0.39

(p=0.31)

0.13

(p=0.28)

0.39

(p=0.43)

Bintulu /

Miri RB

5 5 0.30

(p=0.66)

-1.51

(p=0.08)

0.05

(p=0.53)

0.14

(p=0.80)

0.04

(p=0.61)

0.14

(p=0.81)

N= number of sequences analyzed; H= number of haplotypes; D= Tajima’s statistic (P (Dsimul < Dobs),

Tajima 1989); Fs, Fu’s statistic (Fu 1997); SSD= sum of squared deviations of the observed and

expected mismatch with p values in parentheses; r, raggedness statistic (Harpending, 1994) with p

values in parentheses. ** Significance (p < 0.05) was determined using coalescent simulations in

Excoffier (2004). Sites with gaps were completely excluded.

Tajima ’s test of neutrality (D) for all populations of C. porosus resulted negative values

ranging from -0.28 to -0.78 except for Samarahan/Sadong (0.00) and Bintulu/Miri (0.30)

and lack of significance was observed (p = 0.31 to 1.00), indicating that the populations were

deviate from neutral and was evolved under non-random process (Table 5.8). Fu’s F

neutrality test gave non-significant negative values for Samarahan/Sadong (-0.08, p = 0.23),

Saribas / Krian (-0.36, p = 0.24) and Bintulu/Miri (-1.51, p = 0.08). Conversely, positive Fs

values were observed for Sarawak (1.06) and Rajang RB (0.78) with lack of significance (p

= 0.15 and 0.57, respectively) (Table 5.8).

Page 196: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

174

Figure 5.7: Mismatch distribution of C. porosus at (a) Sarawak RB, (b) Samarahan/Sadong RB, (c) Saribas/Krian RB, (d) Rajang RB and

(e) Bintulu/Miri RB population. The dark line represents the observed and light lines represent the expected distribution for each model.

-1

0

1

2

3

4

0 2 4 6 8 10

Fre

qu

ency

Pairwise Differences-1

0

1

2

3

4

0 2 4 6 8 10

Fre

qu

ency

Pairwise Differences

(b)

-1

0

1

2

3

4

0 2 4 6 8 10

Fre

qu

ency

Pairwise Differences

(c)

-1

0

1

2

3

4

0 2 4 6 8 10

Fre

qu

ency

Pairwise Differences

(d)

-1

0

1

2

3

4

0 2 4 6 8 10

Fre

qu

ency

Pairwise Differences

(e)

(a)

Page 197: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

175

The AMOVA analysis (Table 5.9) revealed that most of molecular variance was founded

among the populations (71.85%) than within the populations (28.51%), which both was

significantly differentiated (p = 0.00). This information possibly signified an unequal rate of

evolution occurs among lineages in the same populations.

Table 5.9: Measures of geographical population differentiation in Crocodylus porosus

based on an analysis of Molecular Variance approach using microsatellite sequences data.

Source of

variance

Variance

component

Percent (%)

variation

Fixation

index, ϕ

Pa

Among

populations

6.73 71.85

0.72 0.00*

Within

Populations

2.64 28.15

0.72 0.00*

Total 9.37 0.72 0.00±0.00

*Significant (p < 0.05). aProbability of finding a more-extreme variance component of the ϕ index

than that observed by chance alone after 1000 permutations.

Significant ϕST values were observed in the pairwise genetic differentiation among all the

populations (Table 5.9).

Table 5.10: Genetic differentiation matrix of populations calculated by ϕST. p values are

shown in parenthesis (below the diagonal).

Sarawak RB Samarahan

/ Sadong RB

Saribas /

Krian RB

Rajang RB Bintulu /

Miri RB

Sarawak RB -

Samarahan /

Sadong RB

0.52

(0.01±0.00)*

-

Saribas / Krian

RB

0.65

(0.01±0.00)*

0.52

(0.04±0.01)*

-

Rajang RB 0.73

(0.01±0.00)*

0.67

(0.01±0.00)*

0.50

(0.01±0.00)*

-

Bintulu / Miri

RB

0.82

(0.01±0.00)*

0.82

(0.01±0.00)*

0.74

(0.01±0.00)*

0.75

(0.01±0.00)*

-

*Significant (p < 0.05) with 1000 permutations.

Page 198: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

176

Low nucleotide Nucleotide (Nst) and population (Fst) subdivision with high number of

migrants per generation (Nm) were recorded in all five populations of C. porosus in Sarawak,

indicating there is gene flow occurs in the populations. Nst and Fst values were higher

between the population of Samarahan/Sadong and Bintulu/Miri (Nst = 0.83, Fst = 0.83)

compared to others, even more than Sarawak River – Bintulu/Miri populations although the

geographical distance between the areas are greater than Samarahan/Sadong - Bintulu/Miri

(Table 5.11). In addition, number of migrants per generation (Nm) for Samarahan/Sadong -

Bintulu/Miri was also lower compared to those in Sarawak River – Bintulu/Miri, further

indication that geographical distance is not necessarily influence the migrations of the

crocodile across Sarawak.

Table 5.11: Measures of Nucleotide Subdivision (Nst), Population Subdivision (Fst) and

Gene Flow (Number of Migrants, Nm) among populations of C. porosus analysed by

locations.

Locality Approx.

Distance

(km)

Nucleotide

Subdivision

(Nst)a

Estimate of

Population

Subdivision (Fst)b

Number of Migrants

per generation

(Nm)b

Sarawak River -

Samarahan/Sadong

69.4 0.55628 0.55414 0.40

Sarawak River -

Saribas/Krian

123.2 0.63199 0.62831 0.30

Sarawak River -

Rajang

271.0 0.71319 0.70911 0.21

Sarawak River –

Bintulu/Miri

532.3 0.80534 0.80096 0.12

Samarahan/Sadong

- Saribas/Krian

53.8 0.53648 0.53448 0.44

Samarahan/Sadong

– Rajang

201.6 0.69685 0.69432 0.22

Samarahan/Sadong

- Bintulu/Miri

462.9 0.82698 0.82410 0.11

Saribas/Krian -

Rajang

147.8 0.48104 0.47856 0.54

Saribas/Krian -

Bintulu/Miri

409.1 0.74098 0.73737 0.18

Rajang -

Bintulu/Miri

341.7 0.75127 0.74781 0.17

a Estimated using lynch and Crease (1990). b Estimated using Hudson et al. (1992).

Page 199: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

177

5.4 Discussion

Potentially parsimoniously informative sites found in the sequences of the microsatellite

genes Cj101, Cj105 and Cj131 are relatively high (50.0% - 55.2%), and this indicates that

the genes are reliable to infer genetic variations of C. porosus in Sarawak at the population

levels (Zainudin et al., 2010). The repeat base, CA, and number of repetition motif for each

markers gained in this study were consistent with what have been obtained by Hekkala et al.

(2015) using the same microsatellite markers. Most frequent repeat base among dinucleotide

in animal genomes is CA (Ellegren, 2004), which explain why many microsatellite markers

are constructed based on this repeat motif including for C. porosus. Higher proportion of

A+T base compared to G+C base found in the sequences in the present study, similar with

those reported by Li et al. (2007) who sequenced a complete genome of C. porosus. In their

study, Li et al. (2007) found out that A+T skew is higher than G+C skew in the C. porosus

genome, whereas the most abundant base is Adenine (A). In other animals like amphibian

and echinoderm, the similar bias was observed in their sequences where the frequencies of

A and T bases is higher than G and C bases (Maltagliati et al., 2010; Zainudin et al., 2010).

Generally, all sequences for each microsatellite genes in the present study matches with at

least one or several C. porosus sequences in NCBI GenBank with the high bases identical

range from 70% to 95% and relatively small E-value (except for one or two matches),

ranging from 3e-17 to 8.0. E-value equal to zero or closer to the value of zero show significant

match with the hit sequence (Karlin & Altschul, 1990). Thus, all of the matches with

microsatellite genes prove that sequences obtained in this study were from C. porosus.

Page 200: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

178

Altogether 21 microsatellite haplotypes were identified from the 22 individuals of C. porosus

sequenced in this study (Table 5.6), meaning that each individual of C. porosus have unique

haplotype except for samples from Sibu, where both SB001 and SB002 share the same

haplotype (Hap_1). This further support the reliability of microsatellite marker in inferring

genetic variation of C. porosus in Sarawak as different haplotype were identified from each

sample. The uniqueness of each haplotype in the presents study could also indicated high

genetic diversity among the C. porosus population of Sarawak. There are also different

haplotypes were identified in each sample from Miri (MR002, MR003 and MR010),

obtained from a crocodile farm (Miri Crocodile Farm, MCF), indicating the diversity of

crocodile populations is high for Miri population. MCF has been operating since 1992 and

the early brood stocks for crocodile ranching in the farm, were obtained from rivers in Miri

and Baram Rivers. In addition, the farm also has been used by the authority as holding

facility for captured crocodile that endanger local people in northern part of Sarawak. Thus,

mixture of adult crocodiles in MCF could best explained the high genetic diversity of C.

porosus from Miri.

Multimodal mismatch distribution shown in all populations scatterplots (Figure 5.7a –

Figure 5.7e) could depict a situation of general demographic stability in the populations

(Rogers & Harpending, 1992). There is a possibility that the crocodile populations are

experiencing demographic stability as the population still in the recovery process, due to

recent declining (Cox & Gombek, 1985). However, SSD and R values (Table 5.8) and

supported by gene flow (Nm) were consistent with the hypothesis of demographical

expansion model (Slatkin & Hudson, 1991; Rogers & Harpending, 1992; Ray et al., 2003;

Excoffier & Lischer, 2010). According to Maltagliati et al. (2010), population sub-

Page 201: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

179

structuring and mutation rate heterogeneity may account for multimodal mismatch

distribution, therefore rather than interpreted as demographic stability, the multimodal

mismatch distributions were the result of the presence of different haplogroups detected.

The negative D value in Tajima neutrality test for Sarawak River, Saribas/Krian and Rajang

populations (Table 5.8) could have indicated that the populations had experience a

bottleneck effect. About 30 to 40 years ago, the crocodile population in the wild were

dramatically decline due to overexploitation (Cox & Gombek, 1985), hence genetic

bottleneck could possibly happen in the population. Intensive harvesting of crocodiles and

their eggs during the exploitation era were recorded in those rivers especially in the Sarawak

and Rajang River (Cox & Gombek, 1985). Meanwhile, negative Fs values in

Samarahan/Sadong, Saribas/Krian and Bintulu/Miri would have inferred population

expansion or genetic hitchhiking in the populations (Zainudin et al., 2010), but not

significant enough (p > 0.05) to support the claim. Therefore, further investigation need be

done in the future to resolve this matter.

The data from the population genetic analysis also reveal that populations from Bintulu/Miri

in northern of Sarawak appeared to be slightly isolated with populations from the central

(Saribas/Krian and Rajang) and western part (Sarawak River and Samarahan/Sadong) based

on the low level of migrants per generation (Nm = 0.11 – 0.18) as well as Nst and Fst values

> 0.8, consistent with phylogenetic trees and Network topologies. High number of migrants

per generation (Nm) indicated frequent migration rate or gene flow among the populations

of C. porosus and further supporting the population expansion hypothesis.

Page 202: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

180

Population genetic data analysis suggest that there is the population expansion due to the

frequent migrations of C. porosus in Sarawak. Complex river systems and massive web-like

shape in several major river basins in Sarawak play major role influencing the expansion of

C. porosus across the state. Sarawak has 22 major river basins connected to several hundred

tributaries, plus peat swamp and mangroves areas that are associated with the river basins,

throughout 12 million hectares area of the state (Tisen & Ahmad, 2010). Crocodiles are

found in all of those river basins based on the HCC data (Chapter 3) and other reports (Tisen

& Ahmad, 2010; Hassan & Abdul-Gani, 2013; Abdul-Gani, 2014; Robi, 2014; Zaini et al.,

2014; Sarawak Forestry Corporation, 2018) and the animals were found travel frequently in

between the river basins.

In several neighbouring river basins in Sarawak, the distance between the mouth of the rivers

are small (closed to each other). As example, in Saribas/Krian and Samarahan/Sadong RB

the distance between the mouth of each rivers is approximately less than 60 km, thus it is

very possible for the crocodiles to travel across the sea to the next river basin. The ability to

swim across sea could also explained closed genetic relationship among crocodile in Bintulu

and Miri although both area have distance about 200 km. Sea barriers do not appear to pose

a significant obstruction for C. porosus to migrate since the reptiles can migrate across the

sea for a distance of more than 800 km (Gratten, 2003). Several movements of crocodiles

along the coastal area of Australia for hundreds kilometers had been recorded using

telemetry and GPS transmitter (Campbell et al., 2010; Campbell et al., 2013). River basins

are also connected to each other at some points, for instance Sarawak RB and Samarahan

RB, both were connected via several tributaries, one of them is a tributary call Loba Batu

Belat River. This could facilitate the migrations of the crocodile between the river basins. In

Page 203: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

181

addition, during NEM where rainfalls are relatively higher throughout the season period,

water level in the rivers are elevated and many areas like swamps and mangroves are flooded

with water (Sa’adi et al., 2017), and this situations are believed had facilitated the crocodile

to travel to other areas or moving from one waterway to another that were previously

disconnected by dry land . Crocodiles also use the water surface current during this monsoon

season to travel longer distance (Campbell et al., 2010). Furthermore, monsoon season in

Sarawak typically coincide with the breeding season of crocodile (Stuebing et al., 1985) and

the females can travel up to 50 km river distance from their original habitat to a another place

for nesting (Campbell et al., 2013).

Migrations of C. porosus in Sarawak are not only occur across the river basins, but the

expansion of the animal populations could also occur further upstream in a large river basin,

based on the high Nm values for Rajang populations (Table 5.8). In the present study, Rajang

populations were represented by samples that had been collected from middle (Bintangor

and Sibu) and upper (Kapit) region of the river basin. Saribas/Krian population are the

closest with Rajang RB with low Fst and high Nm (Table 5.8) indicating frequent migration

in both populations. Geographical distance between the Saribas/Krian and the mouth of

Rajang is estimated around 50 km, while the distance between the mouth with the middle

region of Rajang is approximately 100 km. According to Campbell et al. (2013), ‘nomadic’

crocodiles especially males prefer to foraging into new territory and travel long distances

including toward freshwater upstream looking for the best site to stay.

Page 204: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

182

5.5 Conclusion

Five distinct clades representing five C. porosus populations based on the different

geographical areas in Sarawak obtained in the phylogenetic and Network analysis indicating

that DNA microsatellite is a good gene marker to infer relationship among C. porosus in the

state. Furthermore, population genetic analyses showed that there is gene flow amongst the

five populations suggesting that frequent migrations occur between the populations of C.

porosus in Sarawak. Mismatch distribution shows multimodal pattern in the scatterplot

which is common for populations at demographic equilibrium. However, based on sudden

and spatial expansion SSD and R values, the populations are experiencing expansion. In

addition, neutrality tests support the population expansion hypothesis particularly in

Samarahan/Sadong, Saribas/Krian and Bintulu/Miri populations.

Page 205: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

183

CHAPTER 6

GENERAL DISCUSSION

The historical data (Chapter 3), ecological data (Chapter 4) and genetic data (Chapter 5)

collected in the present study are providing valuable information about the populations of C.

porosus in Sarawak. Data on conflicts between human and crocodile for over 118 years

period revealed that the crocodiles are dispersed in almost all major river basins in Sarawak,

even at the time when Sarawak was ruled by the colonial government prior to the year

1940’s. Indeed, it is believed that the crocodile has been long living in the rivers of Sarawak

based on the stories told by explorers who came to Sarawak (Wallace, 1869; Hornaday,

1885; Bartlett, 1895; Beccari, 1904) and the findings of crocodile earthen in several places

across Sarawak (Datan et al., 2012). The earthen crocodile replicas or known as ‘Baya tanah’

was built by indigenous people in Sarawak more than hundreds of years ago, portraying the

respect of the people towards crocodile, living in the nearby rivers at that period of time

(Datan et al., 2012).

A theory by Gratten (2003) suggested that estuarine crocodile have been migrated across

Indo-pacific region including in Borneo Island since Pleistocene glacial periods about 2

million years ago. During the Pleistocene periods, water level was about 120 m lower

compare to present day, hence reduced the distance between land and facilitate crocodile

migration between islands (Gratten, 2003). Afterward, the increasing water level since the

Pleistocene periods could allowed crocodile to disperse into wider area within Borneo Island.

Genetic diversity as inferred by microsatellite data in Chapter 5 further supports the long

Page 206: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

184

history of crocodile migration particularly in Sarawak as distinctive subpopulations were

identified according to the demographic area.

The attacks data suggest that crocodiles had been living in the upstream areas far from the

sea, since more than 100 years ago, for example two cases of crocodile attack has been

recorded as far as in Belaga and Palagus in 1920’s. Belaga and Pelagus are located more

than 200 km from the mouth of Rajang River. Crocodile surveys in the Rajang River Basin

(RB) (Chapter 4) had spotted crocodiles in tributaries at the middle and upper regions of the

river basin. The farthest tributary surveyed in the present study at Rajang RB is at Katibas

River in Song, Kapit, approximately more than 180 km distance from estuary, with possible

adult crocodiles were detected in the tributary.

The presence of crocodile in different regions (lower, middle and upper) of Rajang RB

indicated that C. porosus in Sarawak live in a wide range of habitats; from large salt water

river system and small tidal tributaries (near to estuary) in the lower region to hypo-saline

or fresh water non-tidal tributaries in the middle and upper regions. The crocodiles were

abundance in mangroves and Nypa areas near to the river mouth as well as their presences

were detected in riverbank areas dominated by mix plants in freshwater rivers. In the

crocodile surveys, there were crocodiles found in about 5 km deep into up- river of non-tidal

freshwater tributaries in the upper region of Rajang. Although C. porosus typically occur at

very low densities in the upstream reaches of freshwater rivers, their presence has or may

have a significant impact on the use of rivers and riparian areas by local people and livestock

(Lading, 2013; Tisen et al., 2013). Similar problem has been faced by other countries

including Australia and Indonesia whereas crocodiles were found in the upstream reaches

Page 207: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

185

(areas upstream of tidal influence) of freshwater rivers and their numbers has been increasing

into worrying figures (Letnic et al., 2011; Shaney et al., 2017).

Human activities and riverbank land use assessment in the surveyed rivers (Chapter 4) varies

among rivers, where the data reflected that anthropogenic pressures have impacts on the

crocodile distributions. In the surveys, the crocodile was not seen or only small number of

individuals were spotted in river areas within town proximity such as in Nyelong River and

Sarikei River near to Sarikei Town. Meanwhile, in Kanowit River near to Kanowit Town,

the crocodile was absent throughout the entire 18 km survey distance. Sarikei and Kanowit

Town, which are located at the river mouths, are experiencing rapid developments on its

riverbank areas and river usages for activities like fishing and boating are constantly high.

All these activities could impact the distribution of crocodile in the rivers and the distribution

pattern in those areas showed that crocodiles are avoiding high human populated areas.

Similarly, Shaney et al. (2017) who studied crocodile population in Indonesia found negative

correlation between the abundance of crocodiles with proximity to humans, meaning that

less crocodiles are found in areas close to humans, consistent with the result of the present

study.

However, this situation is not necessarily depicting that the crocodiles are avoiding all

human populated areas. There are studies elsewhere suggested that human disturbances may

not affect or have a weak influenced on crocodile distributions in the river (Fukuda et al.,

2008; Evans et al., 2016). In river areas near to villages or longhouses where human

disturbances and habitat degradation are considered moderate to low, crocodiles were still

found in close proximity with humans like in Igan and Belawai River in the present study.

Page 208: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

186

The crocodiles in the area might have tolerated with the level of disturbance and adapted

with the river conditions. In certain villages where proper garbage disposal areas are

unavailable, foods leftover or rubbish are thrown into the river and this could attract

crocodiles to come near the villages (Bernama, 2017; Hassan et al., 2018). Crocodiles have

well developed olfaction or sense of smell, hence odours from things like animal carcasses

and leftover bones that had been thrown into the river can be detected by the reptiles miles

away (Grigg & Gans, 1993). If the act of throwing garbage into the river is not stopped, it

feared that the garbage could attract crocodiles to come and stay in the areas near to the

people’s house and consequently could lead to potential risk of crocodile attacks.

Frequent migrations and on-going expansion occur within the population of C. porosus in

Sarawak as evidently shown by population genetic analyses in Chapter 5. This could explain

why their presence are detected in areas that were not known to have the reptiles before or

the crocodile were found reappear again in rivers where previously the animals had been

absent for years in the areas. Lately, riverine communities in Sarawak have rise their concern

about the matter and they hope the relevant agencies could take proper actions to prevent

conflicts with the crocodile (Hassan & Abdul-Gani, 2013). To elaborate further, in the

present study, two crocodiles were spotted in Poi River while in previous survey in 2014, no

crocodile was found in the river (Robi, 2014). Among the two crocodiles spotted in Poi

River, a hatchling was detected about 5 km upriver indicating the possibility of nesting

occurred in further reach of the tributary. Hatchling, with size less than 0.5 meter of body

length, are normally age less than six months (Webb et al., 1991) and the young crocodile

usually did not travel far from the place where it was hatched. At the young age, crocodile

hatchlings have short movement range, usually confine in waterway area near to their nest

Page 209: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

187

(Webb et al., 1977; Hanson et al., 2015). Female crocodiles might find secluded area like in

Poi River as suitable nesting ground, thus they frequently travel into the river.

The expansion of crocodile populations including into the new areas is most likely

influenced by a number of factors. First of all, crocodile populations in Sarawak are on the

road of recovery after severe decline in 1980’s and their densities in several rivers across

Sarawak are increasing (Tisen & Ahmad, 2010; Hassan & Abdul-Gani, 2013; Abdul-Gani,

2014; Sarawak Forestry Corporation, 2018), thus larger areas are needed to support the

growing populations. At the same time, with limited spaces and food sources found in a

particular river, crocodiles have to compete for the resources not just among themselves, but

also with other animals and human too. The dominant crocodiles, typically very large adults,

would take control of specific parts in the river that have the most abundant key resources

like aquatic foods, riverbank spaces for basking and ambushing terrestrial animal. Other

smaller adult crocodiles, on the other hand, would not be able to access the areas guarded by

the dominant crocodiles, therefore they had to forage into new areas (Hanson et al., 2015).

Successful conservation programs supported by the law protecting the crocodiles in Sarawak

may have resulting low fatality among young crocodiles, hence more crocodiles survive into

adulthood (Fukuda et al., 2014). The increasing number of young adult crocodiles could

contribute to the expanding population as what have been mentioned before, this group of

cohorts are the ones that travel long distances and foraging wider areas.

Human could be one of the contributing factors in the migration of crocodile. Sarawak is a

fast developing state in Malaysia, thus developments are rapid across the state. The

developments are influenced by the increasing number of human populations in Sarawak.

Page 210: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

188

The population of Sarawak is estimated to be around 1.72 million in 1991 with population

density of 14 persons/km2 then increased to 2.07 million in 2000, and the population rose to

2.47 million in 2010 with density of 20 persons/km2 (Department of Statistics Malaysia,

2017). With the average annual population growth rates in Sarawak are around 0.8% to 1.4%

from 2014 to 2017, it is expected that the population of people in Sarawak will reach 3

million by the year 2020. The surge of population in Sarawak can be seen in major cities and

towns throughout Sarawak as developments on those areas would attract more people to

come and stay in the urban areas.

Developing towns in Sarawak like Sarikei, Kanowit and Kapit are situated in area close to

rivers, thus land use for developments are expanding towards the riverbank. To support the

growing human population area, more residentials areas are built as well as business and

industrial buildings, leading to more riverbanks being cleared to give ways for the

development. In addition, demands for food sources are also increase, hence more

agriculture lands are opened near to the rivers and fishing activities are booming along the

waterway. As the center of economic activities for the surrounding area, the towns will

become hub for transportations and as the town situated next to a river, water transportation

is still a popular choice among the locals to travel and transport the goods.

These human activities and riverbank developments would affect the habitat and nesting

ground of the crocodiles and also change the ecology of the river, resulting less space area

habitable for crocodile and food sources are also becoming limited (Fukuda et al., 2008;

Shaney et al., 2017). Loud noise from activities in the city and high boat traffic in the river

could also affect the behavior of the crocodile in the river as the crocodile might have

Page 211: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

189

experience bad situation like collision with boat or sound from the city or boat engine

disturbs their feeding or basking activity (Grant & Lewis, 2010). Booming fishing activities

are not just depleting the food abundance for the crocodile, it could also have influence on

crocodile behavior in the river as the animal could have been injured or trap into net or hooks

that were setup by the fishermen. The changing in ecology of the river and all the

anthropogenic disturbance faced by the crocodiles are making harder for them to live in the

area, forcing them to migrate into new areas.

6.1 Management Implication

Managing crocodiles in Sarawak is a big challenge for the local authority. Sarawak has a

very vast area of waterways (about 124,449.51 km2), comprising 22 major rivers that stretch

from centre of Borneo into the sea, with plenty of tributaries, mangroves areas and peat

swamps which are associated to the major rivers and also a number of nature-form

waterholes such as Logan Bunut (Tisen & Ahmad, 2010). Therefore, monitoring crocodiles

in every corner of the waterways would be hard as it will cost a lot of money and manpower

as well as time consuming.

Since the time when the law was introduced to protect the crocodile in 1990’s, crocodile

management in Sarawak focused on conservation of the animal and efforts to recover the

wild population of the crocodiles. After almost three decades, the crocodile populations in

Sarawak are recovering and several rivers show increasing trend in density of the reptiles

(Tisen & Ahmad, 2010; Hassan & Abdul-Gani, 2013; Abdul-Gani, 2014; Sarawak Forestry

Page 212: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

190

Corporation, 2018). However, recovering population of wild crocodile in Sarawak has led

to rising conflicts between human and crocodile (HCC). Now, crocodile management needs

to find solutions that can help in mitigating HCC in the state and at the same time continue

with the efforts for conservation of crocodile and its habitat. With the current situation in

Sarawak where crocodile populations are expanding and also increasing in conflicts between

human and crocodile, formulating plans and making decision for crocodile management that

create a ‘win-win’ situation for both human and crocodile will not be an easy task. Hasty

decision made without proper studies and insufficient information known about the crocodile

are fear to have adverse effect on the crocodile population. Hence, information collected in

the present study could be useful in many ways to help the authority to manage the crocodiles

in Sarawak.

The data about crocodile’s population and habitat in Rajang RB collected in the present study

could provide clues about crocodile’s population in the rest of the river basins in Sarawak.

Rajang River is the longest river in Sarawak and from the present study, a variety of river

habitat that supports crocodile population from lower into upper region of the river were

documented. Similar habitats can be found in other river basins, therefore the data can be

used as reference to predict the dispersion and abundance of crocodile in other river basins.

The data also suggest the possibility of crocodile expansion that could reach the fresh water

sections hundreds of kilometers away from the estuary. The crocodile management agencies

can make early preparation if there are reports of crocodile sighting in freshwater section in

upriver and to warn not just the community in that area but also communities who live further

upstream about the potential risk of attack. Constant reminder and reliable information from

Page 213: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

191

the crocodile management agencies could also help communities to take further precaution

when using the river.

The removal of problematic or potentially threat crocodile from human populated area is

among the quickest options to mitigate HCC. This can be done through translocating the

animal into other places or through culling. In Sarawak, crocodiles culling and translocation

has been started even since the animal population started to make a comeback in 1990’s. At

that time, the removal activities, mostly culling, were carried out only when there were

crocodile attacks occurred and it involved the area or river where the attack occurred only

(Ritchie & Jong, 2002). However, in 2012, public sentiment on crocodile has reached boiling

point as series of attacks across Sarawak claimed human life and the number of attacks

reported increasing from previous year thus as the response, state-wide culling and

translocating of crocodiles were conducted across the state (Tisen et al., 2013).

From 2013 to 2017, there are at least 101 operations to remove problematic crocodiles from

human populated area were conducted by Swift Wildlife Action Team (SWAT) of SFC

throughout Sarawak (Sarawak Forestry Corporation, Unpublished data). In the operations,

about 46 crocodiles were killed (some were found dead in the traps) while another 47

crocodiles were captured alive and transferred into nearest holding facilities (eg: Matang

Wildlife Centre, Benaya Crocodile Farm) or wildlife sanctuaries / national parks (eg:

Similajau National Park). Most of the operations were conducted as a response to the

crocodile attacks incidents or reports by local peoples that concerned about their safety.

During the operations, the SWAT team only targeted crocodile that possess danger to the

human (size above 2.1m) and the team was using traps to captured or if needed, they will

Page 214: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

192

kill the crocodile by shooting (Sarawak Forestry Corporation, 2018). The carcass of

crocodile that had been killed during the operation were buried in strategic locations.

Culling and translocating of crocodiles from rivers might not fully effective in handling

problematic crocodiles in Sarawak and it could only act as temporary measures, mostly to

ease public anger and political demands. The removal programs can be very expensive and

time-consumptive, while in the long run it would not solve the problem as crocodiles are

elusive animals (Fukuda et al., 2014). In addition, homing instinct and the ability of crocodile

to travel long distance might become problems to the management as removal of the

crocodile from a river could end up fill by other crocodile or the translocated crocodile could

find way to return back to the particular river (Campbell et al., 2010; Campbell et al., 2013).

The removal activities could also give rise to some other issues including issues related to

ethical value and conservation.

However, despite all the reasoning, the culling and translocating of crocodile could help in

the management of the animal and the same time mitigate HCC especially with the current

state of recovery population in Sarawak. More systematic and efficient plans on conducting

culling and translocation activities can be formulated with the support of scientific data from

researches. For instance, data on crocodile attack collected in the present study could be used

to narrow down areas that have high records of attacks or areas that have potential risk of

HCC problems, includes area with a high population of residents; recreational areas or

resorts that organise water activities like bathing, boating and jet-skiing; schools, clinics and

places of worship. Crocodile monitoring need to focus on those areas and if crocodile pose

threats to human, the animals need to be removed.

Page 215: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

193

In the present study, an adult crocodile with size more than 2 m has been detected in area

close to a village in Igan and Belawai River, while a sub-adult, size 1.5 m to 2 m were spotted

approximately less 1 km distance from a school in Poi River. The presence of adult

crocodiles potentially possess a risk of attack to the community that live in that area

especially young children as the adult crocodiles are aggressive and they are perpetrator for

most of attacks (Caldicott et al., 2005; Fukuda et al., 2014; Fukuda et al., 2015). Therefore,

the adult crocodile should be removed from those areas before any attacks occur. ‘Crocodile

Removal Zones (CRZ)’ had been introduced by the crocodile management in Sarawak at

major population centres like Kuching City, Miri City, Sibu, Bintulu, Sri Aman, Limbang,

Niah and popular recreation areas such as Pasir Panjang, Damai Beach, Siar Beach, Wind

Cave. The presence of crocodiles in these areas will not be tolerated and will be culled or

captured and removed (Sarawak Forestry Corporation, 2018).

Among concerns when carrying out the removal programs are the translocated animal could

not adapt to the new environment due to distinctive habitat, social awkwardness and

inbreeding depression (Fukuda et al., 2014). This can be minimized through information

provided through researches as the data from studies can be used to decide the areas that best

suit for the translocated crocodile. The data could also be used as reference when deciding

areas that can be act as sanctuary for the crocodile, so that any nuisance crocodile can be

transferred into there. A total of 10 totally protected areas (TPAs) exists in Sarawak, where

crocodiles are found in the area, therefore these areas could be good sanctuaries for the

crocodiles. Crocodile habitats are well preserved in those areas, thus can help with the

conservation of the animal. Pulau Seduku, an island in Batang Lupar is being proposed as a

totally protected areas dedicated to the conservation of crocodiles (Tisen et al., 2013). State-

Page 216: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

194

wide culling and translocating of crocodiles that had been carried out in Sarawak since 2012

(Tisen et al., 2013) seems to have a minimal effect on genetic structure of C. porosus

populations in the state as there is no indications of population fragmentation occurred within

the C. porosus populations of Sarawak based on genetic data (Chapter 5).

In 2016, C. porosus in Malaysia was successfully transferred from Appendix I to Appendix

II, with wild harvest restricted to the state of Sarawak and a zero quota for wild specimens

for the other states of Malaysia (Sabah and Peninsular Malaysia) (Sarawak Forestry

Corporation, 2018). The purpose of transferring C. porosus to CITES Appendix II is to

enable the sustainable utilization of the wild population in Sarawak. The authority in

Sarawak has seen potential in utilizing crocodiles to generate incomes for local communities

and also for the state government in general, and at the same could help in reducing HCC

problems. With the current status of C. porosus in CITES Appendix II, local communities

could be able to involved in the harvesting of wild C. pososus and its eggs, crocodile’s

farming and ranching and also international and domestic trade. As C. porosus is a protected

species under state’s law, every individual or company who are interested in harvesting wild

crocodiles and their eggs need to acquire licence from the authority (Sarawak Forestry

Corporation, 2018).

Allowing harvesting of wild crocodiles in Sarawak would have pros and contras and it

potentially have positive and negative impacts towards the population in the state.

Conservationists feared that allowing harvesting would lead to the history of

overexploitation of crocodiles in Sarawak will repeat and it will cause extinction of the wild

crocodiles. The crocodile management in Sarawak need to take lessons from the past where

Page 217: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

195

the crocodile population in the wild once in the brink of extinction due to uncontrolled

hunting and over harvesting (Cox & Gombek, 1985) to formulate a master plan for

sustainable harvesting. On the genetic level, harvesting will reduce genetic variation in

crocodile population as when a number of crocodiles were taken out from the population,

the rest will have small circle of mating companion. Low genetic variation at low population

size may lead to inbreeding depression that could cause reduction in survival and

reproductive output and thus increase the probability of extinction (Bradshaw et al., 2006).

On the bright side, harvesting would help in reducing the number of crocodiles especially in

rivers that have high density of crocodiles. Large crocodiles that pose risk to local people

are typically targeted by hunters as it can be sold at a good price, thus this could ease the

burden of works for crocodile management team. Harvesting of large adult crocodiles could

also benefit smaller crocodiles particularly young adults as this will give them higher chance

of survival in area that previously dominated by the large crocodile (Bradshaw et al., 2006).

The most important advantage of harvesting of crocodile is that it could potentially reduce

HCC in Sarawak as the number of large crocodiles in the river will be decreased (Webb,

2008).

In the surveys by Sarawak Forestry Corporation (2018), it the estimated that the population

of C. porosus in Sarawak are around 13,507 (non-hatchling). Corrections for visibility bias

or correction factor adapted from Baylis (1987) was used in calculating the population

estimation from the relative density. According to Bayliss (1987), correction factor varies

between different size of crocodile due to the behaviour and wariness. The correction of

Page 218: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

196

visibility biases might also be increase in different habitats or river width (Fukuda et al.,

2011). Therefore, there is possibility that the population estimation is underestimated.

A quota of no more than 500 non-hatchlings and less than 2,500 eggs per year has been

proposed by the Sarawak state for the first three years of the harvesting program (Sarawak

Forestry Corporation, 2018). The annual harvest quota only takes less than 5% from 13,507

individuals of non-hatchling that has been estimated to exist in the rivers in Sarawak and it

is considered to have a high probability of being sustainable. After three years, surveys will

be conducted to assess the impact of the harvesting programmes and harvest rates will then

be adjusted up or down, based on the results. Relatively small off take of crocodiles from

the population could have minimum negative impact on the genetic diversity of the

population especially if the harvest programmes is likely to spread among several major

rivers in Sarawak (Bradshaw et al., 2006). Genetic data in the present study (Chapter 5) also

show relatively high genetic variation within population, hence chance for high reduction of

genetic diversity in crocodile population in Sarawak as the result of the propose quota of

harvesting is probably small.

The people in Sarawak has been long living in fear of crocodiles as many had become the

victims of crocodile attacks. Because of this, crocodile has been viewed negatively by the

local people, thinking that crocodiles are as animals that can only bring troubles, thus need

to be killed (Hassan & Abdul-Gani, 2013). Managing crocodile for conservations would be

not an easy task if the efforts are not supported by the people. Throughout the history people

have never conserved anything that they did not value positively (Webb, 2008), therefore it

is essential to change the negative perspective of people towards crocodile through

Page 219: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

197

awareness programmes. Local people need to know about the benefits of conservation of

crocodile and its habitat by explaining to them the important roles of crocodiles in

environment, socio-economy and cultures.

Potential contribution of crocodiles towards local economy through harvesting and

ecotourism activities, like what have been done in Australia (Ryan, 1998; Corey et al., 2018),

can be introduced to the people of Sarawak as this kind of benefits would attract more people

to involve in conservation efforts. The information on historical exploitation of crocodile

collected in the present study (Chapter 3) could be used in explaining to the people about the

risk of extinction, once almost occur to the crocodile population in Sarawak, if the crocodile

is not been managed in a sustainable manner and no effort is done to conserve the reptile and

its habitat. People may not have particularly liked crocodiles, but when they learn about the

positive values of crocodile, neither did they like the idea of the reptile going extinct and

being lost from the river forever (Webb, 2008).

Reducing HCC in Sarawak would also help in changing negative perspective of local people

towards crocodile. Every time case of crocodile attack on human or livestock reported in the

news, it will rise fear among the community and at the same time people will be mad at the

crocodile and will continue to consider it as a pest. The data collected in the present study

will become in handy, help in the assessing risk of crocodile attacks so that actions can be

taken to prevent more attacks occurred in Sarawak (Pooley, 2015). For instance, crocodile

attacks data especially for the last 20 years (Chapter 3) could be used as a reference to

identify ‘hotspot’ rivers or locations. The Lupar river, Saribas, Samarahan, Sarawak River

and Sadong are among the top five river basins that have high number of crocodile attacks

Page 220: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

198

from 2000 until 2017, therefore, awareness programmes need to be focused to the riverine

communities in these river basins. The awareness programmes are including educational

talks, information sharing and exhibitions, not just related to crocodile but also about the

importance of keeping the river clean for benefit of wildlife as well as human being. In

addition, placing warning signboard in strategic areas along the river is among the effective

way to remind locals and outsiders about the potential risk of crocodile attack.

Relevant agencies who are conducting awareness programmes could use the data and

findings in the present study to share with the locals about when crocodile attacks were

mostly happened and could be used to remind them to take extra precaution when using river

at the particular time. As an example, majority of the attacks occurred from evening to

midnight (Chapter 3, Figure 3.8), therefore, those who are commonly use river for bathing

or other activities at this time need to be extra careful. Furthermore, crocodile attacks were

also high in the months of March and April, during the Northeast monsoon and at the time

of high tide. The awareness programmes need to be focused on specific group of people

especially those who are utilizing river as a source of income and food such as fishermen,

crab collectors and others as they are vulnerable to crocodile attacks. Meanwhile, several

attacks involving workers in the plantation areas need serious attention by relevant agencies.

The awareness programmes should engage the plantation workers too and the authority

concern can advise plantations owners to provide proper bathing and toilet facilities for their

workers so that they will minimize using river for daily chores.

From the attacks data (Chapter 3), it is realized that high percentage of crocodile attacks

occurred when victims are in the water or at the riverbank, doing activities like bathing,

Page 221: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

199

washing clothes or tools and fishing. These activities pose the highest risks of attack in

Sarawak, hence people need to be reminded about the risk when doing the mentioned

activities in the rivers so that they will more alert with their surrounding. In hotspot areas,

community can be advised to minimize activities in the rivers or build fences (or enclosures)

in the water around places where they normally carry out the activities or landing stages to

prevent crocodile to come near to them when using the water body.

In Sri Lanka, the crocodile exclusion enclosures or locally known as ‘kimbula kotuwa’ are

made of thick palm or hard wood poles driven into the river bed, with each end of the

enclosure meeting the river bank (Stevenson et al., 2014). These traditional enclosures

typically built by local villagers to prevent crocodiles from entering the river area where the

people are using water for daily chores like bathing and washing tools. With the support

from the Sri Lanka government and public sectors, more solid and safer enclosures are

constructed using metal and wire to replace the traditional enclosures. The enclosures had

successfully lowered the risk of crocodile attack in Sri Lanka as there was no attacks reported

in area that have the facilities (Stevenson et al., 2014). The similar enclosures could also be

used in Sarawak especially in areas with high density of crocodiles and areas where peoples

are still using river for water sources. Local authority and public sectors also can contribute

by funding the construction of the enclosures, while the villagers can work together in

maintaining the enclosures if there is any damage and ensuring the enclosure free from river

debris.

Concerning behaviour of the large crocodiles wandering in the area near to the local people

houses, scavenging food leftover and rubbish that had been thrown into the river as in Igan

Page 222: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

200

River in the present study, has to be taken seriously by the community and the local authority.

This situation possesses risk of crocodile attacks toward the people who live in the area, thus

actions need to be taken to prevent any loss of life. Awareness programmes should

emphasize on the importance of proper waste disposal, while the local authority could

provide garbage collecting services for the community. The crocodile distribution data in the

present study could also be used to explain to the local community about the potential risk

of crocodile attacks if they do not stop throwing garbage into the rivers.

All cases of crocodile attacks involving children below 10 years old were resulting death to

the victims (Chapter 3, Figure 3.11). This showed how much vulnerable this age group when

they were attacked by the crocodile. Children usually unaware about the danger they will

face when they come near to the water body and also when they were attacked by the

crocodile, they are powerless to escape from even with a small crocodile (Fukuda et al.,

2015). Therefore, awareness programmes can be used to remind communities about the

importance of monitoring their children carefully and keep them away from waterways,

especially from river that are known to have crocodiles in it. Starting from 2012, awareness

campaigns called “3M Buaya” aiming to educate children on crocodiles had been carried out

by SFC. 3M stands for “Mengenali, Memahami and Memulihara” which means to Know,

Understand and Conserve while Buaya is the Malay word for crocodile (Tisen et al., 2013).

“3M Buaya” programs now had been expanded state-wide with the involvement of more

target groups and other relevance agencies such as Resident and District Offices, Police, Fire

and Rescue Department and Civil Defence. Although attacks still happen to children, it

shows some improvement in the number of attacks and severity of the attacks.

Page 223: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

201

CHAPTER 7

CONCLUSION AND RECOMMENDATIONS

In general, this study implies that the human-crocodile conflicts in Sarawak are influenced

by a number of factors, among them are the distribution of crocodiles in wide range of

habitats and the increasing crocodile populations. Analysing crocodile attacks data from

1900 until 2017 had provided essential information that can help in understanding the

patterns of HCC as well as distribution of crocodiles throughout the river basins in Sarawak.

From the data, it was noted that the trend of crocodile attacks on human in the Sarawak was

associated with the exploitation trend and recovery of the crocodiles in the state.

Furthermore, HCC had occurred in 22 river basins in Sarawak, thus this mean that the animal

has been populated all river basins throughout the state. The present study showed that the

C. porosus was distributed along the lower, middle and upper region of Rajang River Basin

suggesting that crocodiles in Sarawak can live in a wide range of habitat, from the large tidal

rivers in coastal area to the small non-tidal freshwater tributaries in the upper side of river

basin. Variation in the water quality, river habitats, riverbank developments and the

abundance of food influenced the density of crocodiles in the eight studied rivers in Rajang

River Basin. DNA microsatellite successfully infer the relationship among C. porosus in

Sarawak as five distintive clades based on the geographical areas (river basins), which can

be seen in the phylogenetic trees and Network. Furthermore, there is gene flow among the

five populations indicating frequent migrations occurs between the populations of C.

porosus in Sarawak. Populations of C. porosus in Sarawak are generally experiencing

expansion as support by the mismatch distribution and evolutionary neutrality test data,

suggesting that populations of crocodile in Sarawak are panmictic population.

Page 224: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

202

More research data are required to provide information for the authority to solve problems

related to crocodile in Sarawak and also in assisting the management of crocodile in the

state. Areas that can be further improved or study are;

1. Monitoring surveys need to be carried out regularly to determine the current

population status and distribution of crocodiles in Sarawak, e.g., survey in every year

for high HCC areas or major tributaries that recorded high crocodile density in

previous surveys or once in every two to three years for large rivers.

2. There is also a need to have a comprehensive study on the size of crocodile

populations in Sarawak as well as their seasonal behaviour and movement together

with the environmental event (drought, floods) and anthropogenic intervention

(pollution, river development, land use), in which affect the distribution of crocodiles

in the state. Human components can also be included in the study such as human

population expansion and human activities in/near waterways.

3. More DNA samples need to be collected from C. porosus populations in different

localities (or from different river order) in Sarawak including from freshwater

sections in upper reach of the rivers to further understand the genetic structure and

expansion of C. porosus in the state.

The limitations of the data set in the present study must be considered before using the

information. Human-crocodile conflicts (HCC) data used in the present study were based on

the reports of attacks collected from the available sources. Thus, there is a possibility that

some cases had not been reported to the authority. There were also limited available sources

related to crocodile attacks incidents within the period from 1946 to 1999. Cases of crocodile

Page 225: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

203

attack during that period of time could be higher than what had been collected in the present

study but without proper records on the matter, it would difficult to access the information.

Data on crocodile densities and distributions in eight rivers of Rajang RB had shed some

lights on the population of crocodiles in the river basin and also provides baseline

information on various aspect of the reptile which is lacking in Sarawak. However, data

collected in the present study only based on one-period survey in Southwest Monsoon season

(SWM), from the month of March to September 2017. Additional surveys including in

different season (Northeast Monsoon, NEM) and years would provide more substantial field

data on the crocodile population for better understanding of the species ecology and

behavior.

In the genetic study, although DNA microsatellite had successfully inferred the relationship

among C. porosus from 13 areas in Sarawak, it might not depict the whole genetic structure

of the species in the state. Samples from other areas or river basins could not be collected

during the study due to time constraints. DNA samples collected from different areas or river

basin will provide more information especially on the movement and expansion of

crocodiles in Sarawak.

Page 226: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

204

REFERENCES

Abdul-Gani, M. I. Z. (2014). Population Density, Human-Crocodile Conflict and Genetic Variation

among Saltwater Crocodile, Crocodylus porosus in Sarawak. (Unpublished Master's thesis).

Universiti Malaysia Sarawak, Sarawak, Malaysia.

Abdullah, N. S. S. (2010). Molecular Phylogeny of Saltwater Crocodiles (Crocodylus porosus) from

Sarawak based on Combined Cyt b and 12S rRNA Gene Analysis. (Unpublished Master's

thesis). Universiti Malaysia Sarawak, Sarawak, Malaysia.

Ali, H., Adenan, R., & Wan Abu Bakar, W. I. (2014). Saltwater Crocodile (Crocodylus porosus)

Survey in Miri and Bintulu Region. Paper presented at the Borneo Crocodile Forum, Sibu,

Sarawak, Malaysia.

Altschul, S. F., Gish, W., Miller, W., Myers, E. W., & Lipman, D. J. (1990). Basic Local Alignment

Search Tool. Journal of Molecular Biology, 215(3), 403-410.

Amarasinghe, A. T., Madawala, M. B., Karunarathna, D. S., Manolis, S. C., de Silva, A., &

Sommerlad, R. (2015). Human-Crocodile Conflict and Conservation Implications of

Saltwater Crocodiles Crocodylus porosus (Reptilia: Crocodylia: Crocodylidae) in Sri Lanka.

Journal of Threatened Taxa, 7(5), 7111-7130.

Ardiantiono, A., Sheherazade, Karta Atmadja, R., & Wardhani, A. (2015). Analisis Serangan Buaya

Muara (Crocodylus porosus) di Indonesia melalui eksplorasi Database CrocBITE

Berbasiskan Citizen Science (An Analysis of Saltwater Crocodile (Crocodylus porosus)

Attack in Indonesia using Citizen Science CrocBITE Database Exploration). Inovasi Online,

24(3), 8-16.

Axelsson, M., & Franklin, C. E. (2011). Elucidating the Responses and Role of the Cardiovascular

System in Crocodilians during Diving: Fifty Years on from the Work of C.G. Wilber.

Comparative Biochemistry and Physiology Part A: Molecular & Integrative Physiology,

160(1), 1-8.

Page 227: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

205

Azreen, A. (2015). Assessment of Saltwater Crocodiles along Bako River during Three Monsoon

Seasons. (Unpublished Final Year Project Report). Universiti Malaysia Sarawak, Sarawak,

Malaysia.

Balaguera-Reina, S. A., Espinosa-Blanco, A. S., Morales-Betancourt, M. A., Seijas, A. E., Lasso, C.

A., Antelo, R., & Densmore, L. D. (2017). Conservation Status and Regional Habitat

Priorities for the Orinoco Crocodile: Past, Present, and Future. PLOS ONE, 12(2), 1-20.

Bandelt, H. J., Forster, P., & Röhl, A. (1999). Median-Joining Networks for Inferring Intraspecific

Phylogenies. Molecular Biology and Evolution, 16(1), 37-48.

Barbour, M. T., Gerritsen, J., Griffith, G. E., Frydenborg, R., McCarron, E., White, J. S., & Bastian,

M. L. (1996). A Framework for Biological Criteria for Florida Streams Using Benthic

Macroinvertebrates. Journal of the North American Benthological Society, 15(2), 185-211.

Baring-Gould, S., & Bampfylde, C. A. (1909). A History of Sarawak under its Two White Rajahs,

1839-1908. London: H. Sotheran & Company.

Bartlett, E. (1895). The Crocodiles and Lizards of Borneo in the Sarawak Museum, with Descriptions

of Supposed New Species and the Variation of Colours in the Several Species during Life.

Journal of the Straits Branch of the Royal Asiatic Society, 28, 73-97.

Bashyal, A., Gross, B., Venegas-Anaya, M., Lowrance, F., & Densmore, L. (2014). Assessment of

Microsatellites in Estimating Inter-and Intraspecific Variation among Neotropical

Crocodylus Species. Genetics and Molecular Research, 13(3), 5492-5502.

Bayliss, P. (1987). Survey Methods and Monitoring within Crocodile Management Programmes. In

G. J. W. Webb, C. Manolis & P. J. Whitehead (Eds.), Wildlife Management: Crocodiles and

Alligators (pp. 157-175). Sydney: Surrey Beatty & Son and The Conservation Commission

of The Northern Territory.

Beccari, O. (1904). Wanderings in The Great Forests of Borneo: Travels and Researches of A

Naturalist in Sarawak. London: Archibald Constabale & Co Ltd.

Page 228: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

206

Bernama. (2017, April 3). SWAT Team Handles Rogue Crocs in Sarawak. New Straits Time.

Retrieved from https://www.nst.com.my/news/2017/04/226826/swat-team-handles-rogue-

crocs-sarawak.

Bolhen, H. (2017). Composition of Fish Fauna and Fishieries at Pelagus Area, Batang Rajang,

Sarawak. (Unpublished Master's thesis). Universiti Malaysia Sarawak, Sarawak, Malaysia.

Bradshaw, C. J. A., Fukuda, Y., Letnic, M., & Brook, B. W. (2006). Incorporating Known Sources

of Uncertainty to Determine Precautionary Harvests of Saltwater Crocodiles. Ecological

Applications, 16(4), 1436-1448.

Brazaitis, P. (1969). The Occurrence and Ingestion of Gastroliths in Two Captive Crocodilians.

Herpetoligica, 25, 63-64.

Brazaitis, P., & Watanabe, M. E. (2011). Crocodilian Behaviour: A Window to Dinosaur Behaviour?

Historical Biology, 23(1), 73-90.

Brien, M. L., Gienger, C. M., Browne, C. A., Read, M. A., Joyce, M. J., & Sullivan, S. (2017).

Patterns of Human–Crocodile Conflict in Queensland: A Review of Historical Estuarine

Crocodile (Crocodylus porosus) Management. Wildlife Research, 44(4), 281-290.

Brooke, M. (1913). My Life in Sarawak, by The Ranee of Sarawak. London: Methuen & Co. Ltd.

Caldicott, D. G. E., Croser, D., Manolis, C., Webb, G., & Britton, A. (2005). Crocodile Attack in

Australia: An Analysis of Its Incidence and Review of the Pathology and Management of

Crocodilian Attacks in General. Wilderness & Environmental Medicine, 16(3), 143-159.

Campbell, H. A., Watts, M. E., Sullivan, S., Read, M. A., Choukroun, S., Irwin, S. R., & Franklin,

C. E. (2010). Estuarine Crocodiles Ride Surface Currents to Facilitate Long-distance Travel.

Journal of Animal Ecology, 79(5), 955-964.

Campbell, H. A., Dwyer, R. G., Irwin, T. R., & Franklin, C. E. (2013). Home Range Utilisation and

Long-Range Movement of Estuarine Crocodiles during the Breeding and Nesting Season.

PLOS ONE, 8(5), 1-9.

Page 229: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

207

Campbell, H. A., Dwyer, R. G., Wilson, H., Irwin, T. R., & Franklin, C. E. (2015). Predicting the

Probability of Large Carnivore Occurrence: A Strategy to Promote Crocodile and Human

Coexistence. Animal Conservation, 18(4), 387-395.

CITES. (2018). Appendices I, II and III. Retrieved 22 March 2018, from

https://www.cites.org/eng/app/appendices.php.

Cooper-Preston, H., & Jenkins, R. W. G. (1993). Natural History of The Crocodylia. In C. G. Glasby,

J. Ross & P. L. Beesley (Eds.), Fauna of Australia Vol 2A: Amphibia and Reptilia (pp. 1-

15). Canberra: Australian Government Publishing Service.

Corey, B., Webb, G. J. W., Manolis, S. C., Fordham, A., Austin, B. J., Fukuda, Y., . . . Saalfeld, K.

(2018). Commercial Harvests of Saltwater Crocodile Crocodylus porosus Eggs by

Indigenous People in Northern Australia: Lessons for Long-term Viability and Management.

Oryx, 52(4), 697-708.

Cox, J. H., & Gombek, F. (1985). A preliminary survey of the crocodile resources in Sarawak, East

Malaysia. Kuala Lumpur: World Wildlife Fund (WWF) Malaysia.

Cozzi, G., Broekhuis, F., McNutt, J. W., Turnbull, L. A., Macdonald, D. W., & Schmid, B. (2012).

Fear of the Dark or Dinner by Moonlight? Reduced Temporal Partitioning among Africa's

Large Carnivores. Ecology, 93(12), 2590-2599.

Cramp, R. L., Meyer, E. A., Sparks, N., & Franklin, C. E. (2008). Functional and Morphological

Plasticity of Crocodile (Crocodylus porosus) Salt Glands. Journal of Experimental Biology,

211(9), 1482-1489.

Das, C. S., & Jana, R. (2018). Human–Crocodile Conflict in the Indian Sundarban: An Analysis of

Spatio-Temporal Incidences in Relation to People's Livelihood. Oryx, 52(4), 661-668.

Das, I. (2004). Collecting in the “Land below the Wind”, Herpetological Explorations of Borneo.

Bonner Zoologische Beiträge, 52(3/4), 231-243.

Datan, I., Stephen, C., & Nicholas, D. (2012). Earthen Crocodile Effigies (Buaya Tanah) of the Iban

of Sarawak: A Preliminary Study. Sarawak Museum Journal (New Series), LXX(9), 145-160.

Page 230: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

208

De Silva, A. (2013). The Crocodiles of Sri Lanka (Including Archeology, History, Folklore,

Traditional Medicine, Human-Crocodile Conflicts and a Bibliography of the Literature on

Crocodiles of Sri Lanka). Gampola: De Silva, Anslem.

Department of Statistics Malaysia. (2017). Statistic Yearbook of Sarawak 2016. Jabatan Perangkaan

Malaysia, Negeri Sarawak. Retrieved from https://newss.statistics.gov.my/newss-

portalx/ep/epDownloadContentSearch.seam?cid=131467.

Dolphin, K., Belshaw, R., Orme, C. D. L., & Quicke, D. L. J. (2000). Noise and Incongruence:

Interpreting Results of the Incongruence Length Difference Test. Molecular Phylogenetics

and Evolution, 17(3), 401-406.

Doyle, J. J., & Doyle, J. L. (1987). A Rapid DNA Isolation Procedure for Small Quantities of Fresh

Leaf Tissue. Phytochemical Bulletin, 19, 11-15.

Dunham, K. M., Ghiurghi, A., Cumbi, R., & Urbano, F. (2010). Human–wildlife Conflict in

Mozambique: A National Perspective, with Emphasis on Wildlife Attacks on Humans. Oryx,

44(2), 185-193.

Ellegren, H. (2004). Microsatellites: Simple Sequences with Complex Evolution. Nature Reviews

Genetics, 5, 435-445.

Elsey, R., Tracy, C. R., Lance, V., & Manolis, C. (2008). Collecting Blood from Crocodilians.

Crocodile Specialist Group Newsletter, 21(1), 21-22.

Emerling, C. A. (2017). Archelosaurian Color Vision, Parietal Eye Loss, and the Crocodylian

Nocturnal Bottleneck. Molecular Biology and Evolution, 34(3), 666-676.

Erickson, G. M., Gignac, P. M., Steppan, S. J., Lappin, A. K., Vliet, K. A., Brueggen, J. D., . . .

Webb, G. J. W. (2012). Insights into the Ecology and Evolutionary Success of Crocodilians

Revealed through Bite-force and Tooth-pressure Experimentation. PLOS ONE, 7(3), 1-12.

Evans, L. J., Jones, T. H., Pang, K., Saimin, S., & Goossens, B. (2016). Spatial Ecology of Estuarine

Crocodile (Crocodylus porosus) Nesting in a Fragmented Landscape. Sensors (Switzerland),

16(9), 1-10.

Page 231: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

209

Evans, L. J., Davies, A. B., Goossens, B., & Asner, G. P. (2017). Riparian Vegetation Structure and

the Hunting Behavior of Adult Estuarine Crocodiles. PLOS ONE, 12(10), 1-12.

Excoffier, L. (2004). Patterns of DNA Sequence Diversity and Genetic Structure after a Range

Expansion: Lessons from the Infinite-island Model. Molecular Ecology, 13(4), 853-864.

Excoffier, L., & Lischer, H. E. L. (2010). Arlequin Suite Ver 3.5: A New Series of Programs to

Perform Population Genetics Analyses under Linux and Windows. Molecular Ecology

Resources, 10(3), 564-567.

Farris, J. S., Källersjö, M., Kluge, A. G., & Bult, C. (1994). Testing Significance of Incongruence.

Cladistics, 10(3), 315-319.

Fu, Y.-X. (1997). Statistical Tests of Neutrality of Mutations Against Population Growth,

Hitchhiking and Background Selection. Genetics, 147(2), 915-925.

Fukuda, Y., Whitehead, P., & Boggs, G. (2008). Broad-scale Environmental Influences on the

Abundance of Saltwater Crocodiles (Crocodylus porosus) in Australia. Wildlife Research,

35(2), 167-176.

Fukuda, Y., Webb, G., Manolis, C., Delaney, R., Letnic, M., Lindner, G., & Whitehead, P. (2011).

Recovery of Saltwater Crocodiles Following Unregulated Hunting in Tidal Rivers of the

Northern Territory, Australia. The Journal of Wildlife Management, 75(6), 1253-1266.

Fukuda, Y., & Cuff, N. (2013). Vegetation Communities as Nesting Habitat for the Saltwater

Crocodiles in the Northern Territory of Australia. Herpetological Conservation and Biology,

8(3), 641-651.

Fukuda, Y., Saalfeld, K., Webb, G., Manolis, C., & Risk, R. (2013a). Standardised Method of

Spotlight Surveys for Crocodiles in the Tidal Rivers of the Northern Territory, Australia.

Northern Territory Naturalist, 24(1), 14-32.

Fukuda, Y., Saalfeld, K., Lindner, G., & Nichols, T. (2013b). Estimation of Total Length from Head

Length of Saltwater Crocodiles (Crocodylus porosus) in the Northern Territory, Australia.

Journal of Herpetology, 47(1), 34-40.

Page 232: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

210

Fukuda, Y., Manolis, C., & Appel, K. (2014). Management of Human-Crocodile Conflict in the

Northern Territory, Australia: Review of Crocodile Attacks and Removal of Problem

Crocodiles. The Journal of Wildlife Management, 78(7), 1239-1249.

Fukuda, Y., & Saalfeld, K. (2014). Abundance of Saltwater Crocodile Hatchlings is Related to

Rainfall in the Preceding Wet Season in Northern Australia. Herpetologica, 70(4), 439-448.

Fukuda, Y., Manolis, C., Saalfeld, K., & Zuur, A. (2015). Dead or Alive? Factors Affecting the

Survival of Victims during Attacks by Saltwater Crocodiles (Crocodylus porosus) in

Australia. PLOS ONE, 10(5), 1-12.

Gehring, P.-S., Pabijan, M., Randrianirina, J. E., Glaw, F., & Vences, M. (2012). The Influence of

Riverine Barriers on Phylogeographic Patterns of Malagasy Reed Frogs (Heterixalus).

Molecular Phylogenetics and Evolution, 64(3), 618-632.

Grant, P. B., & Lewis, T. R. (2010). High Speed Boat Traffic: A risk to Crocodilian Populations.

Herpetological Conservation and Biology, 5(3), 456-460.

Gratten, J. (2003). The Molecular Systematics, Phylogeography and Population Genetics of Indo-

Pacific Crocodylus. (Unpublished Doctoral dissertation). University of Queensland,

Australia.

Grigg, G. C., & Gans, C. (1993). Morphology and Physiology of the Crocodylia. In C. G. Glasby, J.

Ross & P. L. Beesley (Eds.), Fauna of Australia Vol 2A: Amphibia and Reptilia (pp. 326-

336). Canberra: Australian Government Publishing Service.

Grigg, G. C., & Seebacher, F. (2000). Crocodilian Thermal Relations. In G. C. Grigg, F. Seebacher

& C. E. Franklin (Eds.), Crocodilian Biology and Evolution (pp. 297-309). Sydney: Surrey

Beatty and Sons Pty Ltd.

Gunn, J., Hawkins, D., Barnes, R. F. W., Mofulu, F., Grant, R. A., & Norton, G. W. (2014). The

Influence of Lunar Cycles on Crop-raiding Elephants; Evidence for Risk Avoidance. African

Journal of Ecology, 52(2), 129-137.

Page 233: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

211

Hanson, J. O., Salisbury, S. W., Campbell, H. A., Dwyer, R. G., Jardine, T. D., & Franklin, C. E.

(2015). Feeding Across the Food Web: The Interaction between Diet, Movement and Body

Size in Estuarine Crocodiles (Crocodylus porosus). Austral Ecology, 40(3), 275-286.

Hassan, R., & Abdul-Gani, M. I. Z. (2013). Crocodiles in Western of Sarawak, Malaysia. Pp 90-94.

In World Crocodile Conference. Proceedings of the 22nd Working Meeting of the IUCN-SSC

Crocodile Specialist Group. Gland, Switzerland: IUCN.

Hassan, R., Ahmad, R., Md Adzhar, M. A. A., Abdul-Gani, M. I. Z., Ayob, A., & Zainudin, R.

(2016). Notes on the Wild Tomistoma Populations in Western Sarawak, Malaysian Borneo.

International Journal of Ecology, 2016, 1-7.

Hassan, R., Md Adzhar, M. A. A., Abdul-Gani, M. I. Z., & Ahmad, R. (2018). Assessment of Wild

Saltwater Crocodile Population in Bako River, Western Sarawak, Malaysian Borneo for

Potential Ecotourism Industry. Malaysian Applied Biology, 47(1), 131-138.

Hekkala, E. R., Platt, S. G., Thorbjarnarson, J. B., Rainwater, T. R., Tessler, M., Cunningham, S. W.,

. . . Amato, G. (2015). Integrating Molecular, Phenotypic and Environmental Data to

Elucidate Patterns of Crocodile Hybridization in Belize. Royal Society Open Science, 2(9),

1-15.

Hornaday, W. T. (1885). Two Years in the Jungle. The Experiences of A Hunter and Naturalist in

India, Ceylon, the Malay Peninsula and Borneo. New York: Charles Scribner’s Sons.

Hudson, R. R., Slatkin, M. & Maddison, W. P. (1992). Estimation of Levels of Gene Flow from

DNA Sequence Data. Genetics, 132, 583-589.

Huelsenbeck, J. P., & Ronquist, F. (2001). MRBAYES: Bayesian Inference of Phylogenetic Trees.

Bioinformatics, 17(8), 754-755.

Isberg, S. R., Chen, Y., Barker, S. G., & Moran, C. (2004). Analysis of Microsatellites and Parentage

Testing in Saltwater Crocodiles. Journal of Heredity, 95(5), 445-449.

Isberg, S. R., Thomson, P. C., Nicholas, F. W., Webb, G. J., Manolis, S. C., Barker, S. G., & Moran,

C. (2006). Quantitative Analysis of Production Traits in Saltwater Crocodiles (Crocodylus

Page 234: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

212

porosus): IV. Number of Scale Rows. Journal of Animal Breeding and Genetics, 123(1), 48-

55.

Iwata, T., Nakano, S., & Inoue, M. (2003). Impacts of past Riparian Deforestation on Stream

Communities in a Tropical Rain Forest in Borneo. Ecological Applications, 13(2), 461-473.

Jalden, D. (2004). Crocodilians and the Convention on International Trade in Endangered Species of

Wild Fauna and Flora (CITES). Pp 66-68. In Crocodiles. Proceedings of the 17th Working

Meeting of the IUCN-SSC Crocodile Specialist Group. Gland, Switzerland: IUCN.

Jet, O., Palaniappan, P. M., & Hussein, M. A. S. (2011). Population Ecology and Potential Food

Sources of The Saltwater Crocodiles in Kawang River, Sabah. Borneo Science, 28, 57-65.

Kanwatanakid-Savini, C., Pliosungnoen, M., Pattanavibool, A., Thorbjarnarson, J. B.,

Limlikhitaksorn, C., & Platt, S. G. (2012). A Survey to Determine The Conservation Status

of Siamese Crocodiles in Kaeng Krachan National Park, Thailand. Herpetological

Conservation and Biology, 7(2), 157–168.

Karlin, S., & Altschul, S. F. (1990). Methods for Assessing the Statistical Significance of Molecular

Sequence Features by using General Scoring Schemes. Proceedings of the National

Academy of Sciences, 87(6), 2264-2268.

Kasim, N. Y. (2011). Genetic Diversity of Saltwater Crocodiles (Crocodylus porosus) from Sarawak

Using Microsatellite Approach. (Unpublished Final Year Project Report). Universiti

Malaysia Sarawak, Sarawak, Malaysia.

Kaur, T. (2006). Segama River Survey. Crocodile Specialist Group Newsletter, 25(1), 14-15.

Keats, B. J. B., & Sherman, S. L. (2013). Chapter 13 - Population Genetics. In D. Rimoin, R. Pyeritz

& B. Korf (Eds.), Emery and Rimoin's Principles and Practice of Medical Genetics (pp. 1-

12). Oxford: Academic Press.

Kemmerer, E. W. (1904). A Gold Standard for Straits Settlements. Political Science Quarterly,

33(4), 636-649.

Page 235: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

213

Kimura, M. (1980). A Simple Method for Estimating Evolutionary Rate of Base Substitutions

through Comparative Studies of Nucleotide Sequences. Journal of Molecular Evolution, 16,

111-120.

Kumar, S., Stecher, G., & Tamura, K. (2016). MEGA7: Molecular Evolutionary Genetics Analysis

Version 7.0 for Bigger Datasets. Molecular Biology and Evolution, 33(7), 1870-1874.

Lading, E. (2013). Crocodile Attacks in Sarawak. Pp 96. In World Crocodile Conference.

Proceedings of the 22nd Working Meeting of the IUCN-SSC Crocodile Specialist Group.

Gland, Switzerland: IUCN.

Lamichhane, B. R., Persoon, G. A., Leirs, H., Poudel, S., Subedi, N., Pokheral, C. P., . . . de Iongh,

H. H. (2018). Spatio-temporal Patterns of Attacks on Human and Economic Losses from

Wildlife in Chitwan National Park, Nepal. PLOS ONE, 13(4), 1-18.

Langley, R. L. (2010). Adverse Encounters With Alligators in the United States: An Update.

Wilderness & Environmental Medicine, 21(2), 156-163.

Lapbenjakul, S., Thapana, W., Twilprawat, P., Muangmai, N., Kanchanaketu, T., Temsiripong, Y., .

. . Srikulnath, K. (2017). High Genetic Diversity and Demographic History of Captive

Siamese and Saltwater Crocodiles Suggest the First Step toward the Establishment of a

Breeding and Reintroduction Program in Thailand. PLOS ONE, 12(9), 1-21.

Larkin, M. A., Blackshields, G., Brown, N. P., Chenna, R., McGettigan, P. A., McWilliam, H., . . .

Higgins, D. G. (2007). Clustal W and Clustal X Version 2.0. Bioinformatics, 23(21), 2947-

2948.

Letnic, M., Carmody, P., & Burke, J. (2011). Problem Crocodiles (Crocodylus porosus) in the

Freshwater, Katherine River, Northern Territory, Australia. Australian Zoologist, 35(3),

858-863.

Lewis, J. L., FitzSimmons, N. N., Jamerlan, M. L., Buchan, J. C., & Grigg, G. C. (2013). Mating

Systems and Multiple Paternity in the Estuarine Crocodile (Crocodylus porosus). Journal of

Herpetology, 47(1), 24-33.

Page 236: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

214

Li, Y., Wu, X., Ji, X., Yan, P., & Amato, G. (2007). The Complete Mitochondrial Genome of Salt-

water Crocodile (Crocodylus porosus) and Phylogeny of Crocodilians. Journal of Genetics

and Genomics, 34(2), 119-128.

Ling, T.-Y., Soo, C.-L., Sivalingam, J.-R., Nyanti, L., Sim, S.-F., & Grinang, J. (2016). Assessment

of the Water and Sediment Quality of Tropical Forest Streams in Upper Reaches of the Baleh

River, Sarawak, Malaysia, Subjected to Logging Activities. Journal of Chemistry, 2016, 1-

13.

Ling, T.-Y., Soo, C.-L., Phan, T.-P., Nyanti, L., Sim, S.-F., & Grinang, J. (2017). Assessment of

Water Quality of Batang Rajang at Pelagus Area, Sarawak, Malaysia. Sains Malaysiana,

46(3), 401-411.

Low, H. (1848). Sarawak: its Inhabitants and Productions: being Notes during A Residence in that

Country with HH the Rajah Brooke. London: Richard Bentley.

Luck, N. L., Thomas, K. C., Morin-Adeline, V. E., Barwick, S., Chong, A. Y., Carpenter, E. L., . . .

Gongora, J. (2012). Mitochondrial DNA Analyses of the Saltwater Crocodile (Crocodylus

porosus) from the Northern Territory of Australia. Australian Journal of Zoology, 60(1), 18-

25.

Lynch, M. & Crease, T. J. (1990). The Analysis of Population Survey Data on DNA Sequence

Variation. Molecular Biology and Evolution, 7, 377-394.

Mahyan, N. R., & Selaman, O. S. (2016). Water Supply Resources and Management Practices in

Sarawak and Other Countries. Journal of Civil Engineering, Science and Technology, 7(2),

50-56.

Maltagliati, F., Di Giuseppe, G., Barbieri, M., Castelli, A., & Dini, F. (2010). Phylogeography and

Genetic Structure of the Edible Sea Urchin Paracentrotus lividus (Echinodermata:

Echinoidea) Inferred from the Mitochondrial Cytochrome b Gene. Biological Journal of the

Linnean Society, 100(4), 910-923.

Page 237: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

215

Martin, S. (2008). Global Diversity of Crocodiles (Crocodilia, Reptilia) in Freshwater.

Hydrobiologia, 595(1), 587-591.

Mauger, L. A., Velez, E., Cherkiss, M. S., Brien, M. L., Mazzotti, F. J., & Spotila, J. R. (2017).

Conservation Genetics of American Crocodile, Crocodylus acutus, Populations in Pacific

Costa Rica. Nature Conservation, 17, 1-17.

Mazzotti, F. J., Brandt, L. A., Moler, P., & Cherkiss, M. S. (2007). American Crocodile (Crocodylus

Acutus) in Florida: Recommendations for Endangered Species Recovery and Ecosystem

Restoration. Journal of Herpetology, 41(1), 122-132.

Messel, H., & Vorlicek, G. C. (1986). Population Dynamics and Status of Crocodylus porosus in the

Tidal Waterways of Northern Australia. Australia Wildlife Research, 13(1), 71-111.

Miles, L. G., Isberg, S. R., Moran, C., Hagen, C., & Glenn, T. C. (2009a). 253 Novel Polymorphic

Microsatellites for the Saltwater Crocodile (Crocodylus porosus). Conservation Genetics,

10(4), 963-980.

Miles, L. G., Lance, S. L., Isberg, S. R., Moran, C., & Glenn, T. C. (2009b). Cross-species

Amplification of Microsatellites in Crocodilians: Assessment and Applications for the

Future. Conservation Genetics, 10(4), 935-954.

Mohd-Azlan, J., Zulaiha, J., Lading, E., Nuriza, A. A., & Das, I. (2016). Employing Camera Traps

for Studying Habitat Use by Crocodiles in a Mangrove Forest in Sarawak, Borneo.

Herpetological Review, 47(4), 579-583.

Montague, J. (1983). Influence of Water Level, Hunting Pressure and Habitat Type on Crocodile

Abundance in the Fly River Drainage, Papua New Guinea. Biological Conservation, 26(4),

309-339.

Moritz, C. (1999). Conservation Units and Translocations: Strategies for Conserving Evolutionary

Processes. Hereditas, 130(3), 217-228.

Munson, L. (2000). Necropsy Procedures for Wild Animals. In W. B. Karesh, M. F. McEntee, L. J.

Lowenstine, M. E. Roelke-Parker, E. Williams & M. H. Woodford (Eds.), Conservation

Page 238: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

216

Research in the African Rainforests: A Technical Handbook (pp. 203-224). New York:

Wildlife Conservation Society.

Nagelkerken, I., Blaber, S. J. M., Bouillon, S., Green, P., Haywood, M., Kirton, L. G., . . . Somerfield,

P. J. (2008). The Habitat Function of Mangroves for Terrestrial and Marine Fauna: A

Review. Aquatic Botany, 89(2), 155-185.

Nagloo, N., Collin, S. P., Hemmi, J. M., & Hart, N. S. (2016). Spatial Resolving Power and Spectral

Sensitivity of the Saltwater Crocodile, Crocodylus porosus, and the Freshwater Crocodile,

Crocodylus johnstoni. The Journal of Experimental Biology, 219(9), 1394-1404.

National Research Council of United State of America. (1983). Crocodiles as a Resource for the

Tropics. The National Academies Press. Retrieved from

https://www.nap.edu/catalog/18531/crocodiles-as-a-resource-for-the-tropics.

Nazli, M. F., Hashim, N. R., & Zakaria, M. (2009). Distribution, Abundance and Habitat

Conservation of Crocodylus porosus in Rembau-Linggi Estuary, Peninsular Malaysia. Pp

130-135. In Postgraduate Qolloquium First Semester 2009/2010. Selangor, Malaysia:

Universiti Putra Malaysia.

O'Shea, M., & Halliday, T. (2002). Reptiles and Amphibians. New York: Dorling Kindersley.

Official Website of Department of Irrigation and Drainage Sarawak. (2017). Sarawak Major River

Basin. Retrieved 18 May 2016, from http://www.did.sarawak.gov.my/page-0-314-315-

Resource-Centre-IRBM-22-Basins.html.

Packer, C., Swanson, A., Ikanda, D., & Kushnir, H. (2011). Fear of Darkness, the Full Moon and the

Nocturnal Ecology of African Lions. PLOS ONE, 6(7), 1-4.

Parenti, L. R., & Lim, K. K. (2005). Fishes of the Rajang Basin, Sarawak, Malaysia. Raffles Bulletin

of Zoology, 13, 175-208.

Platt, S. G., & Thorbjarnarson, J. B. (2000). Population Status and Conservation of Morelet's

Crocodile, Crocodylus moreletii, in Northern Belize. Biological Conservation, 96(1), 21-29.

Page 239: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

217

Pooley, S. (2014). An Historical Overview of Human Crocodile Conflict in South Africa and

Swaziland, 1949-2014. Pp 236-245. In Crocodiles. Proceedings of the 23rd Working Meeting

of the IUCN-SSC Crocodile Specialist Group. Gland, Switzerland and Cambridge, UK:

IUCN.

Pooley, S. (2015). Using Predator Attack Data to Save Lives, Human and Crocodilian. Oryx, 49(4),

581-583.

Ray, N., Currat, M., & Excoffier, L. (2003). Intra-Deme Molecular Diversity in Spatially Expanding

Populations. Molecular Biology and Evolution, 20(1), 76-86.

Read, M. A., Miller, J. D., Bell, I. P., & Felton, A. (2004). The Distribution and Abundance of the

Estuarine Crocodile, Crocodylus porosus, in Queensland. Wildlife Research, 31, 527-534.

Read, M. A., Grigg, G. C., Irwin, S. R., Shanahan, D., & Franklin, C. E. (2007). Satellite Tracking

Reveals Long Distance Coastal Travel and Homing by Translocated Estuarine Crocodiles,

Crocodylus porosus. PLOS ONE, 2(9), 1-5.

Ritchie, J., & Jong, J. (2002). Man-eating Crocodiles of Borneo. Kota Kinabalu, Sabah: Natural

History Publications (Borneo).

Robi, N. J. (2014). Estuarine Crocodile Distribution in Sibu Region, Sarawak. Paper presented at the

Borneo Crocodile Forum Sibu, Sarawak, Malaysia.

Rodgers, E. M., Schwartz, J. J., & Franklin, C. E. (2015). Diving in a Warming World: The Thermal

Sensitivity and Plasticity of Diving Performance in Juvenile Estuarine Crocodiles

(Crocodylus porosus). Conservation Physiology, 3(1), 1-9.

Rogers, A. R., & Harpending, H. (1992). Population Growth Makes Waves in the Distribution of

Pairwise Genetic Differences. Molecular Biology and Evolution, 9(3), 552-569.

Rozas, J., Ferrer-Mata, A., Sánchez-DelBarrio, J. C., Guirao-Rico, S., Librado, P., Ramos-Onsins,

S. E., & Sánchez-Gracia, A. (2017). DnaSP 6: DNA Sequence Polymorphism Analysis of

Large Data Sets. Molecular Biology and Evolution, 34(12), 3299-3302.

Page 240: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

218

Russello, M. A., Brazaitis, P., Gratten, J., Watkins-Colwell, G. J., & Caccone, A. (2007). Molecular

Assessment of the Genetic Integrity, Distinctiveness and Phylogeographic Context of the

Saltwater Crocodile (Crocodylus porosus) on Palau. Conservation Genetics, 8(4), 777-787.

Ryan, C. (1998). Saltwater Crocodiles as Tourist Attractions. Journal of Sustainable Tourism, 6(4),

314-327.

Sa’adi, Z., Shahid, S., Ismail, T., Chung, E.-S., & Wang, X.-J. (2017). Distributional Changes in

Rainfall and River Flow in Sarawak, Malaysia. Asia-Pacific Journal of Atmospheric

Sciences, 53(4), 489-500.

Sah, S. A. M., & Stuebing, R. B. (1996). Diet, Growth and Movements of Juvenile Crocodiles

Crocodylus porosus Schneider in the Klias River, Sabah, Malaysia. Journal of Tropical

Ecology, 12(5), 651-662.

Sambrook, J., Fritsch, E., & Maniatis, T. (1989). Molecular Cloning: A Laboratory Manual. Cold

Spring Harbor, NY: Cold Spring Harbor Laboratory Press.

Sarawak Forestry Corporation. (2018). Management Plan for Estuarine Crocodile (Crocodylus

porosus) in Sarawak 2016-2020. Kuching: Sarawak Forestry Corporation.

Sarawak Gazette. (June 1, 1933). Government Printing Service, Kuching, Sarawak.

Sarawak Gazette. (July 1, 1929). Government Printing Service, Kuching, Sarawak.

Sarawak Gazette. (November 1, 1927). Government Printing Service, Kuching, Sarawak.

Sarawak Gazette. (May 2, 1908). Government Printing Service, Kuching, Sarawak.

Schneider, J. G. (1801). Historiae Amphibiorum naturalis et literariae. Fasciculus secundus

continens Crocodilos, Scincos, Chamaesauras, Boas. Pseudoboas, Elapes, Angues.

Amphisbaenas et Caecilias. Jena: Sumtibus F. Frommanni.

Seymour, R. S., Bennett‐Stamper, C. L., Johnston, S. D., Carrier, D. R., & Grigg, G. C. (2004).

Evidence for Endothermic Ancestors of Crocodiles at the Stem of Archosaur Evolution.

Physiological and Biochemical Zoology, 77(6), 1051-1067.

Page 241: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

219

Shafiei-Astani, B., Ong, A. H. K., Valdiani, A., Tan, S. G., Yien, C. Y. S., Ahmady, F., . . . Kuar, T.

(2015). Molecular Genetic Variation and Structure of Southeast Asian Crocodile

(Tomistoma schlegelii): Comparative Potentials of SSRs versus ISSRs. Gene, 571(1), 107-

116.

Shaney, K. J., Hamidy, A., Walsh, M., Arida, E., Arimbi, A., & Smith, E. N. (2017). Impacts of

Anthropogenic Pressures on the Contemporary Biogeography of Threatened Crocodilians in

Indonesia. Oryx, 2017, 1-12.

Shoon, A. (2009). Sequencing of Cytochrome b and 12S mtDNA Genes of Saltwater Crocodiles,

Crocodylus porosus from Sarawak. (Unpublished Final Year Project Report). Universiti

Malaysia Sarawak, Sarawak, Malaysia.

Sideleau, B. M., & Britton, A. (2013). An Analysis of Crocodilian Attacks Worldwide for the Period

of 2008 - July 2013. Pp 110-113. In World Crocodile Conference. Proceedings of the 22nd

Working Meeting of the IUCN-SSC Crocodile Specialist Group. Gland, Switzerland: IUCN.

Sideleau, B. M., Edyvane, K. S., & Britton, A. R. C. (2016). An Analysis of Recent Saltwater

Crocodile (Crocodylus porosus) Attacks in Timor-Leste and Consequences for Management

and Conservation. Marine and Freshwater Research, 68(5), 801-809.

Slatkin, M., & Hudson, R. R. (1991). Pairwise Comparisons of Mitochondrial DNA Sequences in

Stable and Exponentially Growing Populations. Genetics, 129(2), 555-562.

Stevenson, C., De Silva, A., Vyas, R., Nair, T., Mobaraki, A., & Aleem Chaudhry, A. (2014).

Human-Crocodile Conflict in South Asia and Iran. Pp 209-226. In Crocodiles. Proceedings

of the 23rd Working Meeting of the IUCN-SSC Crocodile Specialist Group. Gland,

Switzerland and Cambridge, UK: IUCN.

Stuebing, R., Ismail, G., & Kusuadi, S. (1985). The Ecology of Crocodile Attacks in Batang Lupar,

Sarawak. Sarawak Museum Journal, 34, 195-215.

Stuebing, R., Ismail, G., & Ching, L. H. (1994). The Distribution and Abundance of the Indo-Pacific

Crocodile Crocodylus porosus Schneider in the Klias River, Sabah, East Malaysia.

Biological Conservation, 69, 1-7.

Page 242: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

220

Sulaiman, M. K. (2011). Genetic Diversity of Sarawak Saltwater Crocodile (Crocodylus porosus)

using PCR-RAPD. (Unpublished Final Year Project Report). Universiti Malaysia Sarawak,

Sarawak, Malaysia.

Sulaiman, N. A. S. (2018). Fisherman's Knowledge of the Moon Phenomenon in Fishing Activities.

International Journal of Academic Research in Business and Social Sciences, 8(11), 941-

949.

Swofford, L. D. (2002). PAUP*. Phylogenetic Analysis Using Parsimony (*and Other Methods).

Version 4.0b10. Sunderland, Massachusetts: Sinauer Associates.

Taigor, S. R., & Rao, R. J. (2014). Assessments of Potential Suitable Habitats Stretch of Fresh Water

Crocodile, Gharial Gavialis gangeticus (Gmelin 1789) in the Chambal River, Madhya

Pradesh, India. International Journal of Environmental Sciences, 4(4), 544-550.

Tajima, F. (1989). Statistical Method for Testing the Neutral Mutation Hypothesis by DNA

polymorphism. Genetics, 123(3), 585-595.

Thorbjarnarson, J. (1999). Crocodile Tears and Skins: International Trade, Economic Constraints,

and Limits to the Sustainable Use of Crocodilians. Conservation Biology, 13(3), 465-470.

Tisen, O., & Ahmad, R. (2010). Crocodylus porosus in Sarawak: Status and Management. Paper

presented at the IUCN-SSC crocodile specialist group (CSG) Workshop on Human-

crocodile conflict, Sabah, Malaysia.

Tisen, O., Gombek, F., Ahmad, R., & Ubang, C. K. (2013). Human-Crocodile Issues: Sarawak

Report. Pp 115. In World Crocodile Conference. Proceedings of the 22nd Working Meeting

of the IUCN-SSC Crocodile Specialist Group. Gland, Switzerland: IUCN.

UK Office for National Statistics. (2019). How to Calculate Inflation Rate for £1, 1900 to 2017.

Retrieved 16 April, 2019, from https://www.officialdata.org/1900-GBP-in-2017?amount=1.

Wallace, A. R. (1869). The Malay Archipelago: The Land of the Orang-utan and the Bird of Paradise

: A Narrative of Travel, with Studies of Man and Nature. London: Macmillan and Co.

Page 243: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

221

Webb, G. J. W., Messel, H., & Magnusson, W. (1977). The Nesting of Crocodylus porosus in

Arnhem Land, Northern Australia. Copeia, 1977(2), 237 - 249.

Webb, G. J. W., & Messel, H. (1979). Wariness in Crocodylus porosus (Reptilia : Crocodilidae).

Wildlife Research, 6(2), 227-234.

Webb, G. J. W., Manolis, S., Buckworth, R., & Sack, G. (1983). An Examination of Crocodylus

porosus Nests in Two Northern Australian Freshwater Swamps, with an Analysis of Embryo

Mortality. Wildlife Research, 10(3), 571-605.

Webb, G. J. W., Hollis, G. J., & Manolis, S. C. (1991). Feeding, Growth and Food Conversion Rates

of Wild Juvenile Saltwater Crocodiles (Crocodylus porosus). Journal of Herpetology, 25(4),

462-473.

Webb, G. J. W. (2008). Wicked Problems with Wicked Crocodiles. Pp 241-249. In Crocodile.

Proceedings of the 19th Working Meeting of the IUCN-SSC Crocodile Specialist Group.

Gland, Switzerland: IUCN.

Webb, G. J. W., Manolis, C., & Brien, M. L. (2010). Saltwater Crocodile, Crocodylus porosus. In C.

Manolis & C. Stevenson (Eds.), Crocodile. Status Survey and Conservation Action Plan.

Third Edition (pp. 99-113). Darwin: Crocodile Specialist Group.

Whitaker, R. (1984). Preliminary survey of crocodiles in Sabah, East Malaysia. Kuala Lumpur:

World Wildlife Fund (WWF) Malaysia.

Woodward, A. R., Franklin Percival, H., Heath Rauschenberger, R., Gross, T. S., Rice, K. G., &

Conrow, R. (2011). Abnormal Alligators and Organochlorine Pesticides in Lake Apopka,

Florida. In J. Elliott, C. Bishop & C. Morrissey (Eds.), Wildlife Ecotoxicology. Emerging

Topics in Ecotoxicology (Principles, Approaches and Perspectives) (Vol. 3, pp. 153-187).

New York, NY: Springer.

Woodward, A. R., Leone, E. H., Dutton, H. J., Hord, L., & Waller, J. E. (2014). Human Alligator

Conflict in Florida, USA. Pp 182-199. In Crocodiles. Proceedings of the 23rd Working

Meeting of the IUCN-SSC Crocodile Specialist Group. Gland, Switzerland and Cambridge,

UK: IUCN.

Page 244: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

222

Zaini, M. K., Ripot, S., Ubang, C. K., Francis, R., & Simon, A. M. (2014). Crocodile Survey at

Kuching, Samarahan and Sri Aman division, Sarawak, Malaysia. Paper presented at the

Borneo Crocodile Forum, Sibu, Sarawak, Malaysia.

Zainudin, R., Nor, S. M., Ahmad, N., Md-Zain, B. M., & Rahman, M. A. (2010). Genetic Structure

of Hylarana erythraea (Amphibia: Anura: Ranidae) from Malaysia. Zoological Studies,

49(5), 688-702.

Page 245: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

223

APPENDICES

Appendix A1 (habitat assessment data sheet)

Page 246: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

224

Appendix A2

Table appendix A2: Summary of river characteristics observed and recorded during field sampling in eight studied rivers in Rajang River

Basin.

River Type of river Distance from

Sea

Tidal

Influence

Riverbank characteristic

Type of river Water type Riverbank Forest type Canopy cover

1) Igan Large tributary

in estuary area,

located in

lower Rajang

Saltwater

and

brackish

Lower region

of Rajang

River Basin.

Tidal At estuary, sandy

riverbank for about

few hundred meters

and then followed by

muddy riverbank

At the mouth of the river,

riverbank dominated by

pine trees (Casuarina

equisetifolia), then

riverbank dominated by

mangroves and Nypa trees

Open canopy

in most area of

river mouth

2) Belawai Large tributary

in estuary area,

located in

lower Rajang

delta

Saltwater

and

brackish

Lower region

of Rajang

River Basin.

Tidal At estuary, sandy

riverbank for about 1

kilometer and then

followed by muddy

riverbank

At the mouth of the river,

riverbank dominated by

pine trees (Casuarina

equisetifolia). After a few

kilometers riverbank

majorly dominated by

mangroves vegetation

Open canopy

in most area of

river mouth

3) Sarikei Tributary of

Batang Rajang

in lower region

Brackish Lower region

of Rajang

River Basin.

Tidal Muddy riverbank Nypa trees dominated

vegetations in the

riverbanks

Open canopy

in most area of

river mouth

4) Nyelong Tributary of

Batang Rajang

in lower region

Brackish Lower region

of Rajang

River Basin.

Tidal Muddy riverbank Nypa trees dominated

vegetations in the

riverbanks

Open canopy

in most area of

river mouth

Page 247: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

225

Table Appendix A2 continue…

5) Kanowit Tributary of

Batang Rajang

in the middle

region

Brackish

few

kilometres

from mouth

of the river,

freshwater

further

upstream

Middle region

of Rajang

River Basin.

Approx. 125

km from

mouth of

Rajang

Tidal Sandy and muddy

riverbank at

downstream. In the

upstream area,

riverbank substrates

are sandy, gravels and

pebbles.

Mixed Dipterocarp Forest

(MDF). In some areas of

the river, riverbank

vegetations are dominated

by grass and ferns

Open canopy

in most area of

river mouth

6) Poi Tributary of

Batang Rajang

in the middle

region

Brackish

few

kilometres

from mouth

of the river,

freshwater

further

upstream

Middle region

of Rajang

River Basin.

Approx. 135

km from

mouth of

Rajang

Not

influence

by tidal

Sandy and muddy

riverbank at

downstream. In the

upstream area,

riverbank substrates

are sandy, gravels and

pebbles.

Mixed Dipterocarp Forest

(MDF). In some areas of

the river, riverbank

vegetations are dominated

by grass and ferns

Partly shaded

especially

towards

upstream

7) Ngemah Tributary of

Batang Rajang

in the upper

region

Brackish

few

kilometres

from mouth

of the river,

freshwater

further

upstream

Middle region

of Rajang

River Basin.

Approx. 155

km from

mouth of

Rajang

Not

influence

by tidal

Sandy and muddy

riverbank at

downstream. In the

upstream area,

riverbank substrates

are sandy, gravels and

pebbles.

Mixed Dipterocarp Forest

(MDF). In some areas of

the river, riverbank

vegetations are dominated

by grass and ferns

Partly shaded

especially

towards

upstream

8) Katibas Tributary of

Batang Rajang

in the upper

region

Brackish

few

kilometres

from mouth

of the river,

freshwater

further

upstream

Middle region

of Rajang

River Basin.

Approx. 180

km from

mouth of

Rajang

Not

influence

by tidal

Sandy and muddy

riverbank at

downstream. In the

upstream area,

riverbank substrates

are sandy, gravels and

pebbles.

Mixed Dipterocarp Forest

(MDF). In some areas of

the river, riverbank

vegetations are dominated

by grass and ferns

Partly shaded

especially

towards

upstream

Page 248: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

226

Appendix A3

Table appendix A3: Riverbank development and land use recorded during field sampling in eight studied rivers in Rajang River Basin.

River Riverbank development and land use

Residential /schools near

riverbank

Agriculture and fishing

activity

Transportation and Industrial

1) Igan Igan village located at the

mouth of the river.

Fishing activities are relatively high in the

river. Various types of fishing vessels were

found along the river, ranging from small

boats to big fishing vessels. Fishermen use

several methods of fishing including gill

nets and cast nets, which could be seen set

up by the fishermen along the river.

One or two ferries operate in daytime,

transporting peoples and vehicles crossing both

sides of the river. River traffics in the river are

relatively low, as the villagers rarely use the

river to travel to another place. Most of boating

activities in the river are involving fishing

vessels.

2) Belawai Belawai Village located near

to the mouth of the river.

Another village can be found

approx. 15 km from the river

mouth.

Fishing activities are relatively high in the

river. Various types of fishing vessels were

found along the river, ranging from small

boats to big fishing vessels. Fishermen use

several methods of fishing including gill

nets and cast nets, which could be seen set

up by the fishermen along the river.

River traffics in the river are relatively low, as

the villagers rarely use the river to travel to

another place. Most of boating activities in the

river are involving fishing vessels.

3) Sarikei Sarikei Town located near to

the mouth of the river. Several

villages can be found further

upstream.

Several small-scale farms planted with

fruits and vegetables could be seen near to

residential areas. Fishing activities are

relatively high especially in areas near to

Sarikei town,

Buildings including shops and offices,

manmade waterfront and express boat’s jetty

were built near to the mouth of the river. Two

bridges can be found in the survey distance, one

of the bridges situated about less than 1 km from

the river mouth. River traffics are relatively

high especially in areas near to the town.

4) Nyelong Sarikei Town located near to

the mouth of the river. Further

upstream, no other residentials

were found near to riverbank

area during the survey period.

Palm oil estates located approx. more than

10 km in upstream. Fishing activities are

relatively high especially in areas near to

Sarikei Town

Buildings including shops and offices,

manmade waterfront and express boat’s jetty

were built near to the mouth of the river. A

bridge across the river approx. 2 km from the

river mouth. River traffics are relatively high

especially in area near to the town.

Page 249: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

227

Table Appendix A3 continue…

5) Kanowit Kanowit town is located at the

mouth of the river. Approx. 13

to 15 villages/longhouses can

be found throughout the river.

Two schools located near to

riverbank.

Several agriculture plots planted with

paddy and pepper could be seen near to

residential areas. Fishing activities are

relatively are relatively high especially in

areas near to Kanowit Town.

Shops, manmade waterfront and express boat’s

jetty were built near to the mouth of the river. A

logging camp can be found approx. 7 km from

river mouth and use the river to transport logs.

During the time of the survey, construction of a

concrete bridge is on-going, located approx. 2

km from river mouth. Heavy machineries were

used in the construction. River traffics are

relatively high especially in areas near to the

town.

6) Poi Only 1 or 2 houses can be

found less than 5 km from

river mouth. While further

upstream, not more than 6

villages/longhouses can be

found. One school located

near to riverbank.

Several agriculture plots planted with

paddy and pepper could be seen near to

residential areas. Fishing activities are

relatively medium to low throughout the

river.

Abandoned logging camp can be found approx.

less than 2 km from the river mouth. River

traffics are relatively low. Villages/longhouses

were connected to each other and to Kanowit

Town via roads, thus most of the local people

travel using land transportations.

7) Ngemah Ngemah villages located near

to river mouth. Not less than 5

villages/longhouses can be

found throughout the survey

distance in the river. A school

located near to riverbank.

Several agriculture plots planted with

paddy and pepper could be seen near to

residential areas. Fishing activities are

relatively medium to low throughout the

river.

A bridge across the river can be found approx.

6 km from river mouth. River traffics are

relatively low. Majority of local people use land

transportations to travel to other

villages/longhouses or to Kanowit Town as the

areas are connected via roads.

8) Katibas Song town is located at the

mouth of the river. Approx. 8

villages / longhouses and a

school can be found

throughout the survey distance

in the river.

Several agriculture plots planted with

paddy and pepper could be seen near to

residential areas. Fishing activities are

relatively medium to low throughout the

river.

Buildings including shops and offices,

manmade waterfront and express boat’s jetty

were built near to the mouth of the river. River

traffics are relatively high especially in areas

near to the town.

Page 250: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

228

Appendix A4

Table appendix A4: Water quality measurement for each station in eight studied rivers in Rajang River Basin.

River Station GPS Coordinates Depth (m) Width (m) Salinity (ppt) pH Temperature

(oC)

1) Igan 1 2°49'58.83"N, 111°40'47.36"E 15.80 1500 22.00 6.71 26.50

2 2°49'0.95''N, 111°41'20.95''E 14.50 1670 21.00 6.72 26.50

3 2°48'46.76''N, 111°42'58.67''E 14.10 1155 19.00 6.77 26.80

4 2°48'10.46''N, 111°43'45.77''E 13.30 950 17.00 5.96 27.30

5 2°48'05.39"N, 111°44'43.05"E 13.70 915 16.00 5.94 27.00

Mean 14.28 1238 19.00 6.42 26.82

Standard deviation 0.96 335.20 ± 2.54 ± 0.43 ± 0.34

2) Belawai 1 2°11'39.87"N, 111°15'55.24"E 16.20 730 25.33 7.68 29.60

2 2°11'55.83''N, 111°16'38.94''E 14.30 580 17.33 7.56 29.90

3 2°13'20.51''N, 111°17'11.60''E 15.10 1040 14.33 7.47 29.70

4 2°14'51.72''N, 111°16' 41.49''E 14.90 1400 13.33 7.39 29.60

5 2° 16'5.88"N, 111°17'03.34"E 15.50 560 11.00 7.53 29.70

Mean 15.20 862 16.26 7.53 29.70

Standard deviation 0.71 356.82 ± 5.55 ± 0.11 ± 0.12

3) Sarikei 1 2°8'0.16"N, 111°30'50.51"E 7.90 210 14.00 5.86 30.20

2 2°6'38.36''N, 111°30'56.75''E 12.50 90 8.67 5.76 29.90

3 2°5'47.85''N, 111°30'41.64''E 7.30 80 6.33 5.65 29.70

4 2°4'33.40'' N, 111°30'54.16''E 7.20 50 1.33 5.61 29.30

5 2°2'55.13"N, 111°29'37.70"E 6.70 40 0 5.27 29.50

Mean 8.32 94 6.06 5.63 29.72

Standard deviation ± 2.38 68.04 ± 5.67 ± 0.22 ± 0.35

4) Nyelong 1 2°8'4.97"N, 111°31'30.73"E 8.70 240 5.30 5.51 29.50

2 2°6'38.67''N, 111°32'19.77''E 10.70 130 1.33 5.28 28.70

3 2°5'59.36'' N, 111°33'15.44''E 8.60 95 1.33 5.18 29.30

4 2°5'23.08'' N, 111°34' 17.54''E 8.20 85 1.33 5.15 29.40

5 2° 4'5.69"N, 111°35'11.32"E 5.60 60 0.67 5.13 29.40

Mean 8.36 122 1.99 5.25 29.26

Standard deviation ± 1.82 70.59 ± 1.87 ± 0.16 ± 0.32

Page 251: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

229

Table appendix A4 continue…

5) Kanowit 1 2°5'53.16"N, 112°9'28.99"E 12.50 265 2.00 6.87 27.40

2 2°5'13.18''N, 112°9'1.17''E 12.70 100 1.00 6.79 27.50

3 2°3'33.06''N, 112°9'9.46''E 8.10 85 0.37 6.54 27.40

4 2°2'34.18''N, 112°8'21.50''E 10.50 80 0.67 6.72 27.30

5 2°1'7.70"N, 112°4'28.40"E 8.50 60 0.37 7.12 27.20

Mean 10.86 118 0.88 6.81 27.36

Standard deviation ± 2.15 83.41 ± 0.68 ± 0.21 ± 0.11

6) Poi 1 2°3'31.79"N, 112°16'50.19"E 7.10 55 2.00 6.99 27.30

2 2°2'40.49''N, 112°16'9.05''E 7.80 40 0.37 7.16 27.20

3 2°1'44.12''N, 112°15'50.24''E 6.20 50 0 7.25 27.10

4 2°0'29.96''N, 112°15'51.28''E 4.50 30 0 7.30 27.30

5 1°59'20.00"N, 112°15'27.70"E 5.10 25 0 7.38 27.30

Mean 6.14 40 0.47 7.22 27.24

Standard deviation ± 1.36 12.75 ± 0.87 ± 0.15 ± 0.09

7) Ngemah 1 2°1'28.40"N, 112°23'52.57"E 7.60 170 0 6.94 25.50

2 2°0'19.11'' N, 112°23'42.54''E 6.70 55 0 6.88 25.40

3 1°59'30.09'' N, 112°23'51.18''E 6.20 45 0 7.05 25.30

4 1°58'59.61''N, 112°24'17.09''E 6.20 30 0 7.01 25.50

5 1°57'41.48"N, 112°23'53.65"E 5.80 30 0 7.02 25.50

Mean 6.50 66 0 6.98 25.44

Standard deviation ± 0.69 59.10 0 ± 0.07 ± 0.09

8) Katibas 1 2°0'36.13"N, 112°33'14.10"E 10.80 145 0 7.00 25.40

2 1°59'58.43''N, 112°33'15.55''E 3.80 115 0 6.98 25.20

3 1°58'24.32''N, 112°32'55.95''E 7.00 130 0 6.94 25.40

4 1°56'36.10''N, 112°32'52.69''E 6.30 90 0 7.05 25.50

5 1° 54'32.78"N, 112°33'37.92"E 2.00 110 0 7.13 25.40

Mean 5.98 118 0 7.02 25.38

Standard deviation ± 3.35 20.80 0 ± 0.07 ± 0.11

Page 252: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

230

Statistical analysis:

One-way ANOVA: Salinity versus River

Method

Null hypothesis All means are equal

Alternative hypothesis At least one mean is different

Significance level α = 0.05

Equal variances were assumed for the analysis.

Factor Information

Factor Levels Values

River 8 Belawai, Kanowit, Katibas, Kuala Igan, Ngemah, Nyelong, Poi,

Sarikei

Analysis of Variance

Source DF Adj SS Adj MS F-Value P-Value

River 7 2088.8 298.407 32.12 0.000

Error 32 297.3 9.289

Total 39 2386.1

Model Summary

S R-sq R-sq(adj) R-sq(pred)

3.04787 87.54% 84.82% 80.53%

Means

River N Mean StDev 95% CI

Belawai 5 16.26 5.55 ( 13.49, 19.04)

Kanowit 5 0.882 0.677 ( -1.894, 3.658)

Katibas 5 0.000000 0.000000 (-2.776438, 2.776438)

Kuala Igan 5 19.00 2.55 ( 16.22, 21.78)

Ngemah 5 0.000000 0.000000 (-2.776438, 2.776438)

Nyelong 5 1.992 1.871 ( -0.784, 4.768)

Poi 5 0.474 0.868 ( -2.302, 3.250)

Sarikei 5 6.07 5.68 ( 3.29, 8.84)

Pooled StDev = 3.04787

Tukey Pairwise Comparisons

Grouping Information Using the Tukey Method and 95% Confidence

River N Mean Grouping

Kuala Igan 5 19.00 A

Belawai 5 16.26 A

Sarikei 5 6.07 B

Nyelong 5 1.992 B

Kanowit 5 0.882 B

Poi 5 0.474 B

Ngemah 5 0.000000 B

Katibas 5 0.000000 B

Page 253: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

231

Means that do not share a letter are significantly different.

Tukey Simultaneous Tests for Differences of Means

Difference SE of Adjusted

Difference of Levels of Means Difference 95% CI T-Value P-Value

Kanowit - Belawai -15.38 1.93 (-21.62, -9.14) -7.98 0.000

Katibas - Belawai -16.26 1.93 (-22.51, -10.02) -8.44 0.000

Kuala Igan - Belawai 2.74 1.93 ( -3.51, 8.98) 1.42 0.842

Ngemah - Belawai -16.26 1.93 (-22.51, -10.02) -8.44 0.000

Nyelong - Belawai -14.27 1.93 (-20.51, -8.03) -7.40 0.000

Poi - Belawai -15.79 1.93 (-22.03, -9.55) -8.19 0.000

Sarikei - Belawai -10.20 1.93 (-16.44, -3.96) -5.29 0.000

Katibas - Kanowit -0.88 1.93 ( -7.12, 5.36) -0.46 1.000

Kuala Igan - Kanowit 18.12 1.93 ( 11.88, 24.36) 9.40 0.000

Ngemah - Kanowit -0.88 1.93 ( -7.12, 5.36) -0.46 1.000

Nyelong - Kanowit 1.11 1.93 ( -5.13, 7.35) 0.58 0.999

Poi - Kanowit -0.41 1.93 ( -6.65, 5.83) -0.21 1.000

Sarikei - Kanowit 5.18 1.93 ( -1.06, 11.43) 2.69 0.163

Kuala Igan - Katibas 19.00 1.93 ( 12.76, 25.24) 9.86 0.000

Ngemah - Katibas 0.00 1.93 ( -6.24, 6.24) 0.00 1.000

Nyelong - Katibas 1.99 1.93 ( -4.25, 8.23) 1.03 0.966

Poi - Katibas 0.47 1.93 ( -5.77, 6.72) 0.25 1.000

Sarikei - Katibas 6.07 1.93 ( -0.18, 12.31) 3.15 0.062

Ngemah - Kuala Igan -19.00 1.93 (-25.24, -12.76) -9.86 0.000

Nyelong - Kuala Igan -17.01 1.93 (-23.25, -10.77) -8.82 0.000

Poi - Kuala Igan -18.53 1.93 (-24.77, -12.28) -9.61 0.000

Sarikei - Kuala Igan -12.93 1.93 (-19.18, -6.69) -6.71 0.000

Nyelong - Ngemah 1.99 1.93 ( -4.25, 8.23) 1.03 0.966

Poi - Ngemah 0.47 1.93 ( -5.77, 6.72) 0.25 1.000

Sarikei - Ngemah 6.07 1.93 ( -0.18, 12.31) 3.15 0.062

Poi - Nyelong -1.52 1.93 ( -7.76, 4.72) -0.79 0.993

Sarikei - Nyelong 4.07 1.93 ( -2.17, 10.32) 2.11 0.428

Sarikei - Poi 5.59 1.93 ( -0.65, 11.83) 2.90 0.106

Individual confidence level = 99.72%

Page 254: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

232

One-way ANOVA: pH versus River

Method

Null hypothesis All means are equal

Alternative hypothesis At least one mean is different

Significance level α = 0.05

Equal variances were assumed for the analysis.

Factor Information

Factor Levels Values

River 8 Belawai, Kanowit, Katibas, Kuala Igan, Ngemah, Nyelong, Poi,

Sarikei

Analysis of Variance

Source DF Adj SS Adj MS F-Value P-Value

River 7 21.982 3.14035 72.09 0.000

Error 32 1.394 0.04356

Total 39 23.376

Model Summary

S R-sq R-sq(adj) R-sq(pred)

0.208710 94.04% 92.73% 90.68%

Means

River N Mean StDev 95% CI

Belawai 5 7.5260 0.1078 (7.3359, 7.7161)

Kanowit 5 6.8080 0.2128 (6.6179, 6.9981)

Katibas 5 7.0200 0.0731 (6.8299, 7.2101)

Kuala Igan 5 6.420 0.430 ( 6.230, 6.610)

Ngemah 5 6.9800 0.0689 (6.7899, 7.1701)

Nyelong 5 5.2500 0.1564 (5.0599, 5.4401)

Poi 5 7.2160 0.1494 (7.0259, 7.4061)

Sarikei 5 5.630 0.224 ( 5.440, 5.820)

Pooled StDev = 0.208710

Tukey Pairwise Comparisons

Grouping Information Using the Tukey Method and 95% Confidence

River N Mean Grouping

Belawai 5 7.5260 A

Poi 5 7.2160 A B

Katibas 5 7.0200 B

Ngemah 5 6.9800 B

Kanowit 5 6.8080 B C

Kuala Igan 5 6.420 C

Sarikei 5 5.630 D

Nyelong 5 5.2500 D

Means that do not share a letter are significantly different.

Page 255: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

233

Tukey Simultaneous Tests for Differences of Means

Difference SE of Adjusted

Difference of Levels of Means Difference 95% CI T-Value P-Value

Kanowit - Belawai -0.718 0.132 (-1.145, -0.291) -5.44 0.000

Katibas - Belawai -0.506 0.132 (-0.933, -0.079) -3.83 0.012

Kuala Igan - Belawai -1.106 0.132 (-1.533, -0.679) -8.38 0.000

Ngemah - Belawai -0.546 0.132 (-0.973, -0.119) -4.14 0.005

Nyelong - Belawai -2.276 0.132 (-2.703, -1.849) -17.24 0.000

Poi - Belawai -0.310 0.132 (-0.737, 0.117) -2.35 0.300

Sarikei - Belawai -1.896 0.132 (-2.323, -1.469) -14.36 0.000

Katibas - Kanowit 0.212 0.132 (-0.215, 0.639) 1.61 0.743

Kuala Igan - Kanowit -0.388 0.132 (-0.815, 0.039) -2.94 0.098

Ngemah - Kanowit 0.172 0.132 (-0.255, 0.599) 1.30 0.891

Nyelong - Kanowit -1.558 0.132 (-1.985, -1.131) -11.80 0.000

Poi - Kanowit 0.408 0.132 (-0.019, 0.835) 3.09 0.070

Sarikei - Kanowit -1.178 0.132 (-1.605, -0.751) -8.92 0.000

Kuala Igan - Katibas -0.600 0.132 (-1.027, -0.173) -4.55 0.002

Ngemah - Katibas -0.040 0.132 (-0.467, 0.387) -0.30 1.000

Nyelong - Katibas -1.770 0.132 (-2.197, -1.343) -13.41 0.000

Poi - Katibas 0.196 0.132 (-0.231, 0.623) 1.48 0.810

Sarikei - Katibas -1.390 0.132 (-1.817, -0.963) -10.53 0.000

Ngemah - Kuala Igan 0.560 0.132 ( 0.133, 0.987) 4.24 0.004

Nyelong - Kuala Igan -1.170 0.132 (-1.597, -0.743) -8.86 0.000

Poi - Kuala Igan 0.796 0.132 ( 0.369, 1.223) 6.03 0.000

Sarikei - Kuala Igan -0.790 0.132 (-1.217, -0.363) -5.98 0.000

Nyelong - Ngemah -1.730 0.132 (-2.157, -1.303) -13.11 0.000

Poi - Ngemah 0.236 0.132 (-0.191, 0.663) 1.79 0.632

Sarikei - Ngemah -1.350 0.132 (-1.777, -0.923) -10.23 0.000

Poi - Nyelong 1.966 0.132 ( 1.539, 2.393) 14.89 0.000

Sarikei - Nyelong 0.380 0.132 (-0.047, 0.807) 2.88 0.111

Sarikei - Poi -1.586 0.132 (-2.013, -1.159) -12.02 0.000

Individual confidence level = 99.72%

Page 256: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

234

One-way ANOVA: Temperature versus River

Method

Null hypothesis All means are equal

Alternative hypothesis At least one mean is different

Significance level α = 0.05

Equal variances were assumed for the analysis.

Factor Information

Factor Levels Values

River 8 Belawai, Kanowit, Katibas, Kuala Igan, Ngemah, Nyelong, Poi,

Sarikei

Analysis of Variance

Source DF Adj SS Adj MS F-Value P-Value

River 7 110.239 15.7484 316.55 0.000

Error 32 1.592 0.0497

Total 39 111.831

Model Summary

S R-sq R-sq(adj) R-sq(pred)

0.223047 98.58% 98.27% 97.78%

Means

River N Mean StDev 95% CI

Belawai 5 29.7000 0.1225 (29.4968, 29.9032)

Kanowit 5 27.3600 0.1140 (27.1568, 27.5632)

Katibas 5 25.3800 0.1095 (25.1768, 25.5832)

Kuala Igan 5 26.820 0.342 ( 26.617, 27.023)

Ngemah 5 25.4400 0.0894 (25.2368, 25.6432)

Nyelong 5 29.260 0.321 ( 29.057, 29.463)

Poi 5 27.2400 0.0894 (27.0368, 27.4432)

Sarikei 5 29.720 0.349 ( 29.517, 29.923)

Pooled StDev = 0.223047

Tukey Pairwise Comparisons

Grouping Information Using the Tukey Method and 95% Confidence

River N Mean Grouping

Sarikei 5 29.720 A

Belawai 5 29.7000 A B

Nyelong 5 29.260 B

Kanowit 5 27.3600 C

Poi 5 27.2400 C D

Kuala Igan 5 26.820 D

Ngemah 5 25.4400 E

Katibas 5 25.3800 E

Means that do not share a letter are significantly different.

Page 257: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

235

Tukey Simultaneous Tests for Differences of Means

Difference SE of Adjusted

Difference of Levels of Means Difference 95% CI T-Value P-Value

Kanowit - Belawai -2.340 0.141 (-2.797, -1.883) -16.59 0.000

Katibas - Belawai -4.320 0.141 (-4.777, -3.863) -30.62 0.000

Kuala Igan - Belawai -2.880 0.141 (-3.337, -2.423) -20.42 0.000

Ngemah - Belawai -4.260 0.141 (-4.717, -3.803) -30.20 0.000

Nyelong - Belawai -0.440 0.141 (-0.897, 0.017) -3.12 0.066

Poi - Belawai -2.460 0.141 (-2.917, -2.003) -17.44 0.000

Sarikei - Belawai 0.020 0.141 (-0.437, 0.477) 0.14 1.000

Katibas - Kanowit -1.980 0.141 (-2.437, -1.523) -14.04 0.000

Kuala Igan - Kanowit -0.540 0.141 (-0.997, -0.083) -3.83 0.012

Ngemah - Kanowit -1.920 0.141 (-2.377, -1.463) -13.61 0.000

Nyelong - Kanowit 1.900 0.141 ( 1.443, 2.357) 13.47 0.000

Poi - Kanowit -0.120 0.141 (-0.577, 0.337) -0.85 0.988

Sarikei - Kanowit 2.360 0.141 ( 1.903, 2.817) 16.73 0.000

Kuala Igan - Katibas 1.440 0.141 ( 0.983, 1.897) 10.21 0.000

Ngemah - Katibas 0.060 0.141 (-0.397, 0.517) 0.43 1.000

Nyelong - Katibas 3.880 0.141 ( 3.423, 4.337) 27.50 0.000

Poi - Katibas 1.860 0.141 ( 1.403, 2.317) 13.19 0.000

Sarikei - Katibas 4.340 0.141 ( 3.883, 4.797) 30.77 0.000

Ngemah - Kuala Igan -1.380 0.141 (-1.837, -0.923) -9.78 0.000

Nyelong - Kuala Igan 2.440 0.141 ( 1.983, 2.897) 17.30 0.000

Poi - Kuala Igan 0.420 0.141 (-0.037, 0.877) 2.98 0.090

Sarikei - Kuala Igan 2.900 0.141 ( 2.443, 3.357) 20.56 0.000

Nyelong - Ngemah 3.820 0.141 ( 3.363, 4.277) 27.08 0.000

Poi - Ngemah 1.800 0.141 ( 1.343, 2.257) 12.76 0.000

Sarikei - Ngemah 4.280 0.141 ( 3.823, 4.737) 30.34 0.000

Poi - Nyelong -2.020 0.141 (-2.477, -1.563) -14.32 0.000

Sarikei - Nyelong 0.460 0.141 ( 0.003, 0.917) 3.26 0.048

Sarikei - Poi 2.480 0.141 ( 2.023, 2.937) 17.58 0.000

Individual confidence level = 99.72%

Page 258: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

236

Appendix A5

Table appendix A5: The coordinates of locations where the gill nets were deployed.

River Coordinates of the gill nets

1 2 3

1) Igan 2°49'44.03" N,

111°41'22.13" E

2°48'23.93" N,

111°42'22.83" E

2°48'12.98" N,

111°44'22.89" E

2) Belawai 2°11'40.80" N,

111°15'59.21" E

2°12'46.30 " N,

111°16'56.23" E

2°17'14.47" N,

111°16'44.79" E

3) Sarikei 2°6'38.44" N,

111°30'55.07" E

2°4'59.01" N,

111°30'52.15" E

2°3'23.47" N,

111°29'38.97" E

4) Nyelong 2°6'48.65" N,

111°32'16.26" E

2°5'59.99" N,

111°33'17.14" E

2°5'16.42" N,

111°34'22.66" E

5) Kanowit 2°4'23.88" N,

112°9'4.40" E

2°3'28.40" N,

112°9'8.19" E

2°2'52.49" N,

112°7'6.60" E

6) Poi 2°3'29.20" N,

112°16'48.69" E

2°1'57.19" N,

112°15'32.60" E

2°0'28.93" N,

112°15'55.85" E

7) Ngemah 2°0'33.51" N,

112°23'45.20" E

1°58'40.80" N,

112°24'33.62" E

-

8) Katibas 1°58'23.22" N,

112°32'46.63" E

1°56'4.01" N,

112°32'23.21" E

-

Page 259: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

237

Appendix A6

Statistical analysis results for the abundant of aquatic food resources for crocodile (CPUE):

One-way ANOVA: CPUE versus RIver

Method

Null hypothesis All means are equal

Alternative hypothesis At least one mean is different

Significance level α = 0.05

Equal variances were assumed for the analysis.

Factor Information

Factor Levels Values

RIver 8 Belawai, Kanowit, Katibas, Kuala Igan, Ngemah, Nyelong, Poi,

Sarikei

Analysis of Variance

Source DF Seq SS Contribution Adj SS Adj MS F-Value P-Value

RIver 7 1.9674 85.98% 1.9674 0.28105 12.27 0.000

Error 14 0.3207 14.02% 0.3207 0.02291

Total 21 2.2881 100.00%

Model Summary

S R-sq R-sq(adj) PRESS R-sq(pred)

0.151357 85.98% 78.97% 0.747065 67.35%

Means

RIver N Mean StDev 95% CI

Belawai 3 0.970 0.280 ( 0.783, 1.157)

Kanowit 3 0.2483 0.0629 ( 0.0609, 0.4358)

Katibas 2 0.1685 0.0205 (-0.0610, 0.3980)

Kuala Igan 3 0.8217 0.1472 ( 0.6342, 1.0091)

Ngemah 2 0.2590 0.1188 ( 0.0295, 0.4885)

Nyelong 3 0.308 0.199 ( 0.121, 0.495)

Poi 3 0.3750 0.0676 ( 0.1876, 0.5624)

Sarikei 3 0.1220 0.0700 (-0.0654, 0.3094)

Pooled StDev = 0.151357

Page 260: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

238

Tukey Pairwise Comparisons

Grouping Information Using the Tukey Method and 95% Confidence

RIver N Mean Grouping

Belawai 3 0.970 A

Kuala Igan 3 0.8217 A

Poi 3 0.3750 B

Nyelong 3 0.308 B

Ngemah 2 0.2590 B

Kanowit 3 0.2483 B

Katibas 2 0.1685 B

Sarikei 3 0.1220 B

Means that do not share a letter are significantly different.

Tukey Simultaneous Tests for Differences of Means

Difference SE of Adjusted

Difference of Levels of Means Difference 95% CI T-Value P-Value

Kanowit - Belawai -0.722 0.124 (-1.158, -0.286) -5.84 0.001

Katibas - Belawai -0.802 0.138 (-1.289, -0.314) -5.80 0.001

Kuala Igan - Belawai -0.148 0.124 (-0.584, 0.288) -1.20 0.919

Ngemah - Belawai -0.711 0.138 (-1.199, -0.223) -5.15 0.003

Nyelong - Belawai -0.662 0.124 (-1.098, -0.226) -5.36 0.002

Poi - Belawai -0.595 0.124 (-1.031, -0.159) -4.81 0.005

Sarikei - Belawai -0.848 0.124 (-1.284, -0.412) -6.86 0.000

Katibas - Kanowit -0.080 0.138 (-0.567, 0.408) -0.58 0.999

Kuala Igan - Kanowit 0.573 0.124 ( 0.137, 1.009) 4.64 0.007

Ngemah - Kanowit 0.011 0.138 (-0.477, 0.498) 0.08 1.000

Nyelong - Kanowit 0.060 0.124 (-0.376, 0.496) 0.48 1.000

Poi - Kanowit 0.127 0.124 (-0.309, 0.563) 1.02 0.962

Sarikei - Kanowit -0.126 0.124 (-0.562, 0.310) -1.02 0.963

Kuala Igan - Katibas 0.653 0.138 ( 0.166, 1.141) 4.73 0.006

Ngemah - Katibas 0.091 0.151 (-0.444, 0.625) 0.60 0.998

Nyelong - Katibas 0.140 0.138 (-0.348, 0.627) 1.01 0.965

Poi - Katibas 0.207 0.138 (-0.281, 0.694) 1.49 0.799

Sarikei - Katibas -0.046 0.138 (-0.534, 0.441) -0.34 1.000

Ngemah - Kuala Igan -0.563 0.138 (-1.050, -0.075) -4.07 0.019

Nyelong - Kuala Igan -0.514 0.124 (-0.950, -0.078) -4.16 0.016

Poi - Kuala Igan -0.447 0.124 (-0.883, -0.011) -3.61 0.043

Sarikei - Kuala Igan -0.700 0.124 (-1.136, -0.264) -5.66 0.001

Nyelong - Ngemah 0.049 0.138 (-0.439, 0.537) 0.35 1.000

Poi - Ngemah 0.116 0.138 (-0.372, 0.604) 0.84 0.987

Sarikei - Ngemah -0.137 0.138 (-0.625, 0.351) -0.99 0.968

Poi - Nyelong 0.067 0.124 (-0.369, 0.503) 0.54 0.999

Sarikei - Nyelong -0.186 0.124 (-0.622, 0.250) -1.51 0.793

Sarikei - Poi -0.253 0.124 (-0.689, 0.183) -2.05 0.488

Individual confidence level = 99.67%

Page 261: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

239

Appendix B

Table Appendix B: Information on the vouchered samples collected during samplings.

Collection

No.

UNIMAS

Voucher No.

Species Origin/

Sampling site

River Basin (RB) Description of

Samples

Collection

Date

1. SB001 C. porosus Sibu Rajang RB Tissue 02/01/2008

2. SM001 C. porosus Samarahan Samarahan RB Blood 27/08/2008

3. SB002 C. porosus Sibu Rajang RB Blood 27/08/2008

4. BN001 C. porosus Bintulu

(TPB)

Kemena RB Blood 27/08/2008

5. BN002 C. porosus Bintulu

(TPB)

Kemena RB Blood 27/08/2008

6. BG001 C. porosus Bintangor Rajang RB Blood 27/08/2008

7. BK001 C. porosus Sg. Bako Sg. Sarawak RB Blood 29/01/2009

8. MR002 C. porosus Miri

(MCF)

Miri RB Blood 18/03/2009

9. MR003 C. porosus Miri

(MCF)

Miri RB Blood 18/03/2009

10. MR010 C. porosus Miri

(MCF)

Miri RB Blood 18/03/2009

11. BK005 C. porosus Sg. Bako Sg. Sarawak RB Blood 10/03/2010

12. TA001 C. porosus Kuching Wetland NP

(Telaga air)

Sg. Sarawak RB Tissue 02/12/2011

Page 262: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

240

Table Appendix B continue…

Collection

No.

UNIMAS

Voucher No.

Species Origin/

(Sampling site)

River Basin Description of

Samples

Collection

Date

13. RO001 C. porosus Sg. Seblak, Roban Krian RB Tissue 03/2013

14. KP001 C. porosus Kapit Rajang RB Tissue 18/10/2013

15. ST001 C. porosus Sg. Santubong Sg. Sarawak RB Tissue & Blood 04/03/2016

16. SM002 C. porosus Sg. Pinang,

Samarahan

Samarahan RB Tissue & Blood 9/10/2016

17. ST002 C. porosus Semariang,

Santubong

Sg. Sarawak RB Tissue 8/12/2016

18. PU001 C. porosus Sg. Pelasau, Pusa Saribas RB Scute tissue 26/7/2017

19. BG002 C. porosus Sg. Kawi, Bintangor Rajang RB Tissue 30/9/2017

20. SJ001 C. porosus Simunjan Sadong RB Tissue 28/12/2017

21. DB001 C. porosus Sg. Dit, Debak Saribas RB Scute tissue 3/2/2018

22. DB002 C. porosus Sg. Dit, Debak Saribas RB Scute tissue 3/2/2018

*TTB, Tumbina Park, Bintulu; MCF, Miri Crocodile Farm

Page 263: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

241

Appendix C

L 1 2 3 4 5 6

Figure Appendix C1: An example of 1% agarose gel picture of microsatellites

amplification using Cj131 primer showing single band.

Lane L: GeneRuler 100bp Plus DNA ladder (Fermentas); Lane 1: Sample SB001; Lane

2: Sample SB002; Lane 3: Sample KP001; Lane 4: Sample BG001; Lane 5: Sample

BG002; Lane 6: Sample RO001.

200bp

300bp

Page 264: Faculty of Resource Science and Technology Izwan (2019... · 2019. 8. 1. · 2.2 Distribution of crocodiles 13 2.3 Crocodylus porosus 14 2.3.1 Taxonomy 14 2.3.2 Habitat and distribution

242

L 1 2 3 4

Figure Appendix C2: An example of 1% agarose gel picture of microsatellites

amplification using Cj105 primer showing multiple bands.

Lane L: GeneRuler 100bp Plus DNA ladder (Fermentas); Lane 1: Sample SM001;

Lane 2: Sample SM002; Lane 3: Sample SJ001; Lane 4: Sample PU001.

300bp

400bp

500bp