exclusion of bioactive contaminations in …materials and methods toxins. we used the following...

INFECTION AND IMMUNITY,0019-9567/97/$04.0010

Nov. 1997, p. 4725–4733 Vol. 65, No. 11

Copyright © 1997, American Society for Microbiology

Exclusion of Bioactive Contaminations in Streptococcus pyogenesErythrogenic Toxin A Preparations by Recombinant

Expression in Escherichia coliURSULA FAGIN,1 ULRICH HAHN,2 JOACHIM GROTZINGER,3 BERNHARD FLEISCHER,4

DIETER GERLACH,5 FRIEDRICH BUCK,6 AXEL WOLLMER,3

HOLGER KIRCHNER,1 AND LOTHAR RINK1*

Institute of Immunology and Transfusion Medicine, University of Lubeck School of Medicine, D-23538 Lubeck,1

Institute for Biochemistry, D-04103 Leipzig,2 Department of Biochemistry, Rheinisch-WestfalischeTechnische Hochschule, D-52057 Aachen,3 Bernhard Nocht Institute for Tropical Medicine,

D-20359 Hamburg,4 Institute for Experimental Microbiology, D-07745 Jena,5 andInstitute for Cell Biochemistry and Clinical Neurobiology,

D-20246 Hamburg,6 Germany

Received 17 March 1997/Returned for modification 26 May 1997/Accepted 20 August 1997

The streptococcal erythrogenic exotoxin A (SPEA) belongs to the family of bacterial superantigens and hasbeen implicated in the pathogenesis of a toxic shock-like syndrome and scarlet fever. Concerning its biologicalactivity, mainly T-cell-stimulatory properties, conflicting data exist. In this study, we show that most of theSPEA preparations used so far contain biologically active contaminations. Natural SPEA from the culturesupernatant of Streptococcus pyogenes NY-5 and recombinant SPEA purified from the culture filtrate of S.sanguis are strongly contaminated with DNases. We show that natural SPEA induces more tumor necrosisfactor alpha (TNF-a) than recombinant SPEA, but we also show that DNases are able to induce TNF-a. Incommercial SPEA preparations, we identified a highly active protease, which was shown not to be SPEB. Toexclude these contaminations, we overexpressed SPEA cloned in the effective high-level expression vectorpIN-III-ompA2 in Escherichia coli. The expressed SPEA shows the same amino acid composition as naturalSPEA, whereas functional studies reported so far were carried out with toxins containing an incorrect aminoterminus. We describe the rapid purification of lipopolysaccharide-, DNase-, and protease-free SPEA in twosteps from the host’s periplasm and its structural characterization by circular dichroism. Our results repre-sent for the first time the production in E. coli of recombinant SPEA with the authentic N-terminal sequenceand a proven superantigenic activity. Collectively, our results indicate that immunological studies of superan-tigens require highly purified substances free of biologically active contaminations.

The pyrogenic exotoxin A, also known as erythrogenic toxin,is one of the major virulence factors of Streptococcus pyogenesinvolved in the pathogenesis of scarlet fever (59) and strepto-coccal toxic shock-like syndrome (STSS) (31, 44, 50). It hasbecome a subject of great interest because of the significantresurgence of serious infections caused by group A strepto-cocci (2, 19, 50). SPEA (streptococcal pyrogenic exotoxin A) isa phage-encoded exotoxin and is produced by lysogenic strainsof S. pyogenes. The gene encoding for the exotoxin (speA) islocated on bacteriophage T12 (23, 55).

SPEA belongs to the family of bacterial superantigens ofwhich, among others, the staphylococcal enterotoxins Athrough E, toxic shock syndrome toxin 1 (TSST-1), some strep-tococcal exotoxins, and the Mycoplasma arthritidis-derived su-perantigen are members. During the last few years, an increas-ing number of superantigens have been reported, but most ofthem could not be confirmed. Pyrogenic streptococci have de-veloped at least five different superantigens: SPEA, -C and -X,streptococcal superantigen, and mitogenic factor. There areother proteins designated to act as superantigens, such as theM protein from the type 5 strain Manfredo, SPEB, or cyto-plasmic membrane-associated protein, but the initial reports

were probably due to contaminations with known streptococcalsuperantigens or other proteins (for a review, see reference 9).SPEB was recently shown to be a proteinase which possessesmitogenic activity even in its recombinant form, but it is not asuperantigen (4, 12, 14, 46).

SPEA and SPEC show strong sequence homology to thestaphylococcal enterotoxins (5, 24, 56). Superantigens sharecommon features such as pyrogenicity, mitogenicity, and en-hancement of host susceptibility to endotoxin shock (6, 40).Most striking is their ability to induce an oligoclonal T-cellactivation by cross-linking the variable regions of the T-cellreceptor b chain on T cells with the class II major histocom-patibility complex (MHC) on accessory cells. This results in amassive cytokine production considered the cause of the symp-toms of STSS (1, 7, 22, 38). The molecular mechanism of thepathogenesis of severe streptococcal diseases is not yet fullyunderstood, but it is probable that SPEA is involved in thepathogenesis of many STSS cases (7, 16).

Conflicting results concerning the activation of particularT-cell subsets (Vb stimulation pattern) have been obtained,most likely due to contaminations with other superantigens orproteins (1, 20). The availability of highly purified toxin prep-arations is one of the major prerequisites for investigation ofthe biological activities of SPEA. In this study, we describebiologically active contaminations of SPEA and, for the firsttime, expression of a properly folded SPEA with the authenticN-terminal sequence by Escherichia coli.

* Corresponding author. Mailing address: Institute of Immunologyand Transfusion Medicine, University of Lubeck School of Medicine,Ratzeburger Allee 160, D-23538 Lubeck, Germany. Phone: 49 451 5003694. Fax: 49 451 500 3069. E-mail: [email protected].

4725

on February 27, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

MATERIALS AND METHODS

Toxins. We used the following toxin preparations: commercial staphylococcalenterotoxin B (SEB), SPEA, and SPEB, purchased from Toxin Technology Inc.(Madison, Wis.); natural SPEA, purified from S. pyogenes NY-5 culture super-natant (11); recombinant SPEA (rSPEA), purified from culture filtrate of S.sanguis (Challis) containing the speA gene (13); rSPEA, purified from theperiplasm of E. coli containing the speA gene as described below [rSPEA (E.coli)]; and recombinant SEB, produced as described elsewhere (10).

SDS-PAGE. The toxin preparations were analyzed by sodium dodecyl sulfate(SDS)-polyacrylamide gel electrophoresis (PAGE) on an SDS–15% polyacryl-amide gel as described by Laemmli (35). Protein content was measured with theBio-Rad Laboratories (Munich, Germany) assay, using bovine serum albumin(BSA) as the standard. Samples were prepared by boiling for 5 min in samplebuffer (35). The molecular size markers included were a-lactalbumin (14.2 kDa),trypsin inhibitor (20.1 kDa), trypsinogen (24 kDa), carbonic anhydrase (29 kDa),glyceraldehyde-3-phosphate dehydrogenase (36 kDa), ovalbumin (45 kDa), andBSA (66 kDa). Protein bands were visualized with Coomassie brilliant blueG-250 (Serva, Heidelberg, Germany) as the staining dye or by silver staining. Theisoelectric point was determined by isoelectric focusing on a homogeneous poly-acrylamide gel with an immobilized pH gradient of 4.0 to 6.5 (Pharmacia, Upp-sala, Sweden), using the Phast System as specified by the manufacturer (Phar-macia).

Western immunoblotting. Immunoblotting was performed as described byTowbin et al. (54), using a semidry apparatus (Pharmacia). Blotting buffers wereprepared as specified by the manufacturer. Blots were stained prior to blockingto check the quality of the electrophoresis and transfer with Ponceau S (Serva).The nitrocellulose sheet (Schleicher & Schuell, Dassel, Germany) was blockedfor at least 2 h in 15% skim milk and subsequently incubated overnight withpolyclonal SPEA antiserum (Toxin Technology Inc.), 1:5,000 in phosphate-buff-ered saline (PBS)–0.1% BSA. The second antibody was alkaline phosphatase-coupled rabbit anti-sheep immunoglobulin (Dianova, Hamburg, Germany). En-zymatic staining was developed by using nitroblue tetrazolium–5-bromo-4-chloro-3-indolylphosphate as the substrate and staining reagent (Serva).

Azocasein assay for protease activity. The assay was performed as described byOhara-Nemoto et al. (46). Briefly, up to 60 ml of protease-containing fraction wasincubated at 37°C, with or without addition of 2-mercaptoethanol (2-ME) to afinal concentration of 10 mM. After 10 min, 25 ml of reaction mixture containingazocasein (8.0 mg/ml; Sigma, Deisenhofen, Germany) in 50 mM Tris-HCl (pH8.0), prewarmed at 37°C, was added. The reaction was stopped after 20 min ofincubation at 37°C by addition of 25 ml of 15% ice-cold trichloroacetic acid. After15 min on ice, the mixture was centrifuged, and an equal volume of 0.5 M NaOHwas added to the supernatant. The A440 of the sample was measured to deter-mine the amount of azopeptides not precipitated with trichloroacetic acid, usinga Hitachi spectrophotometer (Spectralphotometer U-3000; Hitachi, Bremen,Germany). As a positive control, trypsin (Biochrom, Berlin, Germany) was used.

Substrate gel electrophoresis. Expression of specific protease species wasassayed by gelatin substrate gel electrophoresis (28). Samples were suspended inLaemmli sample buffer (35) without reducing agents, boiled for 4 min, andelectrophoresed on an SDS–15% polyacrylamide gel copolymerized with 0.5%gelatin. SDS was removed by shaking the gel for 1 h in 1% Triton X-100.Subsequently the gel was incubated overnight in a solution containing 0.1 MTris-HCl (pH 8.0), 1.33 mM EDTA, and 250 mM 2-ME at 37°C. Proteinasespecies were identified by the presence of a clear band on Coomassie blue-stained gels.

DNase assay. Three micrograms of plasmid DNA (pIN-III-ompA2) was incu-bated at 37°C with 2 mg of each of the various protein preparations and aspositive controls with various amounts of bovine pancreatic DNase (Sigma) orwith 5 U of EcoRI. After addition of DNA loading buffer, samples were loadedon a 1% agarose gel and electrophoresed at 80 V. DNA fragmentation wasvisualized by staining with ethidium bromide and UV monitoring.

Strains, plasmids, and growth conditions. The speA gene cloned in pGEX2Twas used to transform E. coli XL1-Blue {recA1 endA1 gyrA96 thi-1 hsdR17supE44 relA1, lac [F9 proAB lacIqZDM15, Tn10 (Tetr)]; purchased from Strat-agene, Heidelberg, Germany}.

Plasmid pIN-III-ompA2, kindly provided by M. Inouye, New York, N.Y. (15),was used for the construction of the SPEA overexpression vector. For theamplification of plasmids, E. coli DH5a [F2 endA1 hsdR17 (rk

2 mk1) supE44

thi-1 l2 recA1 gyrA96 relA1 F80dlacZDM15; purchased from Gibco BRL, Egg-enstein, Germany] was used. Cultures (600 ml) were grown in 2-liter flasks at37°C in LB medium (39) containing ampicillin (100 mg/ml) or, in the case ofpGEX2T in XL1-Blue, ampicillin (100 mg/ml) and tetracycline (20 mg/ml). Over-expression of SPEA was induced at an A600 of 0.5 by adding isopropyl-b-D-thiogalactoside (IPTG) to a final concentration of 0.1 mM. Cultures were grownunder vigorous shaking (200 rpm) and harvested after 16 h (speA in pIN-III-ompA2) or 3 h (speA in pGEX2T).

Construction of pA2SPEA. Plasmid pGEX2T/SPEA (17) was used to amplifya 660-bp fragment encoding the mature protein (without the leader peptide).PCR (consisting of 25 amplification cycles of 120 s of denaturating at 94°C, 90 sof annealing at 55°C, and an extension step of 60 s at 72°C) was performed withthe sense (59CGCGTGAATTCGCTCAACAAGACCCCGAT39) and antisense(59AGCAAAAGCTTACTTGGTTGTTAGGTA39) primers (the recognition

sites for EcoRI and HindIII are underlined). The product was digested with thecorresponding restriction enzymes, and the resulting fragment was purified byseparation on an agarose gel and subsequent extraction with silica gel particles(Qiagen, Hilden, Germany). It was ligated into the secretion vector pIN-III-ompA2 which had been cleaved with the same enzymes and had been treatedwith 0.1 U of calf intestinal alkaline phosphatase (Pharmacia). This construct wasused to transform E. coli DH5a. The ampicillin-resistant transformants weretested for SPEA production by growing 5-ml cultures in LB and separating cellextracts on SDS–15% polyacrylamide gels before and after induction with 0.1mM IPTG. The presence of SPEA was confirmed by Western immunoblotting.

Oligonucleotide-directed site-specific mutagenesis. The procedure used wasessentially that of Landt et al. (36). Mutagenesis was performed in a two-stepPCR using the universal primer XBA (59ACTGGAACTCTAGATAACG39; therecognition site for XbaI is underlined) upstream the ompA leader sequence andthe 39 mutagenic primer 59ATCGGGGTCTTGTTGGGCCTGCGCTAC39 forthe first reaction in order to remove the 12-bp linker sequence (Fig. 5). PCR wasperformed under the conditions described above except for the annealing tem-perature, which was 60°C. The generated 116-bp fragment was purified on a 3%agarose gel, using silica gel particles for extraction.

The second PCR was performed as described for the first step with thefollowing modifications: the 39 universal primer 59GAGGTGAATTTCGACCTCT39 was applied at a concentration of 1 mM. The 59 primer was the entirepurified intermediate fragment from the first PCR step. The annealing temper-ature was set to 49°C. The products were extracted once with phenol and twicewith chloroform-isoamylalcohol (25:1) and precipitated with ethanol. Ligationand screening for positive clones was performed as described above. The nucle-otide sequences of all constructs were verified by double-stranded DNA sequenc-ing using AmpliTaq DNA polymerase (Perkin-Elmer) on an automatic DNAsequencer (model 373A; Applied Biosystems).

Purification of rSPEA. Periplasm was prepared as described by Landt et al.(37). The cell pellet was resuspended in 0.03 culture volumes of ice-cold TES (50mM Tris HCl [pH 7.5]–10 mM EDTA [TE] containing 15% sucrose) withoutaddition of further protease inhibitors. The suspension was shaken for 30 min at4°C, diluted to fivefold volumes with ice-cold TE, and centrifuged immediately.The supernatant was filter sterilized (0.2-mm-pore-size filter), transferred to thestarting buffer, and applied to a Sepharose S cation-exchange column (16 by 10mm; Pharmacia) adjusted to pH 4.0 with 0.01 M acetate buffer. Protein waseluted with a 50-min linear gradient from 100% buffer A (0.01 M acetate, pH 4.0)to 60% buffer B (0.05 M acetate, pH 5.8), followed by a 150-min linear gradientfrom 60 to 100% buffer B. The solvent flow rate was 2 ml min21. The fractionswere tested for toxin content by SDS-PAGE and subsequent Western immuno-blotting. Toxin-containing fractions were combined and concentrated to 500 ml ina Centricon-10 (Amicon). For a final purification step, gel filtration using aSuperdex G-75 column (16 by 60 mm; Pharmacia) was performed. The runningand elution buffer was PBS (Gibco, Berlin, Germany) with a flow rate of 1 mlmin21. Toxin-containing fractions were detected as described above.

To remove any residual lipopolysaccharide (LPS) contamination rSPEA (E.coli) was passed over an endotoxin-removing gel (Pierce, Rockford, Ill.), lyoph-ilized, and stored at 220°C. Amounts of LPS were determined by a highlysensitive, quantitative Limulus amebocyte assay (Kinetic-QCL-LAL; BioWhit-taker, Serva) as specified by the manufacturer. Gram-negative bacterial endo-toxin catalyzes the activation of a proenzyme in the Limulus amebocyte lysate.The initial rate of activation is determined by the concentration of endotoxin.The activated enzyme catalyzes the splitting of p-nitroaniline from a colorlesssubstrate. Absorption was measured in a ThermoMax microplate reader (Ther-moMax, Molecular Devices, MWG Biotech, Hannover, Germany).

N-terminal sequence analysis. Protein samples were subjected to SDS-PAGEas described above and electroblotted (50 mM boric acid-NaOH [pH 9]–20%methanol for 5 h at 1 mA/cm2) in a semidry blotting apparatus (Schleicher &Schuell) onto a polyvinylidene fluoride membrane (Immobilon P; Millipore,Eschborn, Germany). The blot was stained with Coomassie blue G-250 (0.1% in40% methanol–10% acetic acid) for 30 s, and the band corresponding to amolecular mass of 26 kDa was cut out for direct Edman degradation. TheN-terminal protein sequence was determined by standard Edman degradation onan automatic peptide sequencer (model 473A; Applied Biosystems).

CD spectroscopy. Circular dichroism (CD) measurements were carried out onan AVIV 62DS CD spectrometer equipped with a temperature control unit anda Jasco J-600 spectropolarimeter (Tasco, Lakewood, N.J.), both calibrated witha 0.1% aqueous solution of D-10-camphorsulfonic acid as described by Yang etal. (58). The spectral bandwidth was 1.5 nm. The time constant ranged between1 and 4 s, and the cell path length ranged from 0.1 to 10 mm in the far-UV andfrom 0.5 to 1.0 cm in the near-UV range. The temperature was 25°C for allmeasurements.

Induction of TNF-a. Peripheral blood mononuclear cells (PBMC) were iso-lated from buffy coat layers of healthy blood donors by density centrifugationover Ficoll-Hypaque (Biochrom) as described previously (48). Cells were washedtwice with PBS and resuspended in RPMI 1640 (Biochrom) containing 10%heat-inactivated fetal calf serum (low-endotoxin, myoclone quality; Gibco BRL),2 mM L-glutamine (Biochrom), and penicillin (100 U/ml)-streptomycin (100mg/ml) (Biochrom). Cells were adjusted to a concentration of 3 3 106 cells/mland seeded in samples of 1 ml into 24-well culture plates (Nunc, Roskilde,Denmark). The cultures were incubated at 37°C in a 5% humidified CO2 atmo-

4726 FAGIN ET AL. INFECT. IMMUN.


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

sphere after the appropriate amount of toxin had been added. As stimulants, weused natural SPEA purified from S. pyogenes NY-5 (11), rSPEA from S. sanguis(13), commercial SPEA from Toxin Technology Inc., rSPEA (E. coli) (seeabove), and bovine pancreatic DNase (Sigma). Furthermore rSPEA (E. coli) wastested for its tumor necrosis factor alpha (TNF-a)-inducing capability with orwithout addition of monoclonal antibody against SPEA (UH1 [18]). Heat inac-tivation was performed by boiling rSPEA (E. coli) for 1 h at 100°C.

The culture supernatants were harvested and stored at 270°C until quantifi-cation of TNF-a by enzyme-linked immunosorbent assay (ELISA). ELISA kitsfor quantification of TNF-a were kindly provided by H. Galatti (Hoffmann-LaRoche, Basel, Switzerland). Results were measured in picograms per milliliter at450 nm, using an ELISA plate reader (Anthos Labotec, Salzburg, Austria).

MHC class II-dependent T-cell response. A transfected mouse DOIS19 T-cellhybridoma that expresses a transfected human Vb14.1 was used as a source ofinterleukin-2 (IL-2)-producing responder cells. Stimulation of the T-cell hybrid-oma was done in triplicate 200-ml microcultures containing 5 3 104 T cells and2.5 3 104 accessory cells as described previously (7). As accessory cells, we usedL cells transfected with HLA-DR2b (DR2b), the lymphoblastoid B-cell line Raji,and untransfected L cells as a control. Anti-HLA-DR antibody (Becton Dickin-son, Heidelberg, Germany) was used to block MHC class II binding of thesuperantigens. IL-2 produced by the cells was measured by using an ELISA formurine IL-2 (Biosource, Fleurus, Belgium). Data are given as means of tripli-cates; standard errors of the means were always below 10% (except for lowvalues).

RESULTS

Purity assessment of SPEA preparations. To assess the pu-rity of SPEA preparations, we used different methods. As afirst quality control, we performed SDS-PAGE followed bydifferent detection methods. Coomassie staining revealed onlya single band on the gel for each preparation tested (data notshown). Silver staining (Fig. 1A, lanes 2 to 4) revealed thatmost of the protein fractions were not homogeneous but con-tained several contaminations. Western immunoblotting with apolyclonal antiserum against SPEA (Toxin Technology Inc.)showed at least two additional immunoreactive bands withmolecular sizes of about 45 kDa (Fig. 1B, lanes 1 to 3).

(i) Protease activity in SPEA preparations. SPEB has longbeen considered to act as a superantigen and was recentlyshown to be a cysteine protease (12, 27, 46). To investigate ifother superantigens possess protease activity, we tested com-mercial SPEA preparations parallel to SPEB (Fig. 2). A dose-dependent curve for the cleavage of azocasein is shown in Fig.2A. In the presence of 2-ME or dithiothreitol (data notshown), SPEB as well as commercial SPEA preparationsshowed striking protease activity, SPEB being at least twofoldmore active than SPEA preparations. Both were not active inthe absence of a reducing agent. As an independent control weused trypsin, a highly active and very potent protease. Theproteolytic activity of commercial SPEA preparations wasfound to be charge dependent.

To attach this protease activity to a distinct protein andexamine whether the activity in SPEA preparations was due tocontaminating SPEB, we performed a gelatin substrate gelelectrophoresis. A clear band indicating protease activity ap-peared only in lanes 4 and 5 (Fig. 3), where commercial SPEAwas applied. SPEB (lanes 2 and 3) showed no protease activityunder these conditions. However, in contrast to commercialSPEA, natural SPEA from S. pyogenes NY-5 as well as rSPEAfrom S. sanguis showed no protease activity (data not shown).

(ii) DNase activity in SPEA preparations. Since contamina-tions with DNases represent one of the major problems inpurifying proteins, we investigated the degree of DNA frag-mentation induced by several SPEA preparations on an aga-rose gel. This was found to be a more sensitive test system thanmeasurement of the increase in A260 by the procedure ofKunitz (34). As shown in Fig. 4, natural SPEA from S. pyogenesNY-5, rSPEA from S. sanguis, and commercial SPEA (ToxinTechnology Inc.) showed remarkable degradation of DNA.The most striking activity was found in the preparation ob-

tained from strain NY-5, resulting in complete degradation ofDNA after only 5 min of incubation (data not shown).

Construction of an E. coli clone producing native SPEA.Since the procedure for purifying SPEA needed to be im-proved and since contaminations had to be excluded, we con-structed an E. coli clone overexpressing native SPEA. For thispurpose, we cleaved the pIN-III-ompA2 vector (a secretionvector developed by Ghrayeb et al. [15]) with HindIII andEcoRI and linked the linearized plasmid with an amplifiedPCR fragment carrying the speA gene which had been digestedwith the same enzymes. The cleavage sites for the appropriaterestriction endonucleases were introduced with the primers.

This cloning strategy resulted in plasmid pA2SPEA-1, whichwas used to transform E. coli DH5a. The speA gene was fusedin frame to the ompA signal peptide gene (Fig. 5). Betweenthe C terminus of the gene for the signal peptide and the Nterminus of the speA gene was a linker of 12 bp coding forthe tetrapeptide Ala-Glu-Phe-Ala, which was removed viaoligonucleotide-directed site-specific mutagenesis, yieldingpA2SPEA (Fig. 5). Expression of the cloned gene could beinduced with IPTG since it was under the control of the lpppromoter and the lac promoter-operator which was regulatedby the lac repressor.

Purification of rSPEA (E. coli). After induction with IPTG,the overnight culture of E. coli DH5a/pA2SPEA was tested forSPEA production by SDS-PAGE and subsequent Western im-munoblotting. No SPEA was found in the supernatant (data

FIG. 1. Analysis of proteins by SDS-PAGE (15% gel). SDS-PAGE followedby silver staining or Western immunoblotting was used to determine the purityof various SPEA preparations. (A) Silver stain. Lane 1, molecular mass standards(positions are given in kilodaltons); lane 2, SPEA from NY-5; lane 3, rSPEAfrom S. sanguis; lane 4, commercial SPEA (Toxin Technology Inc.); lane 5,rSPEA (E. coli) (2 mg of protein was loaded in each lane; lane 5, stained fora longer time to exclude contamination). (B) Western immunoblot. Lane 1,rSPEA from S. sanguis; lane 2, SPEA from NY-5; lane 3, commercial SPEA(Toxin Technology Inc.); lane 4, rSPEA (E. coli). Positions of molecular massstandards are indicated in kilodaltons.

VOL. 65, 1997 BIOACTIVE CONTAMINANTS OF SUPERANTIGENS 4727


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

not shown), but the main portion of the expressed toxin wasaccumulated in the periplasm.

The periplasmic fraction was prepared by osmotic shock byusing an improved protocol of Landt et al. (37). The harvestedcells were resuspended in TES and diluted with TE withoutintermediate centrifugation, so that the amount of contaminat-ing proteins was greatly reduced.

Subsequently the periplasmic fraction was adjusted to pH4.0 and applied to a Sepharose S column. Most of the rSPEAeluted at about 80% buffer B (Fig. 6A). After being concen-trated in a Centricon-10 to a volume of 500 ml, this sample,which contained a small number of contaminating proteinsdetectable as weak bands on the SDS-polyacrylamide gel, wasrun through a Superdex G-75 column for further purification(Fig. 6B and C). Finally, the preparation was passed over anendotoxin-removing gel. This recombinant toxin showed the

same migration properties in PAGE as natural SPEA (Fig. 6C,lanes 5 and 6). The yield of purified toxin was approximately 1mg of rSPEA/liter of liquid culture.

The originally cloned spea in pGEX2T (17) resulted in anartificial toxin with an N terminus containing three additionalamino acids compared to natural SPEA. To show that weproduced rSPEA with the authentic N-terminal sequence, wedetermined the first eight N-terminal amino acids of rSPEAfrom E. coli DH5a/pA2SPEA by Edman degradation, givingthe sequence Gln-Gln-Asp-Pro-Asp-Pro-Ser-Gln. This resultshows that the OmpA signal peptide was very efficiently re-moved at its natural cleavage site (43).

Purity assessment of rSPEA (E. coli). The purity of therecombinant protein was ascertained by several methods. Sil-ver staining (Fig. 1A, lane 5) and Western immunoblotting

FIG. 2. Azocasein assay for protease activity. This assay was used for detec-tion of contaminating proteases. (A) Caseinolytic activity was determined byincubating the protein preparations in various concentrations with a reactionmixture containing azocasein. The amount of azopeptides released was mea-sured by A440 against a negative control containing PBS and reaction mixture.The assay was done with or without addition of 10 mM 2-ME. Trypsin, as aknown protease, was used as positive control. SPEA and SPEB were purchasedfrom Toxin Technology Inc. The data represent means 6 standard deviationsfrom at least three independent experiments. (B) Comparison of caseinolyticactivity of 5 mg of each protein preparation. Assay conditions were as for panelA. The data represent means 6 standard deviations from at least three inde-pendent experiments.

FIG. 3. SDS-gelatin-PAGE. To distinguish between SPEB and other pro-teases, we used SDS-gelatin-PAGE. Two and 3 mg of SPEB (lanes 2 and 3) andSPEA (lanes 4 and 5) preparations (both purchased from Toxin Technology Inc.)were electrophoresed on an SDS–15% polyacrylamide gel copolymerized with0.5% gelatin. After incubation with reducing buffer (for details, see Materialsand Methods), the gel was Coomassie blue stained. Trypsinogen (Tryp.), with amolecular mass of 24 kDa, was used as positive control (lanes 1 and 6). Thearrow indicates the position of the protease activity.

FIG. 4. DNase assay. The contaminations with DNases were determined byDNA cleavage. Shown is DNA degradation after incubation at 37°C for 12 h.Two micrograms of plasmid DNA was incubated with different SPEA prepara-tions. As positive controls, we used DNase for complete degradation and EcoRIfor linearized DNA. Native DNA as a negative control shows the three forms:superhelical circular, nicked circular, and linear. Lanes 1, 6, and 10, 123-bpladder; lane 2, DNA with 5 U of EcoRI; lane 3, native DNA; lane 4, DNA with5 U of DNase; lane 5, DNA with 2 mg of commercial SPEA from Toxin Tech-nology Inc.; lane 7, DNA with 2 mg of rSPEA from S. sanguis; lane 8, DNA with2 mg of SPEA from NY-5; lane 9, DNA with 2 mg of rSPEA (E. coli).



http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

(Fig. 1B, lane 4) revealed only a single band at 26 kDa. Theisoelectric point of rSPEA (E. coli) on a polyacrylamide gelwith an immobilized gradient of pH 4 to 6.5 was found to be5.2, as described elsewhere (25) (data not shown). The azoca-sein assay for protease activity was completely negative forrSPEA (E. coli), even in the presence of 2-ME (Fig. 2B).

In addition, DNA treated with rSPEA (E. coli) showed thesame migration pattern as native DNA (Fig. 4, lanes 3 and 9),indicating that it contained no DNases.

The various SPEA preparations tested and their levels ofcontamination are summarized in Table 1.

Structural characterization by CD spectroscopy. The fold-ing state of the recombinant SPEA (E. coli) was characterizedby CD spectroscopy and compared with the natural protein(from S. pyogenes NY-5). Figure 7A shows the far-UV CDspectra of rSPEA and natural SPEA. Both spectra are indica-tive of a protein in a folded state and differ slightly in intensitybut not in shape, indicating that the two molecules have thesame fold. Secondary structure analysis (49) of the far-UV CDspectra showed that the proteins mainly consist of b-sheet(48% b-sheet, 6% a-helix, 19% turn). These calculatedamounts of secondary structure elements are in good agree-

ment with the crystal structure of SEB (51). Near-UV CDspectra are sensitive indicators for tertiary structure involvingaromatic side chains. Figure 7B shows the near-UV CD spec-tra of the two proteins, which differ in intensity but are almostidentical in shape. The small intensity differences seen in thefar-UV and near-UV CD spectra are probably due to theimpurities found in natural SPEA and/or reflect uncertaintiesin estimating the protein concentrations.

Induction of TNF-a in human PBMC. With a quantitativeLimulus amebocyte assay, the concentration of endotoxin wascalculated from its reaction time by comparison to the reactiontime of solutions containing known amounts of endotoxin stan-dard. Our rSPEA preparation contained less than 0.005 endo-toxin units per ml (i.e., below the detection limit of the assay).When the ability of purified rSPEA (E. coli) to induce TNF-ain human PBMC was tested, even an amount as low as 0.01 mgof rSPEA (E. coli) resulted in a significant TNF-a release (Fig.8).

Furthermore, rSPEA from E. coli was compared to variousother SPEA preparations (Table 2). TNF-a release was foundto be significantly increased for natural SPEA from strainNY-5, possibly as a result of extensive contamination with

FIG. 5. Cloning strategy for the construction of pA2SPEA. The speA gene (from pGEX2T/SPEA after PCR amplification) was inserted into vector pIN-III-ompA2after digestion with EcoRI/HindIII, resulting in plasmid pA2SPEA-1. Triangles under the amino acid sequence indicate the cleavage site of the OmpA signal peptide.The tetrapeptide linker in pA2SPEA-1 is underlined. Removal of the linker sequence yields pA2SPEA. Native SPEA starts with glutamine (marked 1). Abbreviations:Ba, BamHI; Ec, EcoRI; Hi, HindIII.



http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

DNases. In two independent experiments, we found thatDNase induced TNF-a by itself. Human PBMC released 3,100(donor 1) and 5,300 (donor 2) pg of TNF-a per ml afterstimulation with 5,000 U of DNase. However, DNases showedno mitogenic activity (data not shown). In contrast, commer-cial SPEA and rSPEA from S. sanguis showed significantlydecreased TNF-a release in comparison to our rSPEA. Toconfirm that this high TNF-a-stimulating activity of rSPEA (E.coli) was due to its purity, we performed the assay in thepresence of a monoclonal antibody against SPEA (UH1) andalso inactivated our preparation by heat to exclude nonpro-teinaceous contaminations (e.g., LPS). Monoclonal antibodycompletely abolished TNF-a induction. According to the heat

stability of enterotoxins (3), we observed reduced activity after15 min at 95°C (data not shown) and no TNF-a-stimulatingactivity after boiling for 1 h at 100°C (Table 3). In contrast, LPSshould remain active under these conditions (45).

FIG. 6. Course of purification. (A) Elution pattern of periplasmic proteinsrun on a Sepharose S cation-exchange column (Pharmacia) with a 50-min lineargradient from 100% buffer A (0.01 M acetate, pH 4.0) to 60% buffer B (0.05 Macetate, pH 5.8), followed by a 150-min linear gradient from 60% to 100% bufferB. The arrow indicates main SPEA-containing fractions, which were combinedand concentrated in a Centricon-10. %B, 80%. (B) Elution pattern of SPEAfractions obtained from the cation-exchange column and applied to a gel filtra-tion Superdex G-75 column (Pharmacia). SPEA eluted as a single peak (arrow).(C) Proteins were subjected to SDS-PAGE (15% gel) and stained with Coomas-sie brilliant blue. Lanes 1 and 7, molecular mass standards (positions are given inkilodaltons); lanes 2 and 3, periplasmic fraction of E. coli DH5a/pIN-III-ompA2without (lane 2) or with (lane 3) the speA gene inserted; lanes 4 and 5, SPEApreparation after cation-exchange chromatography (lane 4) and after gel filtra-tion (lane 5); lane 6, commercial SPEA.

FIG. 7. Structural characterization. CD spectra were used to analyze thecorrect folding of the recombinant protein. (A) Comparison of the far-UV CDspectra of the natural (solid line) and recombinant (dashed line) SPEA (E. coli).(B) Comparison of the near-UV CD spectra of the natural (solid line) andrecombinant (dashed line) SPEA (E. coli). QMRW, ellipticity at mean residueweight (MRW).

TABLE 1. Summary of contaminations of variousSPEA preparationsa

SPEA prepn Proteaseactivity

DNaseactivity

Contaminations detected by:

Coomassiestain

Silverstain

Westernimmunoblot

Commercial 11 1 2 1 2SPEA from NY-5 2 1111 2 11 1rSPEA from:

S. sanguis 2 111 2 1 1E. coli 2 2 2 2 2

a 2, no activity or contamination; 1 to 1111, relative degrees of positiveactivity.



http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

MHC class II-dependent Vb-specific T-cell response. Super-antigenic activity of our recombinant toxin was tested via MHCclass II-dependent Vb-specific T-cell response. We used hu-man Vb14.1 T cells, which are known to respond to SPEA andSEB (1, 26). In the presence of 100 ng of rSPEA (E. coli) perml, the cells showed a clear response to HLA-DR2b-trans-fected L cells, although the response was fourfold lower than inthe presence of SEB (Fig. 9A). This might reflect the higheraffinity of SPEA for HLA-DQ (21). Antibody against MHCclass II abolished response in both cases. There was no re-sponse to the superantigens when MHC class II-negative cells(L cells) were used as presenting cells. SPEA presented by Rajicells (HLA-DR and -DQ positive) induced an IL-2 releasecomparable to that induced by SEB. T cells elicited a dose-dependent response to either SPEA or SEB when presented byMHC class II-positive cells (Raji) (Fig. 9B).

DISCUSSION

Several groups have reported different methods for the pu-rification of SPEA (6, 8, 11, 25, 29), but as the contradictorypublished data concerning the biological effects show (1, 7, 10,53), the purity of SPEA preparations is still unsatisfactory. Forinvestigations of the biological activities of the toxin, a proce-dure whereby highly purified SPEA can be easily obtained isnecessary. Furthermore, application of stringent methods ofpurity assessment is needed.

In our study, we demonstrate by several techniques that the

purity of a commercial SPEA preparation was less than opti-mal and that it contained at least two contaminating proteins:a protease and a DNase. The protease activity was shown notto be due to contaminations with SPEB, since SPEB did notshow any activity in the gelatin substrate gel electrophoresis.Furthermore, the strain used for purification of SPEA was S.pyogenes 594, which does not produce detectable amounts ofSPEB. The protease activity could not be ascribed to SPEAitself, for it was localized at a higher molecular mass, as com-parison with trypsinogen (Fig. 3, lanes 1 and 6) reveals. There-

FIG. 8. Dose-dependent production of TNF-a by human PBMC stimulatedwith rSPEA (E. coli). Shown are results of an experiment representative of threeothers, using cells from different donors.

FIG. 9. MHC class-II dependent Vb-specific T-cell response. (A) SPEA orSEB was presented by HLA-DR2b-transfected L cells (DR2b), untransfectedMHC class II-negative cells (L cells), or HLA-D-positive Raji cells to humanVb14.1 T-cell hybridoma cells. For indicating MHC class II dependency, presen-tation by HLA-DR2b was blocked by anti-HLA-DR antibodies (DR2b/aDR).Supernatants of stimulated T cells were tested for IL-2 by ELISA. Shown areresults of one representative experiment. (B) Dose-response curve. Assay con-ditions were as described for panel A.

TABLE 2. TNF-a-inducing capacity of various SPEA preparations

Inducer TNF-aa (pg/ml)

Control................................................................................ 61 6 23*SPEA from NY-5 .............................................................. 4,519 6 1,835*rSPEA from:

E. coli .............................................................................. 2,248 6 957S. sanguis ........................................................................ 618 6 169*

SPEA (Toxin Technology Inc.) ....................................... 981 6 403*

a PBMC were incubated for 48 h at 37°C in the presence of 1 mg of each SPEApreparation. RPMI medium was used in control experiments. The data representmean values 6 standard deviations [n 5 8; p, significant deviation from rSPEA(E. coli), P , 0.05 as verified by two-tailed Student’s t test].

TABLE 3. Specific TNF-a induction by rSPEA (E. coli)

Inducer TNF-aa (pg/ml)

Control.................................................................................. 0*Control 1 UH1 ................................................................... 316 6 74*,#

rSPEA (E. coli).................................................................... 2,614 6 508rSPEA (E. coli) 1 UH1..................................................... 365 6 87*,#

rSPEA (E. coli), boiled....................................................... 0*

a PBMC were incubated for 48 h at 37°C in the presence of 1 mg of rSPEA (E.coli) with or without addition of 2 mg of monoclonal anti-SPEA antibody UH1.Heat inactivation of the toxin was achieved by boiling for 1 h. RPMI medium wasused in control experiments. The data represent mean values 6 standard devi-ations [n 5 3; p, significant deviation from rSPEA (E. coli), P , 0.05 as verifiedby two-tailed Student’s t test; #, no statistical difference between control 1 UH1and rSPEA (E. coli) 1 UH1, P . 0.05 as verified by two-tailed Student’s t test].



http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

fore, the commercial SPEA preparation contained a highlyactive protease, most likely a cysteine protease, since it wasactive only in the presence of reducing agents.

Proteolytic enzymes such as trypsin, chymotrypsin, papain,or thrombin are known to possess mitogenic activity (41, 42,52). Since proteases may show biological activities which caninterfere with the activities attributed to SPEA, the presence ofa protease is not desirable. It is a general problem that proteinpreparations can contain DNases with potential immunostimu-lative activities, which are difficult to remove. Here we showedthat SPEA from S. pyogenes NY-5 exhibited a very strikingDNase activity (Fig. 4), which was probably the reason for thesignificantly higher TNF-a release compared with the recom-binant toxin from E. coli (Table 1). Since the same amount ofprotein was used to stimulate the PBMC, the significantlylower TNF-a release of commercial SPEA and SPEA obtainedfrom S. sanguis might be due to inactive contaminations, alter-ing the amount of actually available SPEA. It is questionablewhether the resting activity was an effect of SPEA or thecontaminations. Recently Kum et al. identified a staphylococ-cal lipase in commercial TSST-1 preparations that showedbiological activity which previously was falsely attributed toTSST-1 (33).

The production of recombinant proteins could be a means tocircumvent these difficulties. So far, only unsatisfactory strate-gies for cloning speA have been reported. The toxin has beenexpressed in a variety of backgrounds. The speA gene wasinserted into a high-copy-number plasmid in Bacillus subtilis,but this approach entailed difficulties in resolubilization of thepurified toxin (32). It was further cloned in S. sanguis (55), stillwith the gram-positive streptococcal background, and as a fu-sion protein in the vector pGEX2T in E. coli with three addi-tional amino acids at the N terminus (17). rSPEA derived fromthis fusion protein differed even in its isoelectric point fromnatural SPEA (data not shown). Therefore, the immunologicalspecificity of this artificial SPEA is questionable.

The presence of thrombin in the final protein preparation isanother uncertainty in this system. The recently reported gen-eration of rSPEA by using the pET expression vector (30)resulted in a protein with four additional amino acids at the Nterminus.

In this work, we describe cloning of the speA gene in the verypotent secretion cloning vector pIN-III-ompA2. The matureproduct was found to have an N-terminal sequence identical tothat of natural SPEA. As our results show, the OmpA signalpeptide was cleaved at its natural processing site, and thecleaved product was translocated into the periplasmic space.Thus, our strategy was extremely efficient in producing rSPEAwith the authentic sequence in a system that avoids the strep-tococcal or, in general, the gram-positive background. In E.coli, contaminations of the cloned product with trace amountsof highly active superantigens are excluded, since bacterialsuperantigens are characteristically produced by gram-positivecocci such as Staphylococcus aureus and S. pyogenes. We de-scribe a very simple, rapid procedure for the purification ofSPEA and assessment of its purity by several methods (Table1). Our preparation of rSPEA definitely contains no proteasesand no DNases, whereas nearly all SPEA preparations used sofar in published studies did. Only a single homogeneous 26-kDa protein was visualized either by silver staining or by im-munoblotting. Superantigenic activity of our recombinant toxinwas shown by its ability to induce proliferation of human Vb14cells with DR2b or Raji as presenting cells (1, 20).

While this work was in progress, expression of SPEA in E.coli and its rapid purification by high-pressure liquid chroma-tography were reported (57). A 1.8-kb EcoRI-SalI fragment

containing the speA gene was ligated into vector pET23(1).The recombinant protein was purified from the periplasm byosmotic shock. However, Yamamoto and Ferretti (57) showedneither that the expressed toxin possessed the correct aminoacid sequence nor that their preparation was free of contam-inations. In their system, a protease in a gram-negative hosthad to cleave off specifically a signal peptide which was derivedfrom gram-positive streptococci. Recently Pinkney et al. (47)showed that recombinant streptolysin O found in theperiplasm of E. coli differed in amino acid sequence fromstreptolysin O produced by S. pyogenes. Therefore, it is ques-tionable if a comparable cloning strategy resulted in a toxinidentical to natural SPEA. In contrast to Yamamoto and Fer-retti (57), we cloned only the region coding for the matureprotein. Furthermore, we show that the signal peptide wasremoved specifically and that our recombinant SPEA is prop-erly folded and structurally identical to the natural SPEA. Theauthentic protein sequence was ascertained by N-terminal se-quencing.

In conclusion, the availability of highly purified SPEA prep-arations should greatly facilitate further studies for elucidationof the biological properties of this streptococcal exotoxin. Ourstrategy of quality control of superantigen preparations may behelpful for all superantigens.

ACKNOWLEDGMENT

We thank Una Doherty for critical reading of the manuscript.

REFERENCES

1. Abe, J., J. Forrester, T. Nakahara, J. A. Lafferty, B. L. Kotzin, and D. Y.Leung. 1991. Selective stimulation of human T-cells with streptococcal eryth-rogenic toxins A and B. J. Immunol. 146:3747–3750.

2. Bartter, T., A. Dascal, K. Carrol, and F. J. Curley. 1988. “Toxic strepsyndrome”: manifestations of group A streptococcal infection. Arch. Intern.Med. 148:1421–1424.

3. Bergdoll, M. S. 1983. Enterotoxins, p. 559–598. In S. C. F. Easmon and C.Adlam (ed.), Staphylococci and staphylococcal infections. Academic Press,Inc., New York, N.Y.

4. Bohach, G. A., A. R. Hauser, and P. M. Schlievert. 1988. Cloning of the gene,speB, for streptococcal pyrogenic exotoxin type B in Escherichia coli. Infect.Immun. 56:1665–1671.

5. Bohach, G. A., and P. M. Schlievert. 1987. Nucleotide sequence of thestaphylococcal enterotoxin C1 gene and relatedness to other pyrogenic tox-ins. Mol. Gen. Genet. 209:15–20.

6. Bohach, G. A., D. J. Fast, R. D. Nelson, and P. M. Schlievert. 1990. Staph-ylococcal and streptococcal pyrogenic toxins involved in toxic shock syn-drome and related illnesses. Crit. Rev. Microbiol. 17:251–272.

7. Braun, M. A., D. Gerlach, U. F. Hartwig, J. H. Ozegowski, F. Romagne, S.Carrel, W. Kohler, and B. Fleischer. 1993. Stimulation of human T-cells by“streptococcal” superantigen erythrogenic toxins (scarlet fever toxins). J. Im-munol. 150:2457–2466.

8. Cunningham, C. M., E. L. Barsumian, and D. W. Watson. 1976. Furtherpurification of group A streptococcal pyrogenic exotoxin and characteriza-tion of the purified toxin. Infect. Immun. 14:767–775.

9. Fleischer, B., D. Gerlach, A. Fuhrmann, and K.-H. Schmidt. 1995. Superan-tigens and pseudosuperantigens of gram-positive cocci. Med. Microbiol.Immunol. 184:1–8.

10. Fleischer, B., R. Gerardy-Schahn, B. Metzroth, S. Carrel, D. Gerlach, andW. Kohler. 1991. A conserved mechanism of T-cell stimulation by microbialtoxins. Evidence for different affinities of T-cell receptor-toxin interaction.J. Immunol. 146:11–17.

11. Gerlach, D., H. Knoll, and W. Kohler. 1980. Purification and characteriza-tion of erythrogenic toxins. I. Investigation of erythrogenic toxin A producedby Streptococcus pyogenes strain NY-5. Zentralbl. Bakteriol. Hyg. A 247:177–191.

12. Gerlach, D., H. Knoll, W. Kohler, J. H. Ozegowski, and V. Hribalova. 1983.Isolation and characterization of erythrogenic toxins. V. Identity of erythro-genic toxin type B and streptococcal proteinase precursor. Zentralbl. Bak-teriol. Microbiol. Hyg. A 255:221–233.

13. Gerlach, D., W. Kohler, H. Knoll, L. Moravek, C. R. Weeks, and J. J.Ferretti. 1987. Purification and characterization of Streptococcus pyogeneserythrogenic toxin type A produced by a cloned gene in Streptococcus san-guis. Zentralbl. Bakteriol. Microbiol. Hyg. A 266:347–358.

14. Gerlach, D., W. Reichhardt, B. Fleischer, and K. H. Schmidt. 1994. Sepa-



http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

ration of mitogenic and pyrogenic activities from so-called erythrogenic toxintype B (streptococcal proteinase). Int. J. Med. Microbiol. Virol. Parasitol.Infect. Dis. 280:507–514.

15. Ghrayeb, J., H. Kimura, M. Takahara, H. Hsiung, Y. Masui, and M. Inouye.1984. Secretion cloning vectors in Escherichia coli. EMBO J. 1:1217–1224.

16. Hackett, S. P., and D. L. Stevens. 1993. Superantigens associated with staph-ylococcal and streptococcal toxic shock syndrome are potent inducers oftumor necrosis factor-a synthesis. J. Infect. Dis. 168:232–235.

17. Hartwig, U. F., and B. Fleischer. 1993. Mutations affecting MHC class II ofthe superantigen streptococcal erythrogenic toxin A. Int. Immunol. 5:869–875.

18. Hartwig, U. F., D. Gerlach, and B. Fleischer. 1994. Major histocompatibilitycomplex class II binding site for streptococcal pyrogenic (erythrogenic) toxinA. Med. Microbiol. Immunol. 183:257–264.

19. Holm, S. E., A. Norrby, A.-M. Bergholm, and M. Norgren. 1992. Aspects ofpathogenesis in serious group A streptococcal infections in Sweden 1988–1989. J. Infect. Dis. 166:31–37.

20. Imanishi, K., H. Igarashi, and T. Uchiyama. 1990. Activation of murineT-cells by streptococcal pyrogenic exotoxin A. Requirement for MHC classII molecules on accessory cells and identification of Vb elements in T-cellreceptor of toxin-reactive T-cells. J. Immunol. 144:3170–3175.

21. Imanishi, K., H. Igarashi, and T. Uchiyama. 1992. Relative abilities ofdistinct isotypes of human major histocompatibility complex class II mole-cules to bind streptococcal pyrogenic exotoxin types A and B. Infect. Immun.60:5025–5029.

22. Janeway, C. A., Jr. 1991. Selective elements for the Vb region of the T-cellreceptor: MIs and the bacterial toxic mitogens. Adv. Immunol. 50:1–53.

23. Johnson, L. P., and P. M. Schlievert. 1984. Group A streptococcal phage T12carries the structural gene for pyrogenic exotoxin type A. Mol. Gen. Genet.194:52–56.

24. Johnson, L. P., J. L. L’Italien, and P. M. Schlievert. 1986. Streptococcalpyrogenic exotoxin type A (scarlet fever toxin) is related to Staphylococcusaureus enterotoxin B. Mol. Gen. Genet. 203:354–356.

25. Kamezawa, Y., and T. Nakahara. 1989. Purification and characterization ofstreptococcal erythrogenic toxin type A produced by Streptococcus pyogenesstrain NY-5 cultured in the synthetic medium NCTC-135. Microbiol. Immu-nol. 33:183–194.

26. Kappler, J., B. Kotzin, L. Herron, E. Gelfand, R. D. Bigler, A. Boylston, S.Carrel, C. D. Posneit, Y. Choi, and P. Marrack. 1989. Vb-specific stimulationof human T-cells by staphylococcal toxins. Science 244:811–814.

27. Kapur, V., M. W. Majeski, L. L. Li, R. A. Black, and J. M. Musser. 1993.Cleavage of interleukin 1b (Il-1b) precursor to produce active IL-1b by aconserved extracellular cysteine protease from Streptococcus pyogenes. Proc.Natl. Acad. Sci. USA 90:7676–7680.

28. Keene, W. E., M. G. Petitt, S. Allen, and J. H. McKerrow. 1986. The majorneutral proteinase of Entamoeba histolytica. J. Exp. Med. 163:536–549.

29. Kim, Y. B., and D. W. Watson. 1970. A purified group A streptococcalpyrogenic exotoxin. Physicochemical and biological properties including theenhancement of susceptibility to endotoxin shock. J. Exp. Med. 131:611–622.

30. Kline, B. K., and C. M. Collins. 1996. Analysis of the superantigenic activityof mutant and allelic forms of streptococcal pyrogenic exotoxin A. Infect.Immun. 64:861–869.

31. Kohler, W. 1990. Streptococcal toxic shock syndrome. Int. J. Med. Microbiol.272:257–264.

32. Kreiswirth, B. N., J. P. Handley, P. M. Schlievert, and R. P. Novick. 1987.Cloning and expression of streptococcal pyrogenic exotoxin A and staphy-lococcal toxic-shock syndrome toxin-1 in Bacillus subtilis. Mol. Gen. Genet.208:84–87.

33. Kum, W. W. S., K. B. Laupland, R. H. See, and A. W. Chow. 1993. Improvedpurification and biological activities of staphylococcal toxic shock syndrometoxin 1. J. Clin. Microbiol. 31:2654–2660.

34. Kunitz, M. 1950. Cristalline DNase I. Isolation and general properties.J. Gen. Physiol. 33:349–363.

35. Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly ofthe head of bacteriophage T4. Nature 227:680–685.

36. Landt, O., H. P. Grunert, and U. Hahn. 1990. A general method for rapidsite-directed mutagenesis using the polymerase chain reaction. Gene 96:125–128.

37. Landt, O., M. Zirpel-Giesebrecht, A. Milde, and U. Hahn. 1992. Improving

purification of recombinant ribonuclease T1. J. Biotechnol. 24:189–194.38. Leonard, B. A. B., P. K. Lu, M. K. Jenkins, and P. M. Schlievert. 1991. Cell

and receptor requirements for streptococcal pyrogenic exotoxin T-cell mi-togenicity. Infect. Immun. 59:1210–1214.

39. Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecular cloning: alaboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor,N.Y.

40. Marrack, P., and J. Kappler. 1990. The staphylococcal enterotoxins andtheir relatives. Science 248:705–711.

41. Mazzei, D., C. Novi, and C. Bazzi. 1966. Letter. Lancet ii:232.42. Mazzei, D., C. Novi, and C. Bazzi. 1966. Letter. Lancet ii:802.43. Movva, N. R., K. Nakamura, and I. Masayori. 1980. Amino acid sequence of

the signal peptide of ompA protein, a major outer membrane protein ofEscherichia coli. J. Biol. Chem. 255:27–29.

44. Musser, J. M., A. R. Hauser, M. H. Kim, P. M. Schlievert, K. Nelson, andR. K. Seelander. 1991. Streptococcus pyogenes causing toxic shock-like syn-drome and other invasive diseases; clonal diversity and pyrogenic exotoxinexpression. Proc. Natl. Acad. Sci. USA 88:2668–2672.

45. Nowotny, A., J. J. Spitzer, and E. J. Ziegler. 1990. In Cellular and molecularaspects of endotoxin reactions, endotoxin research ser. A, vol. 1. ElsevierScience Publishers, Amsterdam, The Netherlands.

46. Ohara-Nemoto, Y., M. Sasaki, M. Kaneko, T. Nemoto, and M. Ota. 1994.Cysteine protease activity of streptococcal pyrogenic exotoxin B. Can. J.Microbiol. 40:930–936.

47. Pinkney, M., V. Kapur, J. Smith, U. Weller, M. Palmer, M. Glanville, M.Messner, J. M. Musser, S. Bhakdi, and M. A. Kehoe. 1995. Different formsof streptolysin O produced by Streptococcus pyogenes and by Escherichia coliexpressing recombinant toxin: cleavage by streptococcal cysteine protease.Infect. Immun. 63:2776–2779.

48. Schober, I., R. Braun, H. Reiser, K. Munk, M. Leroux, and H. Kirchner.1984. Ia-positive T lymphocytes are the producer cells of interferon g. Exp.Cell Res. 152:348–356.

49. Sreerama, N., and R. W. Woody. 1994. Protein secondary structure fromcircular dichroism spectroscopy. Combining variable selection principle andcluster analysis with neural network, ridge regression and self-consistentmethods. J. Mol. Biol. 242:497–507.

50. Stevens, D. L., M. H. Tanner, J. Winship, R. Swarts, K. M. Ries, P. M.Schlievert, and E. Kaplan. 1989. Reappearance of scarlet fever toxin Aamong streptococci in the Rocky Mountain West: severe group A strepto-coccal infections associated with a toxic shock-like syndrome and scarletfever toxin A. N. Engl. J. Med. 321:1–7.

51. Swaminathan, W. F., J. Pletcher, and M. Sax. 1992. Crystal structure ofstaphylococcal enterotoxin B, a superantigen. Nature 359:801–805.

52. Teng, N. N., and L. Bo-Chen. 1975. The role of surface proteins in cellproliferation as studied with thrombin and other proteases. Proc. Natl. Acad.Sci. USA 72:413–417.

53. Tomai, M. A., P. M. Schlievert, and M. Kotb. 1992. Distinct T-cell receptorVb gene usage by human T lymphocytes stimulated with the streptococcalpyrogenic exotoxins and pep M5 protein. Infect. Immun. 60:701–705.

54. Towbin, H., T. Staehelin, and J. Gordon. 1979. Electrophoretic transfer ofproteins from polyacrylamide gels to nitrocellulose sheets: procedure andsome applications. Proc. Natl. Acad. Sci. USA 765:4350–4354.

55. Weeks, C. R., and J. J. Ferretti. 1984. The gene for type A streptococcalexotoxin (erythrogenic toxin) is located in bacteriophage T12. Infect. Im-mun. 46:531–536.

56. Weeks, C. R., and J. J. Ferretti. 1986. Nucleotide sequence of the type Astreptococcal exotoxin (erythrogenic toxin) gene from Streptococcus pyogenesbacteriophage T12. Infect. Immun. 52:144–150.

57. Yamamoto, M., and J. J. Ferretti. 1995. High level expression of Streptococ-cus pyogenes erythrogenic toxin A (SPE A) in Escherichia coli and its rapidpurification by HPLC. FEMS Microbiol. Lett. 132:209–213.

58. Yang, J. T., T. A. Bewley, G. C. Chen, and C. H. Li. 1977. Conformation ofbeta-endorphin and beta-lipotropin: formation of helical structure in meth-anol and sodium dodecyl sulfate solutions. Proc. Natl. Acad. Sci. USA74:3235–3238.

59. Yu, C. E., and J. J. Ferretti. 1989. Molecular epidemiologic analysis of thetype A streptococcal exotoxin (erythrogenic toxin) gene (speA) in clinicalStreptococcus pyogenes strains. Infect. Immun. 57:3715–3719.

Editor: S. H. E. Kaufmann



http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

exclusion of bioactive contaminations in …materials and methods toxins. we used the following...

Documents