exam style questions - corbettmaths · exam style questions ensure you have ... write down the...

Name: Exam Style Questions Ensure you have: Pencil, pen, ruler, protractor, pair of compasses and eraser You may use tracing paper if needed Guidance 1. Read each question carefully before you begin answering it. 2. Donʼt spend too long on one question. 3. Attempt every question. 4. Check your answers seem right. 5. Always show your workings Revision for this topic © CORBETTMATHS 2014

Upload: voquynh

Post on 05-Jun-2018

250 views

Category:

Documents

0 download

Report

Download

Embed Size (px):

TRANSCRIPT

Name:

Exam Style Questions

Ensure you have: Pencil, pen, ruler, protractor, pair of compasses and eraser You may use tracing paper if needed

Guidance

1. Read each question carefully before you begin answering it.2. Donʼt spend too long on one question.3. Attempt every question.4. Check your answers seem right.5. Always show your workings

Revision for this topic

Page 2: Exam Style Questions - Corbettmaths · Exam Style Questions Ensure you have ... Write down the translation vector that would take B to C. (1) "(c) Write down the translation vector

" Translate triangle C by 8 squares right and 1 square down.(1)

" Translate rectangle C by 4 squares left and 3 square up.(1)

Page 3: Exam Style Questions - Corbettmaths · Exam Style Questions Ensure you have ... Write down the translation vector that would take B to C. (1) "(c) Write down the translation vector

" Translate triangle A by .

(2)

Page 4: Exam Style Questions - Corbettmaths · Exam Style Questions Ensure you have ... Write down the translation vector that would take B to C. (1) "(c) Write down the translation vector

" Translate rectangle A by

" Label the new shape B.

(2)

Page 5: Exam Style Questions - Corbettmaths · Exam Style Questions Ensure you have ... Write down the translation vector that would take B to C. (1) "(c) Write down the translation vector

" Translate trapezium A by the vector

(1)

Page 6: Exam Style Questions - Corbettmaths · Exam Style Questions Ensure you have ... Write down the translation vector that would take B to C. (1) "(c) Write down the translation vector

" Translate shape A by the vector

(2)

Page 7: Exam Style Questions - Corbettmaths · Exam Style Questions Ensure you have ... Write down the translation vector that would take B to C. (1) "(c) Write down the translation vector

" Translate triangle A by the vector

(2)

Page 8: Exam Style Questions - Corbettmaths · Exam Style Questions Ensure you have ... Write down the translation vector that would take B to C. (1) "(c) Write down the translation vector

" (a) Translate shape A by the vector and label B.

(2)

"" (b) Write down the translation vector that would return B to A.

(1)

Page 9: Exam Style Questions - Corbettmaths · Exam Style Questions Ensure you have ... Write down the translation vector that would take B to C. (1) "(c) Write down the translation vector

" Write down the translation vector that would take A to B.

(1)

Page 10: Exam Style Questions - Corbettmaths · Exam Style Questions Ensure you have ... Write down the translation vector that would take B to C. (1) "(c) Write down the translation vector

10.

" (a) Write down the translation vector that would take A to B.

(1)

" (b) Write down the translation vector that would take B to C.

(1)

" (c) Write down the translation vector that would take C to A.

(1)

Page 11: Exam Style Questions - Corbettmaths · Exam Style Questions Ensure you have ... Write down the translation vector that would take B to C. (1) "(c) Write down the translation vector

11.

" Describe fully the single transformation that maps shape A onto shape B.

"" .....................................................................................................................................

" .....................................................................................................................................

" .....................................................................................................................................(2)

Page 12: Exam Style Questions - Corbettmaths · Exam Style Questions Ensure you have ... Write down the translation vector that would take B to C. (1) "(c) Write down the translation vector

12.

" Describe fully the single transformation that maps shape A onto shape B.

"" .....................................................................................................................................

" .....................................................................................................................................

" .....................................................................................................................................(2)

Page 13: Exam Style Questions - Corbettmaths · Exam Style Questions Ensure you have ... Write down the translation vector that would take B to C. (1) "(c) Write down the translation vector

13.

" Describe fully the single transformation that maps shape A onto shape B.

"" .....................................................................................................................................

" .....................................................................................................................................

" .....................................................................................................................................(2)

Part I: Translation: Write a literal translation within ... … · Web view2008 Final Exam. LATIN II HONORS. VERSION BETA. Magister Chang. Sign Your Acknowledgement of the Honor

POSITION VECTORS & FORCE VECTORS In-Class Activities: Check Homework Reading Quiz Applications / Relevance Write Position Vectors Write a Force Vector

8 Complex Vector Spaces - Cengage€¦ · 392 Chapter 8 Complex Vector Spaces 8.1 Complex Numbers Use the imaginary unit to write complex numbers. Graphically represent …

How to Write for Translation

2-D Geometry. The Image Formation Pipeline Outline Vector, matrix basics 2-D point transformations Translation, scaling, rotation, shear Homogeneous

Google Chrome For Read and write - Squarespace€™s get started! 1. ... ×Settings in Read & Write × Speech -- voice, speed, translation ... × Read and Write is challenging to

NETWORKS LAB MANUAL-10CSL77 2016-2017 SEMESTER · PDF fileNETWORKS LAB MANUAL-10CSL77 2016-2017 SEMESTER-VII ... Write a program for distance vector algorithm to ... Write a program

chpt 9 - Weeblybrutusmath.weebly.com/uploads/3/7/4/9/37497185/chpt_9.1.pdfVECTORS Another way to describe a translation is by using a vector. A vector is a quantity that has both direction

Vector Calculus & General Coordinate Systems · PDF filecoordinate system is used to take advantage of spherical ... We can now write the basis and dual basis, ... Vector Calculus

translation-invariant operators on spaces of vector-valued functions

Structure from Motion€¦ · Orthogonal Structure from Motion •Let’s recap: – Write down matrix of observations – Find translation from avg. position – Subtract translation

Transcription and Translation Practice TACGCTGACGAGAAATTAATTTCCTTGACT Write the mRNA Translate the mRNA into a protein

Chapter 12 Rolling- AP · Web view2016 AP Physics Chapter 11 Notes Chapter 11 Angular Momentum + Rolling along Vector/ scalar Translation Rotation (angular) Relate Translation and

· Web viewCrystalline and Amorphous solids, Crystal Structure: lattice translation vector, symmetry operations, space lattice, basis; Unit cell and Primitive cell, Fundamental

Write to Learn: What is the message of this painting? Translation: “This is not a pipe.”

Mass as a Geometric Property of Spacetime€¦ · spacetime, and a translation of the point which marks the tip of the vector in the tangent space defined at the origin of the vector

COMPUTER NETWORKS LAB MANUAL Lab... · Write a program for distance vector algorithm to find suitable ... Write a program for congestion control using Leaky bucket algorithm. Computer

Gravity 3 - Gravitational Potential and the Geoidcconnor/pot_fields_lectures/Lecture3_gravity.pdfGravity 3 Gravity as a vector We can write Newton’s law for gravity in a vector form

VISVESVARAYA TECHNOLOGICAL UNIVERSITY, BELGAUM … Syllabus.pdf · VISVESVARAYA TECHNOLOGICAL UNIVERSITY, BELGAUM ... Write a program for distance vector algorithm ... Write a program

a. What is the maximum number of knights that · Copy the figure and the given translation vector. Then draw the translation of the figure along the translation vector. 62/87,21 Step

Supporting Information. · pCri-18a map. Nucleotide sequence and translation of the vector cloning site. Part of the GFP sequence that is omitted from the vector map are marked by

· Refr4 Fik Fie Info Z Fik Ok Stop ok F. Up Up Ok Fik Fik Up . Vector Manufacture Ok 4'} Info Ok G. Up Stop G. G. G. Info G. Write G.2 GiÆ2 G.2 Write Vector Manufacture GLÆ2 Up

· 8x — 2y + 5z = 4 The equation above can be rewritten as AF I. Write down the matrix A. 2. Write down the vector r. 3. Write down the vector c. name QUIZ 4 —c, A is a matrix

Section 7.2 Rigid Motion in a Plane Reflection. Bell Work 1.Describe the translation in words: 2.Write the translation in arrow notation: 3.Write coordinates

Ms. Martinez September 3, 2014 Spanish 1 Instructions: You need to write the notes in your Spanish journals. Write the translation next to the Spanish

Minimization with Nonlinear Constraints: Phase 1Phase 1 We can trace the path of the steepest descent vector from initial point (x 1, x 2) using the vector translation

A Log Buffer based Flash Translation Layer using Fully ...vldb.skku.ac.kr/sub_page/pub/ACM-TECS-FAST-paper.pdfHowever, flash memory suffers from the write bandwidth problem. A write

Vector register system for executing plural read/write commands

VISVESVARAYA TECHNOLOGICAL UNIVERSITY, · PDF fileVISVESVARAYA TECHNOLOGICAL UNIVERSITY, BELGAUM ... Write a program for distance vector algorithm to find ... Write a program for congestion

FAsT-Match: Fast Afﬁne Template Matching...the pixel vector by a 2 2 non-singular matrix and adding a ”translation” vector, then rounding down the resulting num-bers. Such a

M17 EMHA SB GCSE 0839 U17 - · PDF file301 17.1 Using translations translation vector column vectors 17.1 Using translations You know that in a translation all points of a shape move

ceipsagradoscorazones.centros.educa.jcyl.esceipsagradoscorazones.centros.educa.jcyl.es/sitio/... · Web viewYou must look for the translation and write it next to the word. It is

Kinematics - Cornell University · A translation has only one common representation, which is a vector that looks just like a position vector. The vector PG B can be interpreted as

May 01 2018.gwb - 1/10 - Tue May 01 2018 08:43:48€¦ · Name the vector and write its component form. Write a rule for the translation. 7. I unit to the left and I unit up 8. 3