evolutionary ecology of host-parasite relationships: …

University of New MexicoUNM Digital Repository

Biology ETDs Electronic Theses and Dissertations

Spring 4-13-2020

EVOLUTIONARY ECOLOGY OF HOST-PARASITE RELATIONSHIPS: ROLE OFHOST ECOLOGY, PHYLOGENY, ANDDEMOGRAPHICS IN SHAPING PARASITEEVOLUTIONErika Taylor GendronUniversity of New Mexico

Follow this and additional works at: https://digitalrepository.unm.edu/biol_etds

Part of the Animal Diseases Commons, Biology Commons, Evolution Commons, GeneticsCommons, Genomics Commons, Other Ecology and Evolutionary Biology Commons, and theParasitic Diseases Commons

This Dissertation is brought to you for free and open access by the Electronic Theses and Dissertations at UNM Digital Repository. It has beenaccepted for inclusion in Biology ETDs by an authorized administrator of UNM Digital Repository. For more information, please [email protected].

Recommended CitationGendron, Erika Taylor. "EVOLUTIONARY ECOLOGY OF HOST-PARASITE RELATIONSHIPS: ROLE OF HOST ECOLOGY,PHYLOGENY, AND DEMOGRAPHICS IN SHAPING PARASITE EVOLUTION." (2020). https://digitalrepository.unm.edu/biol_etds/263

https://digitalrepository.unm.edu?utm_source=digitalrepository.unm.edu%2Fbiol_etds%2F263&utm_medium=PDF&utm_campaign=PDFCoverPages

https://digitalrepository.unm.edu/biol_etds?utm_source=digitalrepository.unm.edu%2Fbiol_etds%2F263&utm_medium=PDF&utm_campaign=PDFCoverPages

https://digitalrepository.unm.edu/etds?utm_source=digitalrepository.unm.edu%2Fbiol_etds%2F263&utm_medium=PDF&utm_campaign=PDFCoverPages

https://digitalrepository.unm.edu/biol_etds?utm_source=digitalrepository.unm.edu%2Fbiol_etds%2F263&utm_medium=PDF&utm_campaign=PDFCoverPages

http://network.bepress.com/hgg/discipline/918?utm_source=digitalrepository.unm.edu%2Fbiol_etds%2F263&utm_medium=PDF&utm_campaign=PDFCoverPages








https://digitalrepository.unm.edu/biol_etds/263?utm_source=digitalrepository.unm.edu%2Fbiol_etds%2F263&utm_medium=PDF&utm_campaign=PDFCoverPages

https://digitalrepository.unm.edu/biol_etds/263?utm_source=digitalrepository.unm.edu%2Fbiol_etds%2F263&utm_medium=PDF&utm_campaign=PDFCoverPages

mailto:[email protected]

i

Erika Taylor Gendron Candidate

Department of Biology Department

This dissertation is approved, and it is acceptable in quality and form for publication: Approved by the Dissertation Committee: Dr. Sara V. Brant, Chairperson

Dr. Eric S. Loker

Dr. Thomas Turner

Dr. Christopher Witt

Dr. Charles Criscione

ii

EVOLUTIONARY ECOLOGY OF HOST-PARASITE RELATIONSHIPS:

ROLE OF HOST ECOLOGY, PHYLOGENY, AND DEMOGRAPHICS IN SHAPING PARASITE EVOLUTION

by

Erika Taylor Gendron (Ebbs)

B.S. Biology, California State University, Fresno, 2011

DISSERTATION

Submitted in Partial Fulfillment of the Requirements for the Degree of

Doctor of Philosophy

Biology

The University of New Mexico Albuquerque, New Mexico

May 2018

iii

ACKNOWLEDGMENTS

I would like to first acknowledge my primary supervisor Dr. Sara Brant who

has provided me with unlimited support and intellectual freedom over the past seven

years. Her guidance and enthusiasm for Parasitology has shaped my academic

development. I would also like to thank my co-supervisor Dr. Eric S. Loker for his

guidance and generosity over the years, and specifically for creating a productive

and supportive environment to study Parasitology. I would like to express my

gratitude to my dissertation committee, Dr. Chris Witt, Dr. Tom Turner and Dr.

Charles Criscione, for sharing their expertise and providing invaluable critiques of

this work.

I would like to thank my lab mates and members of the larger UNM

Parasitology group: Ms. Martina Laidemitt, Dr. Sarah Buddenborg, Mr. Jon Schultz,

Ms. Janeth Pena, Ms. Lijun Liu, Dr. Ramesh Devkota, Dr. Ben Hanelt, Ms. Rachel

Swanteson-Franz, Dr. Coen Adema, Dr. Si-Ming Zang, Dr. Bruce Hofkin, Dr. Lijing

Bu and Ms. Michelle Gordy. Thank you all for your feedback, encouragement and

most of all your friendship. Several undergraduate students have contributed to this

work, and my graduate experience as a whole, as such I would like to acknowledge;

Ms. D’Eldra Malone, Mr. Keith Keller, Ms. Emily Savris and Ms. Marissa Trujillo.

I would like to acknowledge the Museum of Southwestern Biology and its

Divisions for the many experiences and professional development opportunities it

has afforded me as a curatorial assistant. I would also like to acknowledge the

University of New Mexico’s Molecular Biology Facility, specifically Mr. George

Rosenberg for his patience and helpful conversations.

I would like to also thank my family for their constant support during my

pursuit of this degree. Specifically, my husband Daniel and son Jude whom helped

me maintain perspective during this process, my mother Sharon for her love and

encouragement and my father Michael for instilling curiosity about the natural world.

iv

EVOLUTIONARY ECOLOGY OF HOST-PARASITE RELATIONSHIPS:

ROLE OF HOST ECOLOGY, PHYLOGENY, AND DEMOGRAPHICS IN

SHAPING PARASITE EVOLUTION

by

Erika Taylor Gendron (Ebbs)

B.S. Biology, California State University, Fresno, 2011 PhD. Biology, University of New Mexico, Albuquerque 2018

ABSTRACT

Host-parasite systems exist across complex and ecologically heterogeneous

landscapes, and may occur across multiple taxonomically and ecologically disparate

host species. Under these conditions, mechanisms underlying microevolutionary

processes (i.e. gene flow, genetic drift) are not always clear, and may be mediated

by numerous co-occurring factors specific to individual hosts, host groups or life

stages. Host traits such as host immunology, demographics, phylogeny and ecology

are important factors, which may shape host-parasite relationships, and ultimately

evolutionary processes. Importantly, host traits acting at one life stage might impact

transmission at a different life stage. As such, the integrated nature of parasite life

cycles is an important consideration as host traits may act in concert to enhance or

constrain parasite evolution.

The research described herein used phylogeographic, phylogenomic, and

population genetic methods to further our understanding of how host traits impact the

evolutionary ecology of trematode systems, using avian schistosomes (Digenea:

Schistosomatidae) as a model. Much of this work specifically focused on the genus

Trichobilharzia and an important snail host Physa acuta. These studies in aggregate

v

found that host habitat preference, migratory patterns and demographics were all

important factors in mediating parasite transmission. Further within Trichobilharzia

spp., which are parasites of ducks, two species which utilize P. acuta were found to

have substantially different population genetic patterns. Data from this study suggest

that duck habitat preference can increase (dabbling ducks) or dilute (diving ducks)

Trichobilharzia transmission. Further data suggest that certain combinations of hosts

may facilitate transmission into a broader geographic range. At the

macroevolutionary level this study finds support that host-switching has likely been

an important mechanism of schistosome diversification, and did not find evidence

suggesting a strong co-phylogenetic pattern among parasites and intermediate

hosts. In total this research provides a framework for understanding how host traits

may act to shape parasite transmission and subsequent evolution.

vi

TABLES OF CONTENTS

TABLE OF CONTENTS ....................................................................................... vi

LIST OF FIGURES............................................................................................. viii

LIST OF TABLES ............................................................................................... ix

INTRODUCTION ...................................................................................................1

References ................................................................................................7

CHAPTER I: SCHISTOSOMES WITH WINGS: HOW HOST PHYLOGENY

AND ECOLOGY SHAPE THE GLOBAL DISTRIBUTION OF

TRICHOBILHARZIA QUERQUEDULAE (SCHISTOSOMATIDAE) ................. 11

Abstract .................................................................................................... 11

Introduction............................................................................................... 12

Materials and Methods ............................................................................. 15

Results .................................................................................................... 18

Discussion ................................................................................................ 19

Acknowledgements .................................................................................. 27

References ............................................................................................... 28

Figures .................................................................................................... 35

Tables ..................................................................................................... 40

CHAPTER II: PHYLOGEOGRAPHY AND GENETICS OF THE

GLOBALLY INVASIVE SNAIL PHYSA ACUTA DRAPARUND 1805

(= HAITIA ACUTA, TAYLOR 2003), AND ITS POTENTIAL AS AN

INTERMEDIATE HOST TO LARVAL DIGENETIC TREMATODES ......................... 46

Abstract ....................................................................................................46

Introduction............................................................................................... 47

Materials and Methods ............................................................................. 51

Results ..................................................................................................... 58

Discussion ................................................................................................ 63

Conclusions .............................................................................................. 71

Acknowledgements .................................................................................. 72

References ............................................................................................... 72

Figures ..................................................................................................... 82

Tables ...................................................................................................... 85

CHAPTER III: COMPARATIVE MICROEVOLUTIONARY PATTERNS

OF CONGENERIC TREMATODE SPECIES REVEAL IMPORTANCE

OF HOST ECOLOGY IN PARASITE EVOLUTION .............................................. 96

Abstract ................................................................................................... 96

Introduction............................................................................................... 97

Materials and Methods ........................................................................... 101

Results .................................................................................................. 107

Discussion .............................................................................................. 115

Acknowlegments ................................................................................... 121

References ............................................................................................. 121

vii

Figures ................................................................................................... 127

Tables .................................................................................................... 132

CHAPTER IV: ILLUMINATING SCHISTOSOME DIVERSITY:

PHYLOGENOMICS AND DIVERSIFICATION OF SCHISTOSOMATIDAE

USING TARGETED SEQUENCE CAPTURE OF ULTRA-CONSERVED

ELEMENTS ............................................................................................................ 143

Abstract .................................................................................................. 143

Introduction............................................................................................. 144

Materials and Methods ........................................................................... 148

Results .................................................................................................. 151

Discussion .............................................................................................. 153

References ............................................................................................ 162

Figures ................................................................................................... 170

Tables ................................................................................................... 172

CONCLUSIONS ................................................................................................ 175

APPENDIX A – Additional Files for Chapter II .................................................. 181

APPENDIX B – Additional Files for Chapter III ................................................. 188

APPENDIX C – Additional Files for Chapter IV ................................................. 212

viii

LIST OF FIGURES CHAPTER I Figure 1 – cox1 phylogeny ................................................................................ 35 Figure 2 – ITS1 phylogeny ................................................................................ 36 Figure 3 – nd4 phylogeny ................................................................................... 37 Figure 4 – Blue wing group phylogeny .............................................................. 38 CHAPTER II Figure 1 - Map of sampled populations .............................................................. 82 Figure 2 – Relationships of recovered cox1 haplotypes ..................................... 83 Figure 3 – Bayesian skyline plots ....................................................................... 85 Figure 4 – Invasion timeline of Physa acuta ....................................................... 87 CHAPTER III Figure 1 - cox1 phylogeny ................................................................................ 127 Figure 2 – Minimum spanning network ............................................................ 129 Figure 3 – Bayesian skyline plots ..................................................................... 130 Figure 4 – Trichobilharzia summary tree .......................................................... 131 CHAPTER IV Figure 1 - ML analyses of concatenated UCE loci ............................................ 170 Figure 2 – Host-switching within Schistosomatidae ......................................... 171

ix

LIST OF TABLES

CHAPTER I Table 1 - Host association and locality origin of the specimens .......................... 40 Table 2 – Prevalence of T. querquedulae ........................................................... 44 Table 3 – Pairwise genetic distances .................................................................. 45 CHAPTER II Table 1 - Summary of range-wide population statistics ....................................... 88 Table 2 – Analysis of Molecular Variance ........................................................... 91 Table 3 – Pairwise genetic distances and ΦST values ......................................... 92 Table 4 – Reports of infection and trematode species richness ......................... 93 Table 5 - Matrix of correlation coefficients .......................................................... 95 CHAPTER III Table 1 - Summary of Trichobilharzia survey data ............................................ 132 Table 2 – Measures of host specificity .............................................................. 139 Table 3 – Analyses of molecular variance ........................................................ 141 Table 4 – Indices of genetic diversity ................................................................ 142 CHAPTER IV Table 1 - Summary of sequence capture data .................................................. 172 Table 2 – Summary of UCE alignments ........................................................... 174

1

INTRODUCTION

Theoretical Basis

Host-parasite (H-P) systems exist across complex and ecologically

heterogeneous landscapes and are shaped by many co-occurring factors

(host immunology, host physiology, evolutionary constraints and ecology).

The persistence of host-parasite relationships over time and space often

requires interaction among taxonomically and ecologically disparate host

species, each having differential impacts on parasite transmission and

evolution (Blouin et al., 1995; Criscione and Blouin, 2004; Steinauer et al.,

2007; Keeney et al., 2009; Archie and Ezenwa, 2011; Blasco-Costa and

Poulin, 2013) . As such, parasite ecology and evolution is inseparable from

the ecology, behavior and demographics of their host(s). In this way host

specific traits can act to enhance or constrain parasite population size

(Criscione and Blouin, 2005), geographic range (Blasco-Costa, 2012),

transmission (Archie and Ezenwa, 2011), and adaptive potential (Nuismer,

2009). Teasing apart the multilayered impacts of host-use on parasite

evolution requires a holistic understanding of evolutionary relationships of

both the parasites and associated host species, across multiple time-scales.

To contribute to the understanding of parasite evolutionary ecology,

specifically in relation to host specific traits this research integrated host-

parasite phylogeography, population genetics and phylogenomics.

Empirical data resulting from evolutionary studies of parasite populations

supports the idea that host specific traits (e.g. allogeneic/autogenic life stages,

2

dispersal and range) mediate microevolutionary forces (gene flow, genetic

drift) and determine population structure within their associated parasites

(Blouin et al., 1995; Blouin et al., 1999; Criscione and Blouin, 2004; Blasco-

Costa, 2012; Blasco-Costa and Poulin, 2013). Yet beyond broad ecological

distinctions (i.e. allogeneic/autogenetic, migratory/non-migratory), within multi-

host systems little is known about what specific traits contribute to or

determine gene flow, genetic drift and effective population size (Ne) (Nadler,

1995; Criscione et al., 2005; Blasco-Costa and Poulin, 2013). These

parameters directly relate to, or can be predictive of, the evolution of drug

resistance (Blouin et al., 1995), local adaptation (Dybdahl and Lively, 1996;

McCoy et al., 2002; Nuismer, 2009), probability of host-switching (Hoberg and

Brooks, 2008) and ultimately speciation of parasite lineages (Huyse et al.,

2005).

Study System

This research focused on the ecological and evolutionary relationships

of digenetic trematodes and their hosts, primarily those within the family

Schistosomatidae (Weinland 1858). Schistosomatidae, is a medically and

biologically important group which occurs globally. Unlike most trematodes

schistosomes have a two-host life cycle (Cribb et al., 2003), which makes

them more tractable for the types of studies described herein. Additionally,

relative to many other trematode families, host-parasite associations within

Schistosomatidae are fairly well resolved and diverse (Snyder and Loker

2000; Brant and Loker, 2013), facilitating the study of how host-specific traits

influence parasite evolution. Avian infecting lineages (known as avian

3

schistosomes) comprise the majority of schistosome diversity, and were the

primary focus of this work.

Avian schistosomes represent 10 of the 14 named genera within

Schistosomatidae, though recent molecular survey’s have confirmed that this

is an underestimate (Brant et al., 2006; Brant and Loker, 2013). Dioecious

adult schistosomes colonize the vascular system of their vertebrate definitive

host, either a mammal or a bird. There they mature and copulate, with the

female producing eggs that eventually leave the body with the host’s feces,

urine or nasal secretions, depending on the species. There is much variation

in reproductive strategy and sexual development within Schistosomatidae

(Morand and Müller-Graf, 2000; Loker and Brant, 2006) , specifically in

regards to the nature of the relationship between the male and female worms.

Adult body size, sexual dimorphism and life span also vary substantially

across the family (Loker and Brant, 2006).

Liberated eggs hatch and release a motile larval stage known as a

miracidium within an aquatic environment. Miracidia actively seek and

penetrate a gastropod intermediate host. Schistosome species are

remarkable with respect to the aggregate taxonomic range of intermediate

hosts they utilize, especially so for avian schistosomes where an estimated 15

families of snails are employed as intermediate hosts (Brant and Loker, 2013).

Any particular schistosome species however typically successfully exploits a

very limited range of gastropod host species. Prior studies (Brant et al., 2006)

and research herein suggest that intermediate host switching has likely been

an important mechanism of schistosome diversification at multiple time scales

(within and across genera). More interestingly however, is the fact that ‘host-

4

switches’ are not associated with deep nodes or long branches, indicating that

host-switching events were recent (Brant and Loker, 2013) and a lack of strict

co-phylogeny at deeper nodes. Schistosome species are considered to be

more specific (Horak et al. 2015) to their snail intermediate host, relative to

their definitive host, which is common among trematode families (Cribb et al.

2003). Jouet et al. (2010) found that European Trichobilharzia spp. are

specific to single species of snails. Some evidence of co-phylogeny exists

among Schistosoma spp. and snails within the family Planorbidae, suggesting

a possible history of co-speciation (Morgan et al. 2002). This pattern does not

appear to be supported within avian infecting genera like Trichobilharzia,

Dendritobilharzia or Bilharziella.

Within the snail intermediate host, asexual amplification occurs

producing a second motile larval stage known as cercaria. Cercariae actively

seek out their vertebrate definitive hosts, where they will penetrate the

epidermis and migrate through the hosts’ vasculature until they arrive in the

liver (generally), where they will undergo sexual maturation and sexual

reproduction. Cercariae are attracted to general vertebrate fatty acids, and will

often mistakenly attempt to penetrate unsuitable hosts (Horák et al., 2015).

The re-emerging zoonotic disease Human Cercarial Dermatitis (HCD), also

known as “Swimmer’s Itch” (Horák et al., 2015), occurs when non-human

schistosome cercariae accidentally penetrate human skin. HCD is of

increasing concern from a public health and economic perspective (Horák et

al., 2015). In relation to HCD and other snail-transmitted diseases,

understanding the biology and distribution of snail intermediate hosts has

broad significance.

5

One important host to Trichobilharzia, specifically within North America,

is Physa acuta (Draparnaud, 1805). Physa acuta is endemic to North

America, but is now a globally invasive species, with populations established

on six of the seven continents (Bousset et al., 2014; Lydeard et al., 2016). In

general snails are adept invaders (Albrecht et al., 2009; 2008; Facon et al.,

2003; Hanson et al., 2013; Torchin et al., 2005) and in light of the fact that as

group they host over 10,000 species of trematodes (Cribb et al., 2003), their

biology is of great importance, specifically in regards to the potential for

invasive snail populations to sustain trematode life cycles. Surveys of invasive

snail populations suggest that there is a release of trematode burden following

host invasion, for at least a period, in concordance with the ‘Enemy-Release

hypothesis’ observed across host taxa (Keane, 2002; Torchin et al., 2003).

Snail-trematode surveys demonstrate that while trematode assemblages may

change infection within the hosts invasive range does occur (Blakeslee et al.,

2012; Torchin et al., 2005). When local parasites establish within invasive

hosts populations it is known as parasite spillback. It is unknown how, why or

when spillback would be expected to occur, or if there are general

determinants of spillback (Kelly et al., 2009). Free-living systems have shed

light on possible relevant factors (Hayes and Barry, 2007; Keane, 2002),

specifically in identifying the importance of demographic parameters such as

effective population size and background genetic diversity which are expected

to increase with time since invasion (Forsman, 2014; Rius and Darling, 2014).

Studies focusing on characterizing these parameters in combination with

parasite data are ideal to address the underlying mechanisms of host-parasite

6

invasion dynamics and to identify factors relevant in modeling parasite

spillback.

Overall Contributions

How genetic variation is distributed across species, space and time

relates to persistance and diversification of parasites lineages. In total, all

chapters (1-4) included herein sought to describe patterns of genetic variation

within complex H-P systems. The H-P unit evolves at the population level, yet

studying parasite populations is challenging as populations are fragmented

across hosts, distinct life stages and ecological time and space (Prugnolle,

2005). Research presented herein provides a framework for understanding

how populations of parasites within migratory hosts are distributed over

ecological and evolutionary time.

With an emphasis on the biology schistosomes, much of this research

reported here focuses on characterizing microevolutionary patterns, primarily

genetic structure and diversity. These measures directly influence the

adaptability of the host-parasite system, and how the unit can respond to

biotic and abiotic changes such as increasing temperatures, chemotherapy

pressure or habitat loss. Data from this work suggest both host and parasite

demographic patterns may shape H-P interactions and influence

transmission.

This body of research investigated patterns of host-use and parasite

diversity (intra- and inter-specific) over ecological and evolutionary timescales

and made substantial contributions to our understanding of the evolutionary

ecology of parasitic multi-host helminths.

7

REFERENCES

Albrecht, C., Hauffe, T., Schreiber, K., Trajanovski, S., Wilke, T., 2009. Mollusc Biodiversity and Endemism in the Potential Ancient Lake Trichonis, Greece. Malacologia 51, 357–375. doi:10.4002/040.051.0209

Albrecht, C., Kroll, O., Moreno Terrazas, E., Wilke, T., 2008. Invasion of

ancient Lake Titicaca by the globally invasive Physa acuta (Gastropoda: Pulmonata: Hygrophila). Biol Invasions 11, 1821–1826. doi:10.1007/s10530-008-9360-9

Archie, E.A., Ezenwa, V.O., 2011. Population genetic structure and history of

a generalist parasite infecting multiple sympatric host species. International Journal for Parasitology 41, 89–98. doi:10.1016/j.ijpara.2010.07.014

Blakeslee, A.M.H., Altman, I., Miller, A.W., Byers, J.E., Hamer, C.E., Ruiz,

G.M., 2012. Parasites and invasions: a biogeographic examination of parasites and hosts in native and introduced ranges. Journal of Biogeography 39, 609–622. doi:10.1111/j.1365-2699.2011.02631.x

Blasco-Costa, I., Poulin, R., 2013. Host traits explain the genetic structure of

parasites: a meta-analysis. Parasitology 140, 1316–1322. doi:10.1017/S0031182013000784

Blasco-Costa, I.E.A., 2012. Swimming against the current: genetic structure,

host mobility and the drift paradox in trematode parasites. Molecular Ecology 21, 207–217.

Blouin, M.S., Yowell, C.A., Courtney, C.H., Dame, J.B. 1995. Host Movement

and the genetic structure of populations of parasitic nematodes. Genetics 141, 1007–1014.

Blouin, M., Liu, J., Berry, R., 1999. Life cycle variation and the genetic

strucutre of nematode populations. Heredity 83, 253–259. Bousset, L., Pointier, J.P., David, P., Jarne, P., 2014. Neither variation loss,

nor change in selfing rate is associated with the worldwide invasion of Physa acuta from its native North America. Biol Invasions 16, 1769–1783. doi:10.1007/s10530-013-0626-5

Brant, S.V., Loker, E.S., 2013. Discovery-based studies of schistosome

diversity stimulate new hypotheses about parasite biology. Trends in Parasitology 1–11. doi:10.1016/j.pt.2013.06.004

Brant, S.V., Morgan, J.A.T., Mkoji, G.M., Snyder, S.D., Rajapakse, R.P.V.J.,

Loker, E.S., 2006. An approach to revealing blood fluke life cycles, taxonomy, and diversity: provision of key reference data including DNA sequence from single life cycle stages. Journal of Parasitology 92, 77–88. doi:10.1645/GE-3515.1

8

Cribb, T., Bray, R., Olson, P., Timothy, D., Littlewood, J., 2003. Life Cycle

Evolution in the Digenea: a New Perspective from Phylogeny, in: Advances in Parasitology Volume 54, Advances in Parasitology. Elsevier, pp. 197–254. doi:10.1016/S0065-308X(03)54004-0

Criscione, C., Blouin, M., 2004. Life cycles shape parasite evolution:

Comparative population genetics of Salmon Trematodes. Evolution 58, 198–202.

Criscione, C.D., Poulin, R., Blouin, M., 2005. Molecular ecology of parasites:

elucidating ecological and microevolutionary processes. Molecular Ecology 14, 2247–2257.

Criscione, C., Blouin, M., 2005. Effective sizes of macroparasite populations:

a conceptual model. Trends in Parasitology 21. Draparnaud, J., 1805. Histoire naturelle des mollusques terrestres et

fluviatiles de la France. doi:10.5962/bhl.title.13180 Dybdahl, M., Lively C.M., 1996. The Geography of Coevolution: Comparative

Population structures for a snail and its trematode parasite. Evolution 50, 2264–2275.

Facon, B., Pointier, J.P., Glaubrecht, M., Poux, C., Jarne, P., David, P., 2003.

A molecular phylogeography approach to biological invasions of the New World by parthenogenetic Thiarid snails. Molecular Ecology 12, 3027–3039. doi:10.1046/j.1365-294X.2003.01972.x

Forsman, A., 2014. Effects of genotypic and phenotypic variation on

establishment are important for conservation, invasion, and infection biology. Proc. Natl. Acad. Sci. U.S.A. 111, 302–307. doi:10.1073/pnas.1317745111

Hanson, D., Cooke, S., Hirano, Y., Malaquias, M.A.E., Crocetta, F., Valdés,

Á., 2013. Slipping through the Cracks: The Taxonomic Impediment Conceals the Origin and Dispersal of Haminoea japonica, an Invasive Species with Impacts to Human Health. PloS ONE 8, e77457. doi:10.1371/journal.pone.0077457

Hayes, K.R., Barry, S.C., 2007. Are there any consistent predictors of

invasion success? Biol Invasions 10, 483–506. doi:10.1007/s10530-007-9146-5

Hoberg, E.P., Brooks, D.R., 2008. A macroevolutionary mosaic: episodic host-

switching, geographical colonization and diversification in complex host-parasite systems. Journal of Biogeography 35, 1533–1550. doi:10.1111/j.1365-2699.2008.01951.x

Horák, P., Mikeš, L., Lichtenbergová, L., Skála, V., Soldánová, M., Brant,

9

S.V., 2015. Avian schistosomes and outbreaks of cercarial dermatitis. Clin. Microbiol. Rev. 28, 165–190. doi:10.1128/CMR.00043-14

Huyse, T., Poulin, R., Théron, A., 2005. Speciation in parasites: a population

genetics approach. Trends in Parasitology 21, 469–475. doi:10.1016/j.pt.2005.08.009

Jouet, D., Skírnisson, K., Kolářová, L., Ferte, H. 2010. Molecular diversity of

Trichobilharzia franki in two intermediate hosts (Radix auricularia and Radix peregra): a complex of species. Infection, genetics and evolution 10, 1218-27.

Keane, R., 2002. Exotic plant invasions and the enemy release hypothesis.

Trends in Ecology & Evolution 17, 164–170. doi:10.1016/S0169-5347(02)02499-0

Keeney, D.B., King, T.M., Rowe, D.L., Poulin, R., 2009. Contrasting mtDNA

diversity and population structure in a direct-developing marine gastropod and its trematode parasites. Molecular Ecology 18, 4591–4603. doi:10.1111/j.1365-294X.2009.04388.x

Kelly, D.W., Paterson, R.A., Townsend, C.R., Poulin, R., Tompkins, D.M.,

2009. Parasite spillback: A neglected concept in invasion ecology? Ecology 90, 2047–2056. doi:10.1890/08-1085.1

Loker, E.S., Brant, S.V., 2006. Diversification, dioecy and dimorphism in

schistosomes. Trends in Parasitology 22, 521–528. doi:10.1016/j.pt.2006.09.001

Snyder, S., Loker, E.S., 2000. Evolutionary relationships among the

Schistosomatidae (Platyhelminhes: Digenea) and an Asian origin for Schistosoma. Journal of Parasitology 86, 283–288.

Lydeard, C., Campbell, D., Golz, M., 2016. Physa acuta Draparnaud, 1805

Should be Treated as a Native of North America, Not Europe. Malacologia 59, 347–350. doi:10.4002/040.059.0213

Morgan, J.A., DeJong, R.J., Jung, Y., Khallaayoune, K., Kock, S., Mkoji, G.M.,

Loker, E.S. 2002. A phylogeny of planorbid snails, with implications for the evolution of Schistosoma parasites. Molecular phylogenetics and evolution 25, 477-88.

McCoy, K.D., Thierry Boulinier, Schjørring, S., Michalakis, Y., 2002. Local

adaptation of the ectoparasite Ixodes uriae to its seabird host. Evol Ecol Res 4, 441–456.

Nadler, S., 1995. Microevolution and the Genetic Structure of Parasite

Populations. Journal of Parasitology 81, 395–403. Nuismer, S.G.A.S., 2009. Interactions between Genetic Drift, Gene Flow and

10

Selection Mosaics Drive Parasite Local Adaptation. The American Naturalist 173.

Prugnolle, F., 2005. Population genetics of complex life-cycle parasites: an

illustration with trematodes. International Journal of Parasitology 35, 255–263.

Rius, M., Darling, J.A., 2014. How important is intraspecific genetic admixture

to the success of colonizing populations? Trends in Ecology & Evolution 29, 233–242. doi:10.1016/j.tree.2014.02.003

Morand, S., Müller-Graf, C.D. 2000. Muscles or testes? Comparative

evidence for sexual competition among dioecious blood parasites (Schistosomatidae) of vertebrates Parasitology 1–12.

Steinauer, M.L., Nickol, B.B., Ortí, G., 2007. Cryptic speciation and patterns of

phenotypic variation of a highly variable acanthocephalan parasite. Molecular Ecology 16, 4097–4109. doi:10.1111/j.1365-294X.2007.03462.x

Torchin, M.E., Byers, J.E., Huspeni, T.C., 2005. Differential Parasitism of

Native and Introduced Snails: Replacement of a Parasite Fauna. Biol Invasions 7, 885–894. doi:10.1007/s10530-004-2967-6

Torchin, M.E., Lafferty, K.D., Dobson, A.P., McKenzie, V.J., 2003. Introduced

species and their missing parasites. Nature.

11

CHAPTER I

Schistosomes with wings: how host phylogeny and ecology shape the

global distribution of Trichobilharzia querquedulae (Schistosomatidae)

AUTHORS: Erika T. Gendron (Ebbs), Eric S. Loker, Norm E. Davis, Veronica

Flores, Aylen Veleizan, Sara V. Brant

ABSTRACT

Migratory waterfowl play an important role in the maintenance and

spread of zoonotic diseases worldwide. An example is cercarial dermatitis,

caused when larval stages of schistosomes that normally develop in birds

penetrate human skin. Members of the genus Trichobilharzia

(Schistosomatidae), transmitted mainly by ducks, are considered to be major

etiological agents of cercarial dermatitis globally. To better understand the

diversity and distribution of Trichobilharzia spp., we surveyed ducks from

North America (United States and Canada), Argentina, South Africa and New

Zealand. To aid in species identification of the Trichobilharzia worms

recovered, regions of the Cox1, ND4 and ITS1 were sequenced.

Furthermore, we provide molecular phylogenetic evidence for the

cosmopolitan distribution and trans-hemispheric gene flow for one species,

Trichobilharzia querquedulae, previously thought to be restricted to North

America. These new samples from endemic non-migratory duck species

indicate that T. querquedulae transmission occurs within each of the regions

we sampled and that it is specific to the blue-winged + silver teal duck clade.

Prevalence within this host group is >95% across the known range of T.

querquedulae, indicating that transmission is common. Genetic divergence is

12

evenly distributed among continents, and no phylogenetic structure

associated with geography was observed. The results provide strong support

for the global distribution and transmission of T. querquedulae and represent,

to our knowledge, the first report of a cosmopolitan schistosome confirmed by

genetic data. These data are the first known to support trans-hemispheric

genetic exchange in a species responsible for causing cercarial dermatitis,

indicating that the epidemiology of this group of poorly known zoonotic

parasites is more complex than previously expected.

INTRODUCTION

Maintenance of complex life cycles over time and space is influenced

by a myriad of both evolutionary and ecological forces. Determinants of

host associations are essential in understanding the dynamics of any host-

parasite system and for efforts to model the emergence of zoonotic

parasites (Ostfeld and Keesing, 2000; Taylor et al., 2001; McKenzie, 2007).

For example, the degree to which a parasite has phylogenetic and/or

ecological constraints with its host range will largely determine the

predictability of transmission (Thompson, 2000; Hoberg and Brooks, 2008).

Within this context, we aimed to understand host associations and factors

shaping the diversity and distribution of a common group of trematodes in

waterfowl which are known for causing the globally re-emerging zoonotic

disease human cercarial dermatitis (HCD) (de Gentile et al., 1996; Kolářová

et al., 2010; Horak et al., 2015). This disease enters the human population

when avian schistosome (Schistosomatidae) cercariae penetrate human

skin, resulting in a severe, short-term allergic reaction (Horak et al., 2002;

13

Kourilova et al., 2004; Kolářová et al., 2013). Although the larvae are

unable to establish patent infections within a human host, there are intense

immune reactions that can be long lasting and painful (Kourilova et al.,

2004). While HCD is neither communicable nor fatal, it is still not without

economic and epidemiologic importance and is considered a substantial

public health problem (Horak and Kolarova, 2011; Soldánová et al., 2013;

Horak et al., 2015). Relatively little is known about the epidemiology of HCD

due to the diversity of schistosome species, the lack of data on the

preferred hosts and the timing of transmission, and the large geographical

scale over which outbreaks occur.

An increase in the incidence of HCD outbreaks (de Gentile et al., 1996;

Larsen et al., 2004) has been linked to altered or managed habitats that

support high densities of migratory and resident anseriform birds and

permissive snail host species (Larsen et al., 2004; Horak and Kolarova, 2011)

as well as to other forms of environmental degradation such as eutrophication

of water bodies (Valdovinos and Balboa, 2008; Soldánová et al., 2013). These

conditions have created an urgent need to better understand avian

schistosome species diversity, distribution, host use, associated host ecology

and life cycle maintenance, within a global framework. The avian schistosome

genus Trichobilharzia (Skrjabin and Zakharov, 1920) is most frequently

implicated in HCD outbreaks (Kolářová et al., 2010, 2013; Soldánová et al.,

2013; Horak et al., 2015) and is also the most speciose genus within the

family (Blair and Islam, 1983; Brant and Loker, 2009). Adults of

Trichobilharzia spp. primarily infect ducks and as larvae develop within

freshwater pulmonate snails in the families Physidae and Lymnaeidae (Blair

14

and Islam, 1983; Horak et al., 2002; Brant and Loker, 2009). Species diversity

and host use of Trichobilharzia spp. are best known in Europe and North

America (Aldhoun et al., 2009; Brant and Loker, 2009; Jouet et al., 2009,

2010; Rizevsky et al., 2011; Christiansen et al., 2014; Lawton et al., 2014).

But even in these well-studied areas, the presence and dynamics of particular

Trichobilharzia spp. in other bird hosts and in other countries that share those

bird hosts remain unknown. For example, are Trichobilharzia spp. shared

across continents or does each continent have its own species, or both?

Brant and Loker (2009) investigated host-parasite associations

among Trichobilharzia spp. within North America and found that one

species, Trichobilharzia querquedulae (McLeod, 1937), has a clear

association with a globally distributed clade of dabbling ducks (the ‘blue-

wing’ group) that includes the holarctically distributed northern shovelers

(Anas clypeata); the cinnamon (Anas cyanoptera) and blue-wing teal (Anas

discors) as well as several Southern Hemisphere endemic species

(Johnson and Sorenson, 1999). Species in the ‘blue-wing’ group share

specific ecological preferences for shallow freshwater bodies across both

their summer and winter grounds (Baldassarre et al., 1996; Kear, 2005).

Additionally, T. querquedulae infects Physa spp. snails, which are

ubiquitous in North America and one common species, Physa acuta

(Draparnaud, 1805), is globally invasive (Bousset et al., 2014). Until

recently, T. querquedulae had been reported from only the North American

‘blue-wing’ species (A. clypeata, A. cyanoptera and A. discors). Brant and

Loker (2009) sampled a phylogenetically diverse range of ducks (n = 299

individuals) within North America and found that T. querquedulae occurred

15

with a prevalence greater than 95%, exclusively within ‘blue-wing’ ducks.

Endemic, ecologically similar species of the ‘blue-wing’ group also occur in

the Southern Hemisphere (Kear, 2005), but heretofore, records for T.

querquedulae or other schistosome species are largely lacking for these

species. Is the association between T. querquedulae and members of the

‘blue-wing’ group consistent across hemispheres, and if so, what factors

contribute to the global maintenance of this association?

MATERIALS AND METHODS

Parasite collection

Ducks were collected from several locations in both the Northern and

Southern Hemispheres (Table 1); North America (United States and Canada),

South America (Argentina, 30° 5' 56.4'' S, 59° 29' 56.4'' W), Africa (South

Africa, 29° 12' 28.8'' S, 27° 11' 20.4'' E) and New Zealand (South Island, 44°

21' 3.6'' S, 170° 12' 32.4'' E). For the purposes of this paper, reasonable

sampling of hosts and localities from Europe is represented in GenBank. The

mesenteric and hepatic portal veins of ducks and geese were examined for

species of Trichobilharzia. Mesenteric veins were inspected visually for adult

worms, which were removed using Vanna’s micro scissors. Adult worms were

removed from the hepatic portal vein and liver by either crushing and washing

the liver in a series of decantation steps to isolate the worms or using a

syringe to push saline through the hepatic portal vein to collect any worms

that washed out. Schistosome samples were preserved in 95% ethanol for

genetic, and 80% ethanol for morphological analyses. Parasites were

deposited in the Museum of Southwestern Biology, Division of Parasites,

16

University of New Mexico, USA (Table 1). All work with vertebrate hosts was

conducted with the approval of the Institutional Animal Care and Use

Committee at the University of New Mexico (IACUC # 11-100553-MCC,

Animal Welfare Assurance # A4023-01).

Genetic analysis

DNA from the samples was extracted using a DNeasy Tissue Kit

(Qiagen, Valenicia, California, USA) following the manufacturer’s protocol

or by HotShot Lysis (Truett et al., 2000). We targeted two mitochondrial

gene regions and one nuclear region for PCR amplification (Takara Ex Taq

kit, Takara Biomedicals, Otsu, Japan), following protocols used by Brant

and Loker (2009). The mitochondrial cytochrome oxidase subunit I (Cox1)

gene (743 bp region, 5’ end) (primers in Brant and Loker, 2009) and the

NADH Dehydrogenase subunit 4 (ND4) gene (409 bp in the central portion

of the gene), using the ND4 primers TSND4_F4 5’ -

AGTCCTTATCCGGAGCGTTA-3’, TSND4_R4 5’-

AACCAGCAACACACAAAAACA-3’. The ND4 gene was targeted due to

high intraspecific variation relative to Cox1 and internal transcribed spacer

1 (ITS1) (Blouin et al., 1995; Webster et al., 2007), with a goal of

assessing intraspecific relationships across hemispheres and host species.

The nuclear gene region of ITS1 (733 bp, including the 3’ portion of 18S

rRNA and the 5’ portion of 5.8S) was amplified and sequenced using

primers from Dvorak et al. (2002). Sequencing reactions were performed

using the BigDye sequencing kit 3.1 (Applied Biosystems, Foster City,

California, USA). Sequences were edited using Sequencher 5.3 (Gene

17

Codes Corporation, Ann Arbor, MI, USA), aligned using ClustalW (Larkin et

al., 2007) and then modified manually. Sequences generated during this

study were submitted to GenBank (Table 1).

Reconstructing evolutionary relationships

Phylogenetic analyses included the samples collected herein as well

as the available T. querquedulae samples and appropriate outgroups for

Clade Q (sensu Brant and Loker, 2009; Table 1). Each gene was treated as

independent and the best models of nucleotide substitution was chosen

based on the Akaike information criterion (AIC; Akaike, 1974) using

JModelTest (Darriba et al., 2012) as follows: TN93+G for Cox1 (Tamura and

Nei, 1993), K2+G for ITS1 (Kimura, 1980), HKY + I for ND4 (Hasegawa,

Kishino and Yano, 1985). These specific models were incorporated into

Maximum Likelihood (ML) analyses.

Gene trees were analyzed independently using ML methods in the

program PAUP* 4.0 (Swofford, D. L. 2003. PAUP*. Phylogenetic Analysis

Using Parsimony (*and Other Methods). Version 4. Sinauer Associates,

Sunderland, Massachusetts, USA). Five hundred bootstrap replicates were

preformed within each gene tree analysis to statistically assess the resulting

topologies.

Bayesian Inference (BI) was performed using the program MrBayes

3.2.1 (Ronquist and Huelsenbeck, 2003), consisting of two replicated runs for

each locus with four Markov chain Monte Carlo (MCMC) chains, one cold and

three heated chains. Each analysis ran for 2,000,000 generations and was

sampled every 1000 generations. The analysis was terminated when the S.D.

18

of the split frequencies was or fell below 0.01, supporting convergence.

Likelihood parameters and convergence between runs were assessed using

the program Tracer v.1.5 (Rambaut et al., 2014 Tracer v1.6.

http://beast.bio.ed.ac.uk/Tracer). The first 25% of trees from each analysis

was discarded as burnin. Resulting phylogenetic trees were visualized and

manipulated using Fig Tree v. 1.4 (Rambaut and Drummond, 2009, FigTree

v1. 3.1. http://tree.bio.ed.ac.uk/software/figtree) and MEGA 6 (Tamura et al.,

2013).

Genetic distances were estimated, based on uncorrected p-distances

between all sequences for each locus, and then averaged within lineages

for comparison (Table 2), using the program MEGA 6 (Tamura et al., 2013).

RESULTS

Parasite infection and molecular identification

From our collections of endemic ducks in the three countries in the

Southern Hemisphere, T. querquedulae was found to be globally

distributed in ducks from the ‘blue-wing’ clade as well as in the sister clade

of silver teal ducks. In all three countries sampled, endemic ‘blue-wing’ and

allied species were infected with a prevalence of 95% or greater, similar to

what has been reported from the United States (Table 2).

Monophyly of T. querquedulae

Molecular phylogenetic analyses (ML, BI) show strong statistical

support for the monophyly of T. querquedulae populations, regardless of the

hemisphere sampled (Figs. 1 - 3). The resultant phylogenies show similar

http://beast.bio.ed.ac.uk/Tracer

http://tree.bio.ed.ac.uk/software/figtree

19

gene trees among nuclear and mitochondrial genes, suggesting that

Southern Hemisphere samples belong to T. querquedulae and likely do not

have a hybrid origin.

This study provides sequence data for the mitochondrial ND4 gene

region of T. querquedulae, which had more genetic variation (Fig. 3, Table 3)

relative to Cox1 and ITS1. Gene tree analysis (ML, BI) shows a well-

supported monophyly of T. querquedulae and a lack of phylogenetic

resolution for internal nodes, concordant with the Cox1 and ITS1 gene trees

(Figs. 1, 2).

The low nodal support within the T. querquedulae clade, consistent with

what has been reported previously (Brant and Loker, 2009), is suggestive of

a lack of geographic structure and is consistent with gene flow across

hemispheres (Bouzid et al., 2008; Goulding and Cohen, 2014). Genetic

distances within and between continents and hemispheres support low

intraspecific divergence (Table 3). On average, for all genes analyzed,

genetic divergence within North America (approximately 2%) is comparable

with genetic divergence between Northern and Southern Hemisphere

populations (approximately 2.7%).

DISCUSSION

The survey results reported here provide the first known genetic

evidence for an avian schistosome, T. querquedulae, to have a global

distribution spanning three continents and New Zealand. Our sampling

indicates that the duck host range of T. querquedulae extends in the

Southern Hemisphere both to endemic members of the ‘blue-wing’ group

20

(Cape and New Zealand shovelers), and to members of a sister clade

containing the silver teal (see Johnson and Sorenson, 1999). Southern

Hemisphere worms were recovered from endemic non-migratory species

(Kear, 2005), thus we can infer that the infections were acquired locally. For

all loci analyzed, genetic divergence within and between Northern and

Southern Hemisphere individuals was low, suggesting their populations are

connected by trans-hemispheric (specifically, between Northern and

Southern hemispheres) migration of particular duck species. The

holarctically distributed northern shoveler (A. clypeata), for which annual

migrations between the Northern and Southern Hemispheres is common

(Peters et al., 2014), is likely the primary host species facilitating gene flow

across the range of T. querquedulae. It is also likely that populations of blue-

wing and cinnamon teal (A. cyanoptera and A. discors) that breed in North

America and winter in the Southern Hemisphere facilitate T. querquedulae

transmission, as they are seasonally sympatric with the endemic ‘blue-

winged’ ducks and their allies (silver teal) (Wilson et al., 2011). Estimated

genetic distances (Table 3) indicate that across its range T. querquedulae

populations are connected and genetically homogenized, although increased

population sampling is necessary to fully elucidate phylogeographic patterns.

More variable genetic markers, increased sampling and population genetic

analyses are required to determine how much gene flow occurs across the

hemispheres and the relative importance of different duck species in

maintaining the global transmission of T. querquedulae.

Through targeted collections of Southern Hemisphere endemic host

species, we find evidence to support the phylogenetic association between

21

T. querquedulae and the ‘blue-wing’ group uncovered by Brant and Loker

(2009) (host associations are summarized in Fig. 4). Our data suggest that

the duck host range of T. querquedulae includes, in addition to the ‘blue-

wing’ group, the sister clade that includes the silver teal. It is clear that the

definitive hosts of T. querquedulae are not a random sample of Anas duck

species and that definitive host phylogeny is important in life cycle

maintenance. Below we discuss several aspects of the host and parasites

biology which could maintain the observed phylogenetic association among

T. querquedulae and their specific duck hosts.

It is possible that these patterns are maintained as a consequence of

specialization that has occurred over an evolutionary time frame based on

host physiology or immune competence. It has been generally thought that

definitive host specificity is low within species of Trichobilharzia (Blair and

Islam, 1983; Horak et al., 2002), however with increased taxonomic sampling

of hosts and the inclusion of molecular data, patterns of duck host specificity

are becoming increasingly apparent in some Trichobilharzia spp. (Brant and

Loker, 2009, 2013a; Jouet et al., 2015). Similar phylogenetic affinities are

known to occur within other avian schistosome genera. For example,

Allobilharzia (Kolářová et al., 2006) in swans and Anserobilhariza (Brant et

al., 2013b) in geese, are just two examples where avian schistosome

transmission shows some phylogenetic constraints at the definitive host

level. The physiological, genetic and/or immunological barriers mediating

Trichobilharzia infections within duck hosts is currently unknown (Horak et

al., 2002) and, as suggested by the present results, in need of experimental

study. Experimentally, non-‘blue wing’ ducks such as mallards (McLeod and

22

Little, 1942) can support egg-laying infections of T. querquedulae. However,

natural infections of non-‘blue wing’ hosts appear to be rare, and our surveys

over the last 10 years have recovered a single infection of an immature

worm fragment within an American wigeon (Anas americana) in North

America (S.V. Brant, unpublished data).

It is likely that host ecological preferences, which are also influenced by

the hosts’ evolutionary history, play a key role in the persistence of the

association of T. querquedulae in one clade of ducks versus another. ‘Blue-

wing’ ducks are ecological specialists (Baldassarre et al., 1996), with a

preference for shallow marshy habitats. It can be hypothesized that shared

habitat preferences specifically relating to nesting site selection and natal

habitats can act as an encounter filter (Combes, 2001) among ‘blue-wing’

and allied species to restrain T. querquedulae host use. Nesting sites, where

the majority of Trichobilharzia transmission is likely occurring (Rau et al.,

1975; Brant and Loker, 2009), are non-randomly chosen (Clark and Shutler,

1999). Blums et al. (2002) showed that over a 23-year period female

northern shovelers (A. clypeata) exhibited greater than 88% nest site fidelity,

significantly more so than other sympatric duck species measured. Further,

northern shovelers and other ‘blue-wing’ species are known to select

fragmented small water bodies similar to wetland islands for nesting (Blums

et al., 2002), where the pair will live and breed. Males are known to guard

these ‘islands’ and exhibit territorial behavior (Poston, 1974), so much so

that availability of nesting sites limits population sizes (Vickery and Nudds,

1984). Generally, single to a few pairs occur at individual nesting sites, in

contrast to other dabbling and diving duck species (Vickery and Nudds,

23

1984), which may have more concentrated nesting sites and may be

sympatric with several different species of birds. Site and habitat fidelity

exhibited by the duck host likely results in stable transmission dynamics for

T. querquedulae. This also assumes that the intermediate host is present

and that at least peak cercarial shedding of T. querquedulae occurs during

this time as well, when the shovelers and teal are isolated for nesting and

raising of ducklings.

It could also be the case that the potential for temporal isolation is a

mechanism for the maintenance of this global host-parasite association.

Members of the ‘blue-wing’ group are the first duck species to migrate in

both the spring and the winter (Arzel et al., 2006), thus it would follow that

their ducklings may be the first to encounter schistosome cercariae in the

spring. This hypothesis may hinge on the importance of overwintering

infected snails in sustaining a majority of the transmission (Crews and Esch,

1986; Goater et al., 1989). This idea is plausible for a snail host of T.

querquedulae, Physa gyrina, as it is bivoltine, with overwintering snails

producing an early spring generation (Brown, 1979), and it is likely an

abundant permissive snail host within the duck host natal habitats (Pip,

1987). Data from this study support the hypothesis that migrating birds, in

particular northern shovelers, transfer infections among continents

suggesting that transmission may not be strictly confined to natal habitats.

However, habitat requirements by this particular clade of ducks would be the

same among species. Nonetheless, these stimulating ideas require empirical

studies documenting the dynamics of transmission at relevant spatial and

temporal scales.

24

It is clear that for T. querquedulae to persist in the Southern

Hemisphere, suitable snail intermediate hosts must be present. Although

the identity of the intermediate host(s) for T. querquedulae in the Southern

Hemisphere remains unknown, several possibilities exist, some of which

can help account for the broad geographic range and even definitive host

associations observed. In North America, Physa spp. are confirmed hosts

(McLeod and Little, 1942; Brant and Loker, 2009; Brant et al., 2011).

Physid diversity is highest in North America (Wethingtion, 2007), but

several species are native to, or have invaded, the Southern Hemisphere.

South America harbors several endemic physids, which could sustain T.

querquedulae transmission, for example, Physa marmorata (Guilding,

1828), which has now invaded parts of South Africa (Appleton, 2003).

Physa acuta (Draparnaud, 1805), is a well-documented global invader

that has established in much of the Southern Hemisphere (Bousset et al.,

2014) and may well serve as a host for T. querquedulae. Physid snails

commonly colonize the shallow freshwater habitats favored by ‘blue wing’

duck species.

Generally, Trichobilharzia spp. are specific to a single snail species or

a group of closely-related congeners (Kock, 2001; Rudolfova et al., 2005;

Brant and Loker, 2009; Jouet et al., 2009), and experimental and genetic

confirmation that a species of Trichobilharzia can infect multiple genera of

snails within a family has yet to be achieved. There is a report of an avian

schistosome Dendritobilhariza pulverulenta (Cheatum, 1941) found in both

Gyraulus (North America, New Zealand) and Anisus (Europe) snails but the

genetic identity of the worms from Anisus have not been confirmed as D.

25

pulverulenta, since there exists more than one species (Khalifa, 1976;

Vusse, 1980; Brant et al., 2011) and Dendritobilhariza loossi has been found

experimentally to use Anisus vortex in Europe (Akramova et al., 2011). Snail

surveys carried out in Europe (Rudolfova et al., 2005; Jouet et al., 2009b)

and Africa (Appleton and Brackenbury, 1998; Laamrani et al., 2005), have

failed to recover any Trichobilharzia spp. from native or invasive physids.

Two studies report schistosome cercariae from other physids in Europe

(Aplexa hypnorum, Gerard, 2004; Physa fontinalis, Rudolfova et al., 2005),

but neither schistosome belongs to the genus Trichobilharzia. It should be

noted, however, that even within North America the prevalence of T.

querquedulae in Physa spp. is very low and snail surveys for trematodes

frequently fail to recover T. querquedulae and other Trichobilharzia spp. (Loy

and Haas, 2001) from their presumptive snail hosts. However, survey

collections of physids at times of the year when these duck host have

ducklings are lacking, and that might be peak time for cercarial shedding.

It is even less common to find a genetically confirmed schistosome

conspecific infecting two different families of snails (Blair et al., 2001).

However one species, Trichobilharzia jequitibaensis (Leite et al., 1978), has

been reported to infect both Physidae and Lymnaeidae. Miracidia obtained

from naturally infected domestic Muscovy ducks (Cairina moschata

domestica) successfully infected both P. marmorata and Lymnaea columella

under experimental conditions. If such a situation were confirmed and shown

to be true for T. querquedulae, then its broad geographic range would be more

explicable since lymnaeid species diversity is much greater in the Eastern

Hemisphere than physid species diversity. It will be interesting to pursue and

26

verify these intriguing results with further experimentation, field collections

and sequence analyses. These details of both definitive and intermediate

host associations across a parasite’s range are necessary to understand

transmission dynamics as well as to model zoonotic cycles.

The example of T. querquedulae globally distributed within a rather

narrowly defined clade of ducks is instructive for those interested in the

epidemiology of HCD, and more broadly the transmission of waterfowl

zoonoses. The trans-hemispheric occurrence of T. querquedulae is certainly

aided both by the migratory behavior (trans-hemispheric migration of the

northern shoveler) and habitat preferences of definitive hosts as well as

habitat preferences of the snail hosts. Perhaps the shared host ecology of

duck hosts (habitat preference, nest site fidelity and timing of migration)

across both the Northern and Southern Hemispheres sustain transmission

and perpetuate the clear phylogenetic association between T. querquedulae

and the ‘blue-wing’ group. Further research is necessary to partition the

relative roles of host ecology and phylogeny in shaping the transmission of T.

querquedulae over evolutionary time. For example, experimental infections

evaluating permissiveness of non ‘blue-wing’ duck species and other snail

host species would be a logical next step providing data vital to model

transmission dynamics. The greater role duck host ecology plays, the more

dynamic one would expect host associations and transmission to be in

response to ecological change over evolutionary time, as opposed to a strict

specialist model. Human-mediated habitat alteration and climate change

have been implicated in affecting the transmission of other waterfowl

zoonoses (Reed et al., 2003; Fuller et al., 2012; Dijk et al., 2014) and are

27

likely to alter Trichobilharzia host associations over time as well. Together

with the fact that avian schistosomes of other genera infect different bird and

snail lineages, we must remember that HCD is caused by a number of

schistosome species, with markedly different patterns of host use, posing a

challenge for those interested in understanding the epidemiology of HCD.

Thus future studies on the specific ecological relationships among hosts and

worms, and on how permissive other species of ducks and snails are for T.

querquedulae will be an exciting path forward to both understanding parasite-

host biology as well as the ability to more specifically model zoonotic disease

emergence.

ACKNOWLEDGMENTS

Thank you to the following for invaluable help collecting birds—South

Africa: Museum of Southwestern Biology Bird Division: Mr. Andy Johnson,

Dr. Ernest Valdez, Dr. Robert W. Dickerman and Dr. Chris Witt; National

Museum Bloemfontein: Mr. Rick Nuttall and Mr. Dawie H. de Swardt. We

acknowledge technical support from the University of New Mexico Molecular

Biology Facility, which is supported by National Institutes of Health, USA

grant P30GM110907 from the Institute Development Award program of the

National Center for Research Resources, USA. This work was primarily

funded through a National Science Foundation, USA grant to S.V.B. (DEB

1021427) and a National Institutes of Health grant RO1 AI44913 to ESL. We

thank the following funding agencies; Agencia de Promoción Científica y

Técnica, Argentina PICT 1288-2011 and CONICET, Argentina PIP No.:

11220110100550 to VF.

28

REFERENCES

Akaike, H. 1974. A new look at the statistical model identification. IEEE Trans. Automat. Cont. 19, 716-723.

Akramova, F.D., Azimov, D.A., Shakarboev, E.B. 2011. Morphology, biology and

taxonomy of Dendritobilharzia loossi Skrjabin, 1924 (Trematoda: Bilharziellidae), a parasite of Pelecanus onocrotalus (Pelecanidae) and Anas platyrhynchos (Anatidae). Parasite. 18, 39-48.

Aldhoun, J.A., Kolárová, L., Horák, P., Skírnisson, K. 2009. Bird schistosome

diversity in Iceland: molecular evidence. J. Helminthol. 83, 173–180. Appleton, C.C., Brackenbury, T.D., Tonin, A.F.G. 1989. Physa mosambiquensis

(Clessin,1886) rediscovered? South African J. Zool. 24, 340–344. Appleton, C.C. 2003. Alien and invasive fresh water Gastropoda in South Africa.

African J. Aquatic Sci. 28, 69-81. Arzel, C., Elmberg, J., Guillemain, M. 2006. Ecology of spring-migrating Anatidae: a

review. J. Ornithol. 147, 167-184. Baldassarre, G. A., Bolen, E. G. 1994. Waterfowl ecology and management. John

Willey & Sons. Inc. New York, USA.

Blair, D., Islam, K.S. 1983. The life cycle and morphology of Trichobilharzia australis n. sp. (Digenea: Schistosomatidae) from the nasal blood vessels of the black duck (Anas superciliosa) in Australia, with a review of the genus Trichobilharzia. Syst. Parasitol. 5, 89–117.

Blair, D., Davis, G. M., Wu, B. 2001. Evolutionary relationships between

trematodes and snails emphasizing schistosomes and paragonimids. Parasitology. 123, 229-243.

Blouin, M. S., Yowell, C. A., Courtney, C. H., Dame, J. B. 1995. Host movement

and the genetic structure of populations of parasitic nematodes. Genetics. 141, 1007-1014.

Blums, P., Nichols, J. D., Hines, J. E., Mednis, A. 2002. Sources of variation in

survival and breeding site fidelity in three species of European ducks. J. Animal Ecology. 71, 438-450.

Bousset, L., Pointier, J. P., David, P., Jarne, P. 2014. Neither variation loss, nor

change in selfing rate is associated with the worldwide invasion of Physa acuta from its native North America. Biol. Invasions. 16, 1769-1783.

Bouzid, W., Štefka, J., Hypša, V., Lek, S., Scholz, T., Legal, L., Kalthoum, O.,

Hassine, B., Loot, G. 2008. Geography and host specificity: two forces behind the genetic structure of the freshwater fish parasite Ligula intestinalis (Cestoda: Diphyllobothriidae). Int. J. Parasitol. 38, 1465-1479.

29

Brant, S.V., Loker, E.S. 2009. Molecular systematics of the avian schistosome genus

Trichobilharzia (Trematoda: Schistosomatidae) in North America. J. Parasitol. 95, 941–963.

Brant, S. V., Bochte, C. A., Loker, E. S. 2011. New intermediate host records for the

avian schistosomes Dendritobilharzia pulverulenta, Gigantobilharzia huronensis, and Trichobilharzia querquedulae from North America. J. Parasitol. 97, 946-949.

Brant, S. V., Loker, E. S. 2013a. Discovery-based studies of schistosome diversity

stimulate new hypotheses about parasite biology. Trends Parasitol. 29, 449-459.

Brant, S. V., Jouet, D., Ferte, H., Loker, E. S. 2013b. Anserobilharzia gen. n.

(Digenea, Schistosomatidae) and redescription of A. brantae (Farr & Blankemeyer, 1956) comb. n. (syn. Trichobilharzia brantae), a parasite of geese (Anseriformes). Zootaxa. 3670, 193-206.

Cheatum, E.L. 1941. Dendritobilharzia anatinarum n. sp., a blood fluke from the

mallard. J. Parasitol. 27, 165-170. Christiansen, A. Ø., Olsen, A., Buchmann, K., Kania, P. W., Nejsum, P.,

Vennervald, B. J. 2014. Molecular diversity of avian schistosomes in Danish freshwater snails. Parasitol. Res. 1-11.

Clark, R.G., Shuter, D. 1999. Avian habitat selection: Pattern from process in nest-

site use by ducks? Ecology. 80, 272-287. Crews, A.E., Esch, G.W. 1986. Seasonal dynamics of Halipegus occidualis

(Trematoda: Hemiuridae) in Helisoma anceps and its impact on fecundity of the snail host. J. Parasitol. 72, 646-651.

Darriba, D., Taboada, G.L., Doallo, R., Posada, D. 2012. jModelTest 2: more

models, new heuristics and parallel computing. Nature Meth. 9, 772. de Gentile, L., Picot, H., Bourdeau, P., Bardet, R., Kerjan, A., Piriou, M., LeGuennic,

A., Bayssade-Dufour, C., Chabasse, D., Mott, K.E. 1996. Le dermatite cercarienne en Europe: un probleme de la sante´publique nouveau? Bulletin de l’Organisation Mondiale de la Sante´. 74, 159–163.

Dijk, J. G., Hoye, B. J., Verhagen, J. H., Nolet, B. A., Fouchier, R. A., Klaassen, M.

2014. Juveniles and migrants as drivers for seasonal epizootics of avian influenza virus. J. Anim. Ecol. 83, 266-275.

Draparnaud, J. P. R. 1805. Histoire naturelle des mollusques terrestres et fluviatiles

de la France. D Colas, Paris, France.

30

Dvorak, J., Vanácová, Š., Hampl, V., Flegr, J., Horak, P. 2002. Comparison of European Trichobilharzia species based on ITS1 and ITS2 sequences. Parasitology. 124, 307-313.

Ferté, H., Depaquit, J., Carré, S., Villena, I., Léger, N. 2005. Presence of

Trichobilharzia szidati in Lymnaea stagnalis and T. franki in Radix auricularia in northeastern France: molecular evidence. Parasitol. Res. 95, 150-154.

Fuller, T., Bensch, S., Muller, I. Novembre, J., Perez-Tris, J., Rickfels, R.E., Smith,

T.B., Waldenstrom, J. 2012. The ecology of emerging infectious diseases in migratory birds: an assessment of the role of climate change and priorities for future research. Ecohealth. 9, 80-88.

Garvon, J. M., Fedynich, A. M., Peterson, M. J., Pence, D. B. 2011. Helminth

community dynamics in populations of blue-winged teal (Anas discors) using two distinct migratory corridors. J. Parasitol. Res. 2011, Article ID 306257.

Gerard, C. 2004. First occurrence of Schistosomatidae infecting Aplexa hypnorum (Gastropoda, Physidae) in France. Parasite. 11, 231-234.

Goater, T.M., Shostak, A.W., Williams, J.A., Esch, G.W. 1989. A mark- recapture study of trematode parasitism in overwintered Helisoma anceps (Pulmonata), with special reference to Halipegus occidulis (Hemuridae). J. Parasitol. 75, 553-560.

Goulding, T. C., Cohen, S.C. 2014. Phylogeography of a marine acanthocephalan: lack of cryptic diversity in a cosmopolitan parasite of mole crabs. J. Biogeogr. 41, 965–976.

Hasegawa, M., Kishino, H., Yano, T. A. 1985. Dating of the human-ape

splitting by a molecular clock of mitochondrial DNA. J. Mol. Evo. 22, 160-174.

Hoberg, E. P., Brooks, D. R. 2008. A macroevolutionary mosaic: episodic

host‐ switching, geographical colonization and diversification in complex host–parasite systems. J. Biogeography. 35, 1533-1550.

Horák, P., Kolářová, L., Adema, C. M. 2002. Biology of the schistosome genus

Trichobilharzia. Adv. Parasitol. 52, 155-233. Horák, P., Kolářová, L. 2011. Snails, waterfowl and cercarial dermatitis. Freshwater

Biol. 56, 779-790. Horák, P., Mikes, L., Lichtenbergova, L., Skala, V. Soldanova, M., Brant,

S.V. 2015. Avian schistosomes and outbreaks of Cercarial Dermatitis. Clin Microbiol. Rev. 28. 165-190.

31

Johnson, K.J., Sorenson, M.D. 1999. Phylogeny and biogeography of the dabbling ducks (Genus: Anas): A comparison of molecular and morphological evidence. The Auk. 116, 792-805.

Jouet, D., Ferté, H., Hologne, D., Kaltenback, M.L., Depaquit, J. 2009. Avian

schistosomes in French aquatic birds: a molecular approach. J. Helminthol. 83, 181–189.

Jouet, D., Skirnisson, K., Kolarova, L., Ferte, H. 2010. Final hosts and variability of

Trichobilharzia regenti under natural conditions. Parasitol. Res. 107, 923-930. Jouet, D., Kolarova, L., Patrelle, C., Ferte, H., Skirnisson, K. 2015. Trichobilharzia

anseri n. sp. (Schistosomatidae: Digenea), a new visceral species of avain schistosomes isolated from graylag goose (Anser anser L.) in Iceland and France. Inf. Gen. Evol. 34, 298-306.

Kear, J. 2005. Ducks, Geese and Swans: Species Accounts (Cairina to Mergus).

Oxford University Press Inc. New York, USA. Kimura, M. 1980. A simple method for estimating evolutionary rates of base

substitutions through comparative studies of nucleotide sequences. J. Mol. Evol. 16, 111-120.

Kock, S. 2001. Investigations of intermediate host specificity help to elucidate the

taxonomic status of Trichobilharzia ocellata (Digenea: Schistosomatidae). Parasitology. 123, 67-70.

Kolářová, L., Rudolfová, J., Hampl, V., Skírnisson, K. 2006. Allobilharzia visceralis

gen. nov., sp. nov.(Schistosomatidae-Trematoda) from Cygnus cygnus (L.)(Anatidae). Parasitol. Int. 55, 179-186.

Kolářová, L., Horák, P., Skírnisson, K. 2010. Methodical approaches in the

identification of areas with a potential risk of infection by bird schistosomes causing cercarial dermatitis. J. Helminthol. 84, 327-335.

Kolářová, L., Horák, P., Skírnisson, K., Marečková, H., Doenhoff, M. 2013.

Cercarial dermatitis, a neglected allergic disease. Clin Rev Allergy Immunol. 45, 63-74.

Kourilova´, P., Hogg, K.G., Kolářová, L., Mountford, A.P. 2004. Cercarial dermatitis

caused by bird schistosomes comprises both immediate and late phase cutaneous hypersensitivity reaction. J. Immunol. 172, 3766–3774.

Laamrani, H., Boelee, E., Madsen, H. 2005. Trematode infection among

freshwater gastropods in Tessaout Amont irrigation system, Morocco. African Zool. 40, 77-82.

Larkin, M.A., Blackshields, G., Brown, N.P., Chenna, R., McGettigan, P.A.,

McWilliam, H., Valentin, F., Wallace, I.M., Wilm, A., Lopez, R., Thompson,

32

J.D., Gibson, T.J., Higgins D.G. 2007. ClustalW and ClustalX version 2. Bioinformatics. 23, 2947-2948.

Larsen, A.H., Bresciani, J., Buchmann, K. 2004. Increasing frequency of cercarial dermatitis at higher latitudes. Acta Parasitologica. 49, 217–221.

Lawton, S. P., Lim, R. M., Dukes, J. P., Cook, R. T., Walker, A. J., Kirk, R. S. 2014. Identification of a major causative agent of human cercarial dermatitis, Trichobilharzia franki (Müller and Kimmig 1994), in southern England and its evolutionary relationships with other European populations. Parasites & Vectors. 7, 277.

Leite, A. C. R., de Araujo Costa, H. M., Costa, J. O. 1978. Trichobilharzia

jequitibaensis sp. n. (Trematoda, Schistosomatidae) in Cairina moschata domestica (Anatidae). Revista Brazileira de Biologia. 38, 843-846.

Loy, C., Haas, W. 2001. Prevalence of cercariae from Lymnaea stagnalis snails in a

pond system in Southern Germany. Parasitol. Res. 87, 878-882. McKenzie, V.J. 2007. Human land use and patterns of parasitism in tropical

amphibian hosts. Biol. Conserv. 137,102-116. McLeod, J.A. 1937. Two new schistosomid trematodes from water birds. J.

Parasitol. 23, 456-466. McLeod, J. A., Little, G. E. 1942. Continued studies on Cercarial Dermatitis and the

trematode family Schistosomatidae in Manitoba: Part I. Canadian J. Res. 20, 170-181.

Ostfeld, R.S., Keesing, F. 2000. Biodiversity and disease risk: the case of Lyme

disease. Conservation Biol. 14, 722–728. Peters, J. L., Winker, K., Millam, K. C., Lavretsky, P., Kulikova, I., Wilson, R. E.,

Zhuravlev, Y.N., McCracken, K. G. 2014. Mito‐ nuclear discord in six congeneric lineages of Holarctic ducks (genus Anas). Mol. Ecol. 23, 2961-2974.

Poston, H.J. 1974. Home range and breeding biology of the Shoveler. Canadian

Wildlife Serv. Rep. Ser. 25, 1–42. Rau, M. E., Bourns, T. K. R., Ellis, J. C. 1975. Egg production by Trichobilharzia

ocellata (Trematoda: Schistosomatidae) after initial and challenge infection in ducks. Canadian J. Zool. 53, 642-650.

Reed, K. D., Meece, J. K., Henkel, J. S., Shukla, S. K. 2003. Birds, migration and emerging zoonoses: West Nile virus, Lyme disease, influenza A and enteropathogens. Clin Med Res. 1, 5-12

33

Rizevsky, S. V., Cherviakovsky, E. M., Kurchenko, V. P. 2011. Molecular taxonomic identification of Schistosomatidae from Naroch Lake and Polonevichi Lake in Belarus. Biochem Sys Ecol. 39, 14-21.

Ronquist, F, Huelsenbeck, J.P. 2003. MRBAYES 3: Bayesian phylogenetic inference

under mixed models. Bioinformatics. 19, 1572-1574. Rudolfová, J., Hampl, V., Bayssade-Dufour, C., Lockyer, A. E., Littlewood, D. T. J.,

Horák, P. 2005. Validity reassessment of Trichobilharzia species using Lymnaea stagnalis as the intermediate host. Parasitol. Res. 95, 79-89.

Rudolfová, J., Littlewood, D. T. J., Sitka, J., Horák, P. 2007. Bird schistosomes of

wildfowl in the Czech Republic and Poland. Folia Parasitologica 54, 88-93. Skrjabin, K.I. and Zakharov, N.P. 1920. Zweineue Trematodengattugen aus den

Blutgefassen der Volgel. Izvestnik Donskovo Veterinarnovo Instituta 2, 1-6. Soldánová, M., Selbach, C., Kalbe, M., Kostadinova, A., Sures, B. 2013. Swimmer's

itch: etiology, impact, and risk factors in Europe. Trends in Parasitol. 29, 65-74.

Tamura, K., Nei, M. 1993. Estimation of the number of nucleotide substitutions in

the control region of mitochondrial DNA in humans and chimpanzees. Mol. Biol Evol. 10, 512-526.

Tamura, K., Stecher, G., Peterson, D., Filipski, A., Kumar, S. 2013. MEGA6: molecular evolutionary genetics analysis version 6.0. Mol. Bio. Evo. 30, 2725-2729.

Taylor, L.H., Latham, S.M., Woolhouse, M.E.J. 2001 Risk factors for human disease emergence. Phil. Trans. R Soc. Lond. Biol Sci. 356, 983–989.

Thompson, R. A. 2000. Giardiasis as a re-emerging infectious disease and its zoonotic potential. Int. J. Parasitol. 30, 1259-1267.

Truett, G. E., Heeger, P., Mynatt, R. L., Truett, A. A., Walker, J. A., Warman, M. L. 2000. Preparation of PCR-quality mouse genomic DNA with hot sodium hydroxide and tris (Hot- Shot). Biotechniques. 29, 52-54.

Valdovinos, C., Balboa, C. 2008. Cercarial dermatitis and lake eutrophication in

South- central Chile. Epidemiol. Infect. 136, 391–394. Vickery, W.L. Nudds, T.D. 1984. Detection of density dependent effects in annual

duck censuses. Ecology. 65, 96–104. Vusse, F. J. V. 1980. A review of the genus Dendritobilharzia Skrjabin and Zakharow

1920 (Trematoda: Schistosomatidae). J. Parasitol. 1, 814-822. Webster, B. L., Rudolfová, J., Horák, P., Littlewood, D. T. J. 2007. The complete

mitochondrial genome of the bird schistosome Trichobilharzia regenti

34

(Platyhelminthes: Digenea), causative agent of cercarial dermatitis. J. Parasitol. 93, 553-561.

Wilson, R. E., Eaton, M. D., Sonsthagen, S. A., Peters, J. L., Johnson, K. P.,

Simarra, B., McCracken, K. G. 2011. Speciation, subspecies divergence, and paraphyly in the Cinnamon Teal and Blue-winged Teal. The Condor. 113, 747-761.

35

Figure 1. Maximum likelihood (ML) tree based on mitochondrial cytochrome oxidase

subunit I (cox1) sequence data. Branch support values less than 50% were not

shown. Values are reported as bootstrap support from ML analysis/ posterior

probabilities from Bayesian analysis. The shaded box includes all Trichobilharzia

querquedulae individuals analyzed, bolded taxa indicate samples collected from the

Southern Hemisphere. Accession numbers of other analyzed Trichobilharzia

samples can be found in Table 1.

36

Figure. 2. Maximum likelihood (ML) tree based on internal transcribed spacer region

1 (ITS1) sequence data. Branch support values less than 50% are not shown; values

are reported as bootstrap support from ML analysis/posterior probabilities from

Bayesian analysis. The shaded box includes all Trichobilharzia querquedulae

individuals analyzed, bolded taxa indicate samples collected from the Southern

Hemisphere. Accession numbers of other analyzed Trichobilharzia samples can be

found in Table 1.

37

Figure. 3. Maximum likelihood (ML) tree based on NADH Dehydrogenase subunit 4

(ND4) sequence data. Branch support values less than 50% were not shown; values

are reported as bootstrap support from ML analysis/posterior probabilities from

Bayesian analysis. The shaded box includes all Trichobilharzia querquedulae

individuals analyzed, bolded taxa indicate samples collected from the Southern

Hemisphere. Accession numbers of other analyzed Trichobilharzia samples

analyzed can be found in Table 1.

39

Figure. 4. Simplified Anas phylogeny reconstructed from Johnson and Sorensen

(1999). (A) Tree depicts phylogenetic relationships within Anas. Clades are

collapsed to include: pintails (A. acuta, A. georgica, A. bahamensis, A.

erythrorhyncha, A. capensis), green-winged teals (A. flavirostris, A. carolinensis, A.

crecca), Mallards (A. laysanensis, A. luzonica, A. platyrhynchos, A. poecilorhyncha,

A. zonorhyncha, A. diazi, A. rubripes, A. fulvigula, A. superciliosa, A. melleri, A.

undulata, A. sparsa), gray teals (A. gibberifrons, A. castanea, A. bernieri), Brown

teals (A. aucklandica, A. chlorotis), Wigeons (A. americana, A. sibilatrix, A. penelope,

A. strepera, A. falcata), silver teals (A. versicolor, A. puna, A. hottentota, A.

querquedula), blue-winged teals (A. smithii, A. rhynchotis, A. clypeata, A.

cyanoptera, A. discors, A. platalea), South American ducks (Speculanas specularis,

Amazonetta brasiliensis, Tachyeres pteneres, Lophonetta specularioides), outgroup

(Marmaronetta, Pteronetta, Cyanochen, Aythya, Asarcornis, Chenonetta, Callonetta,

Tadorna,Cairina, Aix, Sarkidiorni). (B) Tree depicts interspecific relationships within

the ‘blue-winged’ teal clade (shaded in A). Host taxa are labeled by infection status

with Trichobilharzia querquedulae ( experimental host (McLeod and Little, 1942);

☐, host not examined; , host examined/positive; , host examined/negative). All

survey data summarized was performed by the authors with the exception of A.

querquedulae (Kolarova et al., 1997).

40

Gene

Species Host Locality CO1 ND4 ITS MSB # Reference

W135 Trichobilharzia querquedulae

Anas clypeata LA FJ174497 KU057197 FJ174557 183 *

W137 T. querquedulae A. discors LA FJ174498 - FJ174558 19497 *

W142 T. querquedulae A. discors LA - KU057196 KP788761 19502 *

W148.1 T. querquedulae A. cyanoptera NM FJ174499 KU057194

FJ174559 18584 *

W148.2 T. querquedulae A. cyanoptera NM FJ174500 - - 18584 *

W153 T. querquedulae A. clypeata NM - KU057192 KP788763 18587 *

W155 T. querquedulae A. cyanoptera NM - - FJ174553 18589 *

W155.2 T. querquedulae A. cyanoptera NM - KU057200 - 18589 *

W155.3 T. querquedulae A. cyanoptera NM FJ174501 - KP788764 18589 *

W156 T. querquedulae A. discors NM FJ174502 KU057191 FJ174554 18590 *

W158 T. querquedulae A. clypeata NM FJ174503 - FJ174549 18592 *

W160 T. querquedulae A. discors NM - KU057201 KP788766 18594 *

W162 T. querquedulae A. clypeata NM FJ174504 KU057190 FJ174551 18602 *

W167 T. querquedulae A. discors NM - KU057202 - - *

41

W180 T. querquedulae A. cyanoptera CA FJ174505 - FJ174556 18573 *

W183 T. querquedulae A. clypeata CA FJ174506 KU057189 FJ174560 18575 *

W190 T. querquedulae A. discors CA FJ174507 - FJ174550 18582 *

W203 T. querquedulae A. clypeata AK FJ174508 - FJ174552 18636 *

W345 T. querquedulae A. clypeata MB FJ174509 KU057185 FJ174547 18626 *

W650 T. querquedulae A. smithii ZA - KU057205 KP788765 18990 This study

W664 T. querquedulae A. smithii ZA KU057180 - KP788762 19000 This study

W703 T. querquedulae A. rhynchotis NZ KU057181 KU057204 - 20792 This study

W704 T. querquedulae A. rhynchotis NZ KU057182 KU057203 - 20793 This study

Tshov T. querquedulae A. rhynchotis NZ KU057183 - KP788760 20794 This study

W833 T. querquedulae A. versicolor AR KU057184 KU057206 - - This study

E45 T. querquedulae A. discors FL FJ174510 - FJ174555 - *

E45.2 T. querquedulae A. discors FL - KU057199 - - *

E64 T. querquedulae A. discors FL

FJ174511 KU057198 - - *

SDS1006 T. querquedulae A. clypeata NE - - FJ174548 - *

W206.2 Trichobilharzia sp.

A A. americana AK - - KP788771 - *

W210 Trichobilharzia sp.

A A. americana AK - - KP788772 - *


A A. americana AK FJ174527 - FJ174570 18636 *

42


A A. americana NM - KU057193 - 18585 *


B A. americana AK FJ174528 - KP788770 18638 *


C

Lophodytes

cucullatus

PA FJ174529 - FJ174576 - *

W175 Trichobilharzia

physellae A.platyrhynchos PA - - KP788768 - *

W196 Trichobilharzia

physellae Aythya affinis NM - - KP788767 - *

W263 T. physellae Physa gyrina NM FJ174523 * FJ174562 178 *

RSFO1 Trichobilharzia

franki Radix auricularia FR - - AY795572 -

Ferte et al. 2005

RSFO3 T. franki R. auricularia FR HM131198 - AY795573 -

Ferte et al. 2005

HamRa6 T. franki R. auricularia GB - - KJ775868 - Lawton et al. 2014

HamRa7 T. franki R. auricularia GB - - KJ775869 - Lawton et al,

2014

CYA18 Trichobilharzia

regenti Cygnus olor FR HM439500 - HM439497 -

Jouet et al. 2010

DQ859919 Trichobilharzia

regenti Radix peregra - GeneID: 5333425 - -

Webster et al. 2007

43

Table 1: Host association and locality origin of the specimens used in this study. *Brant and Loker 2009. Locality abbreviations: LA = Louisiana USA, NM = New Mexico USA, CA = California USA, AK = Alaska USA, FL = Florida USA, NE = Nebraska USA, PA = Pennsylvania USA, FR = France, GB = England United Kingdom, MB = Manitoba Canada, ZA = Freestate South Africa, NZ = South Island New Zealand, AR = Corrientes Argentina. All samples collected for this study have been deposited in the Museum of Southwestern Biology (MSB) Division of Parasites at the University of New Mexico; parasite and hosts records (including GPS coordinates) can be accessed via the Arctos database

44

Species Location # Examined # Infected Reference

Anas clypeata North America 22 20 Brant and Loker 2009 Anas discors North America 20 20 Brant and Loker 2009 Anas discors North America 184 175 Garvon et al. 2011 Anas cyanoptera North America 12 12 Brant and Loker 2009 Anas smithii Anas hottentota

South Africa Kenya

2 2

2 0

This Study This Study

Anas rhynchotis New Zealand 3 3 This Study Anas versicolor Anas platalea

Argentina Argentina

3 1

3 0

This Study This Study

Table 2: Prevalence of T. querquedulae within members of the ‘blue-wing’ group and their allies.

45

Gene

Species CO1 ND4 ITS

T. querquedulae within NA

0.01 0.012 0.001

T. querquedulae within SH 0.012 0.017 0.004

T. querquedulae between NA and SH

0.012 0.015 0.003

T. querquedulae all sequences 0.011 0.012 0.002

T. querquedulae vs. T. franki 0.077 - 0.002

T. querquedulae vs. Trichobilharzia sp. A

0.082 0.11 0.002

T. querquedulae vs. T. physellae

0.082 0.13 0.002

Table 3. Genetic distances comparing ITS, CO1 and ND4 gene regions within and between global samples of Trichobilharzia querquedulae and between closely related Trichobilharzia spp. NA= North America, SH = Southern Hemisphere.

46

CHAPTER II

Phylogeography and genetics of the globally invasive snail Physa acuta Draparund 1805 (= Haitia acuta, Taylor 2003), and its potential as an

intermediate host to larval digenetic trematodes.

AUTHORS: Erika T. Gendron (Ebbs), Eric S. Loker and Sara V. Brant

ABSTRACT

Background: Physa acuta is a globally invasive freshwater snail native to

North America. Prior studies have led to conflicting views of how P. acuta

populations are connected and genetic diversity is partitioned globally. This

study aims to characterize phylogeographic and population genetic structure

within the native range of P. acuta, elucidate its invasion history and assess

global patterns of genetic diversity. Further, using meta-analytic methods, we

test the ‘Enemy-Release hypothesis’ within the P. acuta – digenetic trematode

system. The ‘Enemy-Release hypothesis’ refers to the loss of native parasites

following establishment of their host within an invasive range. Population

genetic data is combined with surveys of trematode infections to map range-

wide trematode species richness associated with P. acuta, and to identify

relevant host-population parameters important in modeling host-parasite

invasion.

Results: Phylogenetic analyses using mtDNA uncovered two major clades (A

& B). Clade A occurs globally while clade B was only recovered from the

Western USA. All invasive populations sampled group within Clade A, where

multiple independent source populations were identified from across North

America. Significant population genetic structure was found within the native

47

range of P. acuta, with some evidence for contemporary geographic barriers

between western and eastern populations. Mito-nuclear discordance was

found suggesting historical isolation with secondary contact between the two

mitochondrial clades. Trematode species richness was found to differ

significantly between native and invasive populations, in concordance with the

‘Enemy-Release hypothesis’. Further, our data suggests a positive

relationship between nucleotide diversity of invasive populations and

trematode prevalence and richness.

Conclusions: This study includes a wider geographic sampling of P. acuta

within its native range that provides insight into phylogeographic and

population genetic structure, range-wide genetic diversity and estimation of

the invasion history. Meta-analysis of P. acuta – trematode surveys globally is

consistent with the ‘Enemy-Release hypothesis’. Additionally, results from this

study suggest that host demographic parameters, namely genetic diversity,

may play an essential role in how parasite communities assemble within

invasive host populations. This knowledge can be used to begin to construct a

framework to model host-parasite invasion dynamics over time.

INTRODUCTION

Invasive species are an important consequence of global change (Sax et al.,

2005), therefore understanding their origin and invasion history (Estoup and

Guillemaud, 2010), as well as how genetic variation is partitioned across their range

(Facon et al., 2008), is vital. Population genetics provides a powerful tool by which

invasion processes can be revealed (Cristescu, 2015; Estoup and Guillemaud,

2010). Freshwater gastropods present an interesting case, as they are often

48

dispersed passively and distributed patchily (Jarne and Delay, 1991) in nature, but

human activities (i.e. aquaria trade, boats) may greatly alter dispersal, population

structure and consequently evolutionary dynamics (Facon et al., 2003; Jarne and

Delay, 1991).

One such invader is Physa acuta (Draparnaud, 1805)(= Haitia acuta, Taylor

2003), a globally invasive freshwater snail which is native to North America (Dillon et

al., 2002; Lydeard et al., 2016), now occurs on all continents except Antarctica

(Bousset et al., 2014; Wethington and Lydeard, 2007). Remarkable reproductive

plasticity has been reported within P. acuta, specifically in populations’ ability to alter

the number of generations per year (Clampitt, 1970; Monsutti and Perrin, 1999), a

characteristic that might contribute to the invasion success of P. acuta. Physa acuta

is known to displace native gastropods to become the dominant species over very

short periods of time (Appleton, 2003; Brackenbury and Appleton, 1993; Dobson,

2004). For example, doubling times as short as four weeks have been recorded from

European (invasive) P. acuta populations (Perrin, 1986).

The invasion history of P. acuta is muddled by two centuries of taxonomic

confusion ( summarized by Wethington and Lydeard, 2007), due in large part to

plasticity in shell phenotype and overestimation of nominal diversity. Consequently,

the timing of invasion and the connectivity of native and invasive populations remain

unclear. Interestingly, Physa acuta was first described from its invasive range in

France (Draparnaud, 1805) over two centuries ago and it was not until 12 years

later that it was described by Say (1817) from Pennsylvania, USA, under a different

name, Physa heterostropha. Nominal diversity of P. acuta-like snails reached at least

eight species (Burch, 1989; Taylor, 2003; Te, 1978) prior to the inclusion of

molecular genetic data (Pip and Franck, 2008; Wethington and Guralnick, 2004;

49

Wethington and Lydeard, 2007). Molecular genetic studies in addition to reproductive

isolation experiments (Dillon et al., 2002; Dillon and Wethington, 2004)

demonstrated the need to synonymize P. heterostropha (North America), P. virgata

(North America), P. integra (North America) and P. cubensis (Central and South

America) to a single species, Physa acuta (Draparnaud, 1805). Taylor (Taylor, 2003)

placed P. acuta and closely allied species into the genus Haitia, based primarily on

penial morphology, which has demonstrated phylogenetic utility (Taylor, 2003;

Wethington and Lydeard, 2007). However, current genetic studies support the use of

penial morphology to define species or species groups rather than higher level

taxonomy (Wethington and Lydeard, 2007), as such the use of Haitia has failed to

become widely adopted. Molecular phylogenetic analyses have also supported that

P. acuta occurs globally (Wethington and Lydeard, 2007).

The vast distribution, invasiveness and ubiquity of P. acuta have garnered the

interest of evolutionary biologists. Efforts have been made to elucidate the

population genetic structure of P. acuta at both regional (Bousset et al., 2004; Dillon

and Wethington, 2006; Escobar et al., 2007; Van Leeuwen et al., 2013) and global

(Bousset et al., 2014; 2004) scales. These studies reconstructed the genetic

structure of P. acuta primarily in its invasive range in Europe, with limited sampling

from native populations. Characterizing population structure within the native range

is foundational to resolving invasion history (Ghabooli et al., 2011). Limited sampling

from native populations limit possible hypotheses relative to a likely invasion history

scenario and identification of source populations. Further, those prior studies have

presented conflicting results of how genetic varation is partitioned globally, and

specifically whether genetic diversity is homogenous among native and invasive

populations (Bousset et al., 2014; 2004; Van Leeuwen et al., 2013). The primary

50

objective of this study was to address current gaps in our knowledge of the genetic

distribution of P. acuta by chacterizing range-wide population genetic and

phylogeographic patterns, and reconstruct its invasion history.

Apart from its remarkable distribution, P. acuta offers a unique lens to

understand host-parasite invasion dynamics, which are complex and largely

overlooked (Dunn, 2009; Kelly et al., 2009; Dunn and Hatcher, 2015). Physid snails

are important intermediate hosts to digenetic trematodes (Platyhelminthes, Digenea)

where they occur (Cichy et al., 2011; Gordy et al., 2016). More broadly, snails act as

first and second intermediate host to a large proportion of trematodes, over 10,000

species (Cribb et al., 2003). Despite the several papers discussing parasites in

invasive species, surprisingly little is known about how host population dynamics

might influence the invasion processes of their associated parasites (Kelly et al.,

2009; Dunn and Hatcher, 2015). Following invasion, host species are expected to

lose their associated trematode assemblages (Torchin et al., 2003) based on the

‘Enemy-Release hypothesis’ (Keane, 2002). This hypothesis posits that release of

regulation by natural enemies contributes to the rapid establishment of invasive

populations. It is also expected that invasive hosts may acquire a new indigenous

parasite assemblage within their invasive range. What shapes the assembly of the

new parasite community is unclear (Kelly et al., 2009). Here we measure P. acuta-

trematode species richness globally to test for release of digenetic trematodes within

invasive populations and secondarily test for correlations among trematode

infections and host population genetic parameters to identify factors that may be

relevant to host-parasite invasion, and discuss a framework to use these data to

being to model invasion dynamics.

51


Specimen collection

Physa acuta populations were sampled opportunistically, between 1998–

2015, to document the biodiversity of their trematode parasites. The specimens used

in this study were collected from across North America (native range) as well as

several invasive localities (locality details in Additional Files 1 & 2) and represent P.

acuta over a 17-year period (Figure 1).

Snails were collected primarily from the waters edge using a mesh sieve or

plucked from vegetation. The snails were first screened for trematode infection by

leaving an individual snail in the well of a cell culture plate submerged in artificial

spring water over night. Snails were considered infected upon visual conformation of

mobile trematode larva (cercariae) via a dissection microscope. The cercariae and

their snail hosts, as well as the uninfected snails, were isolated and stored in 95%

ethanol and deposited into the Museum of Southwestern Biology (MSB), Division of

Parasites (Additional Files 1 & 2).

To improve geographic sampling and ensure we were working with a

monophyletic species, specimens from this study were combined in phylogenetic

analyses with known P. acuta samples published in the NCBI GenBank sequence

database (Additional File 1). Sequences were published between 2004 –2016, from

both native and invasive populations. 159 physid sequences were downloaded and

included in this study.

DNA extraction and PCR amplification

A small piece of tissue was taken from the head foot of individual snails. DNA

was extracted using the E.Z.N.A. Mollusc DNA kit (Omega Biotek) following the

manufacture’s protocol.

52

We sequenced two mitochondrial DNA loci (cox1 and 16S) as they are the

most abundant genetic marker available in the NCBI database and have been used

successfully to recover population genetic variation within P. acuta (Wethington and

Guralnick, 2004; Wethington and Lydeard, 2007). We also sequenced a nuclear

locus (ITS1) to assess mito-nuclear discordance of the recovered subclades.

We sequenced 509 bases of cox1 gene using the universal primers,

LCO11490: 5’-GGTCAACAAATCATAAAGATATTGG-3’ and LCO2198: 5’-

TAAACTTCAGGGTGACCAAAAAATCA-3’ (Folmer et al., 1994) and 469 bp of 16S

rDNA using Brh: 5’–CCGGTCTGAACTCAGATCACGT-3’ and Arl: 5’–

CGCCTGTTTAACAAAAACAT -3’ (Palumbi, 1991). Additionally we sequenced the

complete (495 bp) ITS1 internal transcribed spacer region (ITS-1S: 5’-

CCATGAACGAGGAATTCC CAG–3’, 5.8AS: 5’ –TTAGCAAACCGACCCTCAGAC –

3’) of a subset of the P. acuta individuals chosen to represent the recovered

mitochondrial clades. Sequencing reactions were performed using the BigDye

sequencing kit 3.1 (Applied Biosystems, Foster City, California, USA). Sequences

were edited using Sequencher 5.3 (Gene Codes Corporation, Ann Arbor, MI, USA),

and then aligned using ClustalW (Larkin et al., 2007) and further aligned manually if

necessary. GBlocks (Castresana, 2000) was used to identify and remove difficult to

align regions present within both the ITS1 and 16S alignments. Sequences

generated during this study were submitted to GenBank under the accession

numbers MF694400-MF694492, MG001330-MG001338 (Additional Files 1 & 2). All

alignments used in this study were deposited into TreeBase (www.treebase.org).

Phylogenetic analyses

Phylogenetic analyses of Physa species were performed for the purposes of

determining the in-group in all subsequent phylogeographic and population genetic

53

analyses. Aplexa elongata was used as an out-group (Wethington and Lydeard,

2007). Physa phylogenetic datasets were analyzed separately as cox1 (509 bp), 16S

(611 bp) and cox1+16S (1,120 bp). Relatively few ITS1 (525 bp) sequences exist

within the NCBI database (Additional Files 1 & 2), and were therefore unable to be

used in a concatenated analyses of Physa species. The T92+G model of nucleotide

substitution was used to model the cox1, 16S, ITS1 datasets, and HKY+G was used

to model the cox1+16S dataset. Models were chosen based on the Akaike

information criterion (AIC, Akaike, 1974) using JModelTest2 (Darriba et al., 2012).

Phylogenetic analysis of Physa species did not recover a supported sister

clade for P. acuta, and so, Physa spelunca was chosen as an out-group based on

Wethington and Lydeard (Wethington and Lydeard, 2007) and was used to root

subsequent in-group analyses. Samples accessioned in NCBI and/or were identified

as P. acuta via BLASTn search but had a genetic distance greater than 5% (distance

between P. acuta and P. spelunca) were excluded from in-group analyses. In-group

analyses included 151 individual snails and were performed to evaluate

phylogeographic patterns within P. acuta. Each locus was treated as an independent

dataset and analyzed separately. Optimal models of nucletotide substitiution were

found to be the same per gene region as used for phylogenetic analysis of Physa.

Maximum Likelihood (ML), Minimum Evolution (ME) and Bayesian Inference

(BI) were preformed on each phylogenetic dataset. ME and ML analyses were

performed in the program PAUP* 4.0 (Swofford, 2003). One thousand bootstrap

replicates were preformed within each gene tree analysis to statistically assess the

resulting topologies.

Bayesian Inference (BI) was performed using the program MrBayes v. 3.2.6

(Ronquist and Huelsenbeck, 2003), consisting of two replicated runs for each locus

54

with four Markov chain Monte Carlo (MCMC) chains, one cold and three heated

chains. Each analysis ran for 10,000,000 generations and was sampled every 1000

generations. The analysis was terminated when the standard deviation of the split

frequencies was or fell below 0.01, supporting convergence. Likelihood parameters

and convergence between runs were assessed using the program Tracer v.1.6

(Rambaut et al., 2014), based on EES values greater than 200. The first 2,500 trees

from each analysis were discarded as burnin. Resulting phylogenetic trees were

visualized and manipulated using Fig Tree v. 1.3 (Rambaut and A. Drummond, 2009)

and MEGA 6 (Tamura, 2011).

Recovered topologies were statistically compared to a null phylogenetic

hypothesis (HO) using an approximately unbiased (AU) test (Shimodaira, 2002),

where per site likelihood scores were bootstrapped (10,000 replications) using the

program CONSEL (Shimodaira and Hasegawa, 2001) to generate p-values. To

robustly test the ‘single source’ hypothesis we constrained all invasive individuals as

monophyletic, with an Eastern USA origin (HO1), using the cox1 dataset. Secondly, to

test for mito-nuclear discordance within P. acuta, we constrained the ITS1 topology

for complete concordance with recovered mitochondrial topologies (HO2).

Constrained trees were created in Mesquite (Maddison and Maddison, 2015). Per

site likelihood scores were calculated in PAUP* (Swofford, 2003) .

Genetic diversity and population structure

To characterize range-wide population genetic diversity and structure we

grouped native populations according to the freshwater ecological complex (FWEC,

Abell, 2000) from which they were collected. FWECs are based on delineations of

freshwater ecoregions determined by fish distributions (Maxwell et al., 1995).

55

FWEC’s are a subset of ecoregions and are designated based on major habitat type

and biological distinctiveness. We sampled 8 of the 10 North American FWECs

(Abell, 2000). We selected between 2-10 individual P. acuta from each population to

be used for genetic analysis.

Genetic diversity summary statistics of P. acuta populations were estimated

using DNAsp v. 5 (Librado and Rozas, 2009) based on the cox1 and 16S gene

regions; number of unique haplotypes (h), number of segregating (polymorphic) sites

(S), average number of nucleotide differences (K), haplotype diversity (Hd),

nucleotide diversity (π) and Watterson’s estimator (Θw, per site) were calculated. The

dataset of 151 individual P. acuta cox1 sequences consisted of 88 unique

haplotypes. A minimum spanning network was constructed to view connections

among haplotypes using the program PopART (Leigh and Bryant, 2015),

http://popart.otago.ac.nz/). Relationships among haplotypes (185 bases) were also

evaluated using BI, to determine ancestral relationships among haplotypes.

Parameters for BI were identical to those used in analyses described previously.

To estimate overall range-wide genetic structuring of P. acuta (cox1) a one-

way Analysis of Molecular Variance test (AMOVA (Excoffier et al., 1992)) was

performed in Arlequin v. 3.5 (Excoffier and Lischer, 2010). Populations were

partitioned by five geographical regions (North America, Eurasia, South America,

Africa, and Australasia): ΦCT estimates variation among the five regions sampled,

ΦSC estimates variation among localities within the regions and ΦST estimates

variation from all samples across all localities sampled. A second AMOVA was

preformed to assess population genetic structure within the native range of P. acuta

partitioned by sampling localities and the eight FWECs sampled.

56

To further evaluate population genetic structure within P. acuta, pairwise ΦST

(Reynolds et al., 1983) values were estimated from the cox1 dataset. Significance of

ΦST values (p < 0.05) was determined by permutation tests of 10,000 random

permutations, calculated in Arlequin v. 3.5 (Excoffier and Lischer, 2010).

Pairwise uncorrected p-distances were calculated for cox1, 16S and ITS1

datasets within and between FWEC, countries within the invasive range, within and

between the invasive and native ranges, and within and between recovered clades

identified through MSN and phylogenetic analysis using MEGA 6 (Tamura, 2011).

Demographic analysis

We estimated changes in the effective population size (Ne) over time by fitting

a Bayesian Skyline demographic model (BSP, Drummond et al., 2005) for each

FWEC and/or geographic region, recovered clades and the total cox1 dataset in

*BEAST v. 1.7.0 (Drummond et al., 2012). The HKY substitution model was used for

two simultaneous MCMC runs for between 3,000,000 and 80,000,000 iterations

sampling between every 3,000 and 10,000 steps. Analyses were run using three

mutation rates of 1e-4 (0.04%), 1e-6 (1%) and 4e-6 (4%) per million year, chosen to

reflect a range of possible rates of cox1 evolution based on other gastropod systems

(Reid et al., 1996; Crandall et al., 2008; Panova et al., 2011; Harris et al., 2013).

Convergence was checked (ESS of 200 or greater) and results visualized using

Tracer v.1.6 (Rambaut et al., 2014). BSP data from each analyzed dataset generated

in Tracer v. 1.6 was exported and visualized in Microsoft Excel for comparison.

Invasion history and meta-analysis of the trematodes of P. acuta

In conjunction with the molecular data generated by this study, a literature

search was carried out to compile reports of P. acuta outside of North America.

57

ISI Web of Knowledge was searched for 1) all reports of P. acuta outside of North

America and 2) surveys of trematode assemblages of P. acuta within both its native

and invasive range. Data complied was published from 1805 up to the end of 2016,

and recovered using combinations of keywords; Physa acuta, Physa, Physella,

Costella, Haitia, trematode, parasites, invasive gastropod, malacological survey,

trematode survey and cercarial survey. Studies cited by recovered articles were also

included.

In total, the final dataset included 196 published reports of Physa acuta

outside of North America and 7 trematode surveys from the native range of P. acuta

and 15 within its invasive range. Physa acuta-trematode surveys carried out by the

authors for the purposes of this study were also added to the meta-dataset. From

each P. acuta–trematode survey, observed species richness (So) and prevalence

(pr, percentage of patent infections) were calculated. So is defined as the number of

different trematode species occurring within a surveyed host population (Poulin,

1998). Because of the difficulties associated with identifying larval trematodes a

conservative approach to calculating So was taken, ‘species’ richness was

determined by number of trematode families recovered. Consequently, reported

measures of So from the native range are likely underestimates (Gordy et al., 2016;

Laidemitt et al., 2017). Only patent infections, where trematode cercariae were

being shed, were considered as infected. Evidence of metacercaria (trematode

cysts) within P. acuta were not included as the relationships between trematodes

and invertebrate second intermediate hosts are generally less specific (Evans and

Gordon, 1983; McCarthy and Kanev, 1990). Genetic results from this study were

used to assign population parameters as regional estimates for each study used

within the meta-analysis. For example, population genetic estimates from African

58

populations were assigned to all P. acuta–trematode surveys undertaken in Africa.

Australasian samples were excluded from these analyses due to small sample size.

Estimates of haplotype diversity (Hd) and nucleotide diversity (π), were assigned as

population parameters. Time since invasion (tsi) was estimated by assigning each

surveyed population into an ‘invasion phase’ category: phase 4: < 80 years since

invasion, phase 3: 80-180 years since invasion, phase 2: 180-280 years since

invasion and phase 1: 280 + (native range). ‘Invasion phases’ were determined

based on published reports of P. acuta invasions and genetic evidence provided by

this study. Correlation analyses of So, tsi and pr with Hd, π, and Ɵ were evaluated

using Pearson’s correlation coefficient. Probability (p) values were adjusted for

multiple comparisons using both Bonferroni and Benjamini-Hochberg corrections

(Benjamini and Hochberg, 1995).

RESULTS


Cox1, 16S, 16S+cox1 and ITS1 gene tree analysis (Additional Files 3-6) of

Physa species demonstrates that samples included in this study form a clade with P.

acuta sequences published in the NCBI database (Additional Files 1&2), and

represent a single globally distributed species. All phylogenetic analyses failed to

resolve sister relationships to P. acuta, similar to the findings of Wethington and

Lydeard (Wethington and Lydeard, 2007).

In-group analyses demonstrate phylogenetic structuring (Figure 2, Additional

File 6) and revealed two clades, referred to hereafter as clade A and clade B.

Clades were moderately supported statistically for ME and ML analyses (cox1,

89/82; 16S, 89/88) though posterior probabilities from BI were strong (cox1, 1; 16S,

59

1). Clade A (n=123) is the largest, containing all invasive populations in addition to

populations recovered across the native range. While some individuals from clade A

and B were found sympatrically, clade B (n=26) was only recovered west of the

Rocky Mountains. Clades A and B were not recovered from the ITS1 phylogeny,

possibly suggesting mito-nuclear discordance (Additional File 5).

Phylogenetic analyses of the P. acuta in-group largely lacked resolution for

terminal nodes across all genes samples. We therefore employed approximately

unbiased topology tests to more robustly assess phylogenetic hypotheses. Using

this method we rejected the null hypotheses, of a single invasive origin (HO1, p= 2e-

7) and strict concordance of mitochondrial clades A and B within the ITS1 dataset

(HO2, p= 3e-5).


Indices of genetic diversity (cox1 and 16S) for each population sampled are

summarized in Table 1. In comparing native to invasive range, greater genetic

diversity (Hdnative = 0.97, Hdinvasive = 0.615; πnative = 0.0289, πinvasive = 0.0098) was

found within the native range. Haplotype diversity is consistently high among FWECs

sampled, often reaching 100% (Colorado, Coastal, Great Basin, Atlantic).

Within the cox1 and 16S datasets 88 and 43 unique haplotypes were

recovered, respectively. More genetic variability was recovered from the cox1

dataset and haplotype relationships were estimated by constructing a Minimum

Spanning Network (MSN; Figure 2A). The MSN corroborates the split of clades A

and B, however it also suggests that haplogroups may be further substructured.

FWEC’s do not appear to be a primary factor in shaping the genetic structure of P.

acuta. Clade A contains all of the invasive haplotypes. Many of the haplogroups

within clade A (I-V) are connected by haplotypes recovered from the Eastern United

60

States (Mississippi and Atlantic FWECs), indicating that these regions are likely a

source of invasions from the native range of P. acuta.

Clade B shows greater nucleotide diversity than clade A (even when invasive

haplotypes are removed, πCladeA= 0.019, πCladeB= 0.024). All haplotypes were

recovered from the Western United States (west of the Rocky Mountains). While

sampling is not sufficient to know if Clade B is truly geographically restricted, our

data suggests (1) clade B is a Western USA clade and (2) FWEC’s may play a

greater role in shaping western populations of P. acuta (Figure 2A, haplgroups VI

and VII).

Relationships among haplotypes were also examined using BI analysis

(Figure 2B). Haplotype relationships are identical to those observed from the MSN,

and the divergence of clade A and B is supported with 100% posterior probability.

Invasive haplotypes group with multiple source populations, from across the native

range. Together the MSN and BI analyses of haplotypes suggest that there have

been several distinct invasion events to the Eastern Hemisphere from multiple

sources across North America.

Overall population genetic structure of cox1 was evaluated by AMOVA (Table

2). Both range-wide and native-range AMOVA’s suggest a significant ΦCT (p<0.0001

and p<0.0001, respectively). In the native range 78.55% of genetic variation is

attributed to within population variation, indicating that overall FWEC’s, and the

biogeographic regions tested in general, are not important in structuring P. acuta

populations.

Pairwise uncorrected p-distances within and between populations of P. acuta

were calculated from the cox1 dataset (Table 3). Within the native range within

population genetic distance averages 0.0292 (~3%), relative to 0.0102 (~1%) within

61

the invasive range which are significantly lower (p=0.0006). Within population

genetic distances between the Western USA and Eastern USA (native range) vary

significantly (p=0.05), and average 0.0346 (~3.5%) and 0.022 (2.2%) respectively.

Overall western populations exhibit the highest within population genetic distances

while Africa and Asia demonstrate the lowest (x= 0.004, 0.4%).

Pairwise genetic distances and ΦST values were calculated (Table 3) and

assessed statistically (only significance values for ΦST are shown). The Mississippi

FWEC, the largest complex sampled, shows significant (p<0.05) genetic

differentiation from four of the six other FWECs (Rio Grande, Coastal, Colorado and

Atlantic) as well from Africa and Middle East. Similarly, the Atlantic FWEC shows

significant (p<0.05) genetic differentiation from four of the six other FWECs (Rio

Grande, Coastal, Colorado and Mississippi) as well from Europe, Australasia, Asia

and the Middle East.

Demographic and invasion history analyses

Bayesian Skyline Plots (Figure 3, Additional File 7) estimated changes in

effective population sizes over coalescent time. Results based on a 1% change per

million year rate of cox1 evolution (Figure 3) largely matched estimates using 0.04%

and 4% change per million year (Additional File 7). Regionally (Figure 3A) Ne is

greatest within North America and has been stable over the past 60,000 years.

Populations from the invasive range suggest much smaller effective sizes, congruent

with previous analyses of genetic diversity. Eurasian and African/Australasian

populations indicate a possible recent population expansion. When Clades A and B

are compared (Figure 3B), Clade A and the total P. acuta cox1 dataset suggests a

recent population decline which is likely an artifact of population subdivision. Heller

et al. (2013) showed subdivision can confound coalescent estimators of Ne and

62

result in an erroneous signal of population decline. There is no evidence (Figure 3C)

of population decline within the native range. There is evidence to suggest that

Clade B has recently undergone a demographic expansion (within the past 10,000

years), both clades A and B have comparatively similar contemporary Ne.

Invasion timeline and meta-analysis of the trematodes of P. acuta

Based on reports from the literature an invasion timeline is summarized in

Figure 4 (full bibliographic information can be found in Additional File 8). Findings

from this literature search informed subsequent time since invasion analysis.

Physa acuta – trematode surveys from both the native (n=7) and invasive

(n=15) range were compiled to estimate range-wide species richness (Table 4).

Average So within the native range (So = 3.25) was significantly greater (p=0.0016)

than within the invasive range (So = 0.3125). Western European (n=2) and Iranian

(n=1) populations of P. acuta were the only invasive populations surveyed where

patent infections were reported. Prevalence varied significantly (p=0.04) among

invasive (0.00319 %) and native ranges (0.2%). Variables were analyzed using

Pearson’s correlation coefficient (ρ), summarized in Table 5. All comparisons

between So, tsi, pr and the demographic variables (Hd, π, Ɵ) resulted in significant

unadjusted p-values, except for pr and Hd. To correct for multiple comparisons, p-

values were adjusted using BH and Bonferroni methods (Table 5). Following

adjustment, So, tsi and pr were found to significantly correlate with π and Ɵ (pBH=

0.003, pBH= 0.000, pBH= 0.033, respectively). π and Ɵ were found to have a

correlation coefficient of 1 (Table 5). There is a strong positive relationship between

tsi, π (ρ = 0.97) and So (ρ = 0.8) and a moderate correlation with pr (ρ = 0.57),

supporting the prediction that genetic diversity increases with time since invasion. In

total, these results suggest a significant relationship between demographic

63

parameters, namely background genetic variation, and the rate and diversity of

trematode infections.

DISCUSSION

Range wide population genetic patterns

Our results propose discordant population genetic patterns between the

native and invasive range of P. acuta. While haplotype diversity within the invasive

range is not low relative to other invasive snails, Melanoides tuberculata (Facon et

al., 2003), Haminoea japonica (Hanson et al., 2013) (within their invasive range), by

comparison there is an approximately 20% reduction in Hd relative to the native

range. Our analyses reveal that invasive populations have substantially less mtDNA

diversity relative to native populations (Table 1), a finding supported by numerous

studies of invasive gastropods (Facon et al., 2003; Hanson et al., 2013). Interestingly

however, this result is in contrast to recently published work on P. acuta. Bousset et

al. (Bousset et al., 2014) used 9 microsatellite loci to estimate range-wide patterns of

genetic diversity and reported no difference in neutral genetic variation between the

native and invasive ranges. These contradictory results are likely explained by the

fact that the Bousset et al.(2014) study was limited to five native populations, four of

the five were from the Eastern USA where many invasive haplotypes likely

originated. Consequently, Bousset et al.(2014) were unable to capture similar

amounts of genetic diversity revealed in this study. Discordance of mtDNA and

microsatellite data is not uncommon (Bayha et al., 2015) and both reveal aspects of

invasion history. Mitochondrial markers can often better detect subtle genetic

subdivision, due to reduced effective population size and lack of recombination

(Bayha et al., 2015; Larmuseau et al., 2010; Lukoschek et al., 2008). Consequently,

64

a genealogical approach utilizing mtDNA markers is frequently used to characterize

population genetic structure and identify source populations (Cristescu et al., 2001;

Facon et al., 2003; Hanson et al., 2013). Our findings based largely on mtDNA,

combined with those of Bousset et al. (2014) suggest P. acuta is overall a genetically

diverse species, relative to other invasive gastropods (Facon et al., 2003; Lounnas et

al., 2017; Städler et al., 2005). However, this study reports significant genetic

structuring within the native range and between some native and invasive

populations that has not been previously reported by other investigators. Further,

previously unknown mito-nuclear discordance (Figure 2, Additional Files 5 & 6)

suggests historical isolation followed by secondary contact has likely occurred

among native western and eastern populations.

Genetic structure within the native range and biogeographic considerations

The Eastern USA is hypothesized as the origin of all P. acuta (Bousset et al.,

2014; Dillon et al., 2002). Our data suggest that sampled genetic diversity is

comparable (marginally greater in Western USA) across the native range with

evidence of geographic structuring between the Eastern and Western USA

populations. Phylogenetic analyses suggest the existence of two clades (A & B)

within the native range; interestingly these clades are sympatric in the Western USA,

while clade B appears to be restricted to Western USA. Field surveys and

subsequent molecular analysis reveal that individuals belonging to clade A and/or B

can be collected side by side from the same water body in New Mexico, Colorado,

California and Nevada. Phylogenetic analysis (Additional Files 3-6) did not result in

sufficient resolution to reveal the geographic origin of P. acuta, however increased

sampling of western populations fails to support the Eastern origin hypothesis (Dillon

et al., 2002; Bousset et al., 2014; Lydeard et al., 2016). Several individuals (S94 &

65

S22) collected from California (Coastal FWEC) and one (S17) from New Mexico (Rio

Grande FWEC) were close matches genetically to P. acuta, but did not fall in the P.

acuta clade. Additionally the presumed sister species P. spelunca has only been

recovered from Wyoming (Turner and Clench, 1974) and did not have support as the

sister species to P. acuta from our analyses. Anecdotally, recent molecular genetic

studies of Physa (Rogers and Wethington, 2007; Gates et al., 2013; Moore et al.,

2015) may demonstrate a greater number of independent taxonomic units from

western waterways relative to the Eastern USA, suggesting that biogeographically

speaking, the west may have been important in physid diversification.

This study is the first to compare and assess discordance among nuclear and

mitochondrial markers within P. acuta. Discordance between ITS1 and mitochondrial

phylogenies could suggest incomplete lineage sorting, though more likely a recent

history of genetic exchange between once isolated populations. Clades A & B were

not recovered from the ITS1 gene tree (Additional File 5), and when the largely

unresolved ITS1 phylogeny was constrained to match the mitochondrial topology a

significantly (p=3e-5) worse phylogeny was recovered. Gene trees of the non-

recombining mitochondrial markers may suggest historical isolation between the

Western and Eastern USA. It may be hypothesized that the Rocky Mountains, or

associated waterways, have played a role in restricting gene-flow, which has been

shown relevant in other freshwater systems (Forister et al., 2004; Finn et al., 2006;

Hughes et al., 2009). It can also be hypothesized that anthropogenic dispersal within

North America or subsequent re-introduction from the invasive range into the

Western USA, has led to reticulation of the two clades (Turner, 2002), and

contemporary admixture within the Western USA. Another possible line of evidence

supporting this hypothesis is the recent discovery of two distinct mitochondrial

66

genomes, varying in size (Isolate A 14,490 vs Isolate B, 14,314 bp) and 37 indels,

collected from the same pond in New Mexico (Nolan et al., 2014). cox1, 16S and

ITS1 sequence from Nolan et al. (Nolan et al., 2014) was included in our

phylogenetic dataset and consistently parse out with clade A (Isolate A) and B

(Isolate B). At this time there has been no investigation into the biological relevance

or functional consequences of Isolate A versus B. Mitochondrial genome divergence

may in fact be a relic of once isolated populations conferring no functional

differences. The fact that invasive haplotypes have only been recovered from clade

A is an intriguing pattern warranting further investigations.

Invasion history of Physa acuta

Figure 4 summarizes records of P. acuta globally (see Additional File 8 for full

bibliographic information). These records, combined with population genetic

inference, lead to a hypothesized route of invasion. The first record of P. acuta

outside of North America was its initial description in France in 1805 (Draparnaud,

1805), over 200 years ago. It is hypothesized that these were the first founding

populations of P. acuta. Anderson (Anderson, 2003) was the first to posit that the P.

acuta discovered by Draparnaud (Draparnaud, 1805), in the Bordeaux region of

France, were introduced via the cotton trade from Mississippi USA during the 18th

century. Trade between France and the USA ceased during the Napoleonic wars

and began between USA and England, where records of P. acuta appear in the mid

1800’s (Forbes, 1853; Jeffreys, 1862). Western Europe (England and France) likely

maintained the first founding populations of P. acuta. However, in less than 100

years, populations were reported from Eastern Europe, Africa, Asia, South America,

the Middle East, the Caribbean, New Zealand and Australia. Prior studies have

suggested that the subsequent global invasion resulted from the spread of early

67

Western European colonizers (Anderson, 2003; Oscoz et al., 2010). If this was the

case we would expect 1) clustering of all invasive populations with Western

European haplotypes and 2) a stepping stone like model of haplotype relationships

(Reusch et al., 2010; Simon et al., 2011). This model was not supported by any of

the preformed population genetic analyses and further, an approximately unbiased

(AU, Shimodaira, 2002) topology test specifically rejected the monophyly of invasive

populations (p=2e-7).

Our data support that there have been multiple independent invasions into

Western Europe, likely from different sources (Figure 2). Data from this study

suggests that some European populations are closely allied with populations in Asia

and the Middle East and share the most common invasive haplotype, we infer that

this shared haplotype (Posada and Crandall, 2001) is related to the initial invasive

populations of P. acuta in Western Europe roughly 200 years ago, and has

subsequently spread east. It is more parsimonious to hypothesize that genetically

depauperate European populations expanded east than to assume that identical

haplotypes from a genetically diverse source (North America) founded three distinct

invasive regions.

Samples from Africa, South America and the Caribbean are related and are

likely the result of an independent invasion event, though it is currently not possible

to determine the directionality without more samples. Physa acuta invasions into

Africa have been more recent relative to European invasions. Extensive

malacological surveys across the African continent suggest the African invasion

occurred in the range of 1940-50’s, with populations reported from South Africa (De

Kock and Wolmarans, 1998; De Kock et al., 2002; Appleton, 2003), Namibia (Curtis,

1991), Morocco (Mohamed and Najat, 1998), Nigera (Fashuyi, 1990), and Kenya

68

(Brown, 1980). Records suggest a similar time frame for the South American and

Caribbean invasion (Paraense and Pointier, 2003; Collado, 2016). Surveys by

Albrecht et al. (2008) suggest that Lake Titicaca (Peru & Bolivia) was colonized 20

years ago.

Our data suggests haplotype connections between invasive populations and

individuals collected in the Western and Eastern USA and Canada. While our data

supports the initial invasions from the Southeastern USA to Western Europe, we also

find evidence of haplotype connections between the Coastal FWEC (California) and

the Middle East and Eastern Europe. Currently, based on our sampling it is unclear if

there are in fact Western source populations, or if this relationship is the result of the

re-introduction of invasive P. acuta from other continents into the Western USA. Our

data supports that all source populations have originated from Clade A, however, it

remains unclear if Western haplotypes of Clade A originated from the Eastern USA

or are the result of secondary contact from invasive populations, though these

scenarios are not mutually exclusive. Increased sampling within the western range is

necessary to fully elucidate the source of Clade A members recovered from the

Western USA. Founding events, within and from the native range, are likely the

result of the aquaria or aquatic plant trade as posited by multiple investigators

(Anderson, 2003; Appleton, 2003; Bousset et al., 2014; Hui Ng et al., 2015).

Host-Parasite invasion dynamics

Combining published reports of P. acuta occurrence with our genetic data we

found a significant relationship between genetic diversity (π and Ɵ) and trematode

prevalence (pr), and richness (SO). Nucleotide diversity (π) is a better measure of

background genetic variation than haplotype diversity, as it is more robust to the

stochastic effects of drift (Avise, 2000). Higher values of haplotype diversity relative

69

to nucleotide diversity were recovered from the invasive range suggesting rapid

expansion from founding populations (Avise, 2000).

We also found that time since invasion (tsi) significantly correlated with π, Ɵ

as well as pr and SO. Of all the invasive populations screened for trematodes and

included in this study there were only three reports of P. acuta shedding larval

trematodes (cercariae) within its invasive range (Table 4); France (Dreyfuss et al.,

2002), Spain (Toledo et al., 1998), Iran (Athari et al., 2006). Populations from

Western Europe (presumably the first invasive populations) and allied populations

from the Middle East have the greatest π of invasive populations sampled.

These data suggest that the rate and richness of trematode infection

increases positively with background genetic variation and time since invasion, and

leads to the prediction that over time as invasive P. acuta populations become more

genetically diverse their role in local trematode transmission will increase. Meta-

analysis was limited by population genetic sampling within the invasive range, which

will be necessary to more robustly model the relationship between genetic diversity

and trematode prevalence.

Overall results from meta-analyses support the ‘Enemy-Release’ hypothesis

(Keane, 2002; Torchin et al., 2003). There are numerous explanations for this within

the P. acuta – trematode system. Firstly, most founding populations likely consisted

of eggs or young snails, as common with the aquaria trade, and were therefore

uninfected. Secondly, there might be incompatibility among native parasites and

invasive host populations. An additional ecological explanation is that invasive P.

acuta populations often establish in highly modified habitats (i.e. drainage ditches,

man-made water-bodies (Anderson, 2003; Brackenbury and Appleton, 1993), which

may not be suitable to sustain a diversity of trematode lifecycles. As invasive

70

populations spread over time into a broader range of habitat types, one would expect

interaction with wildlife+trematode fauna to become more frequent with a greater

potential for native parasites to establish in P. acuta. For example, in countries such

as England and Germany, where the invasion history of P. acuta is well documented,

initial reports of P. acuta are from habitats such as botanical gardens that are known

to import aquatic vegetation, but less than a decade later, P. acuta is reported from

natural habitats (summarized by Vinarski, 2017).

Apart from directly hosting trematodes, invasive P. acuta populations might

play a role in diluting or enhancing transmission of indigenous parasites in several

ways. Physa acuta may act as a decoy host (Yousif et al., 1998; Chipev, 2009;

Munoz-Antoli et al., 2003) to indigenous trematode species, as it is an efficient

competitor to native snails often displacing them to become the dominant gastropod

within the community (Brackenbury and Appleton, 1993; Dobson, 2004). Dobson

(Dobson, 2004) showed that following its establishment in Mozambique, P. acuta

overtook Bulinus forskalii, a primary transmitter of human schistosomiasis

(Schistosoma hematobium), as the dominant snail. It has been shown experimentally

Schistosoma hematobium can infect P. acuta in Nigeria, though the parasite cannot

reach patency (Akinwale et al., 2011). There are also numerous reports of invasive

P. acuta acting as a reservoir for larval parasites, specifically as a second

intermediate host to trematodes. Similarly, non-host specific larvae of the invasive

nematode Angiostrongylus (=Parastrongylus) cantonensis were reported in Saudi

Arabia (Bin Dajem, 2009) and Egypt (Abo-Madyan et al., 2005) from P. acuta.

Host-parasite invasion dynamics are often underappreciated when

considering the impact of invasive species, especially when the associated parasites

are not causing notable pathology. Most commonly it seems hosts acquire a distinct

71

assemblage of indigenous parasites within their invasive range (Torchin et al., 2003)

over time, and the consequences to local transmission and biodiversity are not clear.

While the primary goal of this study was to characterize the population genetic

structure and invasion history of P. acuta, we aim to begin to use this system to

address the role of host demographics in the acquisition of local parasite

assemblages specifically, to identify potential predictors of parasite invasion success

for the purposes of modeling host-parasite invasion over time.

CONCLUSIONS

This study provides improved sampling of Physa acuta within its native range,

where mtDNA analyses reveal two phylogenetic clades (A & B) and previously

unknown population structure between the Eastern and Western USA. Increased

sampling of native populations allowed the estimation of the invasion history of P.

acuta. We report evidence for the occurrence of multiple independent invasion

events from different source populations across the USA and Eastern Canada. The

initial invasion into Western Europe occurred over 200 years ago, with more recent

invasions into the Southern Hemisphere (South America, Africa) occurring within the

last 20-80 years.

We also examined the relationship between tsi, pr, So and host-population

genetic parameters (Hd, π, Ɵ) to identify parameters of relevance for modeling host-

parasite invasion dynamics over time. We found a significant positive relationship

among π with trematode pr and So. These data suggest that, (1) host demographic

parameters might be integral in the assembly of parasite communities within invasive

host populations and (2) background genetic diversity may be an important

parameter to consider in future efforts to model host-parasite invasion dynamics.

72

Overall, our data supports predictions based on the ‘Enemy Release hypothesis’

(Keane, 2002; Torchin et al., 2003). Hosts, particularity snail intermediate hosts, are

substantially easier to sample and monitor over time and space relative to their

associated trematode assemblages and may prove a valuable and tractable tool to

model parasite invasion.

ACKNOWLEDGEMENTS

The authors would like to thank the following people for their help in the

collection and/or screening of the snails used in this study: Dr. Ramesh Devkota, Dr.

Ben Hanelt, Dr. Norm Davis, Ms. Martina Laidemitt, Mr. John Schlutz. The authors

would also like to thank Dr. Charles Criscione and three anonymous reviewers for

their helpful comments regarding this manuscript, and Dr. Thomas Turner for helpful

suggestions regarding data analysis. We acknowledge technical support from the

University of New Mexico Molecular Biology Facility, which is supported by National

Institutes of Health, USA grant P30GM110907 from the Institute Development Award

program of the National Center for Research Resources, USA. This work was

funded through a National Science Foundation, USA grant to SVB (DEB 1021427)

and a National Institutes of Health grant RO1 AI44913 to ESL.

REFERENCES

Abell, R.A., W.W.F., 2000. Freshwater Ecoregions of North America. Island Press. Abo-Madyan, A.A., Morsy, T.A., Motawea, S.M., Garhy, El, M.F., Massoud, A.M.A.,

2005. Spot light survey on fresh-water snails of medical importance in Al Fayoum Governorate, Egypt. J Egypt Soc Parasitol 35, 49–58.

Akaike, H., 1974. A new look at the statistical model identification. IEEE Trans.

Automat. Contr. 19, 716–723. doi:10.1109/TAC.1974.1100705

73

Akinwale, O.P., Kane, R.A., Rollinson, D., Stothard, J.R., Ajayi, M.B., Akande, D.O., Ogungbemi, M.O., Duker, C., Gyang, P.V., Adeleke, M.A., 2011. Molecular approaches to the identification of Bulinus species in south-west Nigeria and observations on natural snail infections with schistosomes. Journal of Helminthology 85, 283–293. doi:10.1017/S0022149X10000568

Albrecht, C., Kroll, O., Moreno Terrazas, E., Wilke, T., 2008. Invasion of ancient

Lake Titicaca by the globally invasive Physa acuta (Gastropoda: Pulmonata: Hygrophila). Biol Invasions 11, 1821–1826. doi:10.1007/s10530-008-9360-9

Anderson, R., 2003. Physella (Costatella) acuta Draparnaud in Britain and Ireland-its

taxonomy, origins and relationships to other introduced Physidae. Journal of Conchology.

Appleton, C.C., 2003. Alien and invasive fresh water Gastropoda in South Africa.

African Journal of Aquatic Science 28, 69–81. doi:10.2989/16085914.2003.9626602

Athari, A., Gohar-Dehi, S., Rostami-Jalilian, M., 2006. Determination of definitive and

intermediate hosts of cercarial dermatitis-producing agents in northern Iran. Arch Iran Med 9, 11–15.

Avise, J.C., 2000. Phylogeography. Harvard University Press. Bayha, K.M., Chang, M.H., Mariani, C.L., Richardson, J.L., Edwards, D.L., DeBoer,

T.S., Moseley, C., Aksoy, E., Decker, M.B., Gaffney, P.M., Harbison, G.R., McDonald, J.H., Caccone, A., 2015. Worldwide phylogeography of the invasive ctenophore Mnemiopsis leidyi (Ctenophora) based on nuclear and mitochondrial DNA data. Biol Invasions 17, 827–850. doi:10.1007/s10530-014-0770-6

Benjamini, Y., Hochberg, Y., 1995. Controlling the False Discovery Rate - a Practical

and Powerful Approach to Multiple Testing. Journal of the Royal Statistical Society Series B-Methodological 57, 289–300.

Bin Dajem, S.M., 2009. Freshwater snails in Asser region, Saudi Arabia with special

refernce to the zoonotic trematode. J Egypt Soc Parasitol 39, 551–557. Bousset, L., Henry, P.Y., Sourrouille, P., Jarne, P., 2004. Population biology of the

invasive freshwater snail Physa acuta approached through genetic markers, ecological characterization and demography. Molecular Ecology 13, 2023–2036. doi:10.1111/j.1365-294X.2004.02200.x

Bousset, L., Pointier, J.P., David, P., Jarne, P., 2014. Neither variation loss, nor

change in selfing rate is associated with the worldwide invasion of Physa acuta from its native North America. Biol Invasions 16, 1769–1783. doi:10.1007/s10530-013-0626-5

Brackenbury, T.D., Appleton, C.C., 1993. Recolonization of the Umsindusi river.

African Journal of Zoology.

74

Brown, D.S., 1980. Freshwater snails of Africa and their medical importance. Taylor and Francis.

Burch, J.B., 1989. North American freshwater snails. Malacological Publications,

Hamburg, Michigan. Castresana, J., 2000. Selection of conserved blocks from multiple alignments for

their use in phylogenetic analysis. Molecular Biology and Evolution 17, 540–552. doi:10.1093/oxfordjournals.molbev.a026334

Chipev, N.H., 2009. Decoy effect and host infection by miracidia within snail

communities. Parasitology 106, 265–276. doi:10.1017/S0031182000075089 Cichy, A., Faltýnková, A., Żbikowska, E., 2011. Cercariae (Trematoda, Digenea) in

European freshwater snails - a checklist of records from over one hundred years. Folia Malacologica 19, 165–189. doi:10.2478/v10125-011-0023-6

Clampitt, P.T., 1970. The comparative ecology of the snails Physa gyrina and Physa

integra (Basommatophora: Physidae). Malacologia 10, 113–151. Collado, G.A., 2016. Unraveling cryptic invasion of a freshwater snail in Chile based

on molecular and morphological data. Biodiversity and Conservation 26, 567–578. doi:10.1007/s10531-016-1255-y

Crandell, E.D., Frey, M.A., Grosberg, R.K., Barber, P.H., 2008. Contrasting

demographic history and phylogeographical patterns in two Indo‐Pacific

gastropods. Molecular Ecology 17, 611–626. doi:10.1111/j.1365-294X.2007.03600.x

Cribb, T., Bray, R., Olson, P., T.D., Littlewood, J., 2003. Life Cycle Evolution in the

Digenea: a New Perspective from Phylogeny, in: Advances in Parasitology Volume 54, Advances in Parasitology. Elsevier, pp. 197–254. doi:10.1016/S0065-308X(03)54004-0

Cristescu, M.E., 2015. Genetic reconstructions of invasion history. Molecular

Ecology 24, 2212–2225. doi:10.1111/mec.13117 Cristescu, M.E.A., Hebert, P.D.N., Witt, J.D.S., MacIsaac, H.J., Grigorovich, I.A.,

2001. An invasion history for Cercopagis pengoi based on mitochondrial gene sequences. Limnology and Oceanography 46, 224–229. doi:10.4319/lo.2001.46.2.0224

Curtis, B.A., 1991. Freshwater macro-invertebrates of Namibia. Madoqua 17, 164–

187. Darriba, D., Taboada, G.L., Doallo, R., Posada, D., 2012. jModelTest 2: more

models, new heuristics and parallel computing. Nature methods. De Kock, K.N., Wolmarans, C.T., 1998. A re-evaluation of the occurrence of

freshwater molluscs in the Kruger National Park. Koedoe 41, 1–8.

75

doi:10.4102/koedoe.v41i1.240 De Kock, K.N., Wolmarans, C.T., Preez, Du, L.H., 2002. Freshwater mollusc

diversity in the Kruger National Park: a comparison between a period of prolonged drought and a period of exceptionally high rainfall. Koedoe 45, 1–11. doi:10.4102/koedoe.v45i2.23

Dillon, R.T., Jr, Wethington, A.R., 2004. No-choice mating experiments among six

nominal taxa of the subgenus Physella (Basommatophora: Physidae). Heldia 69–78.

Dillon, R.T., Wethington, A.R., 2006. The Michigan Physidae revisited: A population

genetic survey. Malacologia 48, 133–142. Dillon, R.T., Wethington, A.R., Rhett, J.M., Smith, T.P., 2002. Populations of the

European freshwater pulmonate Physa acuta are not reproductively isolated from American Physa heterostropha or Physa integra. Invertebrate Biology 121, 226–234. doi:10.1111/j.1744-7410.2002.tb00062.x

Dobson, M., 2004. Replacement of native freshwater snails by the exotic Physa

acuta (Gastropoda: Physidae) in southern Mozambique; a possible control mechanism for Annals of Tropical Medicine & Parasitology.

Draparnaud, J.P.R., 1805. Histoire naturelle des mollusques terrestres et fluviatiles

de la France. Dreyfuss, G., Vignoles, P., Abrous, M., Rondelaud, D., 2002. Unusual snail species

involved in the transmission of Fasciola hepatica in watercress beds in Central France. Parasite 9, 113–120. doi:10.1051/parasite/2002092113

Drummond, A.J., Suchard, M.A., Xie, D., Rambaut, A., 2012. Bayesian

Phylogenetics with BEAUti and the BEAST 1.7. Molecular Biology and Evolution 29, 1969–1973. doi:10.1093/molbev/mss075

Drummond, A., Shapiro B. Ho, S. 2005. Bayesian Coalescent Inference of Past

Population Dynamics from Molecular Sequences. Molecular Biology and Evolution 22, 1185–1192.

Dunn, A.M., 2009. Chapter 7 Parasites and Biological Invasions, in: Natural History

of Host-Parasite Interactions, Advances in Parasitology. Elsevier, pp. 161–184. doi:10.1016/S0065-308X(08)00607-6

Dunn, A.M., Hatcher, M.J., 2015. Parasites and biological invasions: parallels,

interactions, and control. Trends in Parasitology 31, 189–199. Ellis, M.B., 1926. British Snails (1969 reprint). Claredon Press, Oxford.

doi:10.1016/S0007-1536(69)80174-9 Estoup, A., Guillemaud, T., 2010. Reconstructing routes of invasion using genetic

data: why, how and so what? Molecular Ecology 19, 4113–4130.

76

doi:10.1111/j.1365-294X.2010.04773.x Evans, N.A., Gordon, D.M., 1983. Experimental observations on the specificity of

Echinoparyphium recurvatum toward second intermediate hosts. Zeitschrift fur Parasitenkunde 69, 217–222. doi:10.1007/BF00926956

Excoffier, L., Lischer, H.E.L., 2010. Arlequin suite ver 3.5: a new series of programs

to perform population genetics analyses under Linux and Windows. Molecular Ecology Resources 10, 564–567. doi:10.1111/j.1755-0998.2010.02847.x

Excoffier, L., Smouse, P.E., Quattro, J.M., 1992. Analysis of molecular variance

inferred from metric distances among DNA haplotypes: application to human mitochondrial DNA restriction data. Genetics.

Facon, B., Pointier, J.-P., Jarne, P., Sarda, V., David, P., 2008. High Genetic

Variance in Life-History Strategies within Invasive Populations by Way of Multiple Introductions. Current Biology 18, 363–367. doi:10.1016/j.cub.2008.01.063

Facon, B., Pointier, J.P., Glaubrecht, M., Poux, C., Jarne, P., David, P., 2003. A

molecular phylogeography approach to biological invasions of the New World by parthenogenetic Thiarid snails. Molecular Ecology 12, 3027–3039. doi:10.1046/j.1365-294X.2003.01972.x

Fashuyi, S.A., 1990. Freshwater gastropod molluscs in Ondo State, Nigeria. J Afr

Zool 104, 165–170. Finn, D.S., Theobald, D.M., Black, W.C., Poff, N.L., 2006. Spatial population genetic

structure and limited dispersal in a Rocky Mountain alpine stream insect. Molecular Ecology 15, 3553–3566. doi:10.1111/j.1365-294X.2006.03034.x

Folmer, O., Hoeh, W.R., Black, M.B., Vrijenhoek, R.C., 1994. Conserved primers for

PCR amplification of mitochondrial DNA from different invertebrate phyla. Molecular Marine Biology and ….

Forbes, E., 1853. A history of British Mollusca and of their shells Vol. IV. John Van

Voorst, London. Forister, M.L., Fordyce, J.A., Shapiro, A.M., 2004. Geological barriers and restricted

gene flow in the holarctic skipper Hesperia comma (Hesperiidae). Molecular Ecology 13, 3489–3499. doi:10.1111/j.1365-294X.2004.02349.x

Gates, K.K., Kerans, B.L., Keebaugh, J.L., Kalinowski, S., Vu, N., 2013. Taxonomic

identity of the endangered Snake River physa, Physa natricina (Pulmonata: Physidae) combining traditional and molecular techniques. Conservation Genetics 14, 159–169. doi:10.1007/s10592-012-0439-6

Ghabooli, S., Shiganova, T.A., Zhan, A., Cristescu, M.E., Eghtesadi-Araghi, P.,

MacIsaac, H.J., 2011. Multiple introductions and invasion pathways for the invasive ctenophore Mnemiopsis leidyi in Eurasia. Biol Invasions 13, 679–690. doi:10.1007/s10530-010-9859-8

77

Gordy, M.A., Kish, L., Tarrabain, M., Hanington, P.C., 2016. A comprehensive

survey of larval digenean trematodes and their snail hosts in central Alberta, Canada. Parasitology Research 115, 3867–3880. doi:10.1007/s00436-016-5152-9

Hanson, D., Cooke, S., Hirano, Y., Malaquias, M.A.E., Crocetta, F., Valdés, Á., 2013.

Slipping through the Cracks: The Taxonomic Impediment Conceals the Origin and Dispersal of Haminoea japonica, an Invasive Species with Impacts to Human Health. PloS ONE 8, e77457. doi:10.1371/journal.pone.0077457

Harris, D.J., Ferreira, A.F., De Frias Martins, A.M., 2013. High levels of mitochondrial

DNA diversity within oxychilid land snails (subgenus Drouetia Gude, 1911) from São Miguel island, Azores. J Molluscan Stud 79, 177–182. doi:10.1093/mollus/eyt009

Heller, R., Chikhi, L., Siegismund, H.R., 2013. The Confounding Effect of Population

Structure on Bayesian Skyline Plot Inferences of Demographic History. PloS ONE 8, e62992. doi:10.1371/journal.pone.0062992

Hughes, J.M., Schmidt, D.J., FINN, D.S., 2009. Genes in Streams: Using DNA to

Understand the Movement of Freshwater Fauna and Their Riverine Habitat. BioScience 59, 573–583. doi:10.1525/bio.2009.59.7.8

Hui Ng, T., Kiat Tan, S., Yeo, D.C.J., 2015. Clarifying the identity of the long-

established, globally-invasive Physa acuta Draparnaud, 1805 (Gastropoda: Physidae) in Singapore. BioInvasions Records 4, 189–194.

Jarne, P., Delay, B., 1991. Population genetics of freshwater snails. Trends in

Ecology & Evolution 6, 383–386. doi:10.1016/0169-5347(91)90158-T Jeffreys, J.G., 1862. British Conchology. Van Voorst, London. Keane, R., 2002. Exotic plant invasions and the enemy release hypothesis. Trends

in Ecology & Evolution 17, 164–170. doi:10.1016/S0169-5347(02)02499-0 Kelly, D.W., Paterson, R.A., Townsend, C.R., Poulin, R., Tompkins, D.M., 2009.

Parasite spillback: A neglected concept in invasion ecology? Ecology 90, 2047–2056. doi:10.1890/08-1085.1

Kerney, M.P., 1976. Atlas of the non-marine Mollusca of the British Isles.

Conchological Society of Great Britain and Ireland and the Biological Records Centre, Huntingdon.

Laidemitt, M.R., Zawadzki, E.T., Brant, S.V., Mutuku, M.W., Mkoji, G.M., Loker, E.S.,

2017. Loads of trematodes: discovering hidden diversity of paramphistomoids in Kenyan ruminants. Parasitology 144, 131–147. doi:10.1017/S0031182016001827

Larkin, M.A., Blackshields, G., Brown, N.P., Chenna, R., 2007. Clustal W and Clustal

78

X version 2.0. Larmuseau, M.H.D., Raeymaekers, J.A.M., Hellemans, B., Van Houdt, J.K.J.,

Volckaert, F.A.M., 2010. Mito-nuclear discordance in the degree of population differentiation in a marine goby. Heredity 105, 532–542. doi:10.1038/hdy.2010.9

Leigh, J.W., Bryant, D., 2015. popart: full‐feature software for haplotype network

construction. Methods in Ecology and Evolution 6, 1110–1116. doi:10.1111/2041-210X.12410

Librado, P., Rozas, J., 2009. DnaSP v5: a software for comprehensive analysis of

DNA polymorphism data. Bioinformatics. Lounnas, M., Correa, A.C., Vázquez, A.A., Dia, A., Escobar, J.S., Nicot, A., Arenas,

J., Ayaqui, R., Dubois, M.P., Gimenez, T., Gutiérrez, A., González Ramírez, C., Noya, O., Prepelitchi, L., Uribe, N., Wisnivesky Colli, C., Yong, M., David, P.,

Loker, E.S., Jarne, P., Pointier, J.P., Hurtrez Boussès, S., 2017. Self‐fertilization,

long‐distance flash invasion and biogeography shape the population structure of

Pseudosuccinea columella at the worldwide scale. Molecular Ecology 26, 887–903. doi:10.1111/mec.13984

Lozek, V., 1964. Quartarmollusken der Tschechoslwakie Rozpravy ustredniho.

Ustavu geolickeho 31, 1–374. Lukoschek, V., Waycott, M., Keogh, J.S., 2008. Relative information content of

polymorphic microsatellites and mitochondrial DNA for inferring dispersal and population genetic structure in the olive sea snake, Aipysurus laevis. Molecular Ecology 17, 3062–3077. doi:10.1111/j.1365-294X.2008.03815.x

Lydeard, C., Campbell, D., Golz, M., 2016. Physa acuta Draparnaud, 1805 Should

be Treated as a Native of North America, Not Europe. Malacologia 59, 347–350. doi:10.4002/040.059.0213

Maddison, W.P., Maddison, D.R., 2015. Mesquite: a modular system for evolutionary

analysis. Version 3.04. 2015. Maxwell, J.R., Edwards, C.J., Jensen, M.E., Paustian, S.J., Parrott, H., Hill, D.M.,

1995. A Hierarchical Framework of Aquatic Ecological Units in North America (Nearctic Zone).

Mohamed, F., Najat, M., 1998. Co-occurrence de Physa acuta Draparnaud et

vecteurs intermédiaires de la bilharziose au Maroc. Riv Idrobiol 37, 169–177. Monsutti, A., Perrin, N., 1999. Dinucleotide microsatellite loci reveal a high selfing

rate in the freshwater snail Physa acuta. Molecular Ecology 8, 1076–1078. Moore, A.C., Burch, J.B., Duda, T.F., 2015. Recognition of a highly restricted

freshwater snail lineage (Physidae: Physella) in southeastern Oregon: convergent evolution, historical context, and conservation considerations.

79

Conservation Genetics 16, 113–123. doi:10.1007/s10592-014-0645-5 Munoz-Antoli, C., Trelis, M., Gozalbo, M., Toledo, R., Haberl, B., Esteban, J.G.,

2003. Interactions related to non-host snails in the host-finding process of Euparyphium albuferensis and Echinostoma friedi (Trematoda : Echinostomatidae) miracidia. Parasitology Research 91, 353–356. doi:10.1007/s00436-003-0968-5

Nolan, J.R., Bergthorsson, U., Adema, C., 2014. Physella acuta: atypical

mitochondrial gene order among panpulmonates (Gastropoda). Journal of Molluscan Studies, 80, 388-399.

Oscoz, J., Tomás, P., Durán, C., 2010. Review and new records of non-indigenous

freshwater invertebrates in the Ebro River basin (Northeast Spain). Aquatic Invasions 5, 263–284. doi:10.3391/ai.2010.5.3.04

Palumbi, S., 1991. simple fool's guide to PCR. Panova, M., Blakeslee, A.M.H., Miller, A.W., Mäkinen, T., Ruiz, G.M., Johannesson,

K., André, C., 2011. Glacial History of the North Atlantic Marine Snail, Littorina saxatilis, Inferred from Distribution of Mitochondrial DNA Lineages. PloS ONE 6, e17511. doi:10.1371/journal.pone.0017511

Paraense, W.L., Pointier, J.-P., 2003. Physa acuta Draparnaud, 1805 (Gastropoda:

Physidae): a study of topotypic specimens. Memórias do Instituto Oswaldo Cruz 98, 513–517. doi:10.1590/S0074-02762003000400016

Perrin, N., 1986. The life history parameters of Physa acuta (Gastropoda, Mollusca)

in experimental conditions. Revue Suisse Zoologique 93, 725–736. Pip, E., Franck, J.P.C., 2008. Molecular phylogenetics of central Canadian Physidae

(Pulmonata: Basommatophora). Canadian Journal of Zoology 86, 10–16. doi:10.1139/Z07-112

Posada, D., Crandall, K., 2001. Intraspecific gene genealogies: trees grafting into

networks. Trends in Ecology & Evolution 16, 37–45. Poulin, R., 1998. Comparison of three estimators of species richness in parasite

component communities. Journal of Parasitology 84, 485–490. Rambaut, A., Drummond, A., 2009. FigTree v1. 3.1. Rambaut, A., Suchard, M., Xie, D., Drummond, A., 2014. Tracer v1. 6 http://beast.

bio. ed. ac. uk. Reid, D.G., Rumbak, E., Thomas, R.H., 1996. DNA, Morphology and Fossils:

Phylogeny and Evolutionary Rates of the Gastropod Genus Littorina. Phil. Trans. R. Soc. Lond. B 351, 877–895. doi:10.1098/rstb.1996.0082

Reusch, T.B.H., Bolte, S., Sparwel, M., Moss, A.G., Javidpour, J., 2010.

80

Microsatellites reveal origin and genetic diversity of Eurasian invasions by one of the world’s most notorious marine invader, Mnemiopsis leidyi (Ctenophora). Molecular Ecology 19, 2690–2699. doi:10.1111/j.1365-294X.2010.04701.x

Reynolds, J., Weir, B.S., Cockerham, C.C., 1983. Estimation of the coancestry

coefficient: basis for a short-term genetic distance. Genetics. Rogers, D.C., Wethington, A.R., 2007. Physa natricina Taylor 1988, junior synonym

of Physa acuta draparnaud, 1805 (Pulmonata: Physidae). Zootaxa. Ronquist, F., Huelsenbeck, J.P., 2003. MrBayes 3: Bayesian phylogenetic inference

under mixed models. Bioinformatics 19, 1572–1574. doi:10.1093/bioinformatics/btg180

Sax, D., Kinlan, B., Smith, K., 2005. A conceptual framework for comparing species assemblages in native and exotic habitats. OIKOS 108, 457–464.

Say, T., 1817. Conchology. In: William Nicholson. American Edition. British

Encyclopedia, Philadelphia. Sebastián Escobar, J., Epinat, G., Sarda, V., David, P., 2007. No correlation

between inbreeding depression and delayed selfing in the freshwater snail Physa acuta. Evolution 61, 2655–2670. doi:10.1111/j.1558-5646.2007.00223.x

Shimodaira, H., 2002. An Approximately Unbiased Test of Phylogenetic Tree

Selection. Systematic Biology 51, 492–508. doi:10.1080/10635150290069913 Shimodaira, H., Hasegawa, M., 2001. CONSEL: for assessing the confidence of

phylogenetic tree selection. Bioinformatics 17, 1246–1247. Simon, A., Britton, R., Gozlan, R., van Oosterhout, C., Volckaert, F.A.M., Hänfling,

B., 2011. Invasive cyprinid fish in Europe originate from the single introduction of an admixed source population followed by a complex pattern of spread. PloS ONE 6, e18560. doi:10.1371/journal.pone.0018560

Städler, T., Frye, M., Neiman, M., Lively, C.M., 2005. Mitochondrial haplotypes and

the New Zealand origin of clonal European Potamopyrgus, an invasive aquatic snail. Molecular Ecology 14, 2465–2473. doi:10.1111/j.1365-294X.2005.02603.x

Stelfox, A.W., 1911. Lists of land and freshwater molluscs of Ireland. Proceedings of

the Royal Irish Academy 29B, 65–164. doi:10.5962/bhl.title.111171 Swofford, D.L., 2003. PAUP*: phylogenetic analysis using parsimony (*and Other

Methods), version 4.0, Sinauer Associates. Sunderland Massachusetts, USA. doi:10.1234/12345678

Tamura, K.E.A., 2011. MEGA5: Molecular Evoluionary Genetic Analysis Using

Maximum Likelihood, Evolutionary Distance, and Maximum Parsimony Methods. Molecular Biology and Evolution 28.

Taylor, D.W., 2003. Introduction to Physidae (Gastropoda: Hygrophila);

81

biogeography, classification, morphology. Rev. Biol. Trop. Te, G.A., 1978. A Systematic Study of the Family Physidae (Basommatophora:

Pulmonata). Doctor of Philosophy Dissertation. University of Michigan. Ann Arbor.

Toledo, R., Munoz-Antoli, C., Perez, M., Esteban, J.G., 1998. Larval trematode

infections in freshwater gastropods from the Albufera Natural Park in Spain. Journal of Helminthology 72, 79–82. doi:10.1017/S0022149X00016473

Torchin, M.E., Lafferty, K.D., Dobson, A.P., McKenzie, V.J., 2003. Introduced

species and their missing parasites. Nature. Turner, G.F., 2002. Parallel speciation, despeciation and respeciation: implications

for species definition. Fish and Fisheries 3, 225–229. doi:10.1046/j.1467-2979.2002.00085.x

Turner, R.D., Clench, W.J., 1974. A new blind Physa from Wyoming with notes on its

adaptation to the cave environment. The Nautilus. Van Leeuwen, C.H.A., Huig, N., Van der Velde, G., Van Alen, T.A., Wagemaker,

C.A.M., Sherman, C.D.H., Klaassen, M., Figuerola, J., 2013. How did this snail get here? Several dispersal vectors inferred for an aquatic invasive species. Freshwater Biology 58, 88–99. doi:10.1111/fwb.12041

Vinarski, M.V., 2017. The history of an invasion: phases of the explosive spread of

the physid snail Physella acuta through Europe, Transcaucasia and Central Asia. Biol Invasions 19, 1299–1314. doi:10.1007/s10530-016-1339-3

Welch, R.J., 1930. Foregin Physa, Ards, County Down. Irish Naturalists Journal 3,

91. Wethington, A.R., Guralnick, R., 2004. Are populations of physids from different hot

springs distinctive lineages? American Mala. Bulletin Wethington, A.R., Lydeard, C., 2007. A molecular phylogeny of Physidae

(Gastropoda: Basommatophora) based on mitochondrial DNA sequences. J Molluscan Stud 73, 241–257. doi:10.1093/mollus/eym021

Yousif, F., el-Emam, M., el-Sayed, K., 1998. Effect of six non-target snails on

Schistosoma mansoni miracidial host finding and infection of Biomphalaria alexandrina under laboratory conditions. J Egypt Soc Parasitol 28, 559–568.

82

Figure 1. Map of sampled populations. Colors denote the Freshwater Ecological

Complexes from which P. acuta populations were collected.

84

Figure 2. Relationships of recovered cox1 haplotypes. A. Minimum spanning

network of 88 P. acuta haplotypes. The network is shaded to depict the split between

clade A (pink) and B (green), within each clade haplogroups are denoted as I –VII.

B. BI Phylogeny of all 88 haplotypes. Nodes with a posterior probability of ≥ 95% are

denoted by a black circle. Haplotypes are colored by the FWEC they were collected

from.

86

Figure 3. Bayesian Skyline Plots. Effective size over time plots estimated in

BEAST using a Bayesian Skyline prior using a mutation rate of 1% (1e-6) per million

years. Mean values are shown and confidence values were excluded for clarity. The

x-axis indicates time in ‘thousand years ago’ (kya). A. Range-wide estimates for

North America (dark grey, n=79), Central and South America (lime green, n=13),

Eurasia (pink, n=49) and Africa and Oceania (blue, n=7). North America dataset ran

for 50,000,000 generations, Eurasia 20,000,000 generations, Central/South America

and Africa/Australasia ran for 5,000,000 generations. B. Estimates of recovered

Clades, Clade A (aqua, n=116) and B (dark green, n=33) compared to total (light

grey, n=149). The total dataset and Clade A ran for 80,000,000 generations, Clade B

ran for 10,000,000 generations. C. Estimates by FWECs sampled: Rio Grande (red,

n=16), Coastal (blue, n=13), Colorado (purple, n=11), Atlantic (orange, n=9),

Mississippi (green, n=26), the Great Basin and St. Lawrence FWECs were excluded

because of low sample size. All FWEC datasets were run for 5,000,000 generations,

with the exception of Atlantic (3,000,000). Bayesian skyline plots were constructed in

TRACER, the data was exported and visualized using Excel.

87

Figure 4. Invasion timeline of Physa acuta. 1. Absence of Physa acuta shells from

European fossil deposits older than 18th Century (Lozek, 1964). 2. Described by

Draparnaud (Draparnaud, 1805) near Bordeaux, France. Anderson (Anderson,

2003) posits likelihood of introduction from Mississippi USA via the cotton trade. 3.

Trade between USA and France ends during Napoleonic wars, trade with England

and USA begins. 4. First reports of P. acuta in England (Forbes, 1853; Jeffreys,

1862). 5. Reports of P. acuta all over United Kingdom by the latter half of 20th

Century (Ellis, 1926; Kerney, 1976; Stelfox, 1911; Welch, 1930) 6-12. Primary

citations for these reports are listed in Additional File 7.

88

Region/Population FWEC N H Hd S K Π Θw

Native Range

USA

Gila River, AZ COL 3

Denver Area, CO COL 2

Fremont Co., CO COL 2

Chaffee Co., CO COL 1

Gafield Co., CO COL 1

Mesa Co., CO COL 1

Rio Blanco Co., CO COL 1

Yuma Co., CO COL 1

Total 12 11 0.98 54 17.16 0.0337 0.035

Woodward Park, CA COA 8

Los Banos WMA, CA COA 2

Coyote Creek, CA COA 3

Total 13 13 1 69 18.45 0.0363 0.044

New Harmony, IN MIS 2

Okoboji Lake, IA MIS 1

Reynolds County, MO MIS 1

Medicine Lake, MN MIS 1

Bench Creek Pond, MT MIS 10

Mormon Lake, NE MIS 12

Big Horn River, WY MIS 1

Stillwater, OK MIS 5

Total 24 21 0.989 86 13.93 0.02736 0.0453

Stillwater NWR, NV GRB 2

Total 2 2 1 20 20 0.0393 0.0393

Carson Nat. Fr., NM RIO 3

89

Bosque Del Apache, NM RIO 9

Shady Lakes, NM RIO 2

Bitter Lake, NM RIO

Total 13 12 0.987 49 14.65 0.0278 0.029

Philadelphia, PA ATL 2 Charles Towne Landing SP,

SC ATL 7

Total 9 9 1 33 10.58 0.021 0.024

Canada

Point Peele NP, ON STL 1

Niagra River, ON STL 3

Total 4 3 0.833 14 8.167 0.016 0.015

NR Total 73 68 0.973 45.29 14.74 0.0289 0.033

Invasive Range

Cuba IR 3

Chile IR 10

Lake Titicaca, Peru IR 1

C&S AM

Total 14 6 0.604 13 2.879 0.0056 0.008

Kisumu, Kenya IR 4

AF Total 4 3 0.833 5 2.5 0.00493 0.005

France IR 4

Greece/Macadonia IR 23

Netherlands IR 1

EU Total 28 7 0.696 35 8.132 0.016 0.0177

New Zealand IR 1

Australasia IR 2

NZ/OZ 3 3 1 9 6 0.0118 0.012

90

Total

South Korea IR 1

Thailand IR 1

Singapore IR 3

Maylasia IR 3

AS Total 7 2 0.286 6 1.714 0.0034 0.005

Iraq IR 2

Iran IR 12

MD Total 14 7 0.813 29 8.66 0.017 0.018

IR Total 70 28 0.615 16.16 4.98 0.0098 0.011

Global

Total 143 96 0.794 30.725 9.86 0.0193 0.023

Table 1. Summary of range-wide population statistics, cox1. Regional abbreviations: NR, native range, IR, invasive range, C&S AM, Central and South America, AF, Africa, EU, Europe, NZ/OZ, New Zealand and Australia, MD, Middle East, FWEC refers to Freshwater Ecological Complexes; COL = Colorado FWEC, COA = Coastal FWEC, MISS = Mississippi FWEC, GRB = Great Basin FWEC, RIO = Rio Grande FWEC, ATL = Atlantic FWEC and STL = St. Lawrence FWEC. Population statistic abbreviations: N, number of individuals sampled, H, number of haplotypes, Hd, haplotype diversity, S, segregating sites, K, average sequence divergence, π, nucleotide diversity, Θw, Wattersons estimator per site, Italicized numbers refer to population averages. (*) Indicates a statistically significant value (P<0.05).

91

Source of Variation d.f. %

Variation Fixation indices

p value

Range Wide

Among Regions 6 3.19 ΦCT= 0.093 0.183

Among Populations within Regions 28 27.3 ΦSC = 0.282 < 0.001

Within Populations 110 69.52 ΦST= 0.305 < 0.001

Native Range

Among Regions 6 4.27 ΦCT= 0.043 0.228

Among Populations within Regions 14 19.18 ΦSC = 0.20 < 0.001

Within Populations 55 76.55 ΦST= 0.235 < 0.001

Table 2. Analysis of Molecular Variance

92

1 2 3 4 5 6 7 8 9 10 11 12 13

1. Rio Grande 0.03 0.0673 0.0167 0.1571 0.2818 0.17422 0.0706 0.2668 0.2396 0.2926 0.377 0.2613 0.0288

2. Coastal 0.0366 0.0386 0.05412 0.08 0.1557 0.0269 0.2006 0.1841 0.1509 0.1573 0.2607 0.129 -0.0085

3. Colorado 0.0338 0.0398 0.0363 0.1694 0.3058 0.1857 0.0897 0.3418 0.24643 0.35611 0.4045 0.3038 0.0623

4. Mississippi 0.34 0.0364 0.0387 0.0288 0.0969 0.01138 0.022 0.0983 0.0745 0.00036 0.245 0.0662 -0.0125

5. Atlantic 0.0356 0.0364 0.0418 0.0283 0.0214 0.0773 0.2032 0.1869 0.17405 0.1216 0.0944 0.1189 0.0199

6. St. Lawrence 0.0295 0.0305 0.0348 0.0241 0.0211 0.0166 0.1199 0.0586 0.2199 0.2518 0.4667 -0.006 -0.0158

7. Great Basin 0.031 0.0328 0.0346 0.0327 0.0337 0.0281 0.0333 0.2469 0.2587 0.4986 0.4948 0.2333 -0.1357

8. Europe 0.0298 0.0325 0.0366 0.0251 0.023 0.0175 0.0288 0.0165 0.1726 0.0994 0.3923 0.0291 0.0932

9. Australasia 0.031 0.035 0.0373 0.025 0.022 0.0186 0.0311 0.0184 0.012 0.4158 0.6129 0.1178 -0.0355

10. Asia 0.0249 0.027 0.0318 0.017 0.0143 0.0116 0.0233 0.012 0.01 0.003 0.7128 0.0567 0.13

11. Africa 0.0343 0.036 0.0414 0.0277 0.016 0.02 0.0327 0.0221 0.02 0.01375 0.005 0.383 0.2029

12. Middle East 0.0317 0.0332 0.0378 0.0258 0.0228 0.0178 0.031 0.0181 0.019 0.0124 0.0228 0.0187 0.06245

13. S. & C. America 0.0311 0.0323 0.038 0.0243 0.0146 0.0173 0.0286 0.019 0.0174 0.0103 0.0056 0.0195 0.0058

Table 3. Pairwise genetic distances and ΦST values. Pairwise within and between FWEC/region genetic distances are shown in the lower diagonal. Within genetic distances are italicized. Pairwise ΦST values are shown in the upper diagonal, values with a p-value ≤0.05 are bolded.

93

Country Citation # Individuals

Surveyed # Patent

Infections Prevalence So

Native Range

New Mexico (Bosque del Apache) This study 1,200 78 0.065 5

New Mexico (Eagles Nest) This study 65 5 0.07 2

Nebraska This study 120 16 0.13 4

Montana This study 165 3 0.018 2

Wyoming This study 26 8 0.31 1

Colorado This study 300 5 0.017 3

Mexico Barragán-Sáenz et al. 2009 496 109 0.22 5

Invasive Range

New Zeland Mitchell & Leung 2015 810 0 0 0

Benin Ibikounlé et al. 2009 345 0 0 0

Czech Republic Faltýnková 2005 57 0 0 0

Egypt Abo-Madyan et al. 2005 na 0 0 0

Egypt Bin Dajem 2009 704 0 0 0

Egypt Dahesh & Farid na 0 0 0

France Gerard et al. 2003 413 1 0.0024 1

Germany Faltýnková and Hass 2006 141 0 0 0

Iceland Skinnerson et al. 2008 737 0 0 0

Iran Athari et al. 2006 3,560 8 0.0022 1

Kenya Loker & Laidemitt, unpublished data 589 0 0 0

Morocco Laamrani et al. 2005 na 0 0 0

New Zeland This study 1,480 0 0 0

Spain Toledo et al. 1998 2,717 1 0.00037 1

Zambia Phiri et al. 2007 9 0 0 0

94

Table 4. Reports of infection and trematode species richness of Physa acuta as first intermediate. na, data not given, SO, observed species richness calculated by the number of unique trematode families observed.

95

SO tsi pr Hd π Ɵ

SO 0.8 0.77 0.54 0.76 0.77

tsi 0.0025 0.57 0.46 0.97 -0.98

pr 0.0039 0.032* 0.44 0.55 0.56

Hd 0.0614 0.06 0.096 0.5 0.5

π 0.003 0 0.033* 0.061 1

Ɵ 0.003 0 0.033* 0.061 0

Table 5. Matrix of correlation coefficients. Pearson’s correlation coefficients are shown in the upper diagonal and corresponding p-values, adjusted using Benjamini-Hochberg (BH) correction, are shown in the lower diagonal. p-values ≤0.05 are bolded. *Indicates p-values that significant under the BH correction, but not significant under the more conservative Bonferroni correction.

96

CHAPTER III

Comparative microevolutionary patterns of congeneric trematode species reveal importance of host ecology in parasite evolution

AUTHORS: Erika T. Gendron (Ebbs), D’Eldra Malone, Eric S. Loker, Norm E. Davis, Sara V. Brant ABSTRACT

Identifying factors that shape microevolutionary forces in natural populations

is a fundamental goal of evolutionary biology. In multi-host parasite systems

identification of these factors can be confounded by disparate host ecologies and

evolutionary histories. One approach to teasing apart the relative influence of

ecology verses evolutionary history on observed microevolutionary patterns is to

compare congeners, which are assumed to have evolved under similar

immunological constraints. This research evaluates comparative population genetic

patterns across three congeneric Trichobilharzia species, sampled range-wide, to

determine ecological factors important in shaping parasite genetic diversity, genetic

effective size and gene flow. As adults Trichobilharzia spp. infect anatids (ducks,

geese and swans) and then use freshwater snails (Physidae and Lymnaeidae) as

intermediate hosts. Additionally Trichobilharzia survey data across 73 anatid species

is presented from which measures of host specificity were estimated, in an effort to

characterize anatid-Trichobilharzia host associations. We found higher levels of host

specificity than expected based on published experimental work, possibly mediated

by host ecology. Further comparative population genetic investigations revealed

substantial differences in the population structure and genetic diversity of the three

species of interest. In total, results from this study shed light on how specific host

97

ecological traits impact parasite distribution, demography and microevolutionary

processes.

INTRODUCTION

Identifying factors that shape microevolutionary forces in natural populations is a

fundamental goal of evolutionary biology (Slatkin, 1985). In multi-host helminth

systems very little is known about what factors contribute to or determine gene flow,

genetic drift and effective size (Ne), (Nadler, 1995; Criscione et al., 2005). These

parameters relate directly to the evolution of drug resistance (Blouin et al., 1995),

local adaption (Dybdahl and Lively, 1996; Nuismer and Gandon, 2009), probability of

host-switching (Hoberg and Brooks, 2008) and ultimately speciation of parasite

lineages (Huyse et al., 2003). Considering the parasitic lifestyle is ubiquitous

(Weinstein and Kuris, 2016), this lack of knowledge represents a significant gap in

our understanding of microevolutionary processes within natural populations.

In parasite systems microevolutionary forces are mediated by one or more

host(s) and relate largely to the ecology of the individual host species (Nadler, 1995;

Criscione and Blouin, 2004; Criscione et al., 2005; Nieberding et al., 2006; Whiteman

et al., 2007; Barrett et al., 2008). From these studies and others it is acknowledged

broadly that host traits (i.e. life-history, phylogenetic history, host range, host vagility)

determine parasite genetic structure (Gorton et al., 2012; Blasco-Costa and Poulin,

2013).

Yet, it is unclear how parasite species partition themselves among hosts with

overlapping geographic and ecological ranges. Specifically, it is unknown to what

extent subtle ecological differences among closely related, sympatric and/or

parapatric, host species impact microevolutionary forces. This scenario facilitates

98

encounter between the parasite species and a broad range of compatible hosts,

creating an arena of potential host-parasite interactions. Under these conditions

generalism for at least one life cycle stage might be expected, where the parasite

species utilizes the range of hosts available to it. Alternatively, strict specialization

may develop where a parasite species can only exploit a narrow range of hosts. A

third alternative, though not mutually exclusive, can be predicted, where parasite

species might develop ecological specificity to a host species or a subset of possible

host species, such that there is a reduction in realized host range due to predictable

host ecological traits or behaviors. Our definition of ecological specificity is similar to

that of ‘faux specialists’ proposed by Brooks and McLeenan (2002), though we are

specifically considering parasites whose range is narrowed by the ecology of one or

more host species. Like ‘faux specialists’, under a model of ecological specificity

parasite species may maximize the short-term gains of specialization without

compromising the long-term advantages of generalism (Hoberg and Brooks, 2008).

In terms of population structure, ecological specificity might act to reduce parasite

gene flow by narrowing infections to a subset of actual hosts among a broad range

of potential host species, leading to genetic differentiation and population genetic

patterns that co-vary with realized host range (Nadler, 1995; Poulin and Keeney,

2008; Archie and Ezenwa, 2011).

This research sought to ask how host ecological traits impact parasite

microevolution and to characterize host-parasite associations (generalists,

specialists, ecological specialists) when parasite species co-occur with a broad

ecological range of compatible hosts. To achieve this we took a comparative

population genetic approach among congeneric parasite species. Comparing

congeneric species is ideal as it is assumed that species evolved under similar

99

immunological and evolutionary constraints (Dawson et al., 2002; Benton 2009).

Consequently, microevolutionary differences observed are therefore likely to result

from ecological interrelationships.

This research focuses on species within the genus Trichobilharzia

(Schistosomatidae), specifically three North American taxa within the species

complex known as Clade Q (sensu Brant and Loker 2009). As adults, these worms

develop and reproduce sexually in a duck definitive host (Anatidae) and release

parasite eggs in their feces. A free-swimming larval stage (miracidium) hatches from

the egg to find the freshwater snail (Pulmonata) intermediate host where asexual

amplification occurs. Free-swimming larvae (cercariae) are released from the snail to

find a duck host, thus completing the life cycle. Trichobilharzia is a globally

distributed, species rich genus which infects a broad ecological and taxonomic range

of definitive anatid hosts (ducks, geese and swans) (Brant and Loker, 2009; 2013).

Observational (Blair and Islam, 1983; Brant and Loker, 2009; Jouet, 2009) and

experimental (McMullen and Beaver, 1945; Horak et al., 1999) data largely suggest

duck host use is not constrained by physiological and/or immunological filters,

suggesting a generalist association with anatid hosts. However, surveys in

combination with molecular systematic data (Brant and Loker, 2009; Ebbs et al.,

2016) suggest some Trichobilharzia-host associations appear more specialized than

expected based on host compatibility alone. Results from field collections show that

Trichobilharzia species often preferentially infect certain duck species or duck

ecological groups. Here we compare phylogeographic, population genetic and

demographic patterns of three North American congeners where with differing

patterns of duck host use; T. physellae (TP), T. querquedulae (TQ), and

Trichobilharzia sp. A (TA).

100

We sampled TP, TQ and TA across the ranges of their hosts. TP occurs across

North America and is primarily associated with diving ducks, an ecological group of

ducks (e.g. Aythya, Bucelphala, Mergus) characterized by their preference of large

stable water bodies and diving feeding behavior (Baldassarre and Bolen, 1984). TQ

occurs globally infecting a genus of dabbling ducks, Spatula (Gonzalez et al., 2009)

specific to shallow water bodies. Based on current sampling, the host range of TA

(Brant and Loker, 2009) seems limited relative to TQ and TP, and thus far has been

recovered only from the American wigeon (Anas americana), which is described as a

generalist dabbling duck (Johnson and Greir, 1988).

Importantly, TP and TQ both utilize Physa spp. (Physidae) as their snail

intermediate host, which unites these parasites in space, time and in contact with a

similar sampling of duck host species. Physa spp. are abundant among different

habitats across North America, and parts of South America (Wethington and

Lydeard, 2007). One species, P. acuta is globally invasive occurring on 6 of the 7

continents (Bousset et al., 2014; Ebbs et al. In press). Physa spp. are also more

likely to be found in the preferred habitat of the duck host than not and thus

increases their probability of transmission. TA utilizes Stagnicola elodes

(Lymnaeidae), which is more restricted ecologically and geographically relative to

Physa, and achieves highest densities at higher latitudes (or higher elevations)

within North America. Generally, within digenetic trematodes there is a pattern of

greater specificity in regards to the first intermediate host (snail), which seems to

consistent within Trichobilharzia (Brant and Loker, 2009; Jouet, 2010). As such this

study will focus on adult worms and their associations among duck host species and

ecological groups.

101

We surveyed Trichobilharzia spp. extensively within North America and some

Southern Hemisphere localities to assess duck host associations and evaluate

potential impacts on observed population genetic and demographic patterns.

Additionally, we discuss the microevolutionary consequences associated with

different levels of ecological specificity, specifically in relation to Trichobilharzia

persistence and diversification.

METHODS Host-Parasite Survey

Duck hosts were sampled globally (Table 1, Additional File 1). For the

purposes of this study the authors examined 346 avian, primarily anatid, hosts

(Table 1). Additionally, we compiled results from several published Trichobilharzia –

duck surveys to more robustly calculate host-range and make determinations of host

specificity (Table 1). Combined survey (this study + published) data totaled 1,358

examined birds, across 94 species (73 anatids) and 7 countries. From these data we

calculated several descriptive measures to capture duck host associations within

Trichobilharzia: prevalence, the proportion of infected hosts (Bush et al., 1997),

observed host range, the number of host species infected by a parasite species and

several specificity indices were calculated. As it can be assumed that parasites

capable of infecting a broad taxonomic range tend towards generalism, relative to

those infecting a single host genus the STD measures the taxonomic distinctness of

all hosts species used by a single parasite species (Poulin and Mouillot, 1999). As

rare hosts may disproportionately contribute a high STD (increased generalism) we

also used the weighted specificity index (STD*) (Poulin and Mouillot, 2005). STD* is

weighted by the parasites prevalence within each host. As members of

Trichobilharzia almost exclusively parasitize hosts within the family Anatidae, total

102

taxonomic distinctiveness among hosts is limited and these measures fail to capture

the potential for ecological specificity, as such we developed a modified specificity

index (STD-modified). Based on the Poulin and Mouillot (2005) index, we distinguished

anatid hosts by ecological group rather than taxonomic group. Ecological groups

were assigned following determinations from The Sibley Guide to Birds (Sibley,

2000). We approximated the degree of ecological specificity, calculated as the

proportion of infections within each ecological group. Intensity and consequently

abundance are important parameters and are included in most attempts to quantify

specificity (Poulin and Mouillot 2005). Due to inherent difficulties of sampling

Trichobilharzia infrapopulations it is not feasible to obtain accurate measures of

intensity, as it is unlikely that entire infrapopulations are ever recovered and intact

worms are rare. As such, our measures are limited in this way.

To assess microevolutionary impacts of host specificity, correlation between

measures of specificity and species wide estimates of nucleotide diversity (π) and Θ

was tested by calculating Pearson’s correlation coefficients, as implemented in R

(http://www.R-project.org).

Hosts were either donated by hunters or obtained from the Museum of

Southwestern Biology, Bird Division (MSB) at the University of New Mexico

Albuquerque. All work with vertebrate hosts was conducted with the approval of the

Institutional Animal Care and Use Committee (IACUC) at the University of New

Mexico, USA (IACUC # 11- 100553-MCC, Animal Welfare Assurance # A4023-01).

Species of Trichobilharzia are parasites of the venous system and primarily reside in

the mesenteric and hepatic portal veins. Mesenteric veins were inspected for adult

worms with the aid of a dissecting microscope, and were removed using Vanna’s

microscissors. Adult worms were recovered by perfusing the hepatic portal vein with

103

saline and then crushing the liver. Worms were then isolated in a series of

decantation steps. Trichobilharzia samples were preserved in 95% ethanol for

genetic and 80% ethanol for morphological assessment. In addition to the

schistosome species recovered from the anatid hosts, co-occurring parasites (liver,

kidney, heart and gastrointestinal tract) were also collected. All samples were

deposited as vouchers in the MSB, Division of Parasites (Additional File 1).

DNA Extraction, PCR Amplification and Sequencing

Trichobilharzia DNA was extracted using the QIAmp DNA Micro Kit (Qiagen,

Valenicia, California, USA), the DNeasy Blood and Tissue Kit (Qiagen, Valenicia,

California, USA) or by HotShot Lysis (Truett et al., 2000). We amplified two

mitochondrial and one nuclear gene region using primarily the Takara Ex Taq kit

(Takara Biomedicals, Otsu, Japan). For samples that were difficult to amplify, we

used either the GoTaq Flexi (Promega) or the Platinum Taq kit (Invitrogen) using 0.4

ul of Taq and 4ul of 2.5 mM MgCl2 per reaction. We sequenced a 743 bp (5’ end)

region of the cytochrome oxidase I gene (cox1), a 409 bp (5’ end) region of the

NADH 4 gene (nad4) and 733 bp of the internal transcribed spacer region 1 (ITS1,

including the 3’ end of 18S rRNA and the 5’ end of 5.8S). PCR protocols and primers

used were identical to those used by Brant and Loker (2009) (cox1, ITS1) and Ebbs

et al. (2016) (nad4).

Sequencing reactions were performed using the BigDye 3.1 sequencing kit

(Applied Biosystems, Foster City, California, USA). Sequences were edited using

Sequencher 5.3 (Gene Codes Corporation, Ann Arbor, MI, USA) and aligned using

ClustalW (Larkin et al., 2007) and adjusted manually as needed. Sequences

generated from this study are accessioned in the NCBI Gen Bank database.

Phylogenetic Analyses

104

To evaluate intraspecific relationships and population structure phylogenetic

analyses of Clade Q (sensu Brant and Loker, 2009) were carried out. Phylogenetic

datasets were analyzed by gene (cox1, nad4, ITS1) and concatenated (cox1+ nad4

+ITS1). Mitochondrial genes (cox1 and nad4) are well suited for intraspecific studies

as there is no recombination and consequently have a higher sorting rate(Avise,

1987). Part of the nuclear rRNA complex, ITS1 was chosen to evaluate potential

mito-nuclear discordance. Appropriate models of nucleotide substitution were

selected using JModelTest2 (Darriba et al., 2012)based on the Akaike information

criterion (AIC (Akaike, 1974)).

Pairwise uncorrected p-distances were calculated in MEGA 6 (Tamura et al.,

2013)within and between the three species of Trichobilharzia to determine the in-

group for all subsequent intra-specific analyses. A cut off of ≤5% divergence for cox1

was chosen to delineate each in-group. In-group datasets included; TQ ncox1= 63,

nnad4=41, TP ncox1= 27, nnad4=14, TA ncox1= 12, nnad4=9.

We assessed haplotype relationships in our mitochondrial genes for the in-

group of TP, TQ and TA using minimum spanning network analysis in the program

POPart ((Leigh and Bryant, 2015) http://popart.otago.ac.nz/). Haplotypes were coded

by migratory flyway and host species. Migratory flyways are common way of

partitioning bird populations (Swanson et al., 1985) and their symbionts (Pearce et

al., 2009; Lam et al., 2012; Muñoz et al., 2013). Four North America flyways (Pacific,

Central, Mississippi and Atlantic) have been defined; each were sampled for adult

Trichobilharzia for this study. This study chose to focus primarily on adult worms, as

they represent the point of gene flow within the Trichobilharzia life cycle. However,

cercarial stages of TP and TA were included in some analyses to increase sample

size. Unique haplotypes differed by at least one base pair. All samples collected

105

outside of North America were collected from the Southern Hemisphere and were

pooled together because of the small sample size.


To estimate the genetic diversity and population genetic structure of the TP,

TQ and TA infrapopulations, samples were grouped by the state or province the host

was collected from and then regionally by the migratory flyway from which the host

was collected. Indices of genetic diversity for each species and their respective

populations were estimated in DNAsp v. 5 (Librado and Rozas, 2009) for both cox1

and nad4; number of polymorphic sites (S), average number of nucleotide

differences (K) and nucleotide diversity (π). Uncorrected p-distances were calculated

between flyways, regions and host species in Arlequin 3.5 (Excoffier and Lischer,

2010)

One-way AMOVAs (Excoffier et al., 1992) were performed in Arelquin v. 3.5

(Excoffier and Lischer, 2010) to estimate overall population genetic structure (cox1).

A set of population genetic hypotheses was tested for each species. (1) Where

infrapopulations were grouped by host locality, and then regionally by flyway. For the

TQ dataset AMOVAs were run both with the inclusion and exclusion of Southern

Hemisphere populations. (2) We tested for the effect of host species on population

structure. (3) We tested for the effect of latitude by separating populations into high

vs. low latitude groups rather than the longitudinal groups designated by flyway. ΦST

estimates variation from all samples across all localities sampled, ΦCT estimates

variation among flyways, host species, or latitudinal group and ΦSC estimates

variation among localities within the flyways, host species, and latitudinal groups. We

also estimated pairwise ΦST (Reynolds et al., 1983) by locality, flyway and host

106

species. Significance (P<0.05) was determined by permutation tests of 10,000

random permutations.

To test for isolation by distance patterns we constructed a geographic

distance matrix by converting geographic coordinates to Euclidean distances

between localities as implemented in Primer 7 (Clarke and Gorley, 2015). Correlation

between geographic distances and both uncorrected p-distances and pairwise ΦST

matrices were calculated using Spearman’s rank correlation also in Primer 7.

Demographic analyses

To assess contemporary and historical demographic patterns, Watterson’s

estimator (Θw) and Tajima’s D (D), were calculated (cox1) and assessed statistically

using coalescent simulations with a 95% confidence interval and 10,000

permutations (Table 1) in DNAsp (Librado and Rozas, 2009).

Changes in Ne over time were estimated by fitting a Bayesian Skyline

demographic model (BSP ( Drummond, et al., 2005)) for each of the three species of

interest based on cox1 *BEAST v. 1.7.0 (Drummond et al., 2012). The HKY

substitution model was used for two simultaneous MCMC runs for 10,000,000

iterations sampling every 1,000 steps. Mutation rates of 2% and 4% change per

million year were used to estimate mitochondrial genome evolution for schistosomes

(Schistosoma mansoni, (Morgan et al., 2005)). As substantial divergence within TA,

between the two flyways it was recovered from (Pacific and Central), was found

these populations were analyzed separately. Convergence was checked (ESS of

200 or greater) and results visualized using Tracer v.1.5 (Rambaut et al., 2014

Tracer v1.6. http://beast.bio.ed.ac.uk/Tracer). BSP data from each analyzed datasets

generated in Tracer v. 1.6 was exported and visualized in Microsoft Excel for

107

comparison.

Genetic Diversity of Trichobilharzia

Genus wide genetic diversity was estimated for the purposes of assessing the

relationship between diversity (π, K and Θw) and measures of host specificity. The

cox1 sequences of other Trichobilharzia species published in the NCBI database

were used to estimate phylogenetic relationships (TN93+G+1) and patterns of

genetic diversity across the genus, using methods described previously.

Anserobilharzia brantae and Allobilharzia visceralis were selected as out groups

(Brant and Loker, 2013). Pairwise uncorrected p-distances were calculated within

and between each species in MEGA 6 (Tamura et al., 2013).

RESULTS

Trichobilharzia survey data

Schistosomes from a total of 1,358 birds were included in this study.

Specimens representing Trichobilharzia were only recovered from hosts within the

family Anatidae. Based on our examinations and those within the literature we found

464 hosts (out of 1,358, 34.2%) to be infected with at least one species of

Trichobilharzia. Co-infections were common, (Table 1), and were probably

underestimated as not all individuals were assessed genetically. Of the 73 anatid

species examined, 29 were found to be infected with Trichobilharzia (Table 1)

Using three different measures of host specificity, we found that TQ, TA, T.

stagnicolae, T. mergi, and T. anseri all showed evidence of duck host specificity (STD

values of 1). Using conventional indices based on taxonomic distinctiveness (Poulin

and Mouillot, 1999; 2005) TP and T. regenti had intermediate to high measures of

108

STD, indicating generalism. When a modified indexing method was applied to capture

ecological distinctiveness, TP has a lower STD-modified value while T. regenti reached

the maximum value (STD-modified = 3, despite having a fewer number of observed host

species. It is important to note that STD and STD* were calculated under the

recommendations of (Poulin and Mouillot, 1999; 2005) and only incorporate two

taxonomic levels, consequently STD values can only vary between 1 and 2, where

two is maximum generalism. The STD-modified value vaired across four ecological

groups (divers, dabblers, sea ducks, geese/swans) and can vary between 1 and 4,

therefore the STD-modified of TP is moderate. Only STD was calculated for T. franki as

prevalence values were ambiguously reported due to co-infection with other

Trichobilharzia spp. and could not be included within these calculations. Further

there are known cryptic lineages within the T. franki complex (Jouet et al., 2010),

which could skew our measure of host specificity, for these reasons we did not make

any determinations regarding host associations within T. franki.

Approximating ecological specificity as the proportion of infections occurring

within a single duck ecological group, we determined 6 species to have ecological

specificity (TQ, TP, TA, T. stagnicolae, T. mergi, and T. anseri), as over 90% of their

infections were associated with one duck species or ecological group, while T.

regenti was found to be a generalist among anatids. It is likely that T. szidati also

falls within this category, based on species reports, however a lack of published

prevalence data (from duck hosts) did not allow its inclusion within these

calculations. We estimate that 93%, 100% and 100% of TP, TQ and TA,

respectively, infections occur within a single duck ecological group, and

consequently utilize a narrow selection of their potential host range (Anatidae). The

underlying mechanisms of this observed specificity are yet to be determined and will

109

require experimental infections to confirm the physiological boundaries of

Trichobilharzia host use. Several undescribed Trichobilharzia lineages resulted from

our survey data but were excluded from our calculations of host range and ecological

specificity due to low sampling.

For the species of interest, our data supports that TP infects multiple genera

of diving ducks (Aythya, Bucephala, Mergus) and was recovered from 8 species

within 5 genera. The highest prevalence’s were recorded from Aythya (A. affinis,

27%, A. collaris, 26%, A. valisineria, 20%), which were determined to be core host

species, as 93% of all TP infections were found within these three host species

(Bush et al., 1997). The lowest prevalence values were found within Anas

platyrhynchos (12.5%), Clangula hyemalis (10%), Mergus merganser (10%),

Bucephala albeola (7.7%), and Anas strepera (2.8%), which were determined to be

satellite (Bush et al., 1997) host species. In concordance with previous studies

(Brant and Loker, 2009; Ebbs et al., 2016), TQ was found almost exclusively (98.3%)

from Spatula, or the ‘blue-wing’ duck group (Johnson and Sorenson, 1999), with a

single report (2.7%) from an American wigeon (Anas americana). Prevalence was

highest within Spatula discors (90%), but all Spatula species examined were infected

at a rate of ≥74%. Trichobilharzia sp. A was recovered exclusively (100%) from the

American wigeon (Anas americana), having the narrowest host range of the three

species, with a prevalence 27%. Anas americana was found to harbor the highest

Trichobilharzia species diversity of any of the host species examined, 6

Trichobilharzia species were recovered, compared to an average of 1.5

Trichobilharzia species per host species within North America (1.8 per host species

globally).

110

Correlation of observed host range, indices of host specificity and species

wide estimates of genetic diversity (π) and Θ was evaluated by calculating Pearson’s

correlation coefficients. There was no correlation with observed host range and π (R

= -0.165) or Θ (R=0.147). All indices of host specificity were at least moderately

supported with π (R, STD= -0.571; R, STD*= -0.4995; R, STD-modified = -0.6077) and to a

lesser extent Θ (R, STD= -0.4375; R, STD*= -0.329; R, STD-modified = -0.4424).

Suggesting that ecological specialists were correlated with higher values of π and Θ.

Phylogeographic patterns among congeners

TRICHOBILHARZIA QUERQUEDULAE: Phylogenetic analysis of TQ

supports its global distribution (Ebbs et al. 2016, Figure 1) within Spatula.

Mitochondrial data suggests that several individuals (W345.3, W750.2 and W771,

~4.7% divergent) fall basal to the main TQ clade (Figure 1, Additional File 3).

Genetic distances were low enough to support the inclusion of these samples within

TQ in-group analyses, however this subclade may warrant further investigation as a

putative cryptic species, or divergent subpopulation. Interestingly, all individuals were

recovered from S. clypeata and primarily from northern latitudes. Apart from the

three samples in question, minimal phylogenetic structure was observed within TQ

with no pattern suggesting structure by geography or host use based on either ML or

BI analyses (Figure 1, Additional Files 3-5).

Minimum spanning networks (Figure 2) of cox1 revealed high amounts of

haplotype diversity within TQ, suggesting genetically diverse and well-connected

populations. Infrapopulations (within host) haplotype diversity was similar to

component population (across hosts) haplotype diversity, suggesting infrapopulation

recruitment occurs randomly over time and space (Nadler, 1995; Sire et al., 2001).

TQ haplotypes did not partition according to flyway, and Southern Hemisphere

111

haplotypes did not group together and were not more or less divergent than Northern

Hemisphere haplotypes. No evidence of genetic structure in association with host

species by was found. An AMOVA testing for structure by latitude was found to be

significant, indicating possible population genetic differentiation between breeding

and wintering range.

TRICHOBILHARZIA PHYSELLAE: Two clades (TP1, TP2) were recovered

within TP based on cox1 analysis (Figure 1), taxa grouped within each subclade for

nad4 and cox1 + nad4 + ITS1 analyses (Additional Files 3-5), but subclades were

not supported statistically. Despite limited geographic sampling, representation

within the two subclades might suggest a distinction between eastern and western

populations of TP. Similar to TQ, minimum spanning networks of cox1 suggest

genetically diverse and well-connected populations (Figure 2). For TP two

haplogroups were recovered, equivalent to clades TP1 and TP2 in the mitochondrial

gene tree analyses. Haplotypes within TP1 were recovered from 3 of the 4 flyways.

TP2 was also recovered 3 of the 4 flyways, however 12/16 individuals were

recovered from the Central flyway. Networks were additionally coded by high versus

low latitude and host species, and host species, which provided no structure to

haplotype relationships. An AMOVA testing for structure by flyway was found to be

significant, indicating population genetic differentiation in association with migratory

flyway.

TRICHOBILHARZIA SP. A: Mitochondrial and concatenated datasets support

the monophyly of TA and an affinity to group with T. franki and Trichobilharzia sp. B

(Additional File 5). However, ITS1 analysis (Additional File 4) suggests that TA is

paraphyletic with TP, T. franki, and Trichobilharzia sp. B. This result could suggest

mito-nuclear discordance within the TA dataset that was not found within either TP or

112

TQ. A single specimen (W249) grouped with support within Trichobilharzia sp. C,

rather than TP in cox1 (Figure 1). Geographical sampling was too limited to draw

phylogeographic inferences for a minimum spanning network of TA haplotypes.

No supported sister group relationships within Clade Q were found. BI of

mtDNA supported Trichobilharzia sp. B as sister to Trichobilharzia sp. A, and both

lineages infect American wigeon (Anas americana), though the snail host to

Trichobilharzia sp. B is currently unknown. This however was not found in the

analysis of ITS1 or for the concatenated dataset, cox1+nad4+ITS1. The cox1

analysis showed a South American Trichobilharzia lineage (W701) transmitted by a

physid snail (Pinto et al., 2014) as a well-supported sister clade to T. physellae,

however this relationship was not found in the ITS1 gene tree (Figure 1, Additional

File 4). No gene tree supported T. regenti or any other Trichobilharzia lineage as the

root of Clade Q (Figure 4).

Comparative population genetic structure

TRICHOBILHARZIA QUERQUEDULAE: Hierarchal AMOVA was used to test

multiple hypothesis of population genetic structure (Table 3). When structure by

flyway was tested, ΦSC (among populations within flyways) and ΦST (within

populations) were found to be marginally significant (p= 0.0528 ± 0.00619 and p=

0.0439 ± 0.00594, respectively) while ΦCT was found to be non-significant indicating

population structure is not mediated by migratory flyway. A second AMOVA was

performed excluding non-North American populations, to determine if Southern

Hemisphere populations were driving observed structure. Results from this analysis

(results not shown) were concordant with the total AMOVA. Instead of flyways,

populations were partitioned by latitudinal group (high vs. low) as a proxy for genetic

structure associated with breeding vs. wintering range. Analyses including (ΦCT=

113

0.0441, p= 0.00196) and excluding (ΦCT= 0.0072, p=0.0332, results not shown)

Southern Hemisphere populations support latitude in structuring TQ populations.

Further significant population structure was found at all levels (Table 3) when latitude

was considered. No significant structure by host species was found. Pairwise ƟST

values among flyways are summarized in Additional File 9. When all populations

within a flyway were pooled no significant differentiation between flyway was found

within TQ. However, all North American flyways were found to be distinct from the

Southern Hemisphere populations. Pairwise ƟST between localities within flyways

and by host species were also measured (results not shown) which identified TQ

collected from Manitoba and New Zealand as the most distinct populations.

Interestingly, TQ populations collected from different host species (Spatula clypeata

vs. S. cyanoptera) from the same locality (New Mexico) were found to be

significantly distinct (p=≤0.01). A Spearman rank test was performed and correlation

between geographic distance and both pairwise ƟST and uncorrected p-distance was

found to be weak (ρ= -0.11 and ρ= 0.002, respectively) suggesting no relationship

between geographic distance and genetic diversity/structure.

TRICHOBILHARZIA PHYSELLAE: AMOVA by flyway indicated significant

differentiation among flyways was found (ΦCT= 0.55592, p= 0.02737) (Table 3),

supporting the population genetic hypothesis that flyways structure TP populations.

When populations were grouped according to latitudinal group no significant

population genetic structure was observed. When TP individuals were pooled by

host species they were collected from and then partitioned by host genera a

significant ΦST was recovered (p= 0.00293), however, neither the ΦSC nor ΦCT were

significant suggesting no real influence of host species. The TP dataset is more

limited in terms of sample size, yet significant differentiation was found between

114

several flyways (Additional File 9). Pairwise ΦST between localities within flyways and

by host species were also measured (results not shown) which identified that TP

recovered from New Mexico were distinct from both Alaskan (ƟST= 0.2952, p<0.001)

and Michigan (ΦST= 0.24159, p<0.001) populations. The Mississippi and Atlantic

flyways harbored the highest within flyway divergence values, 1.2% and 0.95%

respectively in comparison to the Central (0.01%) and Pacific (0.048%). There was

no evidence that host species influenced population genetic structure.

Correlation between geographic distance and uncorrected p-distance was

moderate (ρ= 0.473) indicating a relationship between genetic diversity and

geography. When geographic distances were correlated with pairwise ΦST values no

relationship was found (ρ= -0.025).

TRICHOBILHARZIA SP. A: Since TA was only recovered from two flyways a

hierarchal AMOVA was not performed. Pairwise ΦST between the two flyways

sampled (Pacific and Central) was significant (ΦST=0.3283, p <0.001). High intra-

flyway divergence was recovered within the Central flyway (1.4%) relative to the

Pacific (0.36%) with an average p-distance of 1.38% between the two flyways. Due

to limited geographic sampling a Spearmen rank test was not performed.

Genetic diversity and demographic analyses

Haplotype diversity was similar across TP, TQ and TA, however nucleotide

diversity (π) and Ɵ were substantially different across the three species (Table 4).

Historical effective size was estimated by fitting a Bayesian Skyline model

(Drummond). Figure 3 shows estimates of Ne over time (kya) for TP, TQ, and TA

based on a 4% change/million years (Morgan, 2005), a lower rate of 2% was also

tested (Additional File 8). For TP and TQ estimates of Ne were almost double under

the 2% rate. Both TQ and TP indicate a recent population expansion, further

115

supported by significant positive Tajima’s D values (Table 4). Over coalescent time

the effective size of TQ was approximately 3X greater than TP, suggesting this

species has a history of maintaining larger genetically diverse populations. Despite

having greater π than TQ, TA exhibited the smallest effective population size of the

three species with no evidence for notable historical demographic changes.

Genetic diversity within Trichobilharzia.

Using our data combined with published cox1 sequence for other

Trichobilharzia spp. in the NCBI database we estimated species wide genetic

diversity across Trichobilharzia (Table 4). Of the five additional species included,

none has comparable nucleotide diversity to the three species of interest, with the

exception of T. stagnicolae (π = 0.01326). Similarly, estimates of Ɵ were highest

among TQ, TP, TA and T. stagnicolae. Observed genetic diversity was highest

among species with high measures of ecological specificity. Species with the

broadest host range in terms of number of species and taxonomic distinctness

(Poulin and Mouillot, 2005) had the lowest estimates of π and Ɵ (Figure 4).

DISCUSSION

A primary goal of this study was to identify ecological factors (habitat preference,

migratory behavior, and host range) that are important to the microevolution of

Trichobilharzia, specifically under conditions of partially overlapping host ecology.

Remarkably little is known regarding the ecological determinates of Ne, π and Ɵ or

how genetic drift operates within complex, widespread parasite systems (Criscione

et al., 2005). These parameters have vital implications for disease ecology and

parasite control, as they determine how alleles (e.g. resistance alleles) move within

and between populations. Ɵ is often described as a measure for adaptive potential

(Criscione and Blouin, 2004; Gandon et al., 2008; Archie and Ezenwa, 2011) as

116

such it may indicate a species genetic flexibility. In the case of Trichobilharzia spp. it

can be hypothesized that TQ has a greater adaptive potential than TP, and

theoretically populations may be more robust to environmental change (e.g. host

extinction, climate change).

Comparative population genetic analyses of TQ, TP and TA revealed

differences in population structure, genetic diversity and demographic histories.

Specifically, the results suggest that TQ is a common and genetically diverse

schistosome of Spatula spp. across four continents, with population structure likely

associated with duck migratory ranges, such that parasite population structure is

associated with latitude as a proxy for breeding and wintering grounds. No deeper

phylogeographic structure was found within TQ despite its global distribution.

Historical effective population sizes (Ne) of TQ were at least 3X greater than TP and

TA. Contemporary regional measures of π and Ɵ were high across the range of TQ,

including Southern Hemisphere populations, and largely matched species wide and

infra-population measures. In contrast, species wide TP maintains lower π and Ɵ.

Overall geography plays a more important role in the genetic structure of TP relative

to TQ. Phylogenetic analysis suggests the existence of two clades, possibly

separated by the Eastern and Western part of the range. Hierarchal AMOVA (Table

3) and pairwise ΦST values (Additional File 9) support geographic structuring,

potentially in association with migratory flyway, within TP, which would support an

east/west divide. It is important to remember, both TQ and TP rely on the same snail

intermediate hosts (Physa spp.), and are consequently united ecologically in time

and space, as such it is at the definitive host level where TQ and TP partition

themselves among different ecological host groups. We report a 63% difference in

the prevalence of TQ and TP across all hosts, and a 64% difference between the

117

single most common host of each species, suggesting a stark different in

transmission success. It can be hypothesized that as both species infect Physa

snails, the habitats that Spatula spp. (TQ) confer a greater probability of transmission

relative to Aythya spp. (TP). While experimental infections are necessary to rule out

inherent differences in host susceptibility, these results may imply that certain

combinations of hosts and ecologies facilitate the maintenance of high parasite

diversity and Ne.

This study sought to characterize microevolutionary patterns among three

congeneric trematode species, to evaluate how hosts with partially overlapping

ecologies might impact parasite population genetic structure and diversity.

Substantial differences in population genetic structure and demographic parameters

among TQ, TP and TA were found, and further patterns of genetic diversity and

ecological specificity varied across Trichobilharzia. In total this data found that

parasite microevolutionary patterns can vary with host-ecology among ecologically

specific and overlapping parasite species, specifically in terms of host habitat

preference and site fidelity. Here we discuss several potential reasons why and

associated consequences.

Infrapopulation diversity of TQ was equal to overall component population

diversity and the number of unique haplotypes within infrapopulations increased

linearly with the number of individuals sampled. This suggests that infrapopulation

recruitment (transmission) is random, likely occurring across time and space and a

well-mixed component population. Notably, the majority of worms sampled were

males due to the difficulty of recovering females from the duck host. The high level of

infrapopulation diversity observed suggests that duck hosts sampled maintain a

genetically diverse pool of male worms.

118

In contrast to TQ, infrapopulations of TP appear to be less divergent, possibly

suggesting that recruitment is biased regionally, perhaps associated with the overall

great population subdivision observed within TP relative to TQ. This result warrants

further investigation as it might indicate the potential for differential intraspecific

transmission dynamics and ultimately local adaption within TP. Infrapopulation

sampling of TA was insufficient to address population recruitment, however notably

multiple infrapopulations were sequenced from American wigeon (Anas americana)

which revealed Trichobilharzia species diversity unequaled by any of the other host

species sampled. Our data suggests that A. americana hosts at least 5

Trichobilharzia species, 4 of which are currently undescribed. Anas americana is

considered to be one of the most generalists species within Anas (Johnson and

Grier, 1988) in terms of its habitat preferences and thus it may be more likely to

encounter a variety of different snail species and their associated parasites. It can be

hypothesized that these generalist behaviors drive the high species diversity we

observe.

The hosts of TQ (Spatula clypeata, S. discors and S. cyanoptera in North

America) have a broad migratory range and are known to be locally opportunistic.

Habitat quality is the primary determinant of site selection for these species;

consequently ducks move locally to find optimal habitat, increasing their probability

of interacting with infected snails among different habitats (Johnson and Grier, 1988;

Osborn et al., 2017). Additionally, these ducks prefer shallow marsh habitat (Osborn

et al., 2017). These behaviors result in Spatula spp. spending a majority of their time

in Physa rich habitat, increasing the likelihood of encountering Trichobilharzia spp. In

contrast, North American Aythya spp. are highly philopatric, and occupy large stable

water bodies, where they are less likely to encounter snails. Habitat quality is not a

119

primary factor in site selection and consequently local movement of Aythya spp. is

limited (Johnson and Grier, 1988; Austin et al., 2016;). These behaviors in

combination decrease the likelihood of Aythya spp. to encounter locally available

Trichobilharzia. It can also be predicted that philopatric host species are more likely

to facilitate population genetic structure among their parasites, specifically in relation

to flyway. Which is a pattern we observed in TP.

Interestingly the American wigeon (A. americana), a dabbling duck, is one the

most generalist species within Anas (Johnson and Grier, 1988; Sibley, 2000). Anas

americana are known to spend the most time on land grazing relative to other Anas

spp., they can also be found in flowing river waters and brackish estuarine habitats.

Seasonally, A. americana individuals may occur in a diversity of habitat types, which

likely increases the probability of encounter to different species of Trichobilharzia

transmitting snails. We hypothesize the habitat generalism described for A.

americana drives the remarkably high Trichobilharzia lineage diversity recovered

within this species.

A secondary goal of this study was to attempt to quantify the nature of duck host

associations within Trichobilharzia (i.e. specialists= one host genera; generalists=

multiple host genera; ecological specialists= multiple host genera within an

ecological group; ecological generalists= multiple host genera that span multiple

ecological groups). The host range of a parasite (i.e. host specificity) is conceptually

determined by two filters the encounter and/or compatibility filter (Combes, 1991).

Prior studies suggest that Trichobilharzia are largely compatible with anatids

(waterfowl) and even some non-anatids. McMullen and Beaver (1945) demonstrated

experimentally TP could develop successfully in non-anatid birds (e.g canaries and

pigeons). Consensus regarding Trichobilharzia definitive host specificity would

120

suggest, under a traditional definition of host specificity, generalism. However, a

more systematic approach to experimentally defining duck host compatibility is

needed. In contrast, extensive field surveys and molecular systematic investigations

(Brant and Loker 2009, Ebbs et al. 2016, this study) have made clear that several

Trichobilharzia species (TQ, TP, TA and T. stagnicolae) are abundant in one or more

core duck species (or ecological group), and remarkably rare in other potential

(satellite) hosts species. Based the published experimental work discussed above it

might be predicted that immunological or evolutionary constrains (compatibility) are

unlikely, which would suggest that the encounter filter is narrowed by features

specific to hosts ecology (i.e ecological partitioning, temporal partitioning). Our data

suggests host specificity of Trichobilharzia spp. with either dabbling or diving ducks

is common. Divers and dabblers represent ecologically distinct groups which may be

co-distributed geographically but partition themselves ecologically by habitat

preferences and feeding behaviors (Baldassarre and Bolen, 1984), making them at

least seasonally allopatric (Austin et al., 2016). Juvenile and adult diving ducks

spend the majority of their time in deep water, however nesting sites occur near

shore putting breeding pairs and chicks in parapatry with dabbling ducks (Austin et

al., 2016).

In sum we investigated population genetic patterns of three congeneric

Trichobilharzia species which have a broad range of potential, sympatric or

parapatric, anatid hosts. We found evidence suggesting ecological specificity among

some Trichobilharzia species, and that specific host ecological traits may act within

conspecifics to reduce gene flow across potential host species resulting in population

genetic structure that co-varies with host traits. Species exhibiting ecological

specificity had on average higher measures of π and Ɵ relative to species infecting a

121

broader ecological range of potential hosts. Our data suggests that host ecological

traits mediate substantial differences in Trichobilharzia population genetic structure

and dynamics and relates to the adaptive potential of individual species.

ACKNOWLEDGMENTS

Thank you to the following for invaluable help collecting birds—Museum of

Southwestern Biology Bird Division, Mr. Andy Johnson, Dr. Ernest Valdez, Dr.

Robert W. Dickerman and Dr. Chris Witt; National Museum Bloemfontein: Mr. Rick

Nuttall and Mr. Dawid H. de Swardt.: Illinois Natural History Survey, Dr. Heath Hagy

and Mr. Josh Osborne; Dr. Vasyl Tkatch, Dr. Stephen Greimen; Dr. Sean Locke.

Individual duck hunters: Mr. Brad Bothner, Mr. Josh Butler, Mr. Tony Gilyard, Dr.

James Mckeehen and Mr. Bob Mckeehen, Mr. Matthew Snyder. Dr. Veronica Flores.

Individuals who assisted with host necropsies: Mr. Keith Keller and Ms. Emily Savris.

We acknowledge technical support from the University of New Mexico Molecular

Biology Facility, which is supported by National Institutes of Health, USA grant

P30GM110907 from the Institute Development Award program of the National

Center for Research Resources, USA. This work was primarily funded through a

National Science Foundation, USA grant to S.V.B. (DEB 1021427) and a National

Institutes of Health grant RO1 AI44913 to E.S.L.

REFRENCES Akaike, H., 1974. A new look at the statistical model identification. IEEE Trans.

Automat. Contr. 19, 716–723. doi:10.1109/TAC.1974.1100705 Bush, A.E., 1997. Parasitology meets ecology in its own terms: Margolis et. al.

revisited. Journal of Parasitology 84, 575–583. Archie, E.A., Ezenwa, V.O., 2011. Population genetic structure and history of a

generalist parasite infecting multiple sympatric host species. International Journal for Parasitology 41, 89–98. doi:10.1016/j.ijpara.2010.07.014

122

Austin, J.E., O'Neil, S.T., Warren, J.M., 2016. Habitat selection by postbreeding

female diving ducks: influence of habitat attributes and conspecifics. Journal of Avian Biology 48, 295–308. doi:10.1111/jav.01063

Avise, J., 1987. Intraspecific Phylogeography: The Mitochondrial-DNA Bridge

Between Population Genetics And Systematics. Annual Review of Ecology and Systematics 18, 489–522. doi:10.1146/annurev.ecolsys.18.1.489 Baldassarre, G.A., Bolen, E.G., 1984. Field-Feeding Ecology of Waterfowl Wintering

on the Southern High Plains of Texas. The Journal of Wildlife Management 48, 63. doi:10.2307/3808453

Barrett, L.G., Thrall, P.H., Burdon, J.J., Linde, C.C., 2008. Life history determines

genetic structure and evolutionary potential of host–parasite interactions. Trends in Ecology & Evolution 23, 678–685. doi:10.1016/j.tree.2008.06.017

Blair, K.S., Islam, 1983. The life-cycle and morphology of Trichobilharzia australis

n.sp. (Digenea: Schistosomatidae) from the nasal blood vessels of the black duck (Anas superciliosa) in Australia, with a review of the genus Trichobilharzia. Systematic Parasitology 5, 89–117.

Blasco-Costa, I., Poulin, R., 2013. Host traits explain the genetic structure of

parasites: a meta-analysis. Parasitology 140, 1316–1322. doi:10.1017/S0031182013000784

Blouin, M.S., Yowell, C.A., Courtney, C.H., Dame, J.B., 1995. Host Movement and

the genetic structure of Populations of parasitic nematodes. Genetics 141, 1007–1014.

Bousset, L., Pointier, J.P., David, P., Jarne, P., 2014. Neither variation loss, nor

change in selfing rate is associated with the worldwide invasion of Physa acuta from its native North America. Biol Invasions 16, 1769–1783. doi:10.1007/s10530-013-0626-5

Brant, S.V., Loker, E.S., 2013. Discovery-based studies of schistosome diversity

stimulate new hypotheses about parasite biology. Trends in Parasitology 1–11. doi:10.1016/j.pt.2013.06.004

Brant, S.V., Loker, E.S., 2009. Molecular Systematics of the Avian Schistosome

Genus Trichobilharzia (Trematoda: Schistosomatidae) in North America. Journal of Parasitology 95, 941–963. doi:10.1645/GE-1870.1

Clarke, K.R., Gorley, R.N., 2015. PRIMER v7 user manual. PRIMER-E: Plymouth. Combes, C., Théron, A., 2000. Metazoan parasites and resource heterogeneity:

constraints and benefits. International Journal for Parasitology 30, 299–304. Criscione, C., Blouin, M., 2004. Life cycles chape parasite evolution: Comparative

population genetics of Salmon Trematodes. Evolution 58, 198–202.

123

Criscione, C.D., Poulin, R., Blouin, M., 2005. Molecular ecology of parasites:

elucidating ecological and microevolutionary processes. Molecular Ecology 14, 2247–2257.

Darriba, D., Taboada, G.L., Doallo, R., Posada, D., 2012. jModelTest 2: more

models, new heuristics and parallel computing. Nature methods. Dawson, M.N., Louie, K.D., Barlow, M., Jacobs, D.K., Swift, C.C., 2002. Comparative

phylogeography of sympatric sister species, Clevelandia ios and Eucyclogobius newberryi (Teleostei, Gobiidae), across the California Transition Zone. Molecular Ecology 11, 1065–1075.

Drummond, A.J., Suchard, M.A., Xie, D., Rambaut, A., 2012. Bayesian

Phylogenetics with BEAUti and the BEAST 1.7. Molecular Biology and Evolution 29, 1969–1973. doi:10.1093/molbev/mss075

Drummond, R.A., Shapriro, B., Ho, S. 2005. Bayesian Coalescent Inference of Past

Population Dynamics from Molecular Sequences. Molecular Biology and Evolution 22, 1185–1192.

Dybdahl, C.M, Lively, C. 1996. The Geography of Coevolution: Comparative

Population strucutres for a snail and its trematode parasite. Evolution 50, 2264–2275.

Ebbs, E.T., Loker, E.S., Davis, N.E., Flores, V., Veleizan, A., Brant, S.V., 2016.

Schistosomes with wings: how host phylogeny and ecology shape the global distribution of Trichobilharzia querquedulae (Schistosomatidae). International Journal for Parasitology 46, 669–677. doi:10.1016/j.ijpara.2016.04.009

Excoffier, L., Lischer, H.E.L., 2010. Arlequin suite ver 3.5: a new series of programs

to perform population genetics analyses under Linux and Windows. Molecular Ecology Resources 10, 564–567. doi:10.1111/j.1755-0998.2010.02847.x

Excoffier, L., Smouse, P.E., Quattro, J.M., 1992. Analysis of molecular variance

inferred from metric distances among DNA haplotypes: application to human mitochondrial DNA restriction data. Genetics.

Gandon, S., Buckling, A., Decaestecker, E., Day, T., 2008. Host-parasite coevolution

and patterns of adaptation across time and space. Journal of Evolutionary Biology 21, 1861–1866. doi:10.1111/j.1420-9101.2008.01598.x

Gonzalez, J., Düttmann, H., Wink, M., 2009. Phylogenetic relationships based on

two mitochondrial genes and hybridization patterns in Anatidae. Journal of Zoology 279, 310–318. doi:10.1111/j.1469-7998.2009.00622.x

Gorton, M.J., Kasl, E.L., Detwiler, J.T., Criscione, C.D., 2012. Testing local-scale

panmixia provides insights into the cryptic ecology, evolution, and epidemiology of metazoan animal parasites. Parasitology 139, 981–997. doi:10.1017/S0031182012000455

124



Horak, P., Dvořák, J., Kolarova, L., trefil, L., 1999. Trichobilharzia regenti, a

pathogen of the avian and mammalian central nervous systems. Parasitology 119, 577–581. doi:10.1017/s0031182099005132

Huyse, T., Audenaert, V., Volckaert, F.A.M., 2003. Speciation and host-parasite

relationships in the parasite genus Gyrodactylus (Monogenea, Platyhelminthes) infecting gobies of the genus Pomatoschistus (Gobiidae, Teleostei). International Journal for Parasitology 33, 1679–1689.

Johnson, D.H., Grier, J.W., 1988. Determinants of Breeding Distributions of Ducks.

Wildlife Monographs 1–37. Jouet D, Skírnisson K, Kolářová L, Ferte H., 2010. Molecular Diversity of

Trichobilharzia franki in two intermediate hosts (Radix auricularia and Radix peregra): A complex of species. Infection, Genetics and Evolution 10, 1218–1227.

Jouet, D.E.A., 2009. Avian schistosomes in French aquatic birds: a molecular

approach. Journal of Helminthology 83, 181–189. Johnson, K., Sorenson, M.,1999. Phylogeny and biogeography of dabbling ducks

(genus: Anas): A comparison of molecular and morphological evidence. The Auk 116, 792–805.

Lam, T.T.Y., Ip, H.S., Ghedin, E., Wentworth, D.E., Halpin, R.A., Stockwell, T.B.,

Spiro, D.J., Dusek, R.J., Bortner, J.B., Hoskins, J., Bales, B.D., Yparraguirre, D.R., Holmes, E.C., 2012. Migratory flyway and geographical distance are barriers to the gene flow of influenza virus among North American birds. Ecol. Lett. 15, 24–33. doi:10.1111/j.1461-0248.2011.01703.x

Larkin, M.A., Blackshields, G., Brown, N.P., Chenna, R., 2007. Clustal W and Clustal

X version 2.0.

Leigh, J.W., Bryant, D., 2015. POPART: full‐feature software for haplotype network

construction. Methods in Ecology and Evolution 6, 1110–1116. doi:10.1111/2041-210X.12410

Librado, P., Rozas, J., 2009. DnaSP v5: a software for comprehensive analysis of

DNA polymorphism data. Bioinformatics. McMullen, D.B., Beaver, P.C., 1945. Studies on schistosome dermatitis. American

Journal of Epidemiology 42, 128–154. doi:10.1093/oxfordjournals.aje.a119030 Morgan, J.A., Dejong, R.J., Adeoye, G.O., Ansa, E., Barbosa, C.S., Brémond, P.,

125

Cesari, I.M., Charbonnel, N., Corrêa, L.R., Coulibaly, G., D’andrea, P.S, Loker, E.S. 2005. Origin and Diversification of the the Human parasite Schistosoma mansoni. Molecular Ecology 14, 3889–3902.

Muñoz, J., Amat, F., Green, A.J., Figuerola, J., Gómez, A., 2013. Bird migratory

flyways influence the phylogeography of the invasive brine shrimp Artemia franciscana in its native American range. PeerJ 1, e200. doi:10.7717/peerj.200

Nadler, S., 1995. Microevolutoin and the Genetic Structure of Parasite Populations.

Journal of Parasitology 81, 395–403. Nieberding, C., Morand, S., Libois, R., Michaux, J.R., 2006. Parasites and the island

syndrome: the colonization of the western Mediterranean islands by Heligmosomoides polygyrus (Dujardin, 1845). Journal of Biogeography 33, 1212–1222. doi:10.1111/j.1365-2699.2006.01503.x

Nuismer, M., Gandon S. 2009. Interactions between Genetic Drift, Gene Flow and

Selection Mosaics Drive Parasite Local Adaptation. The American Naturalist 173. Osborn, J.M., Hagy, H.M., Mcclanahan, M.D., Davis, J.B., Gray, M.J., 2017. Habitat

selection and activities of dabbling ducks during non‐breeding periods. The

Journal of Wildlife Management 81, 1482–1493. doi:10.1002/jwmg.21324 Pearce, J.M., Ramey, A.M., Flint, P.L., Koehler, A.V., Fleskes, J.P., Franson, J.C.,

Hall, J.S., Derksen, D.V., Ip, H.S., 2009. Avian influenza at both ends of a migratory flyway: characterizing viral genomic diversity to optimize surveillance plans for North America. Evol Appl 2, 457–468. doi:10.1111/j.1752-4571.2009.00071.x

Pinto, H.A., Brant, S.V., de Melo, A.L., 2014. Physa marmorata (Mollusca: Physidae)

as a natural intermediate host of Trichobilharzia (Trematoda: Schistosomatidae), a potential causative agent of avian cercarial dermatitis in Brazil. Acta Tropica 138, 38–43. doi:10.1016/j.actatropica.2014.06.002

Poulin, R., Keeney, D.B., 2008. Host specificity under molecular and experimental

scrutiny. Trends in Parasitology 24, 24–28. doi:10.1016/j.pt.2007.10.002 Poulin, R., Mouillot, D., 2005. Combining phylogenetic and ecological information

into a new index of host specificity. Journal of Parasitology 91, 511–514. doi:10.1645/GE-398R

Poulin, R., Mouillot, D., 1999. Parasite specialization from a phylogenetic

perspective: a new index of host specificity. Parasitology 126, 473–480. doi:10.1017/S0031182003002993

Reynolds, J., Weir, B.S., Cockerham, C.C., 1983. Estimation of the coancestry

coefficient: basis for a short-term genetic distance. Genetics. Sire, C., Durand, P., Pointier, J.P., Théron, A., 2001. Genetic diversity of

Schistosoma mansoni within and among individual hosts (Rattus rattus):

126

infrapopulation differentiation at microspatial scale. International Journal for Parasitology 31, 1609–1616.

Slatkin, M., 1985. Gene Flow in Natural Populations. Annual Review of Ecology and

Systematics 16, 393–430. doi:10.1146/annurev.ecolsys.16.1.393 Swanson, G.A., Hawkins, A.S., Hanson, R.D., Nelson, H.K., Reeves, H.M., 1985.

Flyways: Pioneering Waterfowl Management in North America. The Journal of Wildlife Management 49, 832. doi:10.2307/3801721

Tamura, K., Stecher, G., Peterson, D., Filipski, A., Kumar, S., 2013. MEGA6:

Molecular Evolutionary Genetics Analysis Version 6.0. Molecular Biology and Evolution 30, 2725–2729. doi:10.1093/molbev/mst197

Weinstein, S.B., Kuris, A.M., 2016. Independent origins of parasitism in Animalia.

Biol. Lett. 12, 20160324. doi:10.1098/rsbl.2016.0324 Wethington, A.R., Lydeard, C., 2007. A molecular phylogeny of Physidae

(Gastropoda: Basommatophora) based on mitochondrial DNA sequences. J Molluscan Stud 73, 241–257. doi:10.1093/mollus/eym021

Whiteman, N.K., Kimball, R.T., Parker, P.G., 2007. Co‐phylogeography and

comparative population genetics of the threatened Galápagos hawk and three ectoparasite species: ecology shapes population histories within parasite communities. Molecular Ecology 16, 4759–4773. doi:10.1111/j.1365-294X.2007.03512.x

127

Pacific

Central

Mississippi

Atlantic S. Hemisphere

W137 W756.2 W752

W925 W157 W748

W162 W743 W767.4

W203 W137.2 W190 W183

W154.2 W750

W138.3 W160 W180 W159 SDS1006 W753 W777

W156 W153 W161

W345.2 W746 W756

W135 W142 W155.3 Tshov

W755.2 W754

W148 W767.3 W158

W2135 W664 W698 W166.2

VVT3023 W135.2 W833 W259 W747

W148.2 W154 W778

E45 W774 E64 W191 W152.4

W704 W181 W831 W749

W345.2 W750.2 W703

W345.3 Trichobilharzia sp. C

Trichobilharzia franki W701

W604 W194 W497 W234 W235 W510 W608 W193 W602

W249 W230 W211

W146 W147 W765 W765.5 W196 W765.6 W765.3 W256 W745 SAL92-09 W171 W236 W175 W765.4 W255 W263

Trichobilharzia sp. B W149.2 W511.2 W212

W182 W149

W192 VVT3043

W609 W601 W600 W611 W511 W607

Trichobilharzia regenti 0.02

1

1

1

.99

.99

.98

1

1

1

1

.96

1

.97

.96

1

.99

.99

.95

.99

I

II

128

Figure 1. cox1 phylogeny. BI inference of TQ, TP and TA, only posterior

probabilities ≥.95 are presented. Branches are colored by species; TQ= orange,

TP=green and TA=blue. Individual worms are labeled by the migratory flyway they

were collected from, denoted by a colored box. The two TP clades are denoted at I

and II.

129

Figure 2. Minimum spanning network of cox1

haplotypes. (A) Trichobilharzia querquedulae haplotypes, (B) T. physellae and (C)

Trichobilharzia sp. A. Haplotypes are colored by the migratory flyway the host was

collected from.

A B

C

130

Figure 3. Bayesian skyline plot of cox1 datasets. Estimates of Ne (y-axis) over

time (kya, x-axis). Lines are colored by species; TQ= orange, TP=green and

TA=blue.

0

50000

100000

150000

200000

250000

300000

0 500 1000 1500 2000 2500

Ne

Time (kya)

TQ TP TA

131

Figure 4. Trichobilharzia summary tree. (A) Bayesian phylogeny of cox1 gene

region, posterior probabilities ≥0.95 are denoted with an asterisk (*). DEG=Duck

ecological group, PD =Parasite distribution, SH=Snail host. Under snail host, blocks

with a white background indicate physid transmitted, while blocks with a black

background indicate lymnaeid transmitted. (B) Bar graph of species wide estimates

of nucleotide diversity (π) and (C) species wide estimates of Ɵ.

Trichobilharzia

physellae

W701

Trichobilharzia franki

Trichobilharzia sp. A

Trichobilharzia

querquedulae

Trichobilharzia sp. C

Trichobilharzia regenti

Trichobilharzia mergi

Trichobilharzia szidati

Trichobilharzia anseri

Trichobilharzia stagnicolae

Allobilharzia visceralis

Anserobilharzia brantae

DEG PD

NA

SA

EU

NA

GL

NA

EU

IC

EU

NA

EU

SH

0 0.005 0.01 0.015 0.02

0 0.01 0.02 0.03 0.04

A. B.

C.

**

**

*

*

* **

**

*

*

*

132

Avian Host No. examined

No. infected

% infected

Species of Trichobilharzia Locality Source

Anseriformes: Anatidae

Aix sposa 8 3 0.38 Trichobilharzia sp. C

FL, LA, NC, NM, PA Brant and Loker; This study

Alopochen aegyptiaca 9 0 0 ZA This study

Amazonetta brasiliensis 3 0 0 AR This study

Anas acuta 27 2 0.07 Trichobilharzia sp. E

AK, CA, LA, NV, NM, MB This study

Anas americana 37 10 0.27

Trichobilharzia sp. A,B,D,E & T. querquedulae

AK, CA, NC, NM, WA Brant and Loker; This study

Anas bahamensis 1 0 0 AR This study

Anas crecca (Europe) 15 9 0.6 T. szidati, T. franki FR Jouet et al. 2009

Anas crecca (Iceland) 2 0 0 IC Skirnisson and Kolarova 2008

Anas crecca (North America) 80 6 0.075 Trichobilharzia sp.

AK, CA, LA, MN, NE, NC, NM, MB Brant and Loker 2009; This study

Anas erythrorhyncha 5 2 0.4 Trichobilharzia sp. ZA This study

Anas flavirostris 10 0 0 AR This study Anas fulvigula 5 0 0 LA Brant and Loker 2009

Anas georgica 6 0 0 AR This study

Anas penelope 2 0 0 IC Skirnisson and Kolarova 2008

Anas platyrhynchos (Europe, 196 108 0.55 T. regenti FR Jouet et al 2009

133

nasal)

Anas platyrhynchos (Europe, visceral) 31 26 0.84

T. szidati, T. franki FR Jouet et al 2009

Anas platyrhynchos (Iceland, nasal) 15 11 0.733 T. regenti IC Skirnisson and Kolarova 2008

Anas platyrhynchos (Iceland, visceral) 15 10 0.667

Trichobilharzia sp. IC Skirnisson and Kolarova 2008

Anas platyrhynchos (North America) 24 3 0.125 T. physellae

AK, LA, MI, NM, PA Brant and Loker 2009; This Study

Anas rubripes 4 1 0.25 Trichobilharzia sp.

NC, NM, PA Brant and Loker 2009; This Study

Anas sibilatrix 5 1 0.2 Trichobilharzia sp. AR This study

Anas strepera 36 1 0.028 T. physellae

FL, LA, NC, NM, PA Brant and Loker 2009; This Study

Anas undulata 11 6 0.55 Trichobilharzia sp. ZA This study

Anser anser (nasal) 75 6 0.08 T. regenti FR, IC Jouet et al. 2015

Anser anser(visceral) 133 60 0.45 T. anseri FR, IC Jouet et al 2009; Skirnisson and Kolarova 2008; Jouet et al. 2015

Aythya affinis 72 19 0.26 T. physellae

AK, CA, FL, IL, LA, NC, NM, NY, ON, PA, WA Brant and Loker 2009; This study

Aythya americana 4 0 0 CA, LA, NM Brant and Loker 2009; This study

134

Aythya collaris 8 2 0.25 T. physellae

CA, FL, LA, NC, NM Brant and Loker 2009; This study

Aythya ferina 18 2 0.11 T. regenti FR Jouet et al 2008; Jouet et al 2009

Aythya fuligula (nasal) 10 5 0.5 T. regenti Jouet et al 2008; Jouet et al 2009

Aythya fuligula (visceral) 1 1 1 T. franki FR Jouet et al 2009

Aythya malraia 11 0 0

AK, FL, PA, MB, IC

Brant and Loker; Skirnisson and Kolarova 2008; This study

Aythya novaeseelandia 20 18 0.9 Trichobilharzia sp. NZ Davis 2006

Aythya valisineria 5 1 0.2 T. physellae NM, NV Brant and Loker 2009

Branta canadensis 9 0 0

NC, NM, NV, MB Brant and Loker 2009

Branta hutchinsii 2 0 0 NM This study

Bucephala albeola 13 1 0.077 T. physellae

FL, NC, NM, NV, PA Brant and Loker; This study

Bucephala clangula 3 0 0 CA, NM Brant and Loker 2009

Bucephala islandica 1 0 0 IC Skirnisson and Kolarova 2008

Cairina moschata 2 0 0 PE This study

Callonetta leucophrys 4 0 0 AR This study

Chen caerulescens 11 0 0 LA, NM, MB Brant and Loker 2009; This study

Chen rossii 1 0 0 NM This study

Clangula hyemalis 10 1 0.1 T. physellae AK This study

Cygnus columbianus 18 0 0 NC, NV, NM Brant and Loker 2009; This study

Cygnus cygnus 30 0 0 IC Skirnisson and Kolarova 2008 Cygnus olor (visceral) 9 5 0.55 T. franki FR Jouet et al 2009

135

Cygnus olor (nasal) 40 13 0.325 T. regenti FR Jouet et al 2009

Dendrocygna viduata 6 0 0 AR, ZA This study

Histrionicus histrionicus 3 0 0 AK Brant and Loker 2009

Lophodytes cucullatus 6 2 0.33 Trichobilharzia sp. C

LA, NC, PA Brant and Loker 2009; This study

Melanitta americana 1 0 0 AK This study

Melanitta fusca 5 0 0 AK ,MB Brant and Loker 2009

Melanitta perspicillata 3 0 0 AK Brant and Loker 2009

Mergus merganser (North America) 10 3 0.3

T. stagnicolae, T. physellae MI, NM Brant and Loker 2009; This Study

Mergus merganser (Europe) 1 1 1 T. regenti FR Jouet et al. 2009

Mergus serrator (Iceland) 20 19 0.95 T. mergi IC Skirnisson and Kolarova 2008

Mergus serrator (North America) 3 0 0 CA, NM This study

Netta erythrophthalmia 3 0 0 ZA This study

Oxyura jamaicensis 9 0 0

CA, FL, NC, NM, NV Brant and Loker 2009; This Study

Plectropterus gambensis 1 0 0 ZA This study

Somateria mollissima 1 0 0 MB This study

Somateria spectabilis 3 0 0 AK This study

Spatula clypeata (Europe, nasal) 5 2 0.4 T. regenti FR Jouet et al. 2009 Spatula clypeata (Europe,

visceral) 4 2 0.5 T. szidati FR Jouet et al. 2009

Spatula clypeata (North America) 53 39 0.74 T. querquedulae

AK, CA, FL, LA, NC, NE, NM, MB Brant and Loker; This study

Spatula cyanoptera 14 11 0.79 T. querquedulae

AR, CA, NM Brant and Loker 2009; This study

136

Spatula discors 49 44 0.9 T. querquedulae

CA, FL, LA, MN, NM, PA Brant and Loker 2009; This study

Spatula platelea 1 0 0 AR This study

Spatula smithii 2 2 1 T. querquedulae ZA This study

Spatula versicolor 10 6 0.6 T. querquedulae AR This study

Tadorna cana 1 0 0 ZA This study

Thalassornis leuconotus 1 0 0 ZA This study

Non-Anatids Agelaius phoeniceus

(Passeriformes:Icteridae) 4 0 0 NM This study Alle alle (Charadriiformes:

Alcidae) 1 0 0 DE This study Anhinga anhinga (Suliformes:

Anhingidae) 10 0 0 FL, LA Brant and Loker 2009 Aramides ypecaha (Gruiformes:

Rallidae) 1 0 0 AR This study Aramus guarauna (Gruiformes:

Aramidae) 1 0 0 FL Brant and Loker 2009 Ardea herodias (Pelecaniformes:

Ardeidae) 2 0 0 NM This study Bostrychia hagedash

(Pelecaniformes: Threskiornithidae) 1 0 0 ZA This study Egretta intermedia

(Pelecaniformes: Ardeidae) 1 0 0 ZA Brant and Loker 2009 Egretta thula (Pelecaniformes:

Ardeidae) 1 0 0 LA Brant and Loker 2009 Egretta tricolor (Pelecaniformes:

Ardeidae) 1 0 0 LA Brant and Loker 2009

137

Eudocimus albus (Pelecaniformes:

Threskiornithidae) 6 0 0 LA Brant and Loker 2009 Euplectes sp. (Passeriformes:

Ploceidae) 4 0 0 ZA This study Fulica americana (Gruiformes:

Rallidae) 8 0 0 NC, NM This study Gavia immer (Gaviiformes:

Gaviidae) 1 0 0 NM This study Larus californicus

(Charadriiformes: Laridae) 1 0 0 CA Brant and Loker 2009 Larus delawarensis

(Charadriiformes: Laridae) 15 0 0 CA, LA Brant and Loker 2009 Larus fuscus (Charadriiformes:

Laridae) 1 0 0 LA Brant and Loker 2009 Patagioenas leucocephala

(Columbiformes: Columbidae) 2 0 0 FL This study Pelecanus erythrorhynchos

(Pelecaniformes: Pelecanidae) 1 0 0 NM This study Phalacrocorax africanus

(Pelecaniformes: Phalacrocoracidae) 3 0 0 ZA This study

Phalacrocorax auritus (Pelecaniformes:

Phalacrocoracidae) 2 0 0 LA Brant and Loker 2009 Plegadis chihi (Pelecaniformes:

Threskiornithidae) 6 0 0 LA Brant and Loker 2009 Pluvialis dominica

(Charadriiformes: Charadriidae) 1 0 0 LA Brant and Loker 2009 Podiceps auritus

(Podicipediformes: Podicipedidae) 1 0 0 NM This study

138

Podiceps nigricollis (Podicipediformes:

Podicipedidae) 1 0 0 NM This study Podilymbus podiceps

(Podicipediformes: Podicipedidae) 2 0 0 NM Brant and Loker 2009

Scopus umbretta (Pelecaniformes: Scopidae) 2 0 0 ZA This study

Sterna maxima (Charadriiformes: Laridae) 1 0 0 LA Brant and Loker 2009

Tachybaptus ruficollis (Podicipediformes:

Podicipedidae) 1 0 0 ZA This study Threskiornis aethiopicus

(Pelecaniformes: Threskiornithidae) 1 0 0 ZA This study

Uria aalge (Charadriiformes: Alcidae) 2 0 0 AK This study

Xanthocephalus xanthocephalus (Passeriformes:Icteridae) 1 0 0 NM This study

Table 1. Summary of Trichobilharzia survey data. Note that the majority of hosts were co-infected with other helminths and/or many with other Schistosomatid spp., these worms were accessioned with the associated Trichobilharzia records. Locality abbreviations are as follows: AK=Alaska, AR=Argentina, CA= California, DE=Delaware, FL= Florida, FR=France, IC=Iceland, LA=Lousiana, MB= Manitoba Canada, MI= Michigan, MN=Minnesota, NC= North Carolina, NE= Nebraska, NM = New Mexico, NV= Nevada, NZ= New Zealand, ON= Ontario Canada, PA=Pennsylvania, PE= Peru, PR= Puerto Rico, WA= Washington, ZA= South Africa.

139

Species Host Species Prevalence STD STD* STD-

MOD

Obs. Host Range

Ecological Group % Eco Group

TQ Spatula discors 0.9 dabbling duck

Spatula cyanoptera 0.79 dabbling duck

Spatula clypeata 0.74 dabbling duck

Spatula versicolor 0.6 dabbling duck

Spatula smitthi 1 dabbling duck

Anas americana 0.03

Total 1.05 1.02 1 6 1 (dabbling ducks)

TP Aythya affinis 0.26 diving duck

Aythya collaris 0.25 diving duck

Aythya valisineria 0.2 diving duck

Bucephala albeola 0.077 diving duck

Mergus merganser 0.1 diving duck 0.93 (diving ducks)

Clangula hyemalis 0.1 sea duck

Anas strepera 0.028 dabbling duck

Anas platyrynchos 0.125 dabbling duck 0.07 (other ducks)

Total 1.86 1.82 1.9 8

TA Anas americana 0.27 ─ ─ ─ 1 dabbling duck 1 (dabbling ducks)

T. regenti Spatula clypeata 0.4 dabbling duck

Anas platyrynchos 0.64 dabbling duck 0.82 (dabbling ducks)

Aythya fuligula 0.5 diving duck

Aythya ferina 0.11 diving duck 0.05(diving ducks)

140

Anser anser 0.08 swans/geese

Cygnus olor 0.325 swans/geese 0.13 (swans and geese)

Total 1.87 1.59 3 6

T. mergi Mergus serrator 0.95 ─ ─ ─ 1 diving duck 1 (diving ducks)

T. anseri Anser anser 0.45 ─ ─ ─ 1 swans/geese 1 (swans/geese)

T. stagnicolae Mergus merganser 0.2 ─ ─ ─ 1 diving duck 1 (diving ducks)

Table 2. Measures of host specificity.

141

Source of Variation d.f. %

Variation Fixation indices

p value

T. querquedulae - Flyway

Among Flyways 4 -4.64 ΦCT= -0.0464 0.4858

Among Populations within Flyways

8 11.04 ΦSC =

0.10547 0.0528*

Within Populations 46 93.6 ΦST= 0.0639 0.0439*

T. querquedulae - Latitude

Among LG 2 4.41 ΦCT= 0.0441 0.00196

Among Populations within LG 10 4.42 ΦSC =

0.04621 0.0508*

Within Populations 46 91.17 ΦST=

0.08827 0.0616

T. querquedulae - Host spp.

Among HS 6 -0.47 ΦCT= -0.00472

0.4594

Among Populations within HS 13 8.34 ΦSC =

0.08303 0.0675

Within Populations 35 92.13 ΦST= 0.0787 0.0577

T. physellae – Flyway

Among Flyways 3 55.59 ΦCT=

0.55592 0.02737

Among Populations within Flyways

2 -42.73 ΦSC =

0.96217 0.8495


0.12864 0.1564

T. physellae - Latitude

Among LG 1 2.71 ΦCT=

0.02714 0.50733

Among Populations within LG 4 7.12 ΦSC =

0.07319 0.52884


0.09835 0.15934

T. physellae - Host spp.

Among HS 4 20.13 ΦCT=

0.20128 0.12219

Among Populations within HS 3 10.46 ΦSC

=0.13098 0.26588

Within Populations 17 69.41 ΦST= 0.3059 0.00293

Table 3. Analyses of molecular variance results. For both TQ and TP population structure was tested by flyway, latitude and host species. Significant p-values are denoted in bold, and (*) indicates values that were within one standard deviation of significance and were considered marginally significant.

142

Taxa n Prevalence Pi K Theta Tajima's D

1 Trichobilharzia querquedulae 63 81% (90%) 0.017 11.9 0.04542 -2.4223**

2 Trichobilharzia physellae 27 18% (26%) 0.00696 4.868 0.01387 -2.25017**

3 Trichobilharzia sp. A 15 27% 0.01175 4.348 0.01342 -0.77396

4 Trichobilharzia franki 7 ─ 0.00503 3.524 0.0064 -

5 Trichobilharzia regenti 8 34% (64%) 0.00236 1.75 0.0026 -

6 Trichobilharzia anseri 6 45% 0.00251 1.867 0.00252 -

7 Trichobilharzia stagnicolae 8 20% 0.01326 10.93 0.01825 -

8 Trichobilharzia szidati 8 * 0.00731 5.429 0.00934 -

Table 4: Indices of genetic diversity across Trichobilharzia

143

CHAPTER IV

Illuminating Schistosome Diversity: Phylogenomics and diversification of

Schistosomatidae using targeted sequence capture of ultra-conserved elements

AUTHORS: Erika T. Gendron (Ebbs), Lijing Bu, Eric S. Loker, Vasyl Tkach, Veronica Flores and Sara V. Brant

ABSTRACT

Schistosomatidae Stiles and Hassall 1898 is a medically significant family of

helminth parasites (Digenea: Trematoda), which infects mammals, birds (definitive

hosts) and aquatic snails (intermediate hosts). Currently there are 14 named genera,

of which interrelationships are largely unresolved. The lack of a resolved phylogeny

has encumbered our understanding of the schistosome evolution, specifically in

regard to patterns of host-use and the role of host-switching in diversification. This

research used targeted sequence capture of ultra-conserved elements (UCE) to

generate a phylogenomic dataset for estimation of schistosome interrelationships.

This dataset represents the largest phylogenetic effort within Schistosomatidae in

terms of genetic loci; we recovered an average of 500 and 1,500 UCE loci (of ~4,000

targeted) between two sequencing runs. Relative to published UCE datasets our

capture success was low, reasons for which are discussed. As such, UCE

alignments contained a substantial amount of missing data, which limited

downstream analyses. In light of this, we report increased resolution of two pivotal

genera Heterobilharzia and Schistosomatium, which supports a secondary host-

capture of mammals in North America. Support of other pivotal genera,

Macrobilharzia and Ornithobilharzia, varied among phylogenetic analyses. In total

application of sequence capture technology within Schistosomatidae increased our

144

understanding of schistosome relationships. The implications of these results in

regard to host-use and schistosome diversification are discussed.

INTRODUCTION

Schistosomatidae Stiles and Hassall 1898 represent a biologically diverse

family of trematodes infecting birds or, mammals (definitive hosts) and aquatic snails

(intermediate hosts). Schistosomes are of great significance to human health as

three species within the genus Schistosoma Weinland, 1858 are the major etiological

agents of human schistosomiasis, one of the world’s most recalcitrant Neglected

Tropical Diseases still infecting over 250 million people globally (Tchuem Tchuenté

et al., 2017). Non-human schistosomes, particularly those associated with avian

definitive hosts, also cause Human Cercarial Dermatitis (swimmer’s itch) now

considered a re-remerging zoonotic pathogen (Horák et al., 2015). From the

perspective of parasite biology, schistosomes are remarkable in that they are the

only exclusively dioecious (Platt, 1997) family of digenetic trematodes. This derived

state has resulted in interesting patterns of dimorphic adult traits and reproductive

strategies across the family, including substantial variation in adult body size and

morphology (Morand and Müller-Graf, 2000). There is a remarkably broad range of

intermediate hosts employed by schistosomes, 15 families including members of

Caenogastropoda and Heterobranchia, with evidence for numerous intermediate

host-switching events (Brant and Loker, 2013).

Because of the medical importance, there has long been substantial interest

in understanding interrelationships, patterns of host-use and character evolution

within the Schistosomatidae (Weinland, 1858; Stiles and Hassall, 1898; Farley 1971;

Khali, 2002). However efforts were constrained by a lack of informative

145

morphological characters and adequate adult parasite material for description,

particularly among avian infecting lineages. The advent of molecular makers (Snyder

and Loker, 2000; Lockeyer et al., 2003; Brant et al., 2006) greatly aided efforts to

elucidate schistosome diversity, particularly within avian infecting genera which

proved to harbor cryptic diversity (i.e. Trichobilharzia, (Brant and Loker, 2009; Ebbs

et al., 2016), and supported the existence of 14 named genera and just over 100

named species (Brant and Loker, 2013). This diversity count is likely an

underestimate based on more recent taxon sampling of larval schistosomes (Jouet

et al., 2010; Flores et al., 2015; Brant et al., 2017; Pinto et al., 2017, this study).

Historically Schistosomatidae was divided into three subfamilies (McMullen and

Beaver 1945, Lu and Bai 1976, Khali 2002). However, molecular phylogenetic

methods combined with increased taxon sampling (Lockyer et al., 2003; Brant et al.,

2006) have not provided any support for the previous subfamily designations nor

reflected schistosome interrelationships. In fact schistosome interrelationships have

remained relatively unresolved, specifically at the deeper nodes (Snyder and Loker,

2000; Lockyer et al., 2003; Brant et al., 2006; Brant and Loker, 2013; Pinto et al.,

2017).

Genetic relationships within Schistosomatidae have thus far been based on

few loci, primarily markers within the ribosomal RNA complex (28S, 18S, ITS1 & 2)

and single mitochondrial gene, cox1. While these studies have made great strides in

advancing our knowledge of species diversity, they have failed to resolve deeper

nodes within the family (Snyder and Loker, 2000; Lockyer et al., 2003; Brant et al.,

2006; Brant and Loker, 2013; Pinto et al., 2017). Specifically, there is no resolution

regarding the phylogenetic placement of pivotal genera: Heterobilharzia,

Schistosomatium and Macrobilharzia. Both Heterobilharzia and Schistosomatium

146

(herein referred to as HS clade) are monotypic mammalian infecting genera and

represent the only mammalian lineage found in North America. The major

mammalian clade (Schistosoma, Bivitellobilharzia, or the SB clade), which includes

those species that infect humans, is found in tropical and sub-tropical latitudes. Most

genetic studies have demonstrated an affinity between the HS clade with the derived

avian clade (herein referred to as the DAS clade; Trichobilharzia, Allobilharzia,

Anserobilharzia, Dendritobilharzia, Gigantobilharzia and Bilharziella) rather than the

SB mammalian clade. Such a relationship may not be surprising given that cercaria

within the DAS and HS have eyespots, whereas Schistosoma cercariae lack

eyespots (Khali, 2002). Only a single species of Macrobilharzia, M. macrobilharzia

infecting Anhinga anhinga in North America, is known from genetic data.

Macrobilharzia baeri (Fain 1955) has been reported from cormorants in Rwanda,

however no genetic data currently exists. Macrobilharzia has consistently failed to

group with any support with other schistosome lineages. Since schistosomes are

found in both mammalian and avian hosts, resolution of the phylogenetic position of

Macrobilharzia and the HS clade is necessary to know how many times

schistosomes have undergone definitive host-switches. Currently, it is hypothesized

that the HS clade is the result of a secondary host-capture within North America

(Snyder and Loker, 2000). Most current molecular phylogenies place the AO clade

as basal (though weakly supported) within Schistosomatidae (Brant et al., 2006;

Brant and Loker, 2013). Definitive resolution of basal genera is necessary to

understand ancestral definitive and intermediate host relationships among

schistosomes, and to develop hypotheses regarding diversification time.

This study sought to resolve phylogenetic relationships within

Schistosomatidae in an effort to understand patterns of host-use and host-switching,

147

in addition to character evolution. A resolved phylogeny is required to enable testing

of phylogenetic hypotheses regarding schistosome diversification, and can be

applied to address questions such as: have specific traits aided schistosome

diversification? How common is intermediate and definitive host-switching within

Schistosomatidae? Did the major schistosome clades radiate simultaneously?

Additionally, we expect a resolved phylogeny to provide direction for future collection

efforts of taxa that are under-sampled. For example, the intermediate host of

Bivitellobilharzia has remained a mystery despite extensive sampling (Devkota et al.,

2014a); definitive placement of the genus might suggest potential intermediate host

families for more targeted search efforts. Why some interrelationships have proved

particularly difficult to resolve despite increased taxon sampling is unclear. Brant et

al. (2006) suggests that early schistosomes underwent a rapid radiation from a

marine environment (AO clade) into freshwater snails and definitive hosts,

suggesting the main mammalian (SB clade) and avian (DAS clade) clades diversified

around the same time. Under this scenario substantial incomplete lineage sorting

(ILS) might be expected (Maddison and Knowles, 2006).

Recent developments in phylogenomic methods have proven effective in

resolving difficult groups (McCormack et al., 2013; Grégoir et al., 2015), particularly

where ILS was expected. One such method uses targeted sequence capture of ultra

conserved elements (UCEs) (Faircloth et al., 2012) to generate thousands of nuclear

loci for phylogenomic analysis. The use of UCEs as phylogenomic markers has been

successful at resolving historically problematic vertebrate groups (Esselstyn et al.,

2017; Faircloth et al., 2013; Prum et al., 2015) as well as an increasing number of

invertebrate groups (Blaimer et al., 2015; 2016a; Branstetter et al., 2016; Faircloth et

al., 2015). We applied similar methods within Schistosomatidae, representing the

148

first application of this technology within a parasitic helminth system, to resolve

schistosome interrelationships and address long standing questions of schistosome

evolution.


Taxon sampling

Specimens used for this study are vouchered at the Museum of Southwestern

Biology, Parasite Division in Albuquerque New Mexico USA. Locality information,

host data and museum accession numbers are summarized in Additional File 1.

Schistosome samples were collected using standard parasitological procedures as

described in Brant and Loker (2009) and Ebbs et al. (2016). Specimens used for this

study were collected between 1999- 2017, and primarily preserved in 95% ethanol,

but some were also saved in RNAlater. For the sequence capture experiments, 13 of

the 14 named genera (and 3 as yet unnamed) were selected.

Sequence capture of ultra-conserved elements

19 samples were selected for targeted sequence capture of UCEs, specifically to

address relationships across Schistosomatidae and resolve deeper nodes that have

evaded phylogenetic placement in previous studies (i.e. Macrobilharzia, HS clade).

A custom bait set (18,550 baits, 120 nucleotides in length, 2X tiling density) was

designed using Schistosoma mansoni as a reference genome. Approximately 4,000

UCE loci were targeted. The bait set was manufactured by Arbor Biosciences

(www.arborbiosci.com).

Obtaining template DNA of sufficient quantity and quality proved to be a

significant challenge and limiting factor. Thus, several different extraction protocols

and modifications to sample preparation were used. Most samples were extracted

149

using silica-based columns from either the QIAamp DNA Micro Kit (Qiagen), which is

optimized for small amounts of tissue, or the DNeasy Blood and Tissue kit (Qiagen).

Additionally, organic extraction (E.Z.N.A. Mollusc DNA kit, Omega) and Hot Shot

Lysis (Truett et al., 2000) were also attempted. Different amounts of tissues and

worm body regions were also extracted to optimize extraction efficacy and reduce

host contamination. Samples were quantified using Qubit Fluorometric quantification

(Thermo Fisher) using the manufacturers buffers and following recommended

protocol. Samples selected for sequence capture ranged from 0.31- 2.36 ng of DNA,

generally lower then the 1 ng recommendation from MyBaits (MYbaits® Manual v.

3.02). Sample quality was assessed using a Bioanalyzer, however DNA quantity

was generally too low to accurately gauge fragment size. Across samples, fragment

size was not equal, with some samples showing significant amounts of degradation

and others relatively little. Measures were taken to avoid further degradation (i.e.

excluding vortexing, minimizing thawing/re-freezing of samples).

Library enrichment procedures for the MYcroarray MYBaits kit (MYbaits® Manual

v. 3.02) were followed, but with several modifications to the standard sequence

capture and library preparation protocols to accommodate low amounts of DNA and

variable fragment size. Our samples were divided into two distinct sequence capture

experiments and sequencing runs (R1 and R2), methods varied across R1 and R2

allowing for the comparison (Table 1). R1 used a standard sticky-end library

preparation coupled with standard amplification polymerase. R2 employed blunt end

library preparation chemistry and a uracil non-stalling amplification polymerase. This

step was done to reduce adapter dimers, which were abundant in R1 samples. For

all runs a size-selection step following library preparation was not preformed due to

such low DNA quantity. Between R1 and R2, hybridization temperatures were

150

modified (62C or 65C, respectively). Post-capture libraries were amplified for 12

cycles. Sequencing of paired-end, 100 bp read was conducted on a HiSeq 2000.

Processing and alignment of UCE data

Quality control of the raw reads included trimming adapter contamination and low

quality bases from reads, using the program Trimmomatic (Bolger et al., 2014) with

slide window size 4 bp and quality score 20, minimum read length 36 bp. Clean

reads were processed following the PHYLUCE software package (Faircloth, 2016).

The PHYLUCE workflow includes contig assembly using Trinity (Grabherr et al.,

2011), assembled contigs were then matched to the probe set using lastz (Harris,

2007). For species that have genome sequences, their genome sequences were

downloaded from NCBI ftp site. Where species had no draft genome assembled, but

SRA data available, we downloaded the Sequence Read Archive (SRA)

(https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3013647/) using the NCBI SRA-

toolkit (https://trace.ncbi.nlm.nih.gov/Traces/sra/sra.cgi?view=toolkit_doc). The SRA

data were converted to fastq format (fastq-dump in SRA toolkit) and trimmed

following same steps described above. Draft genome sequences were assembled

using MEGAHIT program (Li et al., 2015). UCE loci were mined from genome

sequences following the PHYLUCE protocol. An incomplete data matrix was

generated including mined UCE loci and those generated by this study. Samples

with low capture success, where fewer than 100 UCE loci were recovered

(n=4) were excluded from subsequent analyses. 13 alignments of variable matrix

completeness (~82%-36%) were created using MAFFT v. 2.2.7 (Liu et al. 2011) for

28 schistosome species and 5 out-group taxa. Only a single UCE locus was shared

among all samples, as such the final trimmed and aligned datasets all incorporated

various amounts of missing data. Missing data refers to the proportion of taxa not

151

represented for a given loci. For example, the “~27% missing” dataset allows

inclusion of loci where only 24 of the 33 taxa are represented.


Shared UCE loci were mined from published genomes of 5 out-group taxa

within Digenea; Echinostoma caproni, Fascioloides gigantica, Opisthorchis viverrini,

Paragonimus westermani and Dicrocoelium dendriticum (Additional File 2). Gene

trees of the 113 best-represented UCE loci were analyzed in RaxML (Stamatakis,

2008) using ML and 500 thorough bootstrap replicates. Individual gene trees were

almost entirely unresolved at deeper nodes, and individual loci contained minimal

pairwise divergence. This, combined with the substantial amount of missing data

within our dataset, did not make our dataset ideal for robust species tree estimation

(Bayzid and Warnow, 2012; Hosner et al., 2016). We instead took a super matrix

approach and analyzed concatenated UCE loci (Faircloth, 2012; Faircloth et al.

2015, Warnow, 2015, Meiklejohn et al., 2016). ML analyses were conducted in

RaxML, using the GTRGAMMA substitution model (Faircloth, 2012; Faircloth et al.

2015). Nodal support was evaluated using thorough bootstrapping (500 replicates).

Supermatrices varied in data completeness from 82%-36% complete.

RESULTS

UCE enrichment and sequencing

Generally, we did not see a direct positive linear relationship between starting

tissue amount and recovered quantities of DNA. Multiplexed sequencing of enriched

libraries resulted in an average 6,939,218 (23,988–24,435,956) reads per sample,

with an average sequencing depth of 350X (58-1001X). An average of 44,060 (12-

442,043) contigs with a mean length of 325 bp were assembled. On average, we

152

recovered ~500 and ~1,500 UCE loci in R1 and R2 respectively. Only a single locus

was shared among all taxa. This is a much smaller recovery rate relative to

published sequence capture datasets of vertebrates (Faircloth et al., 2013; 2015;

Esselstyn et al., 2017) and the few existing studies on invertebrates (Blaimer et al.,

2016a). The unevenness of capture success among samples is likely related to the

poor starting DNA quantity and quality (Blaimer et al., 2016b).

Phylogenetic analysis

Individual alignments (n=13) of concatenated UCE loci across a spectrum of

data completeness (~82% - 36.4%) were analyzed and their likelihood scores

calculated in RaxML. Log likelihood scores decreased linearly with the amount of

missing data within our alignments (Table 2). The best score was recovered from the

82% UCE alignment (-249,913.44), based on 113 UCE loci (41,615 bp). ML

estimation of this dataset showed the following results (Figure 1A): a) statistical

support for the main Schistosoma clades (Barker and Blair, 1996; Lawton et al.,

2011; Devkota et al., 2016); b) lack of statistical support for the position of

Macrobilharzia other than that it is a sister genus to Schistosomatid W688; c) lack of

support for Ornithobilharzia (AO clade) as basal; and d) statistical support for the HS

clade basal to the DAS clade and Bilharziella basal within the DAS clade. ~79% (258

UCE loci) and ~76% (470 UCE loci) complete alignments were congruent with the

82% alignment. The resultant phylogeny from the 73% UCE alignment (Figure 1B),

based on 756 UCE loci (265,282 bp) had a much lower likelihood score relative to

the 82% alignment (-1,487,900.85, Δln = 1,237,987.41) but did resolve those

relationships not supported in the above analyses. The 73% UCE alignment

recovered the following relationships: a) Schistosoma was supported as sister to the

DAS+HS+ Macrobilharzia clade; b) Macrobilharzia and Schistosomatid W688 were

153

basal to a HS+DAS clade providing evidence for non- monophyly avian and

mammalian clades. In other words, the switch into mammals happened at least

twice; c) Bilhaziella polonica was basal to the DAS clade; d) Ornithobilharzia was

supported (AO clade, 100 bootstrap support) as a basal genus to remaining

Schistosomatidae. Alignments with ~70%-36% missing data were concordant with

the initial 82% trees in failing to resolve the placement of the AO clade and

Macrobilharzia, though the topologies were not all identical, however were not used

in subsequent treatments of the data increasing missing data may confound

phylogenetic accuracy (Wiens, 2006).

DISCUSSION

This is the first study to use UCE data and phylogenomic methods within

Schistosomatidae to address long-standing questions regarding the evolution and

interrelationships of any helminth group. This study reconstructed phylogenies

ranging from 113-2,179 UCE loci whereas prior phylogenetic investigations were

based on a maximum of four loci (Snyder and Loker, 2000; Lockyer et al., 2003;

Brant et al., 2006; Brant and Loker, 2013). UCE loci recovery and data

completeness was much reduced relative to vertebrate systems (McCormack et al.,

2013; Longo et al., 2017) and the few published invertebrate studies (Blaimer et al.,

2016a; Branstetter et al., 2016). Application of sequence capture methods (Faircloth

et al., 2012) proved challenging in a system limited because of diminutive size of the

organisms, availability of fresh material and few reference genomes. As such, the

resulting datasets contained extensive missing data, which limited downstream

phylogenetic analyses. However, despite these challenges the recovered UCE loci

were able to resolve some of the pivotal phylogenetic relationships within

154

Schistosomatidae, and shed light on long standing questions regarding schistosome

evolution. All alignments (82%-36% complete) support the HS clade as sister to the

DAS clade, supporting the probability of a secondary host capture of mammals

(Snyder and Loker, 2000). Bilharziella was consistently supported as basal within the

DAS clade which included Dendritobilharzia, Gigantobilharzia, Avian Schistosome C

& D, Allobilharzia and Trichobilharzia. The Schistosoma clade was consistently

supported including three the main clades; S. mansoni, S. hematobium and S.

japonicum. The other Asian Schistosoma were not included within this study.

Between UCE datasets there was inconsistency in regards to the placement of

Ornithobilharzia (AO clade) and the Macrobilharzia clade. The 73% UCE alignment

alone supported the AO clade as basal within Schistosomatidae, a result that has

been commonly recovered using 28S and 18S+28S+cox1 data (Snyder, 2004; Brant

et al., 2006). Secondly, only the 73% UCE alignment supported the Macrobilharzia

clade (Macrobilharzia macrobilharzia + Schistosomatid W688).

Patterns of host-use

Marine spirochiids (Spirochiidae) are the sister group to Schistosomatidae

based on traditional genetic markers (Snyder, 2004; Brant et al., 2006), suggesting

ancestral proto-schistosomes evolved from lineages infecting ectothermic marine

turtles. Patterns of host-use are discussed relative to the 73%-UCE topology, as it

was the most resolved and has general support from previously published

phylogenies (Brant and Loker, 2013). The 73%-UCE ML analysis supports

Ornithobilharzia (AO clade) as a basal, suggesting that proto-schistosomes switched

into marine birds from marine turtles, likely diversifying within Chardiiformes (Figure

2), from which they are most commonly reported (Brant and Loker, 2013). However,

members of the AO clade can also be found in species of marine Anseriformes

155

(Brant and Ebbs, unpublished data). It is likely that basal schistosome lifecycles

occurred entirely within marine environments, specifically within marine

caenogastropods. Including intermediate hosts within the families: Potamididae,

Batillariidae, Nassariidae, and Littorinidae. Brant and Loker (2013) point out that

marine habitats have been under sampled historically and may continue to be a

source of novel schistosome lineages. Our data would suggest that schistosomes

then colonized mammals diversifying into the SB clade (Figure 2). Contemporary

members of the SB clade are known to infect a range of mammalian groups:

Elephantidae, Rhinocerotidae, Bovidae, Rodentia, Hippopotamidae and Hominidae.

Intermediate host use of Bivitellobilharzia remains unknown, however proto-

Schistosoma is considered to have co-diversified with the amphibious

caenogastropod pomatiopsid snails (Davis, 1993; Snyder and Loker, 2000). Because

there are three species of Schistosoma that infect humans, the SB clade has been

well sampled relative to other schistosome clades. The SB clade represents a

substantial radiation within mammals (26 species) and relationships have been

largely resolved (Devkota et al., 2014a;2016; Lawton et al., 2011).

The 73%- UCE dataset places Macrobilharzia at the base of the DAS + HS

clade (Figure 1B). Suggesting avian host use is ancestral to the DAS+HS clade,

however it should be noted that the definitive host associations of Schistosomatid

W688 (Devkota et al., 2014b) have not been uncovered. This lineage is likely a sister

genus to Macrobilharzia, and cercaria have distinctive eyespots which is largely an

avian schistosome trait (except for the HS clade). Macrobilharzia baeri has been

described from the old world cormorants, however currently no genetic data exists.

The HS clade was supported as a basal clade to the DAS clade. Resolution of the

phylogenetic placement of Macrobilharzia and the North American mammalian

156

schistosomes (HS clade) provides evidence that a secondary host-capture of

mammals occurred among more derived genera, as first postulated by Snyder and

Loker (2000). Interestingly Heterobilharzia americana Price 1929 is known to have a

very broad definitive host range as it has been recovered from dogs, horses,

raccoons, nutria and rabbits (Lee, 1962a; 1962b). Further, species level

investigations are required to verify if H. americana is a single species and not a

complex of cryptic species.

Bilharziella polonica, which broadly infects water birds (Anseriformes,

Gruiformes, Ciconiformes, Podicipeformes) was supported as the basal genus of the

DAS clade. Bilharziella utilizes planorbid snails suggesting the ancestral host of the

DAS clade. Planorbids are important hosts within the DAS clade as well utilized by:

Dendritobilharzia, Avian Schistosome C (Pinto et al., 2017), Avian Schistosome D

(this study) and Anserobilharzia. There have been at least 8 intermediate host-

switching events (Brant and Loker, 2013) within the DAS clade (discussed in the

following section), and a stronger association with Anseriformes (Dendritobilharzia,

Avian Schistosome C, Avian Schistosome D, Anserobilharzia, Allobilharzia and

Trichobilharzia). Species diversity within the DAS clade, particularly Trichobilharzia

(~35 species, Brant and Loker, 2013), is likely in large part due to colonization of

Anseriformes. Paradoxically, Anserobilharzia and Dendritobilharzia also utilize anatid

hosts, in addition to common intermediate hosts (Gyraulus spp. and related snails),

yet genera are species poor (based on genetic data), relative to Trichobilharzia.

Intermediate host switching

The breadth of taxonomic diversity of intermediate host use within

Schistosomatidae, particularly among members of the DAS clade, is remarkable and

157

has been discussed as integral in schistosome diversification (Brant and Loker,

2013). Avian schistosomes alone are known to infect 15 families of snails (4 from

mammalian lineages), including representatives from Caenogasotropoda and

Heterobranchia. Intermediate host switching events are known to (potentially) result

in vicariance sufficient for speciation (Huyse et al., 2003; 2005). Interestingly among

schistosomes, most obviously within the DAS clade, intermediate host switching

events are marked by short inter-nodes and do not appear to be associated with

deep divergence events. This could indicate that 1) the breadth of intraspecific snail

use is not well understood, particularly within the DAS clade, 2) that schistosomes

diversified very recently and genetic differences among lineages (especially for

nuclear loci) have not had time to accumulate or 3) that schistosome lineages

maintain a certain flexibility in regards to intermediate host use that facilitates

intermediate host switching. Population level studies of schistosomes’ species

(Schistosoma japonicum; (Rudge et al., 2009; Da-Bing Lu et al., 2011),

Trichobilharzia spp. (Ebbs et al. 2016), and to a lesser extent Schistosoma mansoni

& S. hematobium (Sire et al., 1999; Theron et al., 2004; Crellen et al., 2016; Červená

et al., 2016) suggest that species maintain high genetic diversity and large effective

population sizes. For avian schistosomes this is likely the result of infecting highly

vagile hosts, which are likely to shape the demographics of individual schistosome

lineages. As a group, schistosomes were likely ancestrally parasites of migratory

marine birds (Charadriiformes: Laridae), as such they likely have a history of large

effective sizes and high genetic diversity (and thereby adaptive potential) (Blouin et

al., 1995; Blasco-Costa, 2012), which may have facilitated long-distances host-

switching (Huyse et al., 2005).

Schistosome Diversification

158

Recent efforts to describe schistosome biodiversity have demonstrated that

the DAS clade contains several unnamed genera (Brant and Loker, 2013, Brant et

al., 2017; Pinto et al., 2017). Notably many of the putative genera have been found

to have a broad geographic range and infect Anseriformes. For example, a study of

the putative new genus ‘Avian Schistosome C’ (Figure 1-3) was published (Pinto et

al., 2017) connecting populations collected from North America, South America and

Europe, in association with ducks and planorbid snails. Studies like these

demonstrate that there is still much to learn in terms of schistosome diversity.

However, as the majority of new lineages fall within the DAS clade it is unlikely that

increased taxon sampling will greatly alter phylogenetic inferences of Macrobilharzia

and the HS clade.

Studies describing novel schistosome lineages (Flores et al., 2017) also

demonstrate that intermediate host switching is ubiquitous within schistosomes,

specifically within the DAS clade, and has been an important factor in schistosome

diversification. Why some schistosome genera are species rich while others are

monotypic or species poor is an interesting question that remains unanswered. For

example, why has the HS clade failed to diversify in a similar manner, as

Schistosoma in the old world? Why did it not colonize humans? Heterobilharzia and

Schistosomatium, both monotypic genera, occur in common snail hosts

(Lymnaeidae) and broadly infect mammalian hosts. One potential explanation could

be that hominids and early members of the HS clade do not interact sufficiently in

time and/or space. Alternatively contemporary species diversity might be a poor

reflection of historical diversity, meaning that members of the HS clade might have

been reached maximum lineage diversity some time in the past. With these

considerations in mind, increased sampling at the population level of these genera

159

could inform on historical demographic patterns, species diversity and even

hybridization (Crellen et al., 2016). UCE loci have been shown to be effective at

resolving shallow time relationships, even when compared to ddRAD sequencing

methods (Leaché et al., 2015).

Without the availability of fossil data, for schistosomes and other helminth

parasites, no primary calibration points exist to estimate divergence times. As such,

Parasitologists often turn to host divergence data to derive secondary calibration

points (Jorge et al., 2018), under the assumption that parasites must have evolved

within the bounds of their hosts. This assumption might be sound where parasites

and hosts show evidence of co-phylogeny as the result of a long co-evolutionary

history, for example, among directly transmitted eco-parasites (Huyse and Volckaert,

2005; Whiteman et al., 2007; Hahn et al., 2015). However, as evident within

Schistosomatidae (Brant and Loker, 2013, this study) long distance host-switching at

the definitive and intermediate host level is common, eroding co-evolutionary

signature at the deeper nodes (Ellis et al., 2015). As such, the use of host-

divergence data should be used with great caution when applied to

Schistosomatidae. With this in mind it might be possible to provide some hard

bounds on particular nodes.

Marine spirorchiids (Spirochiidae) are the well supported sister clade to

Schistosomatidae (Snyder, 2004; Brant et al., 2006), and are known to infect marine

turtles. Based on 539 UCE loci it was estimated that living turtles (Shaffer et al.,

2017) originated during the mid-late Triassic. The snail family Nassariidae, one of the

common intermediate host families to Austrobilharzia (AO clade) is estimated to

have diverged roughly 120 mya (Galindo et al., 2016). Extant members which host

contemporary Austrobilharzia are thought to have diverged 30-40 mya.

160

Charadiiformes a primary definitive host group of the AO clade is thought to have

diverged between 23-16 mya (Baker et al., 2007). Correa et al. (2010) reconstructed

phylogenetic relationships among Lymnaeidae, and demonstrated a distinct split

among North American and Old World lymnaeids, and an accurate date for this split

could provide a hard bound on when the HS clade evolved in North America. This

does not assume that the HS clade co-diverged with North American lymnaeids, but

rather that they were unlikely to predate their hosts. Similarly the diversification of

modern ducks has been estimated to have occurred between (25-5 mya) (Sun et al.,

2017), which might be used as a hard bound on the divergence of Trichobilharzia.

Quite a bit is known, regarding the timing and origins of Schistosoma. Snyder

and Loker (2000), hypothesize Schistosoma (including S. japonicum) likely

originated in the mid-Miocene (16-11.6 mya), based largely on estimates by Davis

(1993) using fossil data to estimate the divergence of Pomatiopsidae snails, hosts to

the extant S. japonicum clade. The timing of Pomatiopsidae divergence was later

supported with genetic data which estimated divergence between 12-5 mya (Liu et

al., 2014). Using whole genome sequencing of several S. mansoni and S. rodhaini

individuals Crellen et al. (2016) estimated that these two sister species diverged

147.6-107.5 kya.

Phylogenomic considerations and future directions

Schistosomes posed several unique challenges to our phylogenomic efforts.

Firstly, across all genera, acquisition of adequate material presents inherent

difficulties. Adult worms are diminutive in size, reside in the hosts venous system

and are very fragile, often recovered as small fragments. Some species proved more

difficult than others in terms of acquiring an adequate sample of DNA and

subsequent capture success. For example Austrobilharzia and Anserobilharzia

161

yielded consistently poor DNA and had the lowest UCE capture rates, despite having

access to recently preserved tissue. In general adult worms performed the best for

recovered DNA, average number of reads, and UCE capture success. However,

among cercaria samples none of these measures improved on average by

increasing the number of individual cercaria extracted, suggesting this pattern is not

solely related to amount of starting tissue. Notably, whole adult worms often yielded

lower quantities of DNA relative to fragments of worms (Table 1).

Modifications of our sequence capture and library preparation protocols

greatly increased the recovery rate of UCE loci (a 3-fold increase). Future studies

preforming sequence capture on organisms with low quality or poor quality starting

tissues should incorporate these modifications. Additionally moving forward it would

be advisable to design a new bait kit to specifically target the most common 2,000

UCE loci recovered and increase bait tilling density to improve recovery of UCE loci.

While we were able to resolve some pivotal interrelationships within

Schistosomatidae, UCE loci proved less effective at resolving relationships than

expected based published phylogenies (Faircloth et al., 2015; Blaimer et al., 2016a).

There is no doubt that starting with DNA of low quantity and quality contributed to our

relatively poor sequence capture results, resulting in alignments that relied heavily

on missing data. However, this likely does not entirely explain the difficulties in

resolving schistosome relationships, as published studies with similarly low and

uneven recovery of UCE loci have resulted in well-resolved phylogenies (Blaimer,

2016b). Large amounts of sequence data are fairly robust to missing data

(Maddison, 1993; Wiens, 2006), and it has been demonstrated that incomplete taxon

sampling is more unfavorable to phylogenetic inference than missing data (Streicher

et al., 2016). As such, several known but unnamed genera were not included in this

162

dataset; their future inclusion may prove to increase resolution. As suggested

previously, the radiation resulting in contemporary schistosome diversity may be

particularity refractory to resolution for two possible reasons. Firstly, contemporary

genera might have radiated simultaneously and rapidly, resulting in high amounts of

incomplete lineage sorting (Maddison and Knowles, 2006), and among some genera

a hard polytomy (Maddison, 1989; Whitfield and Lockhart, 2007). Secondly,

colonization-extinction dynamics are common within parasites (Hoberg and Brooks,

2008), as such contemporary lineages might be more closely related to one or many

extinct lineages than to their most closely related extant taxa. A combination of these

factors might work in concert to make the resolution of Schistosomatidae, and

potentially other helminth taxa difficult, if not impossible to resolve.

REFERENCES Correa, A.C., Escobar, J.S., Durand, P., Renaud, F., David, P., Jarne, P., Pointier,

J.P., Hurtrez-Boussès, S., 2010. Bridging the gaps in the molecular phylogeny of the Lymnaeidae (Gastropoda: Pulmonata), vectors of Fascioloasis. BMC Evolutionary Biology 10.p. 381.

Baker, A.J., Pereira, S.L., Paton, T.A., 2007. Phylogenetic relationships and

divergence times of Charadriiformes genera: multigene evidence for the Cretaceous origin of at least 14 clades of shorebirds. Biol. Lett. 3, 205–210. doi:10.1098/rsbl.2006.0606

Barker, S.C., Blair, D., 1996. Molecular Phylogeny of Schistosoma Species Supports

Traditional Groupings within the Genus. The Journal of Parasitology 82, 292. doi:10.2307/3284163

Bayzid, M.S., Warnow, T., 2012. Estimating optimal species trees from incomplete

gene trees under deep coalescence. J. Comput. Biol. 19, 591–605. doi:10.1089/cmb.2012.0037

Blaimer, B.B., Brady, S.G., Schultz, T.R., Lloyd, M.W., Fisher, B.L., Ward, P.S.,

2015. Phylogenomic methods outperform traditional multi-locus approaches in resolving deep evolutionary history: a case study of formicine ants. BMC Evolutionary Biology 15, 271. doi:10.1186/s12862-015-0552-5

Blaimer, B.B., LaPolla, J.S., Branstetter, M.G., Lloyd, M.W., Brady, S.G., 2016a.

163

Phylogenomics, biogeography and diversification of obligate mealybug-tending ants in the genus Acropyga. Molecular Phylogenetics and Evolution 102, 20–29. doi:10.1016/j.ympev.2016.05.030

Blaimer, B.B., Lloyd, M.W., Guillory, W.X., Brady, S.G., 2016b. Sequence Capture

and Phylogenetic Utility of Genomic Ultraconserved Elements Obtained from Pinned Insect Specimens. PloS ONE 11, e0161531. doi:10.1371/journal.pone.0161531

Blasco-Costa, I.E.A., 2012. Swimming against the current: genetic structure, host

mobility and the drift paradox in trematode parasites. Molecular Ecology 21, 207–217.

Blouin, M.S., Yowell, C.A., Courtney, C.H., Dame, J.B., 1995. Host Movement and

the genetic structure of Populations of parasitic nematodes. Genetics 141, 1007–1014.

Bolger, A.M., Lohse, M., Usadel, B., 2014. Trimmomatic: a flexible trimmer for

Illumina sequence data. Bioinformatics 30, 2114–2120. doi:10.1093/bioinformatics/btu170

Branstetter, M.G., Danforth, B.N., Pitts, J.P., Faircloth, B.C., Ward, P.S., Buffington,

M.L., Gates, M.W., Kula, R.R., Brady, S.G., 2016. Phylogenomic Analysis of Ants, Bees and Stinging Wasps: Improved Taxon Sampling Enhances Understanding of Hymenopteran Evolution. bioRxiv 068957. doi:10.1101/068957

Brant, S.V., Loker, E.S., 2013. Discovery-based studies of schistosome diversity

stimulate new hypotheses about parasite biology. Trends in Parasitology 1–11. doi:10.1016/j.pt.2013.06.004

Brant, S.V., Loker, E.S., 2009. Molecular Systematics of the Avian Schistosome

Genus Trichobilharzia (Trematoda: Schistosomatidae) in North America. Journal of Parasitology 95, 941–963. doi:10.1645/GE-1870.1

Brant, S.V., Loker, E.S., Casalins, L., Flores, V., 2017. Phylogenetic Placement of a

Schistosome from an Unusual Marine Snail Host, the False Limpet (Siphonaria lessoni) and Gulls (Larus dominicanus) from Argentina with a Brief Review of Marine Schistosomes from Snails. The Journal of Parasitology 103, 75–82. doi:10.1645/16-43

Brant, S.V., Morgan, J.A.T., Mkoji, G.M., Snyder, S.D., Rajapakse, R.P.V.J., Loker,

E.S., 2006. An approach to revealing blood fluke life cycles, taxonomy, and diversity: provision of key reference data including DNA sequence from single life cycle stages. Journal of Parasitology 92, 77–88. doi:10.1645/GE-3515.1

Carstens, B.C., Knowles, L.L., 2007. Estimating Species Phylogeny from Gene-Tree

Probabilities Despite Incomplete Lineage Sorting: An Example from Melanoplus Grasshoppers. Systematic Biology 56, 400–411. doi:10.1080/10635150701405560

164

Crellen, T., Allan, F., David, S., Durrant, C., Huckvale, T., Holroyd, N., Emery, A.M., Rollinson, D., Aanensen, D.M., Berriman, M., Webster, J.P., Cotton, J.A., 2016. Whole genome resequencing of the human parasite Schistosoma mansoni reveals population history and effects of selection. Sci Rep 6, 20954. doi:10.1038/srep20954

Červená, B., Brant, S.V., Fairet, E., Shirley, M.H., Petrželková, K.J., Modrý, D., 2016.

Schistosoma mansoni in Gabon: Emerging or Ignored? Am. J. Trop. Med. Hyg. 95, 849–851. doi:10.4269/ajtmh.16-0446

Lu, D.B., Wang, T.P., Rudge, J.W., Donnelly, C.A., Fang, G.R., Webster, J.P., 2011.

Genetic Diversity of Schistosoma japonicum miracidia from individual rodent hosts. International Journal of Parasitology 41, 1371–1376.

Davis, G.M., 1993. Evolution of prosobranch snails transmitting Asian Schistosoma;

coevolution with Schistosoma: a review. Prog Clin Parasitol 3, 145–204. Devkota, R., Brant, S.V., Loker, E.S., 2016. A genetically distinct Schistosoma from

Radix luteola from Nepal related to Schistosoma turkestanicum: A phylogenetic study of schistosome and snail host. Acta Tropica 164, 45–53. doi:10.1016/j.actatropica.2016.08.015

Devkota, R., Brant, S.V., Thapa, A., Loker, E.S., 2014a. Sharing schistosomes: the

elephant schistosome Bivitellobilharzia nairi also infects the greater one-horned rhinoceros (Rhinoceros unicornis) in Chitwan National Park, Nepal. Journal of Helminthology 88, 32–40. doi:10.1017/S0022149X12000697

Devkota, R., Brant, S.V., Thapa, S., Loker, E.S., 2014b. Two avian schistosome

cercariae from Nepal, including a Macrobilharzia-like species from Indoplanorbis exustus. Parasitology International 63, 374–380. doi:10.1016/j.parint.2013.12.009

Ebbs, E.T., Loker, E.S., Davis, N.E., Flores, V., Veleizan, A., Brant, S.V., 2016.

Schistosomes with wings: how host phylogeny and ecology shape the global distribution of Trichobilharzia querquedulae (Schistosomatidae). International Journal for Parasitology 46, 669–677. doi:10.1016/j.ijpara.2016.04.009

Ellis, V.A., Collins, M.D., Medeiros, M.C.I., Sari, E.H.R., Coffey, E.D., Dickerson,

R.C., Lugarini, C., Stratford, J.A., Henry, D.R., Merrill, L., Matthews, A.E., Hanson, A.A., Roberts, J.R., Joyce, M., Kunkel, M.R., Ricklefs, R.E., 2015. Local host specialization, host-switching, and dispersal shape the regional distributions of avian haemosporidian parasites. Proc. Natl. Acad. Sci. U.S.A. 112, 11294–11299. doi:10.1073/pnas.1515309112

Esselstyn, J.A., Oliveros, C.H., Swanson, M.T., Faircloth, B.C., 2017. Investigating

Difficult Nodes in the Placental Mammal Tree with Expanded Taxon Sampling and Thousands of Ultraconserved Elements. Genome Biol Evol 9, 2308–2321. doi:10.1093/gbe/evx168

Faircloth, B.C., 2016. PHYLUCE is a software package for the analysis of conserved

165

genomic loci. Bioinformatics 32, 786–788. doi:10.1093/bioinformatics/btv646 Faircloth, B.C., Branstetter, M.G., White, N.D., Brady, S.G., 2015. Target enrichment

of ultraconserved elements from arthropods provides a genomic perspective on relationships among Hymenoptera. Molecular Ecology Resources 15, 489–501. doi:10.1111/1755-0998.12328

Faircloth, B.C., McCormack, J.E., Crawford, N.G., Harvey, M.G., Brumfield, R.T.,

Glenn, T.C., 2012. Ultraconserved elements anchor thousands of genetic markers spanning multiple evolutionary timescales. Systematic Biology 61, 717–726. doi:10.1093/sysbio/sys004

Faircloth, B.C., Sorenson, L., Santini, F., Alfaro, M.E., 2013. A Phylogenomic

Perspective on the Radiation of Ray-Finned Fishes Based upon Targeted Sequencing of Ultraconserved Elements (UCEs). PloS One 8, e65923. doi:10.1371/journal.pone.0065923

Farley, J., 1971. A review of the family Schistosomatidae: excluding the genus

Schistosoma from mammals. Journal of Helminthology 45, 289–320. Galindo, L.A., Puillandre, N., Utge, J., Lozouet, P., Bouchet, P., 2016. The phylogeny

and systematics of the Nassariidae revisited (Gastropoda, Buccinoidea). Molecular Phylogenetics and Evolution 99, 337–353. doi:10.1016/j.ympev.2016.03.019

Grabherr, M.G., Haas, B.J., Yassour, M., Levin, J.Z., Thompson, D.A., Amit, I.,

Adiconis, X., Fan, L., Raychowdhury, R., Zeng, Q., Chen, Z., Mauceli, E., Hacohen, N., Gnirke, A., Rhind, N., di Palma, F., Birren, B.W., Nusbaum, C., Lindblad-Toh, K., Friedman, N., Regev, A., 2011. Full-length transcriptome assembly from RNA-Seq data without a reference genome. Nat. Biotechnol. 29, 644–652. doi:10.1038/nbt.1883

Grégoir, A.F., Hablützel, P.I., Vanhove, M.P.M., Pariselle, A., Bamps, J., Volckaert,

F.A.M., Raeymaekers, J.A.M., 2015. A link between host dispersal and parasite diversity in two sympatric cichlids of Lake Tanganyika. Freshwater Biology 60, 323–335. doi:10.1111/fwb.12492

Hahn, C., Weiss, S.J., Stojanovski, S., Bachmann, L., 2015. Co-Speciation of the

Ectoparasite Gyrodactylus teuchis (Monogenea, Platyhelminthes) and Its Salmonid Hosts. PloS ONE 10, e0127340–20. doi:10.1371/journal.pone.0127340



Horák, P., Mikeš, L., Lichtenbergová, L., Skála, V., Soldánová, M., Brant, S.V., 2015.

Avian schistosomes and outbreaks of cercarial dermatitis. Clin. Microbiol. Rev. 28, 165–190. doi:10.1128/CMR.00043-14

166

Hosner, P.A., Faircloth, B.C., Glenn, T.C., Braun, E.L., Kimball, R.T., 2016. Avoiding Missing Data Biases in Phylogenomic Inference: An Empirical Study in the Landfowl (Aves: Galliformes). Molecular Biology and Evolution 33, 1110–1125. doi:10.1093/molbev/msv347

Huyse, T., Audenaert, V., Volckaert, F.A.M., 2003. Speciation and host-parasite

relationships in the parasite genus Gyrodactylus (Monogenea, Platyhelminthes) infecting gobies of the genus Pomatoschistus (Gobiidae, Teleostei). International Journal for Parasitology 33, 1679–1689.

Huyse, T., Poulin, R., Théron, A., 2005. Speciation in parasites: a population

genetics approach. Trends in Parasitology 21, 469–475. doi:10.1016/j.pt.2005.08.009

Huyse, T., Volckaert, F.A.M., 2005. Comparing host and parasite phylogenies:

gyrodactylus flatworms jumping from goby to goby. Systematic Biology 54, 710–718. doi:10.1080/10635150500221036

Jorge, F., Perera, A., Poulin, R., Roca, V., Carretero, M.A., 2018. Getting there and

around: Host range oscillations during colonization of the Canary Islands by the parasitic nematode Spauligodon. Molecular Ecology 65, 31. doi:10.1111/mec.14458

Khalil, L.F., 2002. Family Schistosomatidae Stiles & Hassall, 1898., in: Keys to the

Trematoda: Volume 1. CABI, Wallingford, pp. 419–432. doi:10.1079/9780851995472.0419

Lawton, S.P., Hirai, H., Ironside, J.E., Johnston, D.A., Rollinson, D., 2011. Genomes

and geography: genomic insights into the evolution and phylogeography of the genus Schistosoma. Parasites & Vectors 4, 131. doi:10.1186/1756-3305-4-131

Leaché, A.D., Chavez, A.S., Jones, L.N., Grummer, J.A., Gottscho, A.D., Linkem,

C.W., 2015. Phylogenomics of phrynosomatid lizards: conflicting signals from sequence capture versus restriction site associated DNA sequencing. Genome Biol Evol 7, 706–719. doi:10.1093/gbe/evv026

Lee, H.F., 1962a. Life history of Heterobilharzia americana Price 1929, a

schistosome of the raccoon and other mammals in southeastern United States. Journal of Parasitology 48, 728–739.

Lee, H.F., 1962b. Susceptibility of mammalian hosts to experimental infection with

Heterobilharzia americana. Journal of Parasitology 48, 740–745. Li, D., Liu, C.-M., Luo, R., Sadakane, K., Lam, T.-W., 2015. MEGAHIT: an ultra-fast

single-node solution for large and complex metagenomics assembly via succinct de Bruijn graph. Bioinformatics 31, 1674–1676. doi:10.1093/bioinformatics/btv033

Liu, L., Huo, G.-N., He, H.-B., Zhou, B., Attwood, S.W., 2014. A phylogeny for the

pomatiopsidae (Gastropoda: Rissooidea): a resource for taxonomic,

167

parasitological and biodiversity studies. BMC Evolutionary Biology 14, 29. doi:10.1186/1471-2148-14-29

Lockyer, A.E., Olson, P.D., Østergaard, P., Rollinson, D., Johnston, D.A., Attwood,

S.W., Southgate, V.R., Horak, P., Snyder, S.D., Le, T.H., Agatsuma, T., Mcmanus, D.P., Carmichael, A.C., Naem, S., Littlewood, D.T.J., 2003. The phylogeny of the Schistosomatidae based on three genes with emphasis on the interrelationships of Schistosoma Weinland, 1858. Parasitology 126, 203–224. doi:10.1017/S0031182002002792

Loker, E.S., Brant, S.V., 2006. Diversification, dioecy and dimorphism in

schistosomes. Trends in Parasitology 22, 521–528. doi:10.1016/j.pt.2006.09.001 Snyder, S. and Loker, E.S., 2000. Evolutionary relationships among the

Schistosomatidae (Platyhelminhes: Digenea) and an Asian origin for Schistosoma. Journal of Parasitology 86, 283–288.

Longo, S.J., Faircloth, B.C., Meyer, A., Westneat, M.W., Alfaro, M.E., Wainwright,

P.C., 2017. Phylogenomic analysis of a rapid radiation of misfit fishes (Syngnathiformes) using ultraconserved elements. Molecular Phylogenetics and Evolution 113, 33–48. doi:10.1016/j.ympev.2017.05.002

Maddison, W., 1989. Reconstructing character evolution on polytomous cladograms.

Cladistics 5, 365–377. doi:10.1111/j.1096-0031.1989.tb00569. Maddison, W.P., 1993. Missing Data versus Missing Characters in Phylogenetic

Analysis. Systematic Biology 42, 576–581. doi:10.1093/sysbio/42.4.576 Maddison, W.P., Knowles, L.L., 2006. Inferring phylogeny despite incomplete lineage

sorting. Systematic Biology 55, 21–30. doi:10.1080/10635150500354928 McCormack, J.E., Harvey, M.G., Faircloth, B.C., Crawford, N.G., Glenn, T.C.,

Brumfield, R.T., 2013. A phylogeny of birds based on over 1,500 loci collected by target enrichment and high-throughput sequencing. PloS One 8, e54848. doi:10.1371/journal.pone.0054848

Meiklejohn, K.A., Faircloth, B.C., Glenn, T.C., Kimball, R.T., Braun, E.L., 2016.

Analysis of a Rapid Evolutionary Radiation Using Ultraconserved Elements: Evidence for a Bias in Some Multispecies Coalescent Methods. Systematic Biology 65, 612–627. doi:10.1093/sysbio/syw014

Morand, S., Müller-Graf, C.D.M., 2000. Muscles or testes? Comparative evidence for

sexual competition among dioecious blood parasites (Schistosomatidae) of vertebrates. Parasitology, 120, 45-56.

Pinto, H.A., Pulido-Murillo, E.A., de Melo, A.L., Brant, S.V., 2017. Putative new

genera and species of avian schistosomes potentially involved in human cercarial dermatitis in the Americas, Europe and Africa. Acta Tropica 176, 415–420. doi:10.1016/j.actatropica.2017.09.016

168

Platt, T.R., 1997. Evolution of Schistosomes ( Digenea: Schistosomatoidea): The origin of dioecy and colonization of the venous system. Journal of Parasitology 83, 1035–1044.

Prum, R.O., Berv, J.S., Dornburg, A., Field, D.J., Townsend, J.P., Lemmon, E.M.,

Lemmon, A.R., 2015. A comprehensive phylogeny of birds (Aves) using targeted next-generation DNA sequencing. Nature 526, 569–573. doi:10.1038/nature15697

Rudge, J.W., Lu, D.-B., Fang, G.-R., Wang, T.-P., Basáñez, M.-G., Webster, J.P.,

2009. Parasite genetic differentiation by habitat type and host species: molecular epidemiology of Schistosoma japonicum in hilly and marshland areas of Anhui Province, China. Molecular Ecology 18, 2134–2147. doi:10.1111/j.1365-294X.2009.04181.x

Shaffer, H.B., McCartney-Melstad, E., Near, T.J., Mount, G.G., Spinks, P.Q., 2017.

Phylogenomic analyses of 539 highly informative loci dates a fully resolved time tree for the major clades of living turtles (Testudines). Molecular Phylogenetics and Evolution 115, 7–15. doi:10.1016/j.ympev.2017.07.006

Sire, C., Durand, P., Pointier, J.-P., Théron, A., 1999. Genetic Diversity and

Recruitment Pattern of Schistosoma mansoni in a Biomphalaria glabrata Snail Population: A Field Study Using Random-Amplified Polymorphic DNA Markers. The Journal of Parasitology 85, 436. doi:10.2307/3285775

Snyder, S.D., 2004. Phylogeny and paraphyly among tetrapod blood flukes

(Digenea: Schistosomatidae and Spirorchiidae). International Journal for Parasitology 34, 1385–1392. doi:10.1016/j.ijpara.2004.08.006

Stamatakis A, Hoover P, Rougemont J. 2008. A Rapid Bootstrap Algorithm for the

RAxML Web Servers. Renner S, editor. Systematic Biology.57:758–71. Streicher, J.W., Schulte, J.A., Wiens, J.J., 2016. How Should Genes and Taxa be

Sampled for Phylogenomic Analyses with Missing Data? An Empirical Study in Iguanian Lizards. Systematic Biology 65, 128–145. doi:10.1093/sysbio/syv058

Sun, Z., Pan, T., Hu, C., Sun, L., Ding, H., Wang, H., Zhang, C., Jin, H., Chang, Q.,

Kan, X., Zhang, B., 2017. Rapid and recent diversification patterns in Anseriformes birds: Inferred from molecular phylogeny and diversification analyses. PloS ONE 12, e0184529. doi:10.1371/journal.pone.0184529

Tchuem Tchuenté, L.-A., Rollinson, D., Stothard, J.R., Molyneux, D., 2017. Moving

from control to elimination of schistosomiasis in sub-Saharan Africa: time to change and adapt strategies. Infect Dis Poverty 6, 42. doi:10.1186/s40249-017-0256-8

Theron A, E.A., 2004. Molecular ecology of Schistosoma mansoni transmission

inferred from the genetic composition of larval and adult infrapopualtions within intermediate and definitive hosts. Parasitology 129, 571–585.

169

Warnow, T., 2015. Concatenation Analyses in the Presence of Incomplete Lineage Sorting. PLoS Currents. doi:10.1371/10.1371/currents.tol.8d41ac0f13d1abedf4c4a59f5d17b1f7

Whiteman, N.K., Kimball, R.T., Parker, P.G., 2007. Co‐phylogeography and

comparative population genetics of the threatened Galápagos hawk and three ectoparasite species: ecology shapes population histories within parasite communities. Molecular Ecology 16, 4759–4773. doi:10.1111/j.1365-294X.2007.03512.x

Whitfield, J.B., Lockhart, P.J., 2007. Deciphering ancient rapid radiations. Trends in

Ecology & Evolution 22, 258–265. doi:10.1016/j.tree.2007.01.012 Wiens, J.J., 2006. Missing data and the design of phylogenetic analyses. J Biomed

Inform 39, 34–42. doi:10.1016/j.jbi.2005.04.001

170

Figure 1: ML analyses of concatenated UCE loci. Phylogenies were estimated in

RaxML, GTRGAMMA+I. Black squares indicate a bootstrap support value of 100%.

(A) 82% complete (18% missing data) UCE dataset based on 110 loci (41,615 bp).

(B) 73% complete (27% missing data) UCE based on 756 loci (265,282 bp).

Dicrocoelium dendriticum

Opisthorchis viverrini

Echinostoma caproni

Fascioloides gigantica

Paragonimus westermani

Schistosoma rhodani

Schistosoma mansoni

Schistosoma mansoni

Schistosoma margebowi

Schistosoma mathetti

Schistosoma hematobium

Schistosoma curssoni

Schistosoma japonicum


Schistosomatid W688

Macrobilharzia macrobilharzia

Ornithobilharzia canaliculata

Bilharziella polonica

Avian Schistosome D Dendritobilharzia pulverulenta Dendritobilharzia pulverulenta

Gigantobilharzia huronensis




Trichobilharzia querquedulae

Trichobilharzia physellae


Trichobilharzia sp E.



Schistosomatium douthitti

Heterobilharzia americana

98

98

0.05

Dicrocoelium dendriticum

Paragonimus westermani

Opisthorchis viverrini

Fascioloides gigantica

Echinostoma caproni

Ornithobilharzia canaliculata

Schistosoma mansoni

Schistosoma mansoni

Schistosoma rhodani

Schistosoma margebowi

Schistosoma mathetti

Schistosoma hematobium

Schistosoma curssoni



Schistosomatid W688

Macrobilharzia macrobilharzia

Bilharziella polonica

Avian Schistosome D Dendritobilharzia pulverulenta Dendritobilharzia pulverulenta





Trichobilharzia sp E.






Heterobilharzia americana

Schistosomatium douthitti

95

98

A. B.

Avian Schistosome C Avian Schistosome C

171

Figure 2: Host-switching within Schistosomatidae. Important traits mapped onto

the the resolved 73% UCE phylogeny. Nodes are numbered as follows: 1= Switch

into avian hosts from an ectothermic reptilian ancestral host, 2= Switch from

Caenogastropoda into Heterobranchia, 3= Secondary host-capture of mammalian

hosts within North America, 4= Diversification within Anseriformes. Red triangles

indicate intra-host habitat shifts. Green triangles indicate switches between

Caenogastropoda into Heterobranchia. All branches have 100% bootstrap support

unless otherwise noted

172

Run Sample ID Taxa Life

stage DNA [ug]

Raw Reads

No. of contigs

No. of bp UCEs

2 W352/W340 Anserobilharzia brantae C 0.562 668,282 1,158 330,978 48 2 W396/359 Austrobilharzia variglandis A 0.704 124,242 145 35,487 6

2 W930 Bilharziela polonica A 0.31 5,572,448 17,081 5,897,771 1677

2 W813 Dendritobilharzia pulverulenta A 1.32 7,352,118 26,978 8,405,837 1737

2 W926 Dendritobilharzia pulverulenta A 2.36

25,041,972 47,498 14,794,680 1631

2 W414/513 Gigantobilharzia huronensis C 0.701 14,030,53

2 242,326 72,500,699 1650

2 W678 Gigantobilharzia huronensis C 0.65 16,867,49

6 48,623 16,046,122 1582

2 W805 Heterobilharzia americana A 2.21 16,016,29

1 442,043 139,396,85

2 1784

2 W931 Macrobilharzia macrobilahrzia A 0.944 2,182,575 3,508 1,580,643 1590

2 W393 Ornithobilharzia canaliculata A 2.5 15,222,38

5 31,569 8,873,305 1441

2 W510/511 Trichobilharzia sp. A C 0.494 2,777,802 6,715 2,136,811 1964

1 W606 Trichobilharzia sp. E A - 9,124,167 22,342 16,933 592

2 W604 Trichobilharzia physellae A 0.224 1,133,317 2,683 952,777 1753

2 W929 Trichobilharzia querquedulae A 0.674 13,523,27

1 70,532 21,183,008 1576

2 W203 Trichobilharzia querquedulae A 0.408 68,006 75 19,185 2

1 W233 Trichobilharzia stagnicolae C 0.0531 10,207,44

0 18,675 13,662 658

1 W607 Avian Schistosome C C 0.212 4,784,485 34,656 53,303 1599

2 W342 Avian Schistosome D C 1.7 3,066,693 13,126 3,804,186 171

2 W216 Schistosomatid W216 C 0.63 23,988 12 3,050 0

2 W688 Schistosomatid W688 C 0.448 6,626,793 8,006 3,890,904 1428

173

Table 1. Summary of sequence capture data. Methodologies between run 1 and run 2 are detailed within the methods section. Sample ID’s with a (/) indicates that samples were pooled in an attempt to increase DNA quantities. Schistosome life stage is indicated as A (adult) or C (cercaria).

174

Alignment % missing

data No. Loci No. bp -logLN

1 18.19% 113 41615 -249,913.44

2 21.22% 258 95215 -552,102.19

3 24.25% 470 167917 -958,990.67

4 27.28% 756 265282 -1,487,900.85

5 30.31% 1,070 372577 -2,061,422.86

6 33.34% 1,364 474081 -2581373.332

7 39.40% 1,819 627118 -3350563.131

8 42.43% 1,970 627118 -3586512.511

9 48.90% 2,006 677378 -3809408.073

10 51.50% 2,082 736137 -3841912.875

11 54.55% 2,144 743745 -3866958.204

12 60.60% 2,159 753058 -3903325.447

13 63.60% 2,179 755774 -3912154.447

Table 2. Summary of UCE alignments.

175

CONCLUSIONS

Host traits are important factors in shaping host-parasite interactions,

including, but not limited to; host immunology, physiology, demographics, range,

phylogeny and ecology. These factors are co-occurring, often across multiple

taxonomically and ecologically disparate host species, and can act to enhance or

constrain parasite population size, geographic range, transmission, and adaptive

potential. Additionally, host traits at one life stage may facilitate or reduce

transmission at another life stage, and are therefore integrative and inseparable in

shaping parasite evolution. This integrative nature is likely a characteristic of

trematode lifecycles and possibly multi-host parasites in general. This research

sought to further our understanding of how host traits impact the evolutionary

ecology of trematode systems, using schistosomes (Digenea: Schistosomatidae)

and associated hosts as a model. Research described here integrated

phylogeographic, phylogenomic, and population genetic methods, to investigate

host-parasite relationships across multiple timescales.

Much of this research focused on the schistosome genus Trichobilharzia.

Molecular phylogenetic methods were used to connect populations of Trichobilharzia

querquedulae from three continents (North America, South America, Africa) and New

Zealand. These data confirmed that T. querquedulae was a single globally

distributed species, with evidence for trans-hemispheric transmission. Further

extensive helminthological surveys of potential duck hosts revealed that T.

querquedulae maintained a specific association with Spatula (= Anas, ‘Blue-wing’

ducks) species. This relationship is likely maintained by a combination of duck host

phylogeny and ecology. There are several reasons why ecological traits specific to

Spatula species might facilitate the global transmission of T. querquedulae. Spatula

176

spp. prefer shallow, marsh habitats where they feed at the surface. These habitats

are snail rich, increasing the likelihood of transmission between the snail

intermediate host (Physa spp.) and Spatula spp. Further one member of Spatula (S.

clypeata) is Holarctic in its distribution, and is known to migrate (at a lower

frequency) into the Southern hemisphere as part of its wintering range. Molecular

data confirms that endemic, non-migratory, Spatula spp. transmit T. querquedulae

within the Southern hemisphere, and may suggest that S. clypeata migration

facilities trans-hemispheric gene flow. The global transmission of T. querquedulae is

likely made possible by (though not confirmed) the global invasion of its snail host

Physa acuta. Data from this study suggest that certain definitive and intermediate

host combinations may act in concert to facilitate Trichobilharzia transmission,

supporting the integrative nature of schistosome lifecycles.

The observation of specificity between T. querquedulae and Spatula spp. was

unexpected as Trichobilharzia species were thought to non-specifically infect anatid

hosts (Anatidae: ducks, geese and swans). A closely related species T. physellae is

known to infect Passeriformesand Columbiformes under experimental conditions and

other Trichobilharzia species are reported from a broad range of anatid hosts. Using

the terminology of Combes (1999), these reports suggest that Trichobilharzia

maintains a wide compatibility filter. As such, the broad potential host range of T.

querquedulae indicates that the encounter filter is narrowed. Host specificity

observed between T. querquedulae and its definitive hosts led to more directed

comparative studies of North American Trichobilharzia species and their host

associations.

Surveys of Trichobilharzia and their duck hosts resulted in the finding that

some level of host specificity was common among Trichobilharzia species and their

177

duck hosts. It was found that measures of host specificity including duck ecological

group often better captured duck host associations than considering host taxonomy

alone. One of the most interesting findings was that T. physellae, which was

considered a generalist using traditional measures of host specificity, was found to

be specific to ‘diving ducks’, when duck ecological group was considered. Diving

ducks represent an ecological group within Anatidae, characterized by feeding

behavior and habitat preferences. Trichobilharzia physellae was found to infect its

most common host (Aythya affinis) at a much lower rate (26%) relative to T.

querquedulae within its most common host (Spatula discors, 90%). This is likely the

result of decreased transmission success within the deeper water bodies (less

interaction with intermediate host) that diving ducks occupy.

This research also compared population genetic and phylogeographic

patterns among North American Trichobilharzia species found to be specific to either

dabbling or diving ducks; T. physellae (diving ducks), T. querquedulae (dabbling

ducks, Spatula spp.) and Trichobilharzia sp. A (dabbling ducks, Anas americana).

Importantly both T. physellae and T. querquedulae infect Physa spp. as their

intermediate host, which unites these species in ecological space and time.

Comparison of congeneric Trichobilharzia species revealed that different host

species structured parasite populations in different ways. Trichobilharzia physellae

populations appear to be structured in relation to the migratory flyways used by their

duck hosts, which is a common pattern found among symbionts of philopatric ducks.

Spatula spp. are less philopatric relative to Aythya as such migratory flyway does not

seem to impact the population structure of T. querquedulae. Instead we found an

association with latitude, which is likely a proxy for breeding versus wintering ground.

Genetic diversity among the three species was variable, the highest values of which

178

were found in T. querquedulae and Trichobilharzia sp. A, possibly suggesting an

advantage to concentrating numbers within a narrow range of hosts (specialization).

The effective size of T. querquedulae was found to be over 3X greater than the other

two species. In sum this work demonstrated that Trichobilharzia-duck associations

are more specific than previously thought, and that individual duck hosts or host

groups can differentially impact Trichobilharzia microevolutionary patterns.

Along a similar vein phylogeographic, population genetic and demographic

patterns of an important intermediate host Physa acuta were estimated. Physa acuta

transmits at least three schistosome species (T. querquedulae, T. physellae and

Gigantobilharzia huronensis) as well as numerous other trematode species in North

America. This snail is of particular importance as it is now global in distribution, as

the result of a 200+ year invasion process. This research had two parts, 1)

characterize phylogeographic and population genetic patterns to reconstruct the

invasion history of P. acuta and 2) test the ‘Enemy-release hypothesis. Increased

sampling from the native range of P. acuta (North America), particularly from the

Western USA, provided greater insight into the phylogeography of P. acuta allowing

for identification of source populations. Using published parasitological surveys of P.

acuta in combination with those carried out for the purposes of this research we

found limited evidence of trematodes infecting invasive P. acuta (as first intermediate

host), supporting the ‘Enemy-release’ hypothesis. The few cases of trematode

infection that were found were in association with invasive populations in the oldest

and most genetically diverse regions of the invasive range. A significant positive

correlation, between time since invasion, genetic diversity, and being colonized by

local parasites was found. These results have significant implications for modeling

host-parasite invasion dynamics over time, and more broadly understanding how

179

host traits might mediate parasite assembly. This data suggests that host

demographic parameters (nucleotide diversity, effective population size) are

important predictors of parasite assembly within invasive populations.

Apart for understanding host-parasite associations at the microevolutionary

level, this research also sought to characterize patterns at the macroevolutionary

level within Schistosomatidae. Evolutionary relationships within Schistosomatidae

have historically lacked resolution, impeding a clear appreciation for patterns of host

use. This research applied sequence capture technology to target ultra-conserved

elements (UCE loci) for phylogenomic analyses, to specifically resolve phylogenetic

placement of pivotal genera and identify host-switching events. Increased resolution

in regards to the North American mammalian schistosomes was found, which

supported that a secondary host capture occurred. Additionally, within the derived

avian clade where the majority of species diversity occurs, we find evidence for high

amounts of intermediate host switching. Suggesting that, 1) intermediate host

switching was an important mechanism of schistosome diversification and 2) an

overall lack of co-phylogenetic structure among schistosomes and their snail hosts.

Largely phylogenetic resolution was poorer than expected based on published

UCE phylogenies of vertebrate and some invertebrate taxa. There are likely several

reasons for this, which require further investigation. Firstly, sequence capture

success reported within this research is on average lower, and substantially more

uneven, relative to published studies. Decreased capture success was likely due to

poor DNA starting quantity and quality, which likely affected downstream

phylogenomic analyses. There is also the possibility, though not mutually exclusive,

that some nodes within Schistosomatidae may never be resolved. Previous authors

have suggested that Schistosomatidae underwent a rapid radiation, which might

180

have resulted in a hard polytomy. Generally UCE loci recovered contained very few

informative sites, and suggested high amounts of incomplete lineage sorting.

This research investigated different host traits across different life stages and

time scales to determine their role shaping host-parasite relationships. We found

evidence for specificity within Trichobilharzia in regards to definitive host use, and

more specifically that duck habitat preferences may substantially impact

Trichobilharzia transmission and demographic patterns. Similarly host demographics

may play an integral role in parasite assembly under invasion conditions. In total

these data support that host traits are important mediators of host-parasite

relationships, and that host traits across life-stages are integrated often acting in

concert to enhance or constrain parasite transmission.

181

APPENDIX A

CHAPTER II ADDITIONAL FILES

Additional File 1. cox1 phylogeny of Physa estimated using Bayesian

inference. Posterior probability values ≥.95 are shown. Taxon names are reflective

of the names assigned to sequences in the original NCBI records.

182

Additional Figure 2. Concatenated 16+cox1 phylogeny. Branch support values

≥.95/70 (PP/BS) are shown. Taxon names are reflective of the names assigned to

sequences in the original NCBI records.

183

Additional File 3. ITS1 phylogeny estimated using Bayesian inference pdf.

Physa acuta samples are colored according to the clade they were recovered from

based on mitochondrial gene tree analysis: pink = Clade A, green = Clade B. Physa

acuta taxa labeled as black did not group within P. acuta based on mitochondrial

gene trees, and were excluded from all in-group analyses (S17, S120 and all P.

zionis samples). ITS1 data only exists for HQ283259 and Pacuta_18S/ITS and were

therefore not included in mitochondrial gene tree analyses. Posterior probabilities are

illustrated as branch support values.

185

Additional Figure 4. 16S in-group analysis. Taxa are colored according to the

FWEC they were collected from. Phylogeny (A) was generated using ML methods

and phylogeny (B) was generated using BI. Branch support values ≥ 70 bootstrap

(A) and ≥ .95 posterior probabilities (B) are denoted by a black circle

186

Time (kya)

A.

B.

C.

1

10

100

1000

10000

100000

0 10 20 30 40 50 60

NAM 1%

NAM 0.04%

NAM 4%

EUR 1%

EUR 0.04%

EUR 4%

SAM 1%

SAM 0.04%

SAM 4%

AFOC 1%

AFOC 0.04%

AFOC 4%

1

10

100

1000

0 10 20 30 40 50 60 70

A 1%

A 0.04%

A 4 %

B 1%

B 0.04%

B 4%

TOT 1%

TOT 0.04%

Total 4%

1

10

100

1000

10000

0 5 10 15 20 25 30

ATL 1%

ATL 0.04%

ATL 4%

COA 1%

COA 0.04%

COA 4%

COL 1%

COL 0.04%

COL 4%

MISS 1%

MISS 0.04%

MISS 4%

RIO 1%

RIO 0.04%

RIO 4%

187

Additional File 5. Bayesian Skyline Plots. Effective size over time plots estimated

in BEAST using a Bayesian Skyline prior, mean values are shown and confidence

values were excluded for clarity. Three mutation rates (per million year): 1% (solid

line), 0.04% (dashed line) and 4%(circle line) were tested. (A) Range-wide estimates

for North America (NAM, dark grey, n=79), Central and South America (SAM, lime

green, n=13), Eurasia (EUR, pink, n=49) and Africa and Oceania (AFOC, blue, n=7).

North America dataset ran for 50,000,000 generations, Eurasia 20,000,000

generations, Central/South America and Africa/Oceania ran for 5,000,000

generations. B. Estimates by FWECs sampled: Rio Grande (RIO, red, n=16),

Coastal (COA, blue, n=13), Colorado (COL, purple, n=11), Atlantic (ATL, orange,

n=9), Mississippi (MISS, green, n=26), the Great Basin and St. Lawrence FWECs

were excluded because of low sample size. All FWEC datasets were run for

5,000,000 generations, with the exception of Atlantic (3,000,000). C. Estimates of

recovered Clades, Clade A (A, aqua, n=116) and B (B, dark green, n=33) compared

to total (TOT, light grey, n=149). The total dataset and Clade A ran for 80,000,000

generations, Clade B ran for 10,000,000 generations. Bayesian skyline plots were

constructed in TRACER, the data was exported and visualized using Excel.

188

APPENDIX B

CHAPTER III ADDITIONAL FILES

Additional File 1. Locality information for TQ, TP and TA. Migratory flyways (MWF). Voucher material housed at the Museum of Southwestern Biology, Parasite Division (MSB:Para).

189

Specimen ID Locality MFW Latitude: Longitude Date Host Species

MSB:Para: # Source


W135

Lousiana: Rockefeller Wildlife Refuge M

29.67304, -92.689902 11/15/2003 Anas clypeata 183

Brant and Loker 2009; Ebbs et al. 2016

W135.2


29.67304, -92.689902 11/15/2003 Anas clypeata 183 This Study

W137


29.67304, -92.689902 11/15/2003 Anas discors 19497

Brant and Loker 2009; This Study

W137.2


29.67304, -92.689902 11/15/2003 Anas discors 19497 This Study

W138



W138.3



W140

Lousiana: Timberton Hunt Club M


W142

Lousiana: Timberton Hunt Club M

30.1705, -90.868 11/13/2003 Anas discors 19502

Ebbs et al. 2016; This Study

W148.1 New Mexico: San Marcial C

33.7131, -106.9579 3/25/2004

Anas cyanoptera 18584


190


33.7131, -106.9579 3/25/2004









W153 New Mexico: San Marcial C

33.7131, -106.9579 4/6/2004 Anas clypeata 18587



33.7131, -106.9579 4/6/2004

Anas cyanoptera 18588 This Study


33.7131, -106.9579 4/6/2004



33.7131, -106.9579 4/6/2004




33.7131, -106.9579 4/6/2004

Anas cyanoptera 18589 Ebbs et al. 2016


33.7131, -106.9579 4/6/2004


Brant and Loker 2009; Ebbs et al. 2016; This Study

W156 New Mexico: Bitter Lake C 33.45, -104.4 4/11/2004 Anas discors 18590


W157 New Mexico: Bitter Lake C 33.45, -104.4 4/11/2004 Anas clypeata 18591 This Study

W158 New Mexico: Bitter Lake C 33.45, -104.4 4/12/2004 Anas clypeata 18592

Brant and Loker 2009

W159 New Mexico: Bitter Lake C 33.45, -104.4 4/12/2004 Anas discors 18593 This Study

191

W160 New Mexico: Bitter Lake C 33.45, -104.4 4/12/2004 Anas discors 18594


W161 New Mexico: Bitter Lake C 33.45, -104.4 4/12/2004


W162 New Mexico: Bitter Lake C 33.45, -104.4 4/12/2004 Anas clypeata 18602




W167 New Mexico: San Marcial C

33.7131, -106.9579 9/9/2004 Anas discors 26231


W180

California: Wister Unit Waterfowl Area P

33.284266, -115.57921 11/24/2004



W181 California: Imperial County P

33.284266, -115.579216 2004

Anas americana 18572 This Study

W183


33.284266, -115.57921 11/24/2004 Anas clypeata 18575


W188


33.284266, -115.57921 11/24/2004


W190


33.284266, -115.57921 11/24/2004 Anas discors 18582


W191


33.284266, -115.57921 11/24/2004


W203 Alaska: Yukon-Koyukuk Borough P

65.665, -149.098

5/29/2005

Anas clypeata 18636 Brant and Loker 2009

192


67.13369, -150.35594

5/30/2005

Anas clypeata 18637 This Study


67.492186, -149.86944

5/30/2005

Anas clypeata 18640 This Study

W2135 Alaska: North Slope Borough P


W259 New Mexico: Bitter Lake C 33.45, -104.4 3/17/2006 Anas discors 19515 This Study

W345

Manitoba: Churchill, Goose Creek M

58.67583, -94.1677 8/3/2007 Anas clypeata 18626


W345.2



W345.3



W650 South Africa: Free State Province SH

-29.208716, 27.18945 1/13/2012 Anas smithii 18990 Ebbs et al. 2016

W664 South Africa: Free State Province SH

-29.14433, 27.02565 1/21/2012 Anas smithii 19000 Ebbs et al. 2016

W698 North Dakota C - - Anas clypeata - This Study

W703

New Zealand, South Island, Lake Benmore SH

-44.35124, 170.2091 12/31/2012

Anas rhynchotis - Ebbs et al. 2016

W704

New Zealand, South Island, Lake Benmore SH

-44.35124, 170.2091 12/31/2012

Anas rhynchotis 20793 Ebbs et al. 2016

W743 New Mexico C - - Anas clypeata - This Study

W746 Florida: Hamilton County A

30.42307, -82.7936 1/12/2013 Anas clypeata - This Study

193








30.42307, -82.7936 1/12/2013 Anas discors - This Study

W750.2 Florida: Hamilton County A
















W758 New Mexico: Eddy County C


W762 Florida: Palm Beach County A


W763 New Mexico: San Juan County C


194





W767.2 Florida: Palm Beach County A






W771 Alaska: Fairbanks North Star Borough P


W774

Minnesota: Polk County M


W775

Minnesota: Polk County C


W776



W777



W778



W779



W814



W815



W816



195

W816.2



W831 Argentina: Corrientes SH

-30.0999, -59.49915 6/1/2013 Anas versicolor 23178 This Study

W833 Argentina: Corrientes SH

-30.0999, -59.49915 6/1/2013 Anas versicolor 23180


W845 New Zealand: South Island SH

-44.568863, 170.1872 5/24/2015

Anas rhynchotis 24887 This Study

W846 New Zealand: South Island SH

-44.568863, 170.1872 5/24/2015

Anas rhynchotis 24888 This Study

W857 North Carolina: Hyde County A 1/15/2016 Anas clypeata - This Study

W925 Puerto Rico A - - Anas discors - This Study

E64 Florida A - 10/1/2002 Anas discors 24777


E45 Florida A - 10/1/2002 Anas discors 24778 Brant and Loker 2009

E45.2 Florida A - 10/1/2002 Anas discors - Ebbs et al. 2016

SDS1006 Nebraska C - 11/1/2004 Anas clypeata 24776


TshovNZ New Zealand: South Island SH

Anas rhynchotis 20794 Ebbs et al. 2016

W413 Minnesota: Ramsey County M

45.0684361, -93.1257 6/17/2009 Physa gyrina 186 Brant et al. 2011


W146 New Mexico: Soccoro County C

33.7131, -106.9579 3/25/2004 Physa gyrina -



33.7131, -106.9579 3/25/2004 Physa gyrina -


196


33.7131, -106.9579 3/25/2004 Anas strepera 18586


W171 Pennsylvania: Erie County A

41.170333, -80.086883 11/10/2004 Aythya affinis 18565


W175 Pennsylvania: Crawford County A

41.59215, -80.4093666 11/10/2004

Anas platyrhynchos 18567


W176 Pennsylvania: Crawford County A

41.59215, -80.4093666 11/10/2004

Anas platyrhynchos 18568 This Study

W193 New Mexico: Chaves County C 33.45, -104.4 2005 Aythya affinis 18610

Brant and Loker 2009; This study

W194 New Mexico: Chaves County C 33.45, -104.4 2005 Aythya collaris 18611





68.64636, -149.44891 2005

Clangula hyemalis 18644 This Study


68.98204, -148.83182 2005 Aythya affinis 18645


W230I1I2 Mergus merganser eggs MI M

45.581, -84.697 2005

Mergus merganser -


W234 Michigan: Emmet County M

45.581, -84.697 2005 Physa gyrina 18656



45.581, -84.697 2005 Physa gyrina 18657



45.581, -84.697 2005 Physa gyrina 18658


W249 Nevada: Churchill County P

39.9, -118.8166 2005

Aythya valisineria 18554


W255 New Mexico: Chaves County C 33.45, -104.4 2006

Bucephala albeola 19159


197



W263 New Mexico: Sandoval County C

35.8485, -106.4907 2006 Physa gyrina 178



33.79336, -106.8912 2008 Physa gyrina 18686 This Study

W497 New Mexico: Bernalillo County C

35.2166138, -106.59698 2009 Physa acuta 18700 This Study

W602 Alaska: Fairbanks P - 2011 Bucephala albeola 25267 This Study

W604 Alaska: Fairbanks P - 2011 Bucephala clangula 25269 This Study

W608 Alaska: Fairbanks P - 2011 Aythya collaris 25260 This Study


30.42307, -82.7936 1/12/2013 Aythya collaris - This Study


33.79336, -106.8912 2014 Aythya affinis - This Study

W765.3 New Mexico: Soccoro County C








MGC804 Alberta C - - Physa gyrina - Gordy et al. 2016

SAL92-09 Canada: Alberta C - - Aythya americana - This Study


198

W149.1 New Mexico: Socorro County C

33.7131, -106.9579 2004

Anas americana 18585


W149.2 New Mexico: Socorro County C

33.7131, -106.9579 2004


W182.1 California: Imperial County P

33.284266, -115.579216 2004



W182.2 California: Imperial County P

33.284266, -115.579216 2004

Anas americana -

W192 New Mexico: Sierra county C

32.9071, -107.3116 2004



W206 Alaska: Yukon-Koyukuk Borogh P

67.4093611, -150.104883 2005


W206.2 Alaska: Yukon-Koyukuk Borogh P

67.4093611, -150.104883 2005

Anas americana 18639 Ebbs et al. 2016


68.98204, -148.8318 2005



W213.2 Alaska: North Slope Borough P

68.98204, -148.8318 2005


W510 New Mexico: Colfax county C

36.46363, -105.2733 2011

Stagnicola elodes 18705 This Study

W510.2 New Mexico: Colfax county C

36.46363, -105.2733 2011



36.46363, -105.2733 2011


W511_2 New Mexico: Colfax county C

36.46363, -105.2733 2011



36.46363, -105.2733 2011


W600 Alaska: Fairbanks P - 2011 Anas americana 25265 This Study

199

W601 Alaska: Fairbanks P - 2011 Anas americana 25266








VVT3043 North Dakota C - - Anas americana -


200

p-

distance

Taxa CO1 ND4 ITS1 Trichobilharzia querquedulae 0.01 0.014 0.002

vs. T. querquedulae like 0.047 0.035 -

vs. T. physellae 0.095 0.133 0.012

vs. Trichobilharzia sp. A 0.112 0.1 0.009

vs. T. franki 0.075 - 0.016

vs. Trichobilharzia sp. C 0.089 - 0.034

vs. W701 0.098 - 0.014

vs. T. regenti 0.125 0.129 0.337

vs. T. mergi 0.116 - -

vs. T. anseri 0.13 - -

vs. T. stagnicolae 0.121 - -

vs. T. szidati 0.106 - -

vs. Anserobilharzia brantae 0.141 - -

Trichobilharzia querquedulae - like - 0.036 -

Trichobilharzia phsyellae 0.009 0.034 0.006



vs. T. franki 0.081 - 0.014


vs. W701 0.066 - 0.016

vs. T. regenti 0.1 0.163 0.333

vs. T. mergi 0.131 - -

vs. T. stagnicolae 0.143 -

vs. T. anseri 0.126 - -



Trichobilharzia sp. A 0.014 0.007 0.003


vs. T. franki 0.096 - 0.011


vs. W701 0.097 - 0.008

vs. T. regenti 0.116 0.127 0.333

vs. T. mergi 0.124 - -

vs. T. anseri 0.135 - -




Trichobilharzia sp. B 0.01 0.16 0.002



vs. T. physellae 0.103 0.159 0.01

vs. T. querquedulae 0.094 0.139 0.013

vs. T. fanki 0.081 - 0.008

Trichobilharzia franki 0.004 - 0.001


vs. W701 0.091 - 0.026

vs. T. regenti 0.093 - 0.34

vs. T. mergi 0.114 - -

vs. T. anseri 0.129 - -



201


Trichobilharzia regenti 0.002 - 0.011

vs. T. mergi 0.111 - -

vs. T. anseri 0.116 - -




Trichobilharzia mergi 0 - -

Trichobilharzia anseri 0.003 - -

Trichobilharzia stagnicolae 0.007 - -

Trichobilharzia szidati 0.008 - -

Anserobilhariza brantae 0.013 - -

vs. Allobilhariza visceralis 0.143 - -

Allobilharzia visceralis 0.01 - -

Additional File 2. Pairwise p-distances within and between Trichobilharzia species.

202

Additional File 3. nad4 Phylogeny. BI inference of TQ, TP and TA, only posterior


TP=green and TA=blue. Individual worms are labeled by the migratory flyway they

were collected from, denoted by a colored box. Average pairwise p-distances

between TQ subclades are indicated.

203

Additional File 4. ITS1 Phylogeny. BI inference of TQ, TP and TA, only posterior


TP=green and TA=blue.

204

W137 W752

W756.2 W162 W767.4 W743

W925 W748

W750.2 W203

W190 W183 SDS1006 W156 W159

W154.2 W750

W160 W180

W753 W777 W166.2

W664 W213 W831 W259

W833 W747

W778 E45 W774

W148.2 W154 W191 W152.4 W704

W153 W158

W746 W703

W749 W161 W181

W754 W756

W148 W767.3 W155.3

Tshov W755.2 W135 W142

Trichobilharzia sp. C

W701 W604

W194 W497 W234 W235

W193 W602

W249

W510 W608 W230

W211 W213

W146 W147 W236 W745

W196 W765.3

W765.6 W765 W765.5 W765.4 W256 W171 W175 W255 W263

W149 W212

W601 W609 W182

W192 W600 W511 W607

.97

.97

.99

0.02


Trichobilharzia sp. B


Pacific

Central

Mississippi

Atlantic S. Hemisphere

205

Additional File 5. nad4 + cox1+ ITS1 phylogeny. BI inference of TQ, TP and TA,

only posterior probabilities ≥.95 are presented. Branches are colored by species;

TQ= orange, TP=green and TA=blue. Individual worms are labeled by the migratory

flyway they were collected from, denoted by a colored box.

206

Additional File 6. Minimum spanning network, showing relationships of TP

haplotypes by host genera.

207

Additional File 7. Minimum spanning network, showing relationships of TQ

haplotypes by host species.

208

Additional File 8. Bayesian skyline plot of cox1 datasets, all mutation

rates. Estimates of Ne (y-axis) over time (kya, x-axis), using a 2%(dashed line) and

4% (solid line) rate of cox1 change. TA populations were further subdivided by

flyway as significant among flyway divergence was suspected. Lines are colored by

species; TQ= orange, TP=green and TA=blue.

209


Pacific Central Mississippi Atlantic S. Hemisphere

AK CA NM NE ND MB MN LA FL PR AR ZA NZ

AK /

CA 0.03448 /

NM 0.10577 -0.02813 /

NE 1 -0.4 -0.34135 /

ND 0.71429 0.06728 -0.02875 0.5 /

MB 0.18519 0.39558** 0.38637* -0.04762 0.35 /

MN 0.2381 -0.00378 -0.02657 -0.23077 -0.09615 0.3543 /

LA -0.02703 -0.04893 0.00183 -0.31034 0.08042 0.39144 0.0293 /

FL -0.10238 -0.0388 -0.0066 -0.43789 -0.08456 0.29923** -0.04908 -0.02889 /

PR 1 0.5942 0.55854 1 0.85714 0.46341 0.64444 0.54217 0.3987 /

AR 0.5 0.0884 0.02967 0.2 0 0.34783 -0.03125 0.1289 -0.03954 0.73333 /

ZA 1 -0.47368 -0.56157 1 -1 -0.15789 -1 -0.40741 -0.5938 1 -1 /

NZ 0.37931 0.21437* 0.14928 0 0.04545 0.40517* 0.10526 0.17263* 0.10268* 0.64706 0.07692 -0.63636 /


Pacific Central Miss Atlantic

AK CA NM AB MI PA

AK /

CA -0.7193 /

NM 0.29524** 0.11111 /

AB -0.30667 1 -0.85507 /

MI 0.0582 -0.66667 0.24159** -0.33333 /

PA 0.12695 1 -0.25703 0 0.11111 /

Additional File 9. Pairwise ΦST values by flyway for TQ and TP. (*) indicates a p-value ≤ 0.05, (**) indicates a p-value ≤ 0.01.

210

Specimen ID Locality Host Species

MSB: Para: # NCBI Source

Trichobilharzia sp. B

W205 Alaska Anas americana 18638 ─ This study

W210 Alaska Anas americana 18643 ─ This study


W164 New Mexico Stagnicola elodes 18659 FJ174461 Brant and Loker, 2009

W221 Michigan Mergus merganser 18649 ─ Brant and Loker 2009; This study

W222 Michigan Mergus merganser 18650 KP734304 Brant and Loker 2009


W224 Michigan Stagnicola emarginata 18652 ─ Brant and Loker 2009; This study

W225 Michigan Stagnicola emarginata 19505 ─ Brant and Loker 2009; This study

W229 Michigan Stagnicola emarginata 179 FJ1744543 Brant and Loker 2009



W240 Michigan Stagnicola emarginata 18673 FJ174462 Brant and Loker, 2009


BERS1 France Radix auricularia ─ HM131199 Jouet et al. 2010

EAN77 France Radix auricularia ─ HM131201 Jouet et al. 2010

BERS67 France Radix auricularia ─ HM131200 Jouet et al. 2010

STRS2 France Radix auricularia ─ HM131202 Jouet et al. 2010

FORS3 France Radix auricularia ─ HM131198 Jouet et al. 2010

FORS4 France Radix auricularia ─ HM131197 Jouet et al. 2010


ACI25 Iceland Anas platyrhynchos ─ HM439504 Jouet et al. 2010

BERS58 France Anas platyrhynchos ─ HM439502 Jouet et al. 2010

211

HAR1 France Mergus merganser ─ HM439501 Jouet et al. 2010

CYA18 France Cygnus olor ─ HM439500 Jouet et al. 2010

AC122 Iceland Anas platyrhynchos ─ HM439503 Jouet et al. 2010

EAN9 France Radix peregra ─ HM439499 Jouet et al. 2010

AY157190 Czech Republic Radix peregra ─ AY157190 Lockyer et al. 2003

Trichobilharzia szdati

Lsk2 Siberia Lymnaea stagnalis ─ JF838203 Korsunenko et al. 2012

Lsm20 Siberia Lymnaea stagnalis ─ JF838202 Korsunenko et al. 2012






AY157191 Czech Republic Lymnaea stagnalis ─ AY157191 Lockyer et al. 2003

Trichobilharzia anseri

ANS41 France Anser anser ─ KP901385 Jouet et al 2015




FCI1 Iceland Radix balthica ─ KP901381 Jouet et al 2015

ICR9 Iceland Radix balthica ─ KP901380 Jouet et al 2015

Additional File 10. Trichobilharzia samples included in estimates of species wide diversity

212

APPENDIX C CHAPTER IV ADDITIONAL FILES

Taxa Sample ID Host Locality Lat:Long

MSB: PARA: #

Anserobilharzia brantae W340/352 Branta canadensis Manitoba, CAN 58.7419, -93.9747 176/18628

Austrobilharzia variglandis W697 Larus argentatus Quebec, CAN 48.674, -66.237 -

Bilharziella polonica W930 Anas platyrhynchos Ukraine - -

Dendritobilharzia pulverulenta W926 Anas crecca New Mexico, USA - -

Dendritobilharzia pulverulenta W813 Anas discors Minnesota, USA 47.69405, -96.31216 19616

Gigantobilharzia huronensis W414/513 Physa sp. New Mexico, USA 35.21166, -106.5969 18687/25488

Gigantobilharzia huronensis W678 Physa sp. New Mexico, USA 35.21166, -106.5969 -

Heterobilharzia americana W805 Procyon lotor Louisiana, USA 32.3258, -91.3855 19286

Macrobilharzia macrobilharzia W931 Anhinga anhinga Mississippi, USA - -

Ornithobilharzia canaliculata W393 Larus occidentalis California, USA - 18542

Trichobilharzia physellae W604 Bucephala clangula Alaska, USA - 25269

Trichobilharzia querquedulae W203 Anas clypeata Alaska, USA 65.665, -149.098 18636

Trichobilharzia querquedulae W929 Anas discors Puerto Rico, USA - -

Trichobilharzia stagnicolae W233 Stagnicola emarginata Michigan, USA 45.569,-84.71215 19509

Trichobilharzia sp. A W510/511 Stagnicola elodes New Mexico, USA 36.4636, -105.2733 18705

Trichobilharzia sp. E W606 Anas crecca Alaska, USA - 25257

Avian Schistosome C11 W607 Anas americana Alaska, USA - 25258

Avian Schistosome D W342 Gyraulus parvus Manitoba, CAN 58.7369, -93.7982 18619

Schistosomatidae W216 W216 Haminoea japonica California, USA 37.7678, -122.2776 18660

Schistosomatidae W688 W688 Indoplanorbis exustus Nepal 27.616575, 83.097119 18710

Additional File 1. Locality and accession information for schistosome specimens.

213

Sample ID Taxa UCE Loci

Schistosomatidae

SAMEA2201407 Allobilharzia visceralis 1254

PRJEB519 Schistosoma curassoni 2421

PRJNA273970 Schistosoma haematobium 2423

PRJEB2425 Schistosoma haematobium 2422

PRJNA354903 Schistosoma japonicum 2384

PRJNA286685 Schistosoma japonicum 2382

PRJEB13625 Schistosoma mansoni 2417

PRJNA302212 Schistosoma mansoni 2411

PRJEB523 Schistosoma mattheei 2422

PRJEB522 Schistosoma margrebowiei 2421

PRJEB526 Schistosoma rhodani 2424

SAMEA1920831 Schistosomatium douthitti 115

SAMEA2422295 Trichobilharzia regenti 2400

PRJEB4661 Trichobilharzia szidati 1219

Out-groups

PRJEB3954 Dicrocoelium dendriticum 58

PRJEB1207 Echinostoma caproni 296

PRJNA438721 Fasciola gigantica 260

PRJNA392273 Opisthorchis viverrini 214

PRJNA248332 Paragonimus westermani 246

Additional File 2. Published genomes mined for UCE loci.

evolutionary ecology of host-parasite relationships: …

Documents