of February 3, 2019.This information is current as

Granulocyte Activation in FishCoupled Estrogen Receptor Regulates

−Estrogen Signaling through the G Protein

Meseguer, Victoriano Mulero and Alfonsa García-AyalaIsabel Cabas, M. Carmen Rodenas, Emilia Abellán, José

http://www.jimmunol.org/content/191/9/4628doi: 10.4049/jimmunol.1301613September 2013;

2013; 191:4628-4639; Prepublished online 23J Immunol 

Referenceshttp://www.jimmunol.org/content/191/9/4628.full#ref-list-1

, 16 of which you can access for free at: cites 68 articlesThis article

        average*  

4 weeks from acceptance to publicationFast Publication! •    

Every submission reviewed by practicing scientistsNo Triage! •    

from submission to initial decisionRapid Reviews! 30 days* •    

Submit online. ?The JIWhy

Subscriptionhttp://jimmunol.org/subscription

is online at: The Journal of ImmunologyInformation about subscribing to

Permissionshttp://www.aai.org/About/Publications/JI/copyright.htmlSubmit copyright permission requests at:

Email Alertshttp://jimmunol.org/alertsReceive free email-alerts when new articles cite this article. Sign up at:

Print ISSN: 0022-1767 Online ISSN: 1550-6606. Immunologists, Inc. All rights reserved.Copyright © 2013 by The American Association of1451 Rockville Pike, Suite 650, Rockville, MD 20852The American Association of Immunologists, Inc.,

is published twice each month byThe Journal of Immunology

by guest on February 3, 2019http://w

ww

.jimm

unol.org/D

ownloaded from

by guest on February 3, 2019

http://ww

w.jim

munol.org/

Dow

nloaded from

The Journal of Immunology

Estrogen Signaling through the G Protein–Coupled EstrogenReceptor Regulates Granulocyte Activation in Fish

Isabel Cabas,* M. Carmen Rodenas,* Emilia Abellan,† Jose Meseguer,* Victoriano Mulero,*

and Alfonsa Garcıa-Ayala*

Neutrophils are major participants in innate host responses. It is well known that estrogens have an immune-modulatory role, and

some evidence exists that neutrophil physiology can be altered by these molecules. Traditionally, estrogens act via classical nuclear

estrogen receptors, but the identification of a G protein–coupled estrogen receptor (GPER), a membrane estrogen receptor that

binds estradiol and other estrogens, has opened up the possibility of exploring additional estrogen-mediated effects. However,

information on the importance of GPER for immunity, especially, in neutrophils is scant. In this study, we report that gilthead

seabream (Sparus aurata L.) acidophilic granulocytes, which are the functional equivalent of mammalian neutrophils, express

GPER at both mRNA and protein levels. By using a GPER selective agonist, G1, it was found that GPER activation in vitro slightly

reduced the respiratory burst of acidophilic granulocytes and drastically altered the expression profile of several genes encoding

major pro- and anti-inflammatory mediators. In addition, GPER signaling in vivo modulated adaptive immunity. Finally, a cAMP

analog mimicked the effects of G1 in the induction of the gene coding for PG-endoperoxide synthase 2 and in the induction of CREB

phosphorylation, whereas pharmacological inhibition of protein kinase A superinduced PG-endoperoxide synthase 2. Taken to-

gether, our results demonstrate for the first time, to our knowledge, that estrogens are able to modulate vertebrate granulocyte

functions through a GPER/cAMP/protein kinase A/CREB signaling pathway and could establish therapeutic targets for several

immune disorders in which estrogens play a prominent role. The Journal of Immunology, 2013, 191: 4628–4639.

It is well known that estrogens have an immune-modulatoryrole (1). Traditionally, estrogens act via classical nuclear es-trogen receptors (ER), ERa and ERb, in a process involving

ligand binding to receptors, dimerization, and binding to regulatoryestrogen response elements (ERE) in the promoter regions of targetgenes (2), being the primary mode of action of these receptors astranscriptional regulators. Nevertheless, there are physiological re-sponses to estrogens that cannot be explained by the activationof classical nuclear ER. In 2005, an orphan G protein–coupledreceptor, GPR30, now officially designated G protein–coupled ER

(GPER) (3), was identified as an estrogen-binding intracellularmembrane G protein–coupled receptor (4, 5). It was later shownthat GPER is activated by 17b-estradiol (E2) (6–8). The mecha-nisms through which GPER is activated include the rapid activa-tion of MAPKs, ERK-1, and ERK-2 through the transactivation ofepidermal grown factor receptor (9), PI3K signaling activation (5),cAMP activation (8), and intracellular calcium mobilization (5),most of which were reviewed previously (10, 11). Moreover, rapidsignaling events initiated by GPER have been shown to regulategene expression (10). Thus, physiological responses to estrogensare often categorized as rapid/nongenomic or genomic, althoughthere is much evidence that these artificially defined categories areconnected (12, 13). Thus, the activation of GPER by G1, a GPERselective agonist (14), does not trigger ERE-mediated activation,but upregulates CFOS by means of a nongenomic mechanism similarto E2 (15).The identification of G1 has allowed the involvement of GPER in

several physiological functions to be investigated. For example,GPER has been linked with nervous, reproductive, cardiovascular,and immune systems; metabolism and obesity; cancer and cellgrowth; and inflammatory vascular diseases, reviewed previously(11). However, information concerning the relevance of GPER forthe immune system is scant. However, it is known that GPERcontributes to estrogen-induced thymic atrophy (16) and the im-paired production of T cells in the thymus (17). In the context ofexperimental autoimmune encephalomyelitis (EAE), GPER knock-out mice show impaired estrogen-mediated protection againstEAE (18), whereas G1 has a beneficial role in multiple sclerosis(19). In addition, G1 is able to promote a suppressive phenotypeof CD4 regulatory T cells (20) and is able to induce IL-10 in Th17effector populations (21). Although the information on the role ofGPER in innate immunity is very limited, it has been describedthat G1 is able to decrease the expression of TLR4 in murinemacrophages (MF), limiting the sensitivity of these cells to LPS

*Department of Cell Biology and Histology, Faculty of Biology, Regional Campus ofInternational Excellence “Campus Mare Nostrum,” University of Murcia, 30100Murcia, Spain; and †Centro Oceanografico de Murcia, Instituto Espanol de Ocean-ografıa, Puerto de Mazarron, 30860 Murcia, Spain

Received for publication June 18, 2013. Accepted for publication August 20, 2013.

This work was supported by Fundacion Seneca, Coordination Center for Research,Comunidad Autonoma de la Region de Murcia Grant 04538/GERM/06 (to A.G.-A.)a fellowship to I.C., Spanish Ministry of Science and Innovation Grants AGL2008-04575-C02-01 and AGL2008-04575-C02-02 (to A.G.-A.) and a fellowship to M.C.R.,all cofunded with Fondos Europeos de Desarrollo Regional/European Regional De-velopment Funds.

The sequence presented in this article has been submitted to European NucleotideArchive (http://www.ebi.ac.uk/ena/) under accession number HG004163.

Address correspondence and reprint requests to Prof. Victoriano Mulero and Prof.Alfonsa Garcıa-Ayala, Department of Cell Biology and Histology, Faculty of Biol-ogy, University of Murcia, 30100 Murcia, Spain. E-mail addresses: vmulero@um.es(V.M.) and agayala@um.es (A.G.-A.)

Abbreviations used in this article: AG, acidophilic granulocyte; ATF-1, activatingtranscription factor-1; dbcAMP, 29-dibutyryladenosine 39,59-cyclic monophosphatesodium salt; dpb, days postbooster; dpp, days postpriming; E2, 17b-estradiol; EAE,experimental autoimmune encephalomyelitis; EE2, 17a-ethinylestradiol; ER, estro-gen receptor; ERE, estrogen response element; FSC, forward scatter; GPER,G protein–coupled ER; GSI, gonadosomatic index; HK, head kidney; Ly, lympho-cyte; MF, macrophage; PI, propidium iodide; PKA, protein kinase A; PTGDS, PGD2 synthase; PTGS, PG-endoperoxide synthase; ROS, reactive oxygen species; SSC,side scatter; VaDNA, genomic DNA from Vibrio anguillarum; VTG, vitellogenin.

Copyright� 2013 by TheAmericanAssociation of Immunologists, Inc. 0022-1767/13/$16.00

www.jimmunol.org/cgi/doi/10.4049/jimmunol.1301613

by guest on February 3, 2019http://w

ww

.jimm

unol.org/D

ownloaded from

(22). Finally, it has been described that both the affinity and thesignaling pathway of GPER are conserved in both mammals andfish (23).Neutrophils play a key role in the innate host response: they are

the most abundant type of WBCs and often the first to migrate toinflammatory lesions. In response to specific stimuli, neutrophilscan synthesize an array of factors such as antimicrobial proteins,extracellular matrix proteins, cytokines, and chemokines, all ofwhich play a major role in early stages of the inflammatory re-sponse (24). In the bony fish gilthead seabream (Sparus aurata L.),acidophilic granulocytes (AGs) are the major cell type partici-pating in innate host responses, whereas the head kidney (HK), themain hematopoietic organ in fish comparable to the bone marrowof mammals (25), is the central immune organ that provides asource for AGs (25, 26). AGs might be considered as functionallyequivalent to mammalian neutrophils, because they are the mostabundant circulating granulocytes (25), show strong phagocyticand reactive oxygen species (ROS) production capabilities (25,27), produce cytokines in response to several immunologicalstimuli (27, 28), and express a broad range of TLRs, although notTLR3 (27).In mammals, neutrophil physiology may be altered by estrogens

(29–31). These cells express ERa and ERb as well as their varioussplice variants (32, 33). A recent study has shown that neutrophil-like HL60 cells express a functional GPER (34). However, it isunknown whether primary neutrophils express GPER and, if thisis the case, what its functional relevance in neutrophil biology is.In gilthead seabream, AG physiology is also shown to be regulatedby estrogens. Despite the massive infiltration of AGs into the testisafter spawning (35–37), they show impaired phagocytic and ROSproduction activities (36). Moreover, exogenous administration ofE2 and 17a-ethinylestradiol (EE2) induces AGs infiltration into thegonad (35, 38, 39). Strikingly, however, AGs do not express any ofthe three ER (ERa, ERb1, ERb2) known to exist in the giltheadseabream (40, 41). In the current study, we demonstrate that AGsexpress a functional GPER, which modulates the gene expressionprofile and immune activities of these cells after in vitro andin vivo exposure. The identification of GPER as an importantregulator of vertebrate neutrophil biology points to new thera-peutic targets for autoimmune diseases where estrogens are in-volved, such as multiple sclerosis and EAE. The findings are alsorelevant in the context of endocrine disruption, because xeno-estrogens can activate GPER (42, 43).

Materials and MethodsAnimals, in vivo treatment, and sample collection

Healthy specimens of the hermaphroditic protandrous marine fish giltheadseabream (Sparus aurata L., Actinopterygii, Perciformes, Sparidae) weremaintained at the Oceanographic Centre of Murcia (Spain), where theywere kept in running seawater aquaria (dissolved oxygen 6 ppm, flow rate20% aquarium vol/h) with a natural temperature and photoperiod, and fedtwice per day with a commercial pellet diet (44% protein, 22% lipids;Skretting) at a feeding rate of 1.5% of fish biomass. Fish were fasted for 24 hbefore sampling.

In vivo G1 treatment was carried out with mature gilthead seabreammales (n = 150) with a body weight of 225 6 35 g kept in 2-m3 aquaria.Briefly, G1 was incorporated in the commercial food to give a concentra-tion of 0, 2, and 20 mg/fish/day, using the ethanol evaporation method (0.3lethanol/kg food), as described elsewhere (44). The specimens were fedthree times per day ad libitum with the G1-containing food for up to50 d and fasted for 24 h before sampling. To evaluate the effect of G1 onadaptive immunity, the animals were injected i.p. with PBS (control fish)or hemocyanin (200 mg/fish; Sigma-Aldrich) and Inject Alum Adjuvant(4 mg/fish; Thermo Scientific) (vaccinated fish) after 7 (priming) and20 (booster) d of G1 exposure. The samplings were carried out on days8 (1 d postpriming [dpp]) and 21, 30, and 50 (1, 10, and 30 d postbooster[dpb], respectively). Specimens (n = 6 fish/group and time) were anes-

thetized with 40 ppm clove oil, decapitated, and weighed, and the HKs,spleens, livers, and gonads were removed and then processed for geneexpression analysis, as described below. The gonads were weighed,whereas serum samples from trunk blood were obtained by centrifugationand immediately frozen and stored at 280˚C until use. Cell suspensionsfrom HKs were obtained, as described elsewhere (36, 37). As an index ofthe reproductive stage and to evaluate the effect of the in vivo G1 treat-ment, the gonadosomatic index (GSI) was calculated as 100 3 (MG/MB)(%), where MG is gonad mass and MB is body mass (both in grams).

For the in vitro experiments, mature male gilthead seabream (300–650 gmean weight, kept in 14-m3 aquaria) were decapitated. The HKs wereremoved, and cell suspensions were obtained (36, 37). The experimentsdescribed comply with the guidelines of the European Union Council (86/609/EU) and the Bioethical Committees of the University of Murcia (Spain)(approval 333, 2008) for the use of laboratory animals.

Isolation of AGs, cell culture, and in vitro G1 treatments

AGs were obtained by MACS, as described earlier (45). Briefly, HK cellsuspensions were incubated with a 1:10 dilution of a mAb specific togilthead seabream AGs (G7) (25), washed twice with PBS containing 2 mMEDTA (Sigma-Aldrich) and 5% FCS (Life Technologies), and then incubatedwith 100–200 ml/108 cells of micromagnetic bead–conjugated anti-mouseIgG (Miltenyi Biotec). After washing, G7+ (AG) and G72 (AG-depleted)cell fractions were collected by MACS following the manufacturer´s in-structions, and their purity was analyzed by flow cytometry (45).

Seabream HK leukocytes or purified AGs were maintained in salt RPMI(sRPMI, RPMI 1640 culture medium [Life Technologies] adjusted with0.35% NaCl to gilthead seabream serum osmolarity) containing 100 i.u./mlpenicillin and 100 mg/ml streptomycin (Biochrom). Depending on theexperiments, aliquots of HK cell suspension (0.5 3 106) or purified AGs(0.2–13 106) from HK were incubated for 5 min, 30 min, 1 h, 2 h, 3 h, and16 h in sRPMI medium supplemented with 5% charcoal/dextran-treatedhormone-free FCS (HyClone) alone (untreated cells) or containing 1 and100 mM G1 (Sigma-Aldrich) in the presence or absence of 50 mg/mlphenol-extracted genomic DNA from the bacterium Vibrio anguillarumATCC19264 cells (VaDNA). In some experiments, purified AGs (0.2–1 3106) from the HK were incubated with 0.1, 0.2, and 0.5 mM cell-permeablecAMP analog 29-dibutyryladenosine 39,59-cyclic monophosphate sodiumsalt (dbcAMP; Sigma-Aldrich) for 30 min and 2 h, or preincubated for30 min with 10 mM protein kinase A (PKA) inhibitor H89 (Sigma-Aldrich) and then stimulated with G1 or VaDNA for an additional 2 h.After the incubations, viability assay, reactive oxygen intermediate (ROS)production, GPER immunofluorescence staining, Western blot, and/orgene expression analysis were performed (see below).

Cloning of gilthead seabream GPER

A partial sequence of gilthead seabream GPER cDNAwas obtained by PCRamplification using a Taq DNA polymerase (Bioclone), testis cDNA astemplate and degenerated primers (Table I), targeting conserved domainsof GPER from a phylogenetically close species (Micropogonias undulatus,Actinopterygii, Perciformes, Sciaenidae) (European Nucleotide Archive,accession number EU274298; http://www.ebi.ac.uk/ena/). The PCR-amplified fragment was cloned into the pCRII-TOPO cloning vector(Life Technologies) and transformed into competent Escherichia coliDH5a cells. Positive clones were sequenced and analyzed by BLAST. Apartial gilthead seabream GPER sequence was deposited in the EuropeanNucleotide Archive with accession number HG004163.

Analysis of gene expression

Total RNA was extracted from tissues or cell pellets with TRIzol reagent(Invitrogen), following the manufacturer’s instructions, and quantified witha spectrophotometer (NanoDrop, ND-1000). The RNA of three or six fishper group, in the case of cell pellets or tissue, respectively, was pooledusing the same amount of RNA from each specimen. The RNA was thentreated with DNase I, amplification grade (1 U/mg RNA; Invitrogen), toremove genomic DNA traces that might interfere with the PCRs, and theSuperScript III RNase H reverse transcriptase (Invitrogen) was used tosynthesize first-strand cDNA with oligo-dT18 primer from 0.5–1 mg totalRNA, at 50˚C for 50 min. The b-actin (actb) gene was analyzed by semi-quantitative PCR performed with an Eppendorf Mastercycle GradientInstrument (Eppendorf). Reaction mixtures were incubated for 2 min at95˚C, followed by 35 cycles of 45 s at 95˚C, 45 s at the specific annealingtemperature, 1 min at 72˚C, and finally 10 min at 72˚C.

The expression of the genes coding for GPER, CFOS, IL-1b, IL-8, IL-10,PG-endoperoxide synthase 2 (PTGS2, also known as COX2), PG D2synthase (PTGDS), and vitellogenin (VTG) was analyzed by real-time

The Journal of Immunology 4629

by guest on February 3, 2019http://w

ww

.jimm

unol.org/D

ownloaded from

RT-PCR performed with an ABI PRISM 7500 instrument (Applied Bio-systems) using SYBR Green PCR core reagents (Applied Biosystems).Reaction mixtures were incubated for 10 min at 95˚C, followed by 40 cyclesof 15 s at 95˚C, 1 min at 60˚C, and finally 15 s at 95˚C, 1 min at 60˚C, and15 s at 95˚C. For each mRNA, gene expression was corrected by the ribo-somal protein S18 gene (rps18) content in each sample using the com-parative cycle threshold method (22DDCt). The gilthead seabream-specificprimers used are shown in Table I. In all cases, each PCR was performedwith triplicate samples and repeated in at least three independent samples.

GPER immunofluorescence and flow cytometry analysis

Aliquots of HK cell suspensions (0.5 3 106) were washed in PBS con-taining 2% FCS and 0.05% sodium azide (FACS buffer). Cells were fixedwith 4% paraformaldehyde for 15 min at room temperature. After threerinses, cells were incubated in ice-cold PBS containing 0.1% Triton X-100(Sigma-Aldrich) at 4˚C to permeabilize the membranes. Cells were thenstained with 0, 0.2, 0.4, and 0.8 mg/ml (0, 1:1000, 1:500, and 1:250, re-spectively) of a commercial affinity-purified rabbit polyclonal Ab raisedagainst a conserved peptide mapping near the N terminus of GPER ofhuman origin (sc-48525-R, Santa Cruz Biotechnology), in PBS containing2% FCS for 30 min at 4˚C. For competition studies, a 10-fold excess (inmolarity) of a commercial blocking peptide (sc-48525 P, Santa Cruz Bio-technology) was preincubated with the GPER Ab overnight at 4˚C. Afterwashing, cells were incubated with a 1:500 dilution of a PE-conjugated goatF(ab) anti-rabbit IgG (H + L) (Life Technologies) for 30 min at 4˚C, washedagain, and analyzed by flow cytometry. Data were collected in the form offorward scatter (FSC) versus side scatter (SSC) dot plot, green (FL1) versusred (FL2) fluorescence dot plot, and red (FL2) fluorescence histogramsusing a flow cytometer (BD Biosciences). The percentage and the intensityof red fluorescence cell were analyzed on all regions (ungated), gate R1(high FSC and SSC, i.e., AGs) and/or gate 2 (low FSC and SSC, i.e., mainlyMF and lymphocytes [Ly]) (25, 46).

Western blot

G7+ (AG) and G72 (AG-depleted) cell fractions collected by MACS orAGs untreated or treated with 100 mM G1 or 0.2 mM dbcAMP for 2 h, asdescribed above, were lysed in lysis buffer (10 mM Tris-HCl [pH 7.4], 150mM NaCl, 1% Triton X-100, and 0.5% Nonidet P40). The protein con-centrations of cell lysates were estimated by the bicinchoninic acid proteinassay reagent (Pierce) using BSA as a standard. Cell extracts (10 or 45 mgprotein, depending on the experiments) were boiled in SDS sample buffer,resolved on 12% SDS-PAGE, and transferred for 30 min at 200 mA tonitrocellulose membranes (Bio-Rad). Blots were probed with 1 mg/ml(1:200) anti-GPER Ab or with a 1:1000 dilution of a commercial rabbitmAb raised against CREB phosphorylated at serine 133 (phospho-CREB)(the epitope is fully conserved in all vertebrates, and the Ab also reactswith phospho–activating transcription factor-1) (9198; Cell SignalingTechnology). Then blots were probed with 1:5000 of an anti-rabbit HRP Ab

and developed with ECL reagents (GE Healthcare), according to the manu-facturer’s protocol. Membranes were then reprobed with a 1:5000 dilution ofan affinity-purified rabbit polyclonal to histone H3 (ab 1791; Abcam).

Viability assay

Aliquots of 0.2 3 106 of purified AGs, treated as described above, werediluted in 200 ml PBS containing 40 mg/ml propidium iodide (PI). Thenumber of red fluorescent cells (dead cells) from duplicate cultured sam-ples was analyzed by flow cytometry.

ROS production assay

ROS production was measured as the luminol-dependent chemilumines-cence produced by 0.2 3 106 AGs pretreated or not with G1, in thepresence or absence of 50 mg/ml VaDNA, or by 0.5 3 106 HK leukocytesfrom G1-treated fish (both control or vaccinated fish), as described pre-viously (47). This was achieved by adding 100 mM luminol (Sigma-Aldrich) and 1 mg/ml PMA (Sigma-Aldrich), whereas the chemilumines-cence was recorded every 127 s for 1 h in a FLUOstart luminometer(BGM; LabTechnologies). The values reported are the average of triplereadings from six different samples, expressed as the maximum and slopeof the reaction curve from 127 to 1016 s, from which the apparatusbackground was subtracted.

Determination of IgM-specific titer

The hemocyanin-specific IgM titer was determined by an ELISA kit(Aquatic Diagnostic), following the manufacturer’s instructions. In short,serial dilutions of serum from control or hemocyanin-immunized fish wereadded to hemocyanin-precoated 96-well ELISA plates, followed by a mAbspecific to seabream IgM and an anti-rabbit IgG (whole molecule)-peroxidase Ab produced in goat (Sigma-Aldrich). Finally, the chromogentetramethylbenzidine was added, and the absorbance was read at 450 nmusing a FLUOstart luminometer (BGM; LabTechnologies).

Statistical analysis

ANOVA and Tukey multiple range tests were applied to determine dif-ferences among groups. A Student t test was used to determine differencesbetween two groups. The critical value for statistical significance wastaken as p # 0.05 (*p , 0.05, **p , 0.01, and ***p , 0.001). All sta-tistical analyses were carried out using the GraphPad Prism 5 program.

ResultsGPER is expressed in immune organs and is differentiallyexpressed in HK cell populations

The mRNA levels of GPER were analyzed using specific primers(Table I) in several gilthead seabream tissues, such as the HK

Table I. Gene accession numbers and primer sequences used for gene expression analysis.

Species Gene Accession No. Name Nucleotide sequence (59→39)

S. aurata actb X89920 F3 ATCGTGGGGCGCCCCAGGCACCR3 CTCCTTAATGTCACGCACGATTTC

gper HG004163 F1 GGCTGCCAGAGAATGTCTTCR1 GTGGCCTGTGAGTGGGTAGTR2 GAGGCAGCTGTTGGAGAAAG

cfos AM962391 F CAGCATGGGATCACCACAGTR AAGGCTGTACCATCCACTGC

il1b AJ277166 F2 GGGCTGAACAACAGCACTCTCR3 TTAACACTCTCCACCCTCCA

ptgs2 AM296029 F2 CATCTTTGGGGAAACAATGGR2 AGGCAGTGTTGATGATGTCG

il10 FG261948 F TGGAGGGCTTTCCTGTCAGAR TGCTTCGTAGAAGTCTCGGATGT

ptgds AM959591 F CACGCCATAACATGGTGAAGR GACCGTAAAGTGCCACCTGT

vtg AF210428 F1 CTGCTGAAGAGGGACCAGACR1 TTGCCTGCAGGATGATGATA

rps18 AM490061 F AGGGTGTTGGCAGACGTTACR CTTCTGCCTGTTGAGGAACC

M. undulatus gper EU274298 F3 GGTCGTGGTTCTGGTGTTCTR3 CTACTGACCAGCTGGCCTTC

The gene symbols followed the Zebrafish Nomenclature Guidelines (http://zfin.org/zf_info/nomen.html). All primerswere used for real-time PCR, except actb primers that were used for conventional PCR.

4630 GPER REGULATES GRANULOCYTE ACTIVATION IN FISH

by guest on February 3, 2019http://w

ww

.jimm

unol.org/D

ownloaded from

(main hematopoietic organ in fish), spleen, liver, and testis. Al-though the GPER was expressed in immune organs, its expressionwas much lower than in liver and testis (Fig. 1A). The mRNAlevels of GPER were 4.3-fold higher in G7+ (AGs) than in G72

(AG-depleted) cell fractions (Fig. 1B). Similarly, most AGs (gateR1: cells with high FSC and SSC) (25) were immunostained withthe GPER Ab in a dose-dependent manner (Fig. 1C–E). Thisstaining was found to be specific, because preincubation of GPERAb with a specific blocking peptide significantly reduced thisstaining (Fig. 1D–F). The same analysis was performed in gate R2(low FSC and SSC, i.e., MF, Ly, and precursor cells), for whichthe results showed a weaker immunostaining compared with AGs(as low as 25, 7, and 4% of GPER-positive cells with 1:250, 1:500,and 1:1000 dilutions of GPER Ab, respectively; Fig. 1G). How-ever, the immunostaining of R2 cells was also reduced by theblocking peptide (Fig. 1G). These results were further confirmedby Western blot, in which G7+ (AGs) cell fractions showed a more

robust expression of GPER protein than G72 (AG-depleted) cellfractions (Fig. 1H).

GPER activation fails to modulate the expression of GPERin vitro

After 16 h of G1 in vitro treatment, the longest time used in thisstudy, AG viability was 88 6 1.5% in control cells, 92 6 1% inVaDNA-stimulated cells, and 85 6 2% in cells treated with 100mM G1 plus VaDNA, as assayed by PI exclusion and flowcytometry analyses (Fig. 2A). This high viability of AGs after1 d of culture is consistent with previous results (48).To examine the possibility that G1 is able to regulate the ex-

pression levels of GPER, the mRNA levels of GPER (Fig. 2B) andthe percentage (Fig. 2C) and intensity (Fig. 2D) of GPER-positivecells were analyzed after G1 treatment of AGs in vitro for 16 h inthe presence or absence of VaDNA. There were no significantchanges after G1 treatment either at GPER mRNA or protein

FIGURE 1. GPER mRNA and protein levels in HK cell populations. The mRNA levels of gper were analyzed by real-time PCR in (A) several gilthead

seabream tissues, such as HK, spleen (S), liver (L), and testes (T) and in (B) HK G7+ (AGs) and G72 (AG-depleted) cell fractions obtained by MACS. Gene

expression levels were normalized to rps18 mRNA levels. Data for gper expression represent means 6 SEM in triplicate. The results are representative of

three independent samples and analyses. (C) Representative FSC/SSC dot plots of HK leukocytes showing two main regions: one of high FSC and SSC

(AGs, gate R1), and the other of low FSC and SSC (MF, Ly, and precursor cells, gate R2). The percentage of GPER-positive cells was analyzed by flow

cytometry in HK leukocytes unstained or immunostained with a 1:250, 1:500, and 1:1000 dilution of GPER Ab preincubated or not with the blocking

peptide (BP). The analysis was made in (D) gate R1 and (G) gate R2. Values are means 6 SEM of values of three specimens and are representative of

multiple independent experiments. (E) The fluorescence of the HK leukocytes (gate R1) unstained or immunostained with a 1:250, 1:500, and 1:1000

dilution of GPER, and (F) the fluorescence of the HK leukocytes (gate R1) immunostained with a 1:1000 dilution of anti-GPER preincubated or not with the

BP was analyzed by flow cytometry. The red fluorescence histograms (FL2, GPER) shown are representative of multiple independent experiments. (H)

Western blot analysis of GPER in G7+ (AGs) and G72 (AG-depleted) cell fractions obtained by MACS. The results are representative of three independent

experiments. A positive control from testes (T) was also included. The asterisks denote statistically significant differences among groups according to

Student t test. ***p , 0.001.

The Journal of Immunology 4631

by guest on February 3, 2019http://w

ww

.jimm

unol.org/D

ownloaded from

levels. In the case of 100 mM G1 plus VaDNA, gper mRNA levelswere lower than in VaDNA-stimulated control cells, an effect thatmight be related to the fact that the cell viability was slightlylower in this condition.

GPER activation hardly modulates the respiratory burst of AGs

G1 (1 and 100 mM) was able to slightly decrease ROS productionby naive AGs after 3-h exposure, but not 16 h, whereas 100 mMG1 slightly increased the ROS production after 5 min (Fig. 3A).However, neither dose of G1 was able to modulate ROS produc-tion in AGs that had been primed for 16 h with VaDNA, a potentactivator of these cells through TLR9 (27) (Fig. 3B).

GPER signaling via the cAMP/PKA/CREB pathway regulatesthe gene expression profile of naive AGs

Fig. 4A and 4B shows that G1 (100 mM) was able to rapidly, buttransiently, induce the mRNA levels of cfos, a marker gene for theactivation of the GPER signaling pathway (15). When the abilityof G1 to modulate the gene expression profile through GPERsignaling was evaluated in naive AGs, GPER activation was seento induce high mRNA levels of IL-1b very quickly (30 min), butinhibited them at later time points (Fig. 4C). However, GPERengagement resulted in sustainably increased mRNA levels ofPTGS2 (Fig. 4D) and IL-10 (Fig. 4E). In addition, GPER sig-naling resulted in increased mRNA levels of PTGDS after 30 min

FIGURE 2. GPER signaling does not alter GPER mRNA and protein levels in AGs. AGs were incubated with 0, 1, and 100 mM G1 alone or in the

presence of VaDNA (50 mg/ml) for 16 h. Afterward, cell viability and GPER expression levels were analyzed. (A) The percentage of PI-negative AGs was

determined by flow cytometry. Values are means 6 SEM of nine specimens. (B) The mRNA levels of gper were analyzed by real-time PCR. Gene ex-

pression levels were normalized to rps18 mRNA levels and are shown as relative to the mean of nonstimulated cells (value 1; represented by the dashed

line). Data for gper expression represent means 6 SEM in triplicate and are representative of two independent experiments. The percentage (C) and the

intensity (D) of GPER-positive cells were analyzed by flow cytometry. Values are means 6 SEM of nine specimens. The asterisks denote statistically

significant differences among groups according to one-way ANOVA and Tukey post hoc test. *p , 0.05, **p , 0.01. No symbol or “ns” means not

significant.

FIGURE 3. GPER signaling hardly modulates the respiratory burst of AGs. Naive (A) and VaDNA-primed (50 mg/ml, 16 h) (B) AGs were incubated with

0, 1, or 100 mM G1 for 5 min, 3 h, or 16 h. Afterward, the respiratory-burst activity by these cells triggered by PMA (1 mg/ml) was measured using

a luminol-dependent chemiluminescence method. Values are normalized with respect to control cells (value 1; represented by the dashed line), cells with

medium alone in naive AGs or medium plus VaDNA in priming AGs. Values represent means 6 SEM in triplicate and are representative of multiple

independent experiments. The asterisks denote statistically significant differences among groups according to one-way ANOVA and Tukey post hoc

test. *p , 0.05, **p , 0.01. No symbol or “ns” means not significant.

4632 GPER REGULATES GRANULOCYTE ACTIVATION IN FISH

by guest on February 3, 2019http://w

ww

.jimm

unol.org/D

ownloaded from

and 3 h, but lower levels after 16 h (Fig. 4F). Curiously, however,GPER activation in VaDNA-primed AGs decreased the mRNAlevels of IL-1b (Fig. 4G) and had a negligible effect on the mRNAlevels of PTGS2 (Fig. 4H) and IL-10 (Fig. 4I).To explore the signaling pathway downstream of GPER acti-

vation in AGs, a pharmacological inhibitor of PKA (H89), a cell-permeable cAMP analog that activates PKA (dbcAMP) and a mAbagainst phospho-CREB were used. Pharmacological inhibition ofPKA resulted in the hyperinduction of PTGS2 transcript levels inresponse to G1, but had negligible effects, if any, in VaDNA-primedAGs (Fig. 5A). In sharp contrast, H89 treatment had no effect onthe transcript levels of IL-1b (Fig. 5B). In contrast, dbcAMPmimicked the GPER-dependent induction of PTGS2 (Fig. 5C).Notably, after 30 min of exposure, G1 promoted the phosphory-lation of CREB and activating transcription factor-1 (ATF-1) inAGs, and this effect was also mimicked by dbcAMP (Fig. 5D).

GPER signaling modulates innate immunity in vivo

The survival of the animals exposed to G1 was 100% during the trial.After 8 (s1), 21 (s2), and 50 (s4) days of G1 exposure, the GSI was notsignificantly altered in nonimmunized animals (Fig. 6A, 6B). LivermRNA levels of VTG, a gene induced by the activation of nuclearER (49), weakly increased in fish treated with the higher dose (20 mg)

(Fig. 6C). Neither G1 treatment nor vaccination was able to modulatethe percentage (Fig. 7) and intensity (data not shown) of GPER-positive cells in the HK at any analysis time.Using luminol-dependent chemiluminescence, we analyzed the

production of ROS triggered by PMA in HK leukocytes from controland vaccinated fish on days 8 (s1; 1 dpp) (Fig. 8A), 21 (s2; 1 dpb) (Fig.8B), and 50 (s4; 30 dpb) (Fig. 8C) after G1 exposure. Unexpectedly,the ability to produce ROS was higher in leukocytes from non-vaccinated fish compared with the vaccinated animals at all timepoints. Moreover, the higher dose of G1 was able to strongly reducethe production of ROS in nonvaccinated fish 1 dpp and 1 dpb,whereas it had no statistically significant effect in vaccinated animals.Regarding the expression of genes encoding key cytokines,

vaccination significantly increased the mRNA levels of IL-1b andIL-10 in the HK at all analysis times (Fig. 9). Importantly, the G1treatment had a dual effect, significantly inhibiting the mRNAlevels of IL-1b and increasing those of IL-10 in nonvaccinated fishat all time points (Fig. 9), although reducing IL-10 transcriptlevels 1 dpp and 30 dpb in vaccinated fish (Fig. 9D, 9F).

GPER signaling in vivo modulates adaptive immunity

The impact of G1 exposure on the adaptive immune responsewas evaluated as hemocyanin-specific IgM titers in the serum of

FIGURE 4. GPER activation regulates the gene expression profile of AGs. AGs were stimulated with 0, 1, and 100 mM G1 for 30 min, 1 h, 3 h, and 16 h

or with 0, 1, and 100 mM G1 in the presence of VaDNA for 16 h. Afterward, the mRNA levels of (A, B) c-fos, (C, G) il1b, (D, H) ptgs2, (E, I) il10, and (F)

ptgds were determined by real-time RT-PCR. Gene expression is normalized against rps18 and is shown as relative to the mean of control cells (value 1;

represented by the dashed line; either one with their corresponding time control). Each bar represents the mean 6 SEM of triplicate samples. The asterisks

denote statistically significant differences compared with untreated cells for each time point, according to one-way ANOVA and Tukey post hoc test or

Student t test when comparing two treatments. *p , 0.05, **p , 0.01, ***p , 0.001. No symbol or “ns” means not significant.

The Journal of Immunology 4633

by guest on February 3, 2019http://w

ww

.jimm

unol.org/D

ownloaded from

vaccinated fish on days 30 (s3; 10 dpb) (Fig. 10A) and 50 (s4; 30 dpb)(Fig. 10B, 10C) after G1 exposure. As expected, vaccinated ani-mals showed a strong Ab response to the Ag, and the hemocyanin-specific IgM titers were higher at 30 dpb than at 10 dpb. Moreimportantly, whereas the higher dose of G1 slightly decreased theAb titer of vaccinated fish, the lower dose significantly increased it(Fig. 10C).

DiscussionAs many of the effects of estrogen cannot be explained by theactivation of classical ER and given the clear involvement ofestrogens in several immune disorders, it is important to investigatethe relevance of the novel GPER in immunity to opening thepossibility for the design of new therapeutic targets. For thesereasons, there has been increasing attention to GPER in recentyears. Nevertheless, knowledge on the role of GPER in immuneresponses is very limited.In mice, data on the expression of the GPER mRNA in tissues

have not necessarily produced a consensus result. Nevertheless, themRNA for GPER appears to be expressed extensively in mosttissues as judged from the overall reports [reviewed in (50)]. Weobserved that, in the tissues analyzed of gilthead seabream, thehigher expression of GPER expression was observed in liver andgonad. In fish, GPER has been detected in Atlantic croaker andzebrafish gonads, and its activity has been related with the mat-uration of oocytes (51–53). Considerably, GPER is expressed inspleen and HK, the main hematopoietic organ in fish. In humans,it has been described that GPER is expressed in hematopoieticstem cells, but not in mature megakaryocytes (54).Neutrophils play a key role in innate host immunity, and their

physiology can be altered by estrogens (29–31). In giltheadseabream, AGs are equivalent to mammalian neutrophils (25, 27).However, AGs do not express any of the three nuclear ER that

have been described in gilthead seabream (40, 41). Therefore, wehypothesized that the described effect of estrogens on AGs (35,38) would primarily be mediated through GPER. We first foundthat AGs express GPER at both mRNA and protein levels and,more importantly, at much higher levels than other immune cells.To our knowledge, little is known regarding the expression ofGPER in immune cells, and there is only one study describing theexpression of GPER in neutrophil-like HL-60 cells (34). In ourresults, we also obtained a very low, but consistent, expressionof GPER in G72 (AG-depleted) cell fractions. This fraction ismainly constituted by MF, Ly, and precursor cells. In mammals,the expression of GPER in MF and Ly, among other immunecells, has also been described (19, 21, 22, 55). Therefore, furtherstudies are needed to clarify the differential expression on seab-ream immune cell populations and the importance of GPER in theestrogen-mediated effects on these cells, because we have previ-ously described that the main activities and the gene expressionprofile of MF were altered by E2 and EE2 (40, 56).To evaluate the effects of G1 on purified AGs, they were treated

in vitro with several doses of the GPER agonist G1 in the presenceor absence of VaDNA, a potent activator of AGs that acts via theTLR9/NF-kB signaling pathway (27). We observed slightly re-duced cell viability in VaDNA-stimulated AGs treated with G1,at the highest dose and time used in this study. Similar effect incell viability was described by others, showing an increase inexpression of the apoptotic/cell death marker annexin V in G1-treated CD4+ T cells (21). More studies are needed to determinewhether these findings reflect direct or secondary effects of G1. Incontrast, neither GPER nor TLR activation in vitro altered theexpression of GPER in AGs. In contrast, E2 increased the ex-pression of ER in gilthead seabream MF and potentiated estrogensignaling in these cells (40). In contrast, GPER activation was ableto slightly increase (after 5 min) and then inhibit (after 3 h) the

FIGURE 5. GPER signaling via the cAMP/PKA/CREB pathway regulates the gene expression profile of naive AGs. (A, B) AGs were preincubated for

30 min with the PKA inhibitor (H-89) and further stimulated with 0 and 100 mM G1, or 75 mg/ml VaDNA for additional 2 h. (C) AGs were stimulated with

0, 0.1, and 0.5 mM dbcAMP or 100 mM G1 for 2 h. Afterward, the mRNA levels of (A, C) ptgs2 and (B) il1b were determined by real-time RT-PCR. Gene

expression is normalized against rps18. Data for gene expression represent means 6 SE in triplicate. (D) Western blot analysis of phospho-CREB (Ser133)

and histone H3 in AGs untreated or treated with 100 mM G1 or 0.2 mM dbcAMP for 30 min. The results are representative of at least two independent

experiments in (A–C). The results from AGs from two fish (AG1 and AG2) are shown in (D). The asterisks denote statistically significant differences

compared with untreated cells, according to one-way ANOVA and Tukey post hoc test. **p , 0.01, ***p , 0.001. ns, Not significant.

4634 GPER REGULATES GRANULOCYTE ACTIVATION IN FISH

by guest on February 3, 2019http://w

ww

.jimm

unol.org/D

ownloaded from

production of ROS by naive AGs, but not by VaDNA-primedones. Therefore, it is tempting to speculate that the ability ofnatural or synthetic estrogens to inhibit the production of ROSby HK leukocytes (40, 56) would be mediated, at least in part,through GPER signaling. To the best of our knowledge, nostudies have evaluated to date the impact of GPER signaling inthe production of ROS of neutrophils. This inhibition, however,will not be surprising, because GPER signals via adenylate cy-clase and cAMP (8), and a recent study observed that splitomicin,a cell-permeable lactone, mediates the cAMP/PKA-dependentphosphorylation of ERK to decrease superoxide anion production(57).

It has been described that GPER activation promotes the up-regulation of c-FOS in an ERE-independent and ERK-dependentmanner (10, 15). For this, the early expression of c-FOS hasbeen considered has an earlier marker of estrogenic responsethrough GPER, although it can also be induced by ERa activation(58). Moreover, the induction of c-FOS has been related with theactivation of the cAMP/PKA signaling pathway (59). Similarly,we observed that GPER is functional in AGs, as shown by the sig-nificant induction on cfos mRNA levels after G1 treatment. Im-portantly, as AGs express GPER, but not nuclear ER (40), GPERactivation is sufficient to induce cFOS, as observed in ER-negativebreast tumor cells (60). Strikingly, GPER signaling also promotes

FIGURE 6. GPER activation in vivo does not promote an estrogenic response. (A) Schematic drawing of the experimental design for gilthead seabream

under G1 dietary exposure and vaccination schedule. Fish were exposed to several G1 concentrations (0, 2, and 20 mg/fish/day) for up to 50 d. After 7 and

20 d of G1 exposure, fish were i.p. injected with PBS (control fish) or vaccinated with hemocyanin plus Alum adjuvant. Sampling was carried out on days 8,

21, 30, and 50. (B) The GSI and (C) the hepatic mRNA levels of vitellogenin (vtg) were analyzed after 8 (s1), 21 (s2), 30 (s3), and 50 (s4) days of G1

exposure in nonvaccinated fish. In all the analyses, the sample size was n = 6 fish/group/time. The mRNA levels of vtg were analyzed by real-time PCR.

Gene expression is normalized against rps18 and is shown as relative to the mean of untreated fish (value 1; represented by the dashed line). Each bar

represents the mean 6 SEM. The asterisks denote statistically significant differences compared with untreated fish according to one-way ANOVA and

Tukey post hoc test. **p , 0.01. No symbol or “ns” means not significant.

FIGURE 7. GPER activation in vivo does not alter GPER protein levels in HK leukocytes. After 8 d (s1; 1 dpp) (A) and 50 d (s4; 30 dpb) (B) of G1

exposure, HK leukocytes from G1-treated fish (both nonvaccinated and vaccinated groups) were obtained to determine the percentage of GPER-positive

cells by flow cytometry. The sample size was n = 6 fish/group. The mean for each group of specimens is shown as a horizontal line. The asterisks denote

statistically significant differences compared with control group (untreated control or untreated vaccinated fish) according to one-way ANOVA and Tukey

post hoc test. No symbol or “ns” means not significant.

The Journal of Immunology 4635

by guest on February 3, 2019http://w

ww

.jimm

unol.org/D

ownloaded from

a rapid increased expression of IL-1b, a pivotal proinflammatorycytokine, and a robust increase of IL-10, an anti-inflammatorycytokine, and of PTGS2, a pivotal and rate-limiting enzyme inthe generation of inflammatory prostanoids. We also observed thatGPER signaling rapidly induced the expression of the gene en-coding PTGDS, enzyme responsible for the synthesis of the powerfulanti-inflammatory PGD2 and PGJ2. In addition, at longer timepoints, that is, 3 and 16 h, IL-1b expression decreased, and IL-10and PTGS2 expression significantly increased even with the low-est doses of G1. All of these results, together with the negligibleeffect of GPER activation on PAMP-primed AGs, indicate that,although the effects of GPER on AGs are very complex, GPERsignaling skews AG activation to an anti-inflammatory phenotype,and suggest a pivotal role of estrogens in the homeostasis of theimmune responses through GPER signaling. Furthermore, theability of seabream AGs to induce IL-10 gene expression uponGPER activation may indicate that these cells are more similarto mouse than to human neutrophils, because the latter cannot

switch on the IL-10 gene because its locus is in an inactive state(61).The induction in the expression of PTGS2 and IL-10 could be

mediated in part by the activation of cAMP/PKA/CREB signalingpathway. In this pathway, PKA mediated the phosphorylation ofCREB, a transcription factor that binds to the CRE sites present atboth IL-10 (62) and PTGS2 promoters. It has been described thatGPER activation promotes adenylate cyclase activation (8). In ad-dition, stimuli known to elevate intracellular cAMP levels, such asPGE2, adenosine, and isoproterenol, positively modulate the PTGS2expression (63–65). In support of this mechanism, we observedthat G1 promoted the phosphorylation of CREB and that the in-duction of PTGS2 and the phosphorylation of CREB were bothmimicked by dbcAMP, a cell-permeant cAMP analog. Nevertheless,the PKA inhibitor, H89, not only failed to block the G1-mediatedinduction of PTGS2, but even superinduced it. However, it hadno effect in PAMP-stimulated AGs. This has already been ob-served with human neutrophil, and it was speculated that it is the

FIGURE 8. GPER activation in vivo slightly decreases the respiratory burst of HK leukocytes. After (A) 8 d (s1; 1 dpp), (B) 21 d (s2; 1 dpb), and (C) 50 d (s4;

30 dpb) of G1 exposure, HK leukocytes from G1-treated fish of both nonvaccinated and vaccinated fish were obtained, and their respiratory burst triggered by

PMA (1 mg/ml) was measured using a luminol-dependent chemiluminescence method. The sample size was n = 6 fish/group. The mean for each group of

specimens is shown as a horizontal line. The asterisks denote statistically significant differences compared with a control group (untreated control or untreated

vaccinated fish) according to one-way ANOVA and Tukey post hoc test. *p , 0.05, **p , 0.01, and ***p , 0.001.

FIGURE 9. GPER activation in vivo regulates the expression of inflammatory genes in HK leukocytes. The mRNA levels of il1b (A–C) and il10

(D–F) were analyzed by real-time PCR on (A, D) day 8 (s1; 1 dpp), (B, E) day 21 (s2; 1 dpb), and (C, F) day 50 (s4; 30 dpb). Gene expression levels

were normalized to rps18 mRNA levels, and data represent means 6 SEM in triplicate. The asterisks denote statistically significant differences compared

with control group (untreated control or untreated vaccinated fish) according to one-way ANOVA and Tukey post hoc test. *p , 0.05, **p , 0.01, and

***p , 0.001. No symbol or “ns” means not significant.

4636 GPER REGULATES GRANULOCYTE ACTIVATION IN FISH

by guest on February 3, 2019http://w

ww

.jimm

unol.org/D

ownloaded from

consequence of the complex regulatory mechanisms of CREBactivation/deactivation (63). Thus, the activation of the proteinphosphatase involved in the dephosphorylation of CREB alsodepends on PKA activity (66, 67). Although further studies arerequired to clarify GPER signaling in AGs, our results point to acrucial role of the cAMP/PKA/CREB pathway in the regulation ofthe expression of genes encoding major inflammatory moleculesin these cells. It is, therefore, tempting to speculate that similarmechanisms operate in mammalian neutrophils.GPER activation in vivo did not promote an evident estrogenic

response, because the GSI and the expression of VTG in the liver,two markers of the estrogenic response, were not significantlyaltered by dietary G1 exposure. In sharp contrast, administration ofEE2, which is able to bind the nuclear ER, decreases the GSI andsuperinduces the liver VTG (40,000-fold increase compared withcontrol fish) (56). Similarly, GPER does not mediate an estrogenicresponse in the reproductive organs in mice (68). These resultsconfirm the specificity of the G1 agonist over GPER in the gilt-head seabream.Activation of GPER in vivo was unable to modify the expression

levels of GPER, as observed in vitro with purified AGs. Therefore,GPER activation is unable to increase the sensitivity of fish toestrogen, in contrast to EE2 (56). Notably, GPER activation in-hibits the respiratory burst of HK leukocytes from nonvaccinatedfish, but had no effect in vaccinated animals, further supporting theidea of a prominent role of GPER signaling in the homeostasis ofthe immune response, which is largely bypassed by its activation

during infection. Similarly, G1 has been reported to be able todecrease the expression of TLR4 in MF, limiting their ability torecognize LPS (22). This result, together with decreased IL-1band increased IL-10 expression in G1-treated fish, supports thatGPER promotes an anti-inflammatory effect, as observed in vitro.Similar results have been obtained in mice, in which G1 was ableto induce IL-10 expression in the Th17 cells, suggesting thatGPER may be involved in the estrogens’ ability to suppress au-toimmune diseases (21). Strikingly, GPER signaling fine-tunesadaptive immunity, assayed as the presence of specific IgM inthe serum of vaccinated fish. To the best of our knowledge, thereare no studies on the impact of GPER on Ab production. It willbe worthy to investigate the relevance of GPER in mammalianadaptive immunity as well as the role of different immune cellpopulations on this response.In conclusion, we have described for the first time, to our

knowledge, that AGs, the functional equivalent to mammalianneutrophils, express a functional GPER and that its selectiveagonist G1 promotes an anti-inflammatory effect both in vitroand in vivo and fine-tunes adaptive immunity. Remarkably,most of the effects of G1 treatment were observed in naive cellsand nonvaccinated fish, in sharp contrast with the effects ofother estrogens, which are only apparent in a challenge state, inagreement with the postulate by Kollner et al. (69). As estro-gens play a prominent role in human autoimmune disorders,our study also suggests that GPER could represent a therapeutictarget.

FIGURE 10. GPER signaling in vivo modulates adaptive immunity. Hemocyanin-induced specific IgM levels were determined by ELISA on days 30 (s3;

10 dpb) (A) and 50 (s4; 30 dpb) (B, C). The absorbance was read at 450 nm using a FLUOstart luminometer. The sample size was n = 6 fish/group. The data

represent the mean of (A, B) pooled sera from six fish at all indicated serum dilutions and (C) the mean6 SEM absorbance value of six individual fish using

a 1:500 serum dilution, respectively. The asterisks denote statistically significant differences compared with control group (untreated control fish) according

to one-way ANOVA and Tukey post hoc test. *p , 0.05, **p , 0.01, and ***p , 0.001.

The Journal of Immunology 4637

by guest on February 3, 2019http://w

ww

.jimm

unol.org/D

ownloaded from

AcknowledgmentsWe thank I. Fuentes for excellent technical assistance; M. P. Sepulcre for

help and advice on flow cytometry; and the “Servicio de Apoyo a la

Investigacion” of the University of Murcia for assistance with cell culture,

flow cytometry, and real-time PCR.

DisclosuresThe authors have no financial conflicts of interest.

References1. Straub, R. H. 2007. The complex role of estrogens in inflammation. Endocr. Rev.

28: 521–574.2. Deroo, B. J., and K. S. Korach. 2006. Estrogen receptors and human disease.

J. Clin. Invest. 116: 561–570.3. Alexander, S. P., A. Mathie, and J. A. Peters. 2011. Guide to receptors and

channels (GRAC), 5th edition. Br. J. Pharmacol. 164 (Suppl. 1): S1-S324.4. Thomas, P., Y. Pang, E. J. Filardo, and J. Dong. 2005. Identity of an estrogen

membrane receptor coupled to a G protein in human breast cancer cells. En-docrinology 146: 624–632.

5. Revankar, C. M., D. F. Cimino, L. A. Sklar, J. B. Arterburn, and E. R. Prossnitz.2005. A transmembrane intracellular estrogen receptor mediates rapid cell sig-naling. Science 307: 1625–1630.

6. Filardo, E., J. Quinn, Y. Pang, C. Graeber, S. Shaw, J. Dong, and P. Thomas.2007. Activation of the novel estrogen receptor G protein-coupled receptor 30(GPR30) at the plasma membrane. Endocrinology 148: 3236–3245.

7. Funakoshi, T., A. Yanai, K. Shinoda, M. M. Kawano, and Y. Mizukami. 2006.G protein-coupled receptor 30 is an estrogen receptor in the plasma membrane.Biochem. Biophys. Res. Commun. 346: 904–910.

8. Filardo, E. J., J. A. Quinn, A. R. Frackelton, Jr., and K. I. Bland. 2002. Estrogenaction via the G protein-coupled receptor, GPR30: stimulation of adenylyl cy-clase and cAMP-mediated attenuation of the epidermal growth factor receptor-to-MAPK signaling axis. Mol. Endocrinol. 16: 70–84.

9. Filardo, E. J., J. A. Quinn, K. I. Bland, and A. R. Frackelton, Jr. 2000. Estrogen-induced activation of Erk-1 and Erk-2 requires the G protein-coupled receptorhomolog, GPR30, and occurs via trans-activation of the epidermal growth factorreceptor through release of HB-EGF. Mol. Endocrinol. 14: 1649–1660.

10. Prossnitz, E. R., and M. Maggiolini. 2009. Mechanisms of estrogen signalingand gene expression via GPR30. Mol. Cell. Endocrinol. 308: 32–38.

11. Prossnitz, E. R., and M. Barton. 2009. Signaling, physiological functions andclinical relevance of the G protein-coupled estrogen receptor GPER. Prosta-glandins Other Lipid Mediat. 89: 89–97.

12. Ma, L., and G. Pei. 2007. Beta-arrestin signaling and regulation of transcription.J. Cell Sci. 120: 213–218.

13. Moriarty, K., K. H. Kim, and J. R. Bender. 2006. Minireview: estrogen receptor-mediated rapid signaling. Endocrinology 147: 5557–5563.

14. Bologa, C. G., C. M. Revankar, S. M. Young, B. S. Edwards, J. B. Arterburn,A. S. Kiselyov, M. A. Parker, S. E. Tkachenko, N. P. Savchuck, L. A. Sklar, et al.2006. Virtual and biomolecular screening converge on a selective agonist forGPR30. Nat. Chem. Biol. 2: 207–212.

15. Albanito, L., A. Madeo, R. Lappano, A. Vivacqua, V. Rago, A. Carpino,T. I. Oprea, E. R. Prossnitz, A. M. Musti, S. Ando, and M. Maggiolini. 2007.G protein-coupled receptor 30 (GPR30) mediates gene expression changesand growth response to 17beta-estradiol and selective GPR30 ligand G-1 inovarian cancer cells. Cancer Res. 67: 1859–1866.

16. Wang, C., B. Dehghani, I. J. Magrisso, E. A. Rick, E. Bonhomme, D. B. Cody,L. A. Elenich, S. Subramanian, S. J. Murphy, M. J. Kelly, et al. 2008. GPR30contributes to estrogen-induced thymic atrophy. Mol. Endocrinol. 22: 636–648.

17. Isensee, J., L. Meoli, V. Zazzu, C. Nabzdyk, H. Witt, D. Soewarto, K. Effertz,H. Fuchs, V. Gailus-Durner, D. Busch, et al. 2009. Expression pattern of G protein-coupled receptor 30 in LacZ reporter mice. Endocrinology 150: 1722–1730.

18. Wang, C., B. Dehghani, Y. Li, L. J. Kaler, T. Proctor, A. A. Vandenbark, andH. Offner. 2009. Membrane estrogen receptor regulates experimental autoim-mune encephalomyelitis through up-regulation of programmed death 1. J. Immunol.182: 3294–3303.

19. Blasko, E., C. A. Haskell, S. Leung, G. Gualtieri, M. Halks-Miller,M. Mahmoudi, M. K. Dennis, E. R. Prossnitz, W. J. Karpus, and R. Horuk. 2009.Beneficial role of the GPR30 agonist G-1 in an animal model of multiplesclerosis. J. Neuroimmunol. 214: 67–77.

20. Brunsing, R. L., K. S. Owens, and E. R. Prossnitz. 2013. The G protein-coupledestrogen receptor (GPER) agonist G-1 expands the regulatory T-cell populationunder TH17-polarizing conditions. J. Immunother. 36: 190–196.

21. Brunsing, R. L., and E. R. Prossnitz. 2011. Induction of interleukin-10 in theT helper type 17 effector population by the G protein coupled estrogen receptor(GPER) agonist G-1. Immunology 134: 93–106.

22. Rettew, J. A., S. H. McCall, IV, and I. Marriott. 2010. GPR30/GPER-1 mediatesrapid decreases in TLR4 expression on murine macrophages. Mol. Cell. Endo-crinol. 328: 87–92.

23. Thomas, P., R. Alyea, Y. Pang, C. Peyton, J. Dong, and A. H. Berg. 2010.Conserved estrogen binding and signaling functions of the G protein-coupledestrogen receptor 1 (GPER) in mammals and fish. Steroids 75: 595–602.

24. Mantovani, A., M. A. Cassatella, C. Costantini, and S. Jaillon. 2011. Neutrophilsin the activation and regulation of innate and adaptive immunity. Nat. Rev.Immunol. 11: 519–531.

25. Sepulcre, M. P., P. Pelegrın, V. Mulero, and J. Meseguer. 2002. Characterisationof gilthead seabream acidophilic granulocytes by a monoclonal antibody un-equivocally points to their involvement in fish phagocytic response. Cell TissueRes. 308: 97–102.

26. Mulero, I., E. Chaves-Pozo, A. Garcıa-Alcazar, J. Meseguer, V. Mulero, andA. Garcıa-Ayala. 2007. Distribution of the professional phagocytic granulocytesof the bony fish gilthead seabream (Sparus aurata L.) during the ontogeny oflymphomyeloid organs and pathogen entry sites. Dev. Comp. Immunol. 31:1024–1033.

27. Sepulcre, M. P., G. Lopez-Castejon, J. Meseguer, and V. Mulero. 2007. Theactivation of gilthead seabream professional phagocytes by different PAMPsunderlines the behavioural diversity of the main innate immune cells of bonyfish. Mol. Immunol. 44: 2009–2016.

28. Chaves-Pozo, E., P. Pelegrın, J. Garcıa-Castillo, A. Garcıa-Ayala, V. Mulero, andJ. Meseguer. 2004. Acidophilic granulocytes of the marine fish gilthead seab-ream (Sparus aurata L.) produce interleukin-1beta following infection withVibrio anguillarum. Cell Tissue Res. 316: 189–195.

29. Cutolo, M., R. Brizzolara, F. Atzeni, S. Capellino, R. H. Straub, and P. C. Puttini.2010. The immunomodulatory effects of estrogens: clinical relevance in immune-mediated rheumatic diseases. Ann. N. Y. Acad. Sci. 1193: 36–42.

30. Stygar, D., B. Masironi, H. Eriksson, and L. Sahlin. 2007. Studies on estrogenreceptor (ER) alpha and beta responses on gene regulation in peripheral bloodleukocytes in vivo using selective ER agonists. J. Endocrinol. 194: 101–119.

31. Nalbandian, G., and S. Kovats. 2005. Understanding sex biases in immunity:effects of estrogen on the differentiation and function of antigen-presenting cells.Immunol. Res. 31: 91–106.

32. Stygar, D., P. Westlund, H. Eriksson, and L. Sahlin. 2006. Identification of wildtype and variants of oestrogen receptors in polymorphonuclear and mononuclearleucocytes. Clin. Endocrinol. 64: 74–81.

33. Molero, L., M. Garcıa-Duran, J. Diaz-Recasens, L. Rico, S. Casado, andA. Lopez-Farre. 2002. Expression of estrogen receptor subtypes and neuronalnitric oxide synthase in neutrophils from women and men: regulation by estrogen.Cardiovasc. Res. 56: 43–51.

34. Blesson, C. S., and L. Sahlin. 2012. Expression pattern and signalling pathwaysin neutrophil like HL-60 cells after treatment with estrogen receptor selectiveligands. Mol. Cell. Endocrinol. 361: 179–190.

35. Chaves-Pozo, E., S. Liarte, L. Vargas-Chacoff, A. Garcıa-Lopez, V. Mulero,J. Meseguer, J. M. Mancera, and A. Garcıa-Ayala. 2007. 17Beta-estradiol trig-gers postspawning in spermatogenically active gilthead seabream (Sparus aurataL.) males. Biol. Reprod. 76: 142–148.

36. Chaves-Pozo, E., V. Mulero, J. Meseguer, and A. Garcıa-Ayala. 2005. Profes-sional phagocytic granulocytes of the bony fish gilthead seabream displayfunctional adaptation to testicular microenvironment. J. Leukoc. Biol. 78: 345–351.

37. Chaves-Pozo, E., P. Pelegrın, V. Mulero, J. Meseguer, and A. Garcıa-Ayala.2003. A role for acidophilic granulocytes in the testis of the gilthead seabream(Sparus aurata L., Teleostei). J. Endocrinol. 179: 165–174.

38. Cabas, I., E. Chaves-Pozo, A. G. Alcazar, J. Meseguer, V. Mulero, andA. Garcıa-Ayala. 2011. Dietary intake of 17a-ethinylestradiol promotes leu-kocytes infiltration in the gonad of the hermaphrodite gilthead seabream. Mol.Immunol. 48: 2079–2086.

39. Chaves-Pozo, E., P. Castillo-Briceno, A. Garcıa-Alcazar, J. Meseguer, V. Mulero,and A. Garcıa-Ayala. 2008. A role for matrix metalloproteinases in granulocyteinfiltration and testicular remodelation in a seasonal breeding teleost. Mol.Immunol. 45: 2820–2830.

40. Liarte, S., E. Chaves-Pozo, E. Abellan, J. Meseguer, V. Mulero, and A. Garcıa-Ayala. 2011. 17b-Estradiol regulates gilthead seabream professional phagocyteresponses through macrophage activation. Dev. Comp. Immunol. 35: 19–27.

41. Pinto, P. I., A. L. Passos, R. S. Martins, D. M. Power, and A. V. Canario. 2006.Characterization of estrogen receptor betab in sea bream (Sparus auratus):phylogeny, ligand-binding, and comparative analysis of expression. Gen. Comp.Endocrinol. 145: 197–207.

42. Watson, C. S., Y. J. Jeng, and J. Guptarak. 2011. Endocrine disruption via es-trogen receptors that participate in nongenomic signaling pathways. J. SteroidBiochem. Mol. Biol. 127: 44–50.

43. Thomas, P., and J. Dong. 2006. Binding and activation of the seven-transmembraneestrogen receptor GPR30 by environmental estrogens: a potential novel mecha-nism of endocrine disruption. J. Steroid Biochem. Mol. Biol. 102: 175–179.

44. Shved, N., G. Berishvili, H. D’Cotta, J. F. Baroiller, H. Segner, E. Eppler, andM. Reinecke. 2007. Ethinylestradiol differentially interferes with IGF-I in liverand extrahepatic sites during development of male and female bony fish.J. Endocrinol. 195: 513–523.

45. Roca, F. J., M. A. Sepulcre, G. Lopez-Castejon, J. Meseguer, and V. Mulero.2006. The colony-stimulating factor-1 receptor is a specific marker of macro-phages from the bony fish gilthead seabream. Mol. Immunol. 43: 1418–1423.

46. Esteban, M. A., V. Mulero, J. Munoz, and J. Meseguer. 1998. Methodologicalaspects of assessing phagocytosis of Vibrio anguillarum by leucocytes of gilt-head seabream (Sparus aurata L.) by flow cytometry and electron microscopy.Cell Tissue Res. 293: 133–141.

47. Mulero, V., P. Pelegrın, M. P. Sepulcre, J. Munoz, and J. Meseguer. 2001. A fishcell surface receptor defined by a mAb mediates leukocyte aggregation anddeactivation. Dev. Comp. Immunol. 25: 619–627.

48. Sepulcre, M. P., A. Lopez-Munoz, D. Angosto, A. Garcıa-Alcazar, J. Meseguer,and V. Mulero. 2011. TLR agonists extend the functional lifespan of professionalphagocytic granulocytes in the bony fish gilthead seabream and direct precursordifferentiation towards the production of granulocytes. Mol. Immunol. 48: 846–859.

4638 GPER REGULATES GRANULOCYTE ACTIVATION IN FISH

by guest on February 3, 2019http://w

ww

.jimm

unol.org/D

ownloaded from

49. Sumpter, J. P., and S. Jobling. 1995. Vitellogenesis as a biomarker for estrogeniccontamination of the aquatic environment. Environ. Health Perspect. 103(Suppl.7): 173–178.

50. Mizukami, Y. 2010. In vivo functions of GPR30/GPER-1, a membrane receptorfor estrogen: from discovery to functions in vivo. Endocr. J. 57: 101–107.

51. Pang, Y., and P. Thomas. 2009. Involvement of estradiol-17beta and itsmembrane receptor, G protein coupled receptor 30 (GPR30) in regulation ofoocyte maturation in zebrafish, Danio rario. Gen. Comp. Endocrinol. 161:58–61.

52. Liu, X., P. Zhu, K. W. Sham, J. M. Yuen, C. Xie, Y. Zhang, Y. Liu, S. Li,X. Huang, C. H. Cheng, and H. Lin. 2009. Identification of a membrane estrogenreceptor in zebrafish with homology to mammalian GPER and its high expres-sion in early germ cells of the testis. Biol. Reprod. 80: 1253–1261.

53. Pang, Y., J. Dong, and P. Thomas. 2008. Estrogen signaling characteristicsof Atlantic croaker G protein-coupled receptor 30 (GPR30) and evidence itis involved in maintenance of oocyte meiotic arrest. Endocrinology 149:3410–3426.

54. Di Vito, C., S. Bergante, A. Balduini, A. Rastoldo, A. Bagarotti, N. Surico,A. Bertoni, and F. Sinigaglia. 2010. The oestrogen receptor GPER is expressedin human haematopoietic stem cells but not in mature megakaryocytes. Br. J.Haematol. 149: 150–152.

55. Owman, C., P. Blay, C. Nilsson, and S. J. Lolait. 1996. Cloning of human cDNAencoding a novel heptahelix receptor expressed in Burkitt’s lymphoma andwidely distributed in brain and peripheral tissues. Biochem. Biophys. Res.Commun. 228: 285–292.

56. Cabas, I., S. Liarte, A. Garcıa-Alcazar, J. Meseguer, V. Mulero, and A. Garcıa-Ayala. 2012. 17a-Ethynylestradiol alters the immune response of the teleostgilthead seabream (Sparus aurata L.) both in vivo and in vitro. Dev. Comp.Immunol. 36: 547–556.

57. Liu, F. C., Y. J. Day, J. T. Liou, H. P. Yu, and H. R. Liao. 2012. Splitomicininhibits fMLP-induced superoxide anion production in human neutrophils byactivate cAMP/PKA signaling inhibition of ERK pathway. Eur. J. Pharmacol.688: 68–75.

58. Maggiolini, M., A. Vivacqua, G. Fasanella, A. G. Recchia, D. Sisci, V. Pezzi,D. Montanaro, A. M. Musti, D. Picard, and S. Ando. 2004. The G protein-coupled receptor GPR30 mediates c-fos up-regulation by 17beta-estradiol andphytoestrogens in breast cancer cells. J. Biol. Chem. 279: 27008–27016.

59. Kanda, N., and S. Watanabe. 2003. 17Beta-estradiol enhances the production ofnerve growth factor in THP-1-derived macrophages or peripheral bloodmonocyte-derived macrophages. J. Invest. Dermatol. 121: 771–780.

60. Albanito, L., D. Sisci, S. Aquila, E. Brunelli, A. Vivacqua, A. Madeo,R. Lappano, D. P. Pandey, D. Picard, L. Mauro, et al. 2008. Epidermal growthfactor induces G protein-coupled receptor 30 expression in estrogen receptor-negative breast cancer cells. Endocrinology 149: 3799–3808.

61. Tamassia, N., M. Zimmermann, M. Castellucci, R. Ostuni, K. Bruderek, B. Schilling,S. Brandau, F. Bazzoni, G. Natoli, and M. A. Cassatella. 2013. Cutting edge: aninactive chromatin configuration at the IL-10 locus in human neutrophils. J.Immunol. 190: 1921–1925.

62. Platzer, C., E. Fritsch, T. Elsner, M. H. Lehmann, H. D. Volk, and S. Prosch.1999. Cyclic adenosine monophosphate-responsive elements are involved in thetranscriptional activation of the human IL-10 gene in monocytic cells. Eur. J.Immunol. 29: 3098–3104.

63. Cadieux, J. S., P. Leclerc, M. St-Onge, A. A. Dussault, C. Laflamme, S. Picard,C. Ledent, P. Borgeat, and M. Pouliot. 2005. Potentiation of neutrophilcyclooxygenase-2 by adenosine: an early anti-inflammatory signal. J. Cell Sci.118: 1437–1447.

64. Avni, D., O. Ernst, A. Philosoph, and T. Zor. 2010. Role of CREB in modulationof TNFalpha and IL-10 expression in LPS-stimulated RAW264.7 macrophages.Mol. Immunol. 47: 1396–1403.

65. Pouliot, M., M. E. Fiset, M. Masse, P. H. Naccache, and P. Borgeat. 2002.Adenosine up-regulates cyclooxygenase-2 in human granulocytes: impact on thebalance of eicosanoid generation. J. Immunol. 169: 5279–5286.

66. Van Eynde, A., M. Beullens, W. Stalmans, and M. Bollen. 1994. Full activationof a nuclear species of protein phosphatase-1 by phosphorylation with proteinkinase A and casein kinase-2. Biochem. J. 297: 447–449.

67. Beullens, M., A. Van Eynde, M. Bollen, and W. Stalmans. 1993. Inactivation ofnuclear inhibitory polypeptides of protein phosphatase-1 (NIPP-1) by proteinkinase A. J. Biol. Chem. 268: 13172–13177.

68. Otto, C., I. Fuchs, G. Kauselmann, H. Kern, B. Zevnik, P. Andreasen, G. Schwarz,H. Altmann, M. Klewer, M. Schoor, et al. 2009. GPR30 does not mediate estrogenicresponses in reproductive organs in mice. Biol. Reprod. 80: 34–41.

69. Kollner, B., B. Wasserrab, G. Kotterba, and U. Fischer. 2002. Evaluation ofimmune functions of rainbow trout (Oncorhynchus mykiss)—how can environ-mental influences be detected? Toxicol. Lett. 131: 83–95.

The Journal of Immunology 4639

by guest on February 3, 2019http://w

ww

.jimm

unol.org/D

ownloaded from