ORIGINAL ARTICLE

Estradiol induces osteoprotegerin expression by human dentalpulp cells

Jeeranan Manokawinchoke • Patcharee Ritprajak •

Thanaphum Osathanon • Prasit Pavasant

Received: 9 May 2014 / Accepted: 6 September 2014

� The Society of The Nippon Dental University 2014

Abstract Estrogen deficiency is associated with

increased inflammation related periapical bone resorption.

The present study aimed to evaluate the effect and intra-

cellular mechanism(s) of estrogen on osteoprotegerin

(OPG) and receptor activator of nuclear factor jB ligand

(RANKL) expression in human dental pulp cells (HDPs).

HDPs were treated with estradiol at a concentration of

0.1–10 lM. The results showed that estradiol induced OPG

expression at both the mRNA and protein levels in a dose-

dependent manner. However, no influence on RANKL

expression was observed. An estrogen receptor (ER)

inhibitor failed to attenuate the estradiol-induced OPG

expression. Furthermore, ER-a and ER-b agonists did not

simulate estradiol’s effects on OPG expression by HDPs.

However, a significant OPG upregulation was observed in

HDPs treated with an estradiol-BSA conjugate or a GPR30

agonist. An ERK inhibitor significantly enhanced estradiol-

induced OPG expression, whereas a p38 inhibitor markedly

attenuated this expression. In conclusion, OPG expression

by HDPs may be regulated by estradiol binding a mem-

brane receptor and the balance between the ERK and p38

signaling pathways.

Keywords Human dental pulp cells � Estrogen � OPG �RANKL

Introduction

The role of estrogen in hard tissue homeostasis is well

known. Postmenopausal women, who lack estrogen, are

affected by osteoporosis [1]. In addition, the role of

estrogen in men has been reported. In men, the enzyme

aromatase can convert testosterone to estradiol [2], which

has been shown to influence body composition, strength,

and sexual function [2]. In addition, estrogen deficient

animals have been found to have a significant increase in

periapical bone resorption [3]. Correspondingly, periapical

lesions in ovariectomized rats demonstrated a significant

increase in receptor activator of nuclear factor jB ligand

(RANKL)-positive cells [4]. Thus, estrogen may regulate

hard tissue destruction in tooth-related areas.

Two forms of the estrogen receptor (ER-a and ER-b)

have been identified in human dental pulp cells (HDPs) [5].

Estrogen has been shown to promote the osteo/odontogenic

differentiation of dental pulp cells [6]. Together, these

results suggest the influence of estrogen in dental and

periapical tissue homeostasis.

Estradiol, a form of estrogen, stimulated osteoprotegerin

(OPG) expression and decreased the expression of RANKL

in osteoblasts [7]. OPG and RANKL are molecules that

play important roles in osteoclast formation and potentially

regulate hard tissue resorption [8]. In inflamed dental pulp

tissue, the upregulation of OPG expression was noted [9],

implying that OPG is involved in pulp homeostasis. In the

present study, we hypothesized that estrogen may partici-

pate in pulp homeostasis. Thus, the aim of our study was to

investigate the influence of estrogen on OPG and RANKL

J. Manokawinchoke � P. Ritprajak � T. Osathanon � P. Pavasant

Mineralized Tissue Research Unit, Faculty of Dentistry,

Chulalongkorn University, Bangkok, Thailand

J. Manokawinchoke � T. Osathanon � P. Pavasant (&)

Department of Anatomy, Faculty of Dentistry,

Chulalongkorn University, Henri-Dunant Rd.,

Pathumwan, Bangkok 10330, Thailand

e-mail: prasit215@gmail.com

P. Ritprajak

Department of Microbiology and Immunology, and DRU in Oral

Microbiology, Faculty of Dentistry, Chulalongkorn University,

Bangkok, Thailand

123

Odontology

DOI 10.1007/s10266-014-0178-x

expression in dental pulp cells. The potential regulatory

mechanism was also examined.

Materials and methods

Cell culture

The human dental pulp cell isolation protocol was approved

by the Ethics Committee of the Faculty of Dentistry, Chul-

alongkorn University. HDPs were isolated from freshly

extracted teeth that were removed according to the treatment

plan. Informed consent was obtained from patients prior to

extraction. The isolation protocol and culture conditions were

performed as previously described [10]. Briefly, the teeth were

gently split apart and the dental pulp tissues were removed and

rinsed in sterilized culture medium. The tissues were minced

into small pieces and placed in 35 mm dishes in a humidified

atmosphere with 5 % CO2 at 37 �C and the HDP cells were

allowed to migrate from the tissue. The HDP cells were cul-

tured until near confluence and then subcultured by trypsini-

zed and maintained in Dulbecco’s Modified Eagle Medium

(DMEM) containing penicillin (100 unit/mL), streptomycin

(100 ug/mL), amphotericin B (250 ng/mL), 2 mM L-gluta-

mine (1x Glutamax�) and 10 % FBS. The culture medium and

supplements were purchased from Gibco (BRL, Carlsbad,

CA, USA). The cells were cultured in a humidified atmo-

sphere with 5 % CO2 at 37 �C. Cells from passages 3–6 were

used in the study. Cells from three different donors were used.

Cell treatment

HDPs were seeded in 12-well plates (37,500 cells/cm2).

The cells were starved in serum free medium for 8 h prior

to treatment. The concentrations of the reagents used were

0.1–10 lM 17b-estradiol (Sigma-Aldrich, St. Louis, MO,

USA), 2.7 lg/mL 17b-estradiol-BSA (CalBioreagents, San

Mateo, CA, USA), 400 pM PPT (an estrogen receptor aagonist; Tocris Bioscience, Bristol, UK), 10 nM ERB 041

(an estrogen receptor b agonist; Tocris Bioscience, Bristol,

UK), 0.3 nM ICI 182,780 (an estrogen receptor antagonist;

Tocris Bioscience, Bristol, UK), 5 nM G-1 (a GPR30

receptor agonist; Tocris Bioscience, Bristol, UK, 0.26 lM

Src Kinase inhibitor I (Calbiochem, San Diego, CA, USA),

1.4 lM LY294002, a phosphatidylinositol 3-kinase

(PI3 K) inhibitor (Calbiochem, San Diego, CA, USA), 10

nM NF-jB inhibitor (Calbiochem, San Diego, CA, USA),

2.5 lM ERK inhibitor (Calbiochem, San Diego, CA,

USA), and 5.2 lM SB 203580 (a p38 kinase inhibitor;

(Calbiochem, San Diego, CA, USA).

Cell viability test

Cell viability analysis was performed using the MTT assay

as previously described [11]. Briefly, the cells were incu-

bated in the MTT (3-(4, 5-dimethylthiazol-2-yl)-2,

5-diphenyltetrazolium bromide) solution for 15 min. Sub-

sequently, the formazan crystals were dissolved in a buffer

composed of glycine (0.1 M), sodium chloride (0.1 M),

and DMSO at pH 10. Absorbance was measured at 570 nm

using a microplate reader (Elx800; Biotek, Winooski, VT,

USA). The data were normalized to control.

Reverse transcription-polymerase chain reaction

(RT-PCR)

Total RNA was extracted using Isol-RNA Lysis Reagent (5

PRIME, Gaithersburg, MD, USA). RT-PCR was performed

as previously described [9]. Briefly, one microgram of each

RNA sample was converted to cDNA using reverse trans-

criptase (Promega, Madison, WI, USA). The polymerase

chain reaction was performed in a thermocycling machine

(BiometraGmH, Gottingen, Germany) using Taq polymer-

ase (Invitrogen, Eugene, OR, USA). The primers’ sequences

are shown in Table 1 [12–14]. The annealing temperature

was 60 �C. The PCR products were electrophoresed on

1.8 % agarose gel and stained with ethidium bromide.

Enzyme-linked immunosorbent assay (ELISA)

The secreted OPG protein was measured using a Human

Osteoprotegerin/TNFRSF11B DuoSet kit (catalog no:

DY805, R and D Systems, Minneapolis, MN, USA) according

to the manufacturer’s instructions. The capture antibody and

Table 1 Primer sequences

Gene (Accession No) Forward sequence Reverse sequence Cycles

Estrogen receptor a (NM_000125) 50AACACAAGCGCCAGAGAGAT30 50GATCTCCACCATGCCCTCTA30 40

Estrogen receptor b (NM_001437.2) 50TGAAAAGGAAGGTTAGTGGGAACC30 50TGGTCAGGGACATCATCATGG30 40

RANKL (NM_033012.2) 50CCAGCATCAAAATCCCAAGT30 50CCCCTTCAGATGATCCTTC30 32

OPG (NM_002546.3) 50TCAAGCAGGAGTGCAATCG30 50AGAATGCCTCCTCACACAGG30 24

GAPDH (NM_002046.3) 50TGAAGGTCGGAGTCAACGGAT30 50TCACACCCATGACGAACATGG30 22

Odontology

123

the detection antibody were mouse anti-human OPG and

biotinylated goat anti-human OPG, respectively. The absor-

bance was determined at 450 nm. The concentration of OPG

was calculated using a recombinant human OPG standard

curve. The data are presented as the percentage increase of

OPG concentration compared to the control.

Western blot analysis

Blotting was performed as previously described [10].

Protein concentrations were determined using a BCA assay

kit (Pierce Biotechnology, Rockford, IL, USA). The

membrane was incubated with primary antibody overnight.

Subsequently, the membranes were incubated with biotin-

ylated secondary antibody for 30 min, followed by perox-

idase-labeled streptavidin for 30 min. Chemiluminescence

(Pierce Biotechnology, Rockford, IL, USA) was used to

evaluate the presence of the target protein. The primary

antibodies used were mouse anti-human RANKL (dilution

1:300, R and D Systems, Minneapolis, MN, USA), mouse

anti-human ACTIN (dilution 1:2000, Chemicon Interna-

tional, Billerica, MA, USA), rabbit anti-phospho-ERK1/

ERK2 (dilution 1:2000, R and D Systems, Minneapolis,

MN, USA), mouse anti-ERK1/ERK2 (dilution 1:2000, R

and D Systems, Minneapolis, MN, USA), rabbit anti-

phospho-p38 (dilution 1:1000, R and D Systems, Minne-

apolis, MN, USA), mouse anti-p38 (dilution 1:1000, Santa

Cruz Biotechnology, Inc., Santa Cruz, CA, USA).

Immunocytochemistry staining

The cells were fixed with 4 % formalin and permeabilized

with 0.1 % Triton-X100. The cells were incubated with

primary antibodies against estrogen receptor a (dilution 1:

250, Chemicon International, Billerica, MA, USA) or

estrogen receptor b (dilution 1: 100, Chemicon International,

Billerica, MA, USA) at 4 �C overnight. The specimens were

then incubated with biotinylated secondary antibody, fol-

lowed by streptavidin-FITC and DAPI. The images were

captured using a Zeiss Axio Observer Z1 (Carl Zeiss, Ger-

many). The staining protocol was performed omitting the

primary antibody as the negative control.

Statistical analysis

The data were presented as mean ± standard deviation and

statistically analyzed by one-way analysis of variance

(ANOVA) using SPSS software (Chicago, IL, USA). The

Scheffe’s test was used for post hoc analysis (significance

was set at p \ 0.05).

Results

Estradiol enhanced OPG expression

We began by examining the endogenous expression of ER-

a and ER-b in HDPs. We observed the mRNA expression

Fig. 1 Human dental pulp cells expressed estrogen receptors (ER).

ER-a and ER-b expression was examined using reverse transcriptase

polymerase chain reaction (a) and immunocytochemistry staining (b).

Cell viability was determined using an MTT assay after estradiol

treatment for 24 h (c)

Odontology

123

of ER-a and ER-b in human dental pulp tissues and HDPs

(Fig. 1a). Correspondingly, ER-a and ER-b protein

expression was observed in HDPs (Fig. 1b). We found no

differences in cell viability after exposing HDPs to estra-

diol at concentrations ranging from 0.1 to 10 lM for 24 h

(Fig. 1c). Furthermore, OPG mRNA and protein levels

increased in a dose-dependent manner upon estradiol

stimulation (Fig. 2a, b). However, estradiol did not

enhance RANKL expression at either the mRNA or protein

level (Fig. 2a, c). The upregulation of OPG but not

RANKL expression in HPDs treated with estradiol resulted

in a dose-dependent increase in the OPG/RANKL ratio.

However, only the groups treated with estradiol at con-

centrations of 1 and 10 lM demonstrated a statistically

significant release of OPG protein release. Thus, estradiol

at a concentration of 10 lM was used in subsequent

experiments.

A membrane receptor, not ER, is involved in estradiol-

induced OPG expression

Blocking the ER with ICI 182780 did not attenuate the

estradiol-induced OPG expression at the mRNA or protein

levels (Fig. 3a, b). In addition, neither the ER-a agonist nor

the ER-b agonist stimulated OPG expression at the mRNA

or protein levels (Fig. 3c, d).

We used estradiol-BSA, which cannot pass through the cell

membrane, to investigate if a membrane receptor was

involved in the estradiol-induced OPG expression. The results

demonstrated that both estradiol and estradiol-BSA enhanced

OPG mRNA and protein expression (Fig. 4a, b). No differ-

ences in RANKL mRNA expression was observed under

either condition. Correspondingly, OPG mRNA and protein

expression were upregulated by a GPR30 agonist, similar to

treatment with estradiol (Fig. 4c, d). These results suggest the

role of a membrane-bound receptor in estradiol-induced OPG

expression.

ERK and p38 contributed to estradiol-induced OPG

expression

To determine the potential intracellular signaling pathway

of estradiol signaling, various pathway inhibitors were

employed. HDPs were pretreated with each inhibitor before

estradiol treatment. The results showed that the Src, PI3 K,

and NF-jB inhibitors did not alter the estradiol-induced

OPG expression (Fig. 5a). Interestingly, pretreatment with

the ERK inhibitor resulted in an additional upregulation of

OPG expression, however, the p38 inhibitor attenuated this

expression (Fig. 5b, c). Combined pretreatment with ERK

inhibitor and p38 inhibitor had similar effects to that of

pretreatment with p38 inhibitor alone (Fig. 5b, c), implying

a regulatory role for p38.

We also evaluated the phosphorylation levels of ERK and

p38. Phosphorylated ERK and p38 were noted at 15 min after

estradiol treatment and phosphorylation levels decreased

thereafter (Fig. 6a). The p38 and ERK phosphorylation levels

were attenuated by pretreatment with a p38 inhibitor and an

ERK inhibitor, respectively (Fig. 6b). These results confirmed

the contribution of p38 and ERK signaling to estradiol sig-

naling in HDPs. We also found that that p38 inhibition in

estradiol-treated HDPs resulted in increased ERK phosphor-

ylation compared to the control (Fig. 6b). However, ERK

inhibition did not influence p38 phosphorylation levels

(Fig. 6b). Thus, the balance between p38 and ERK signaling

may play a role in estradiol-induced OPG expression.

To evaluate the mechanism of a membrane-bound

receptor in estradiol-treated HPDs, HDPs were treated with

Fig. 2 Estradiol induced OPG expression in human dental pulp cells

(HDPs). HDPs were treated with estradiol for 24 h. OPG and RANKL

mRNA expression (a). OPG and RANKL protein expression was

determined using an enzyme-linked immunosorbent assay (b) and

western blot analysis (c), respectively. Asterisk indicates a significant

difference compared to the control

Odontology

123

Fig. 3 Estrogen receptor (ER)

agonists did not stimulate OPG

expression in human dental pulp

cells (HDPs). HDPs were

treated with either estradiol, an

ER-a agonist, or ER-b agonist

for 24 h. In the ER inhibition

experiment, HDPs were

pretreated with an ER

antagonist (ICI 182780) for

30 min. OPG and RANKL

mRNA expression was

determined using reverse

transcriptase polymerase chain

reaction (a, c). OPG protein

expression was evaluated using

an enzyme-linked

immunosorbent assay (b, d).

Asterisk indicates a significant

difference compared to the

control

Fig. 4 GPR30 agonist induced

OPG expression in human

dental pulp cells (HDPs). HDPs

were treated with either

estradiol, estradiol-BSA, an ER-

a agonist, an ER-b agonist, or a

GPR30 agonist for 24 h. OPG

and RANKL mRNA expression

was determined using reverse

transcriptase polymerase chain

reaction (a, c). OPG protein

expression was examined using

an enzyme-linked

immunosorbent assay (b, d).

Asterisk indicates a significant

difference compared to the

control

Odontology

123

a GPR30 agonist and the p38 and ERK phosphorylation

levels were evaluated. The results illustrated that the

GPR30 agonist induced an increase in p38 and ERK

phosphorylation levels at 15 min and the phosphorylation

levels subsequently decreased (Fig. 7). These results were

similar to those of HDPs treated with estradiol, implying

the participation of membrane-bound receptor signaling in

estradiol-induced OPG expression by HDPs.

Discussion

In the present study, we investigated the influence of

estradiol on OPG and RANKL expression by HDPs,

finding that estradiol increased the expression of OPG but

not that of RANKL We also found that the estradiol-

induced OPG expression occurred via a membrane-bound

receptor, not through ER-a or ER-b. OPG and RANKL

have been demonstrated to be associated with periapical

bone loss. When stimulated with a polymicrobial biofilm,

dental pulp cells exhibited a lower OPG/RANKL ratio than

did periodontal ligament cells [15]. The increase of OPG

expressing cells in metformin treatment was related to the

attenuation of periapical bone loss [16]. The pro-inflam-

matory cytokines IL1-a and TNF-a stimulated RANKL but

decreased OPG expression in human dental pulp cells [17].

In the primary dentition, the OPG/RANKL ratio in the

dental pulp regulates physiological root resorption [18].

However, the role of the OPG/RANKL ratio in the dental

pulp of permanent teeth is unresolved. The specific func-

tion of the OPG/RANKL ratio in the destruction of dental

pulp and periapical tissues is unclear due to the limited

numbers of studies [19]. In addition, the OPG/RANKL

ratio was not carefully evaluated in these studies [19].

However, the OPG/RANKL ratio may contribute to the

regulation of hard tissue destruction in periapical lesions

and internal resorption.

A difference in periapical bone loss has been observed

between male and female mice. Male mkp-1-/- mice

exhibited significantly greater periapical bone loss than that

of mkp-1-/- female mice [20], suggesting the potential role

of sex hormones in the regulation of periapical bone

destruction. In addition, estrogen deficient rats had signif-

icantly higher periapical bone resorption when compared to

normal rats [3]. Moreover, RANKL-positive cells were

prevalent in the periapical lesions of ovariectomized rats

[4]. These findings are consistent with our study where

estradiol treatment resulted in the increase of OPG

expression. Although the RANKL expression was not

altered, the OPG/RANKL ratio increased. In addition to its

role in regulating the OPG/RANKL ratio, estrogen levels

have been shown to be correlated to dental pulp micro-

circulation in women [21], with high serum estradiol levels

associated with high pulpal blood flow. Conversely, post-

menopausal and menstruating women had low pulpal blood

flow. It was also reported that in men, oral supplementation

with testosterone resulted in an increase of serum estradiol

in a dose-dependent manner [2]. Although the effect of

estradiol on hard tissue in men is still unclear, increased

serum estradiol in men resulted in an increase in body fat

accumulation and decreased sexual function [2]. Our

finding suggests that estrogen may have a protective role

on hard tissue and participates in the homeostasis of dental

pulp and periapical tissues.

Estrogen has been shown to activate its intracellular

signaling via binding with the classical steroid receptors

(ER-a and ER-b) or G protein-coupled receptors [22]. ER-

Fig. 5 ERK and p38 signaling pathways are involved in estradiol-

induced OPG expression. OPG protein expression was determined after

treating human dental pulp cells with estradiol in the presence of various

signaling inhibitors (a). OPG and RANKL mRNA expression was

determined using reverse transcriptase polymerase chain reaction (b). e

OPG protein expression was examined using an enzyme-linked immu-

nosorbent assay (c). Bars indicate a significant difference between groups

Odontology

123

a and ER-b are both expressed in human dental pulp cells

(HDPs) [5], and ER-a has been detected in human dental

pulp tissues [23]. This is in accordance with our results that

human dental pulp tissues and cells expressed both ER-aand ER-b at the mRNA level. ER-a and ER-b protein

expression was also present in HDPs. We also observed

that HDPs expressed GPR30 mRNA (data not shown).

These data imply that HDPs may respond to estradiol

stimulation via the classical steroid receptors or G protein-

couple receptors.

One limitation of the present study is that we did not

have information on the sex of the donors of the cells and

tissues due to ethical constraints. It has been previously

reported that ER-a was expressed in both male and female

HDPs [5]. Studies have shown that there is no correlation

between estrogen receptor expression and sex differences

in thyroid sections of Graves’ disease subjects and nodular

goiter as well as pulmonary neuroendocrine tumors [24,

25]. However, a study has shown that female-derived

HDPs exhibited higher levels of ER expression compared

to those of the male-derived cells [5]. Thus, the differential

ER expression and function based on the donor’s sex

should be further investigated.

Estrogen binds to ERs and regulates gene expression

[26]. In the present study, ER-a and ER-b agonists did not

stimulate OPG expression. Correspondingly, ER inhibition

did not diminish the estradiol effect. These data indicate

that ER-a and ER-b did not participate in estradiol-induced

OPG expression in HDPs. Thus, we hypothesized that this

effect might occur via a membrane receptor. We used

Fig. 6 p38 inhibitor enhanced ERK phosphorylation in estradiol-

treated human dental pulp cells (HDPs). The phosphorylation levels

of ERK and p38 were determined using western blot analysis after

estradiol treatment (a). HDPs were treated with estradiol in the

presence or absence of the p38 inhibitor or the ERK inhibitor. The

phosphorylation levels of ERK and p38 at different time points were

determined using western blot analysis (b)

Fig. 7 GPR30 agonist induced p38 and ERK phosphorylation in

human dental pulp cells (HDPs). HDPs were treated with a GPR30

agonist and the phosphorylation levels of p38 and ERK were

determined using western blot analysis at various time points after

treatment

Odontology

123

estradiol-BSA, a cell impermeable form of estradiol, to

investigate this hypothesis. Interestingly, estradiol-BSA

enhanced OPG expression similar to that of estradiol in

HDPs, implying the role of a membrane receptor in

estradiol signaling. It has been reported that the non-

genomic effects of estradiol occurred via a G-protein-

coupled protein or membrane-associated receptor [27, 28].

The present study demonstrated that estradiol upregu-

lated the phosphorylation levels of ERK and p38. Previous

studies using various cell types also reported that estradiol

signaling was regulated via the ERK and p38 signaling

pathways. For example, ERK and p38 involvement was

shown in the estradiol-induced reduction in apoptosis in

skeletal muscle cells [29, 30]. In contrast, it was previously

reported that estradiol promoted the osteo/odontogenic

differentiation of human dental pulp stem cells via acti-

vation of NF-jB [6]. However, we did not observe the

involvement of NF-jB in our study. Notably, we found that

GPR30 agonist treatment resulted in increased phosphor-

ylation levels of ERK and p38. In accordance with our

results, it has been reported that GPR30 regulates gene

expression in response to estrogen stimulation via the

GPR30/EGFR/ERK signaling pathway [31]. These data

imply that estradiol activates its intracellular signaling via

binding to a membrane-associated receptor.

Our study revealed that ERK inhibition increased the

estradiol-induced OPG expression, but p38 inhibition

attenuated this expression. Moreover, p38 inhibition resulted

in increased ERK phosphorylation levels. These results

imply that the balance between ERK and p38 signaling is

involved in the mechanism(s) of estradiol-induced OPG

expression in HDPs. It has been shown that p38 inhibition

resulted in the attenuation of P. gingivalis-induced RANKL,

but not OPG, in bone marrow stromal cells, implying the

existence of different regulatory mechanisms [32]. Thus, our

study revealed a potential estradiol regulating mechanism in

HDPs. Further investigation into the role of OPG in dental

pulp in addition to osteoclastogenesis regulation should be

further investigated.

In summary, the present study has shown that estrogen

enhanced OPG expression in human dental pulp cells.

Interestingly, the mechanism involved membrane-bound

receptors rather than the typical estrogen receptors. The

regulation of OPG/RANKL expression in HDPs by estra-

diol could be translated into a clinical treatment. The

application of an estrogen-like substance in the dental pulp

tissues may increase the OPG/RANKL ratio and attenuate

bone resorption. Correspondingly, it has previously been

shown that estradiol participated in the odonto/osteogenic

differentiation by human dental pulp cells [6, 33]. In

addition, phytoestrogen was utilized in several clinical

trials in postmenopausal women, resulting in positive

clinical outcomes [34, 35]. Thus, estradiol may be a

candidate chemical agent for the potential application in

dental treatment. However, this hypothesis requires further

investigation.

Acknowledgments This study was supported by ‘Integrated Inno-

vation Academic Center: IIAC’ Chulalongkorn University Centenary

Academic Development Project and the Research Chair Grant 2012,

the National Science and Technology Development Agency

(NSTDA).

Conflict of interest All authors declare no conflicts of interest in

the present study.

References

1. Balasch J. Sex steroids and bone: current perspectives. Hum

Reprod Update. 2003;9:207–22.

2. Finkelstein JS, Lee H, Burnett-Bowie SM, Pallais JC, Yu EW,

Borges LF, Barry CV, Wulczyn KE, Thomas BJ, Leder BZ.

Gonadal steroids and body composition strength, and sexual

function in men. N Engl J Med. 2013;369:1011–22.

3. Gilles JA, Carnes DL, Dallas MR, Holt SC, Bonewald LF. Oral

bone loss is increased in ovariectomized rats. J Endod.

1997;23:419–22.

4. Zhang X, Peng B, Fan M, Bian Z, Chen Z. The effect of estrogen

deficiency on receptor activator of nuclear factor kappa B ligand

and osteoprotegerin synthesis in periapical lesions induced in

rats. J Endod. 2007;33:1053–6.

5. Inaba T, Kobayashi T, Tsutsui TW, Ogawa M, Uchida M, Tsutsui

T. Expression status of mRNA for sex hormone receptors in

human dental pulp cells and the response to sex hormones in the

cells. Arch Oral Biol. 2013;58:943–50.

6. Wang Y, Zheng Y, Wang Z, Li J, Wang Z, Zhang G, et al. 10(-7)

m 17beta-oestradiol enhances odonto/osteogenic potency of

human dental pulp stem cells by activation of the NF-kappaB

pathway. Cell Prolif. 2013;46:677–84.

7. Bord S, Ireland DC, Beavan SR, Compston JE. The effects of

estrogen on osteoprotegerin, RANKL, and estrogen receptor

expression in human osteoblasts. Bone. 2003;32:136–41.

8. Boyce BF, Xing L. Functions of RANKL/RANK/OPG in bone

modeling and remodeling. Arch Biochem Biophys.

2008;473:139–46.

9. Kuntz KA, Brown CE Jr, Legan JJ, Kafrawy AH. An immuno-

histochemical study of osteoprotegerin in the human dental pulp.

J Endod. 2001;27:666–9.

10. Srisawasdi S, Pavasant P. Different roles of dexamethasone on

transforming growth factor-beta1-induced fibronectin and nerve

growth factor expression in dental pulp cells. J Endod.

2007;33:1057–60.

11. Muincharern W, Louwakul P, Pavasant P, Lertchirakarn V. Effect

of fluocinolone acetonide on human dental pulp cells: cytotox-

icity, proliferation, and extracellular matrix formation. J Endod.

2011;37:181–4.

12. Kim IY, Kim BC. Seong do H. Raloxifene, a mixed estrogen

agonist/antagonist, induces apoptosis in androgen-independent

human prostate cancer cell lines. Cancer Res. 2002;62:5365–9.

13. Lee SI, Kim GT, Kim HJ, Park SH, Kim EC. NOD2 mediates

odontoblast differentiation and RANKL expression. J Dent Res.

2014;93:678–84.

14. Zhang D, Yang YQ, Li XT, Fu MK. The expression of osteopro-

tegerin and the receptor activator of nuclear factor kappa B ligand

in human periodontal ligament cells cultured with and without

1alpha,25-dihydroxyvitamin D3. Arch Oral Biol. 2004;49:71–6.

Odontology

123

15. Belibasakis GN, Meier A, Guggenheim B, Bostanci N. Oral

biofilm challenge regulates the RANKL-OPG system in peri-

odontal ligament and dental pulp cells. Microb Pathog.

2011;50:6–11.

16. Liu L, Zhang C, Hu Y, Peng B. Protective effect of metformin on

periapical lesions in rats by decreasing the ratio of receptor

activator of nuclear factor kappa B ligand/osteoprotegerin. J En-

dod. 2012;38:943–7.

17. Kim YS, Min KS, Lee HD, Oh HW, Kim EC. Effect of cytosolic

phospholipase A2 on proinflammatory cytokine-induced bone

resorptive genes including receptor activator of nuclear factor

kappa B ligand in human dental pulp cells. J Endod.

2010;36:636–41.

18. Zhu Y, Shang L, Chen X, Kong X, Liu N, Bai Y, et al. Deciduous

dental pulp stem cells are involved in osteoclastogenesis during

physiologic root resorption. J Cell Physiol. 2013;228:207–15.

19. Belibasakis GN, Rechenberg DK, Zehnder M. The receptor

activator of NF-kappaB ligand-osteoprotegerin system in pulpal

and periapical disease. Int Endod J. 2013;46:99–111.

20. McAbee J, Li Q, Yu H, Kirkwood KL. Sexual dimorphism in

periapical inflammation and bone loss from mitogen-activated

protein kinase phosphatase-1 deficient mice. J Endod.

2012;38:1097–100.

21. Dzeletovic B, Grga D, Krsljak E, Stratimirovic D, Brkovic B,

Stojic D. Dental pulp blood flow and its oscillations in women

with different estrogen status. J Endod. 2012;38:1187–91.

22. Prossnitz ER, Arterburn JB, Smith HO, Oprea TI, Sklar LA,

Hathaway HJ. Estrogen signaling through the transmembrane G

protein-coupled receptor GPR30. Annu Rev Physiol.

2008;70:165–90.

23. Jukic S, Prpic-Mehicic G, Talan-Hranilovc J, Miletic I, Segovic

S, Anic I. Estrogen receptors in human pulp tissue. Oral Surg

Oral Med Oral Pathol Oral Radiol Endod. 2003;95:340–4.

24. Domoslawski P, Podhorska-Okolow M, Pula B, Lukienczuk T,

Dziegiel P. Expression of estrogen and progesterone receptors

and Ki-67 antigen in graves’ disease and nodular goiter. Folia

Histochem Cytobiol. 2013;51:135–40.

25. Sica G, Wagner PL, Altorki N, Port J, Lee PC, Vazquez MF, Saqi

A. Immunohistochemical expression of estrogen and

progesterone receptors in primary pulmonary neuroendocrine

tumors. Arch Pathol Lab Med. 2008;132:1889–95.

26. Stevis PE, Deecher DC, Suhadolnik L, Mallis LM, Frail DE.

Differential effects of estradiol and estradiol-BSA conjugates.

Endocrinology. 1999;140:5455–8.

27. Schwartz N, Chaudhri RA, Hadadi A, Schwartz Z, Boyan BD.

17Beta-estradiol promotes aggressive laryngeal cancer through

membrane-associated estrogen receptor-alpha 36. Horm Cancer.

2014;5:22–32.

28. Sylvia VL, Walton J, Lopez D, Dean DD, Boyan BD, Schwartz

Z. 17 beta-estradiol-BSA conjugates and 17 beta-estradiol regu-

late growth plate chondrocytes by common membrane associated

mechanisms involving PKC dependent and independent signal

transduction. J Cell Biochem. 2001;81:413–29.

29. Ronda AC, Vasconsuelo A, Boland R. Extracellular-regulated

kinase and p38 mitogen-activated protein kinases are involved in

the antiapoptotic action of 17beta-estradiol in skeletal muscle

cells. J Endocrinol. 2010;206:235–46.

30. Ronda AC, Buitrago C, Boland R. Role of estrogen receptors,

PKC and Src in ERK2 and p38 MAPK signaling triggered by

17beta-estradiol in skeletal muscle cells. J Steroid Biochem Mol

Biol. 2010;122:287–94.

31. Prossnitz ER, Maggiolini M. Mechanisms of estrogen signaling

via GPR30. Mol Cell Endocrinol. 2009;308:32–8.

32. Reddi D, Brown SJ, Belibasakis GN. Porphyromonas gingivalis

induces RANKL in bone marrow stromal cells: involvement of

the p38 MAPK. Microb Pathog. 2011;51:415–20.

33. Wang Y, Yan M, Yu Y, Wu J, Yu J, Fan Z. Estrogen deficiency

inhibits the odonto/osteogenic differentiation of dental pulp stem

cells via activation of the NF-kappaB pathway. Cell Tissue Res.

2013;352:551–9.

34. Scuderi G, Contestabile MT, Gagliano C, Iacovello D, Scuderi L,

Avitabile T. Effects of phytoestrogen supplementation in post-

menopausal women with dry eye syndrome: a randomized clin-

ical trial. Can J Ophthalmol. 2012;47:489–92.

35. Yang TS, Wang SY, Yang YC, Su CH, Lee FK, Chen SC, et al.

Effects of standardized phytoestrogen on Taiwanese menopausal

women. Taiwan J Obstet Gynecol. 2012;51:229–35.

Odontology

123