1  

Establishing a method to extract bacterial DNA from the cervical mucus plug

Stud. Med. Lea Kirstine Hansen, årskortnummer: 20074156

Vejleder: Professor, DMSc., Niels Uldbjerg.

Abstract

Objective: The cervical mucus plug is thought to constitute a barrier against ascending infections

during pregnancy. Such infections may cause preterm birth. No previous studies have performed

bacterial DNA extraction from the cervical mucus plug. Bacterial DNA can be used for PCR

techniques. The objective was therefore to establish a method to extract bacterial DNA from the

cervical mucus plug.

Methods: Qiagen DNA Mini Kit (QIAGEN GmbH, Hilden, Germany), a silica membrane based

technique, and bead beating, a physical disruption technique, were compared regarding bacterial

DNA yield as measured by 16SrDNA qPCR.

Results: Both extraction methods were able to extract bacterial DNA from the cervical mucus plug,

and there was no difference in the DNA yield between the two.

Conclusion: By establishing two methods to extract bacterial DNA from the cervical mucus plug, it

is possible to conduct studies that focus on the amount and morphology of the cervical mucus plug.

  2  

Introduction:

The cervical mucus plug (CMP) is a visco-elastic gel-like structure that fills out the cervical canal

during pregnancy (Figure 1). It constitutes a physical and immunological barrier between the sterile

uterine cavity and the bacterial rich vagina. Several studies suggest that the CMP exhibits important

gate-keeper functions during pregnancy and that this property is crucial for the protection against

ascending infection and hence preterm delivery (1–7)

Figure 1: The cervical mucus that creates the CMP is secreted from the endocervical glands/crypts. After conception

hormones influence the mucus to thicken and it becomes a regular plug.

Approximately 30% of all preterm deliveries have infectious etiology (8), and especially

Ureaplasma species have been linked to preterm birth (8–14). No previous studies have evaluated

the number or the species of the bacteria present in the CMP using polymerase chain reaction

(PCR) techniques. This technique is the most sensitive method to detect microbial pathogens in

clinical specimens, especially when many bacteria are difficult to culture in vitro, for example

Ureaplasma species(15). Other studies(16) have performed bacterial DNA extraction on cervix

mucus from non-pregnant women. However, it is not possible to use the same DNA extraction

methods due to differences in the the consistency of the mucus from pregnant and non-pregnant

women(17).

  3  

The objective of this study was therefore to establish a method to extract bacterial DNA from CMP

specimens to subsequent use for quantitative PCR (qPCR).

Methods:

Whole cervical mucus plugs (CMPs) (figure 2) were either spontaneously shed or digitally retrieved

during active vaginal labor (n = 5, gestational age 37-42 weeks, cervical dilatation 4-10 cm). The

CMPs were stored at 4°C for a maximum of 48 hours before they were stored at -80°C, and kept

until analyses.

For bacterial DNA extraction, two methods were compared: Standard Qiagen extraction (Qiagen

DNA Mini Kit, QIAGEN GmbH, Hilden, Germany), and a bead beating (18) protocol with

subsequent Qiagen extraction. In order to determine which extraction method that results in the

highest DNA yield, extracts were run on 16SrDNA quantitative PCR (qPCR). 16SrDNA is a gene

that codes for 16SrRNA, which is a component of the 30S subunit of bacterial ribosomes. By using

this gene to design a primer for qPCR, the total bacterial load will be quantified.

Whole CMPs were crushed in liquid nitrogen with a mortar and pestle and from the resulting

powder 100 mg were used for extraction. Specimens from the same mucus plug were extracted

according to both protocols.

Figure 2: Whole CMP

  4  

Qiagen blood and tissue kit

(QIAGEN GmbH, Hilden, Germany)

This DNA extraction method is based on a silica-membrane technology. The specimen/powder was

dissolved in 180μl ATL buffer and 20μl proteinase K in an incubator at 56°C until the mucus was

completely dissolved. 200μl AL buffer was added and the specimens were mixed thoroughly by

vortexing. Then 200μl ethanol (96-100%) was added and the specimens were mixed by vortexing

again and added to a spin column. The spin column was centrifuged at 6000 x g for one minute,

flow through and collection tube were discarded. The spin column was transferred to a new

collection tube, 500μl AW1 buffer was added and it was centrifuged at 6000 x g for one minute.

The spin column was again added to a new collection tube, 500μl AW2 buffer was added and it was

centrifuged at 20000 x g for three minutes. The DNA was finally eluted in 200μl elution buffer.

Bead beating

This DNA extraction method is based on physical disruption of both human and microbial cells(18). The specimens were dissolved in a mixture of lyzozyme, TE buffer, proteinase K (30mM Tris/HCl

pH 8.0; 15 mg/ml lyzozyme + 20μg/ml proteinase K) and 200μl AL buffer in an incubator at 56°C

until the mucus was completely dissolved. The specimen was then transferred to a 2 mL tube

containing 200 μl beads (Zirkonia/Silica Beads 0,1mm pk/450g, Roth, Karlsruhe,Germany, N033.1)

in AL buffer. The sample was homogenized for 70 seconds at 7000 rpm in a MagNALyser (Roche,

Hvidovre, Denmark) and then centrifuged at 30.000 x g for five minutes. The sample was

transferred to a new 1.5 mL tube and 230μl ethanol (70%) was added. The mixture was now

transferred to spin column and the extraction continued as with the Qiagen procedure.

16S rDNA qPCR

To run the 16SrDNA qPCR it was necessary to optimize the primers and PCR conditions. In our

first set up the PCR conditions were composed of:

  5  

95°C for 10 min, 10 cycles of 95°C/15 sec., 65°C/30 sec. with a 1 °C decrement per cycle and

72°C/32 sec., 30 cycles of 95°C/15 sec., 55°C/30 sec and 72°C/32 sec., 72°C for 7 minutes, 95°C

for 15 seconds, 50°C for 1 minute, 95°C for 15 seconds and 60°C for 15 seconds.

In the next setup the PCR programmes was changed by removing the touch down sequence:

95°C for 10 min, 40 cycles of 95°C/15 sec., 55°C/30 sec and 72°C/32 sec., 72°C for 7 minutes,

95°C for 15 seconds, 50°C for 1 minute, 95°C for 15 seconds and 60°C for 15 seconds.

16S rDNA qPCR, SYBR green

Primers used for qPCR(19):

16S rDNA forward primer: CCTAYGGGRBGCASCAG

16S rDNA reverse primer: GGACTACNNGGGTATCTAAT

The standard curves were generated by analyzing 10-fold dilutions of DNA from Legionella

pneumophila containing from 10 to 100 000 genome equivalents/ µL (geq/ µL). The qPCR was

performed in a total volume of 50 μl with 5 µL template DNA in a master-mix containing:

5 µL 10X PCR buffer: 200 mM Tris-HCl, pH 8.4, 500 mM KCl, as supplied with the Platinum Taq

DNA polymerase (Invitrogen); 2.5 µL 50 mM MgCl2, 1 µL 20 µM each primer, 5 µL dUTP-mix:

1.25 mM each dATP,dCTP and dGTP, 2.5 mM dUTP, 10 µL of 50% glycerol in PCR grade water,

1 µL 0.83 µM 6-carboxy-x-rhodamine (ROX) reference dye, 0.5 µL SYBR Green (Life

technologies) Diluted 1:200 in PCR grade water, 0.4 µL (2 U) Taq DNA polymerase (Platinum

Taq; Invitrogen), PCR grade water to a final volume of 45 µl

A 7500 Real-time PCR System (Applied Biosystems) was used for qPCR and all reactions were

done in duplicate. For negative control the template DNA was replaced with distilled water. The

cycling conditions were composed of 95°C for 10 min, 40 cycles of 95°C/15 sec., 55°C/30 sec and

72°C/32 sec., 72°C for 7 minutes, followed by a melt-curve analysis with 95°C for 15 seconds,

50°C for 1 minute, 95°C for 15 seconds and 60°C for 15 seconds. Data was collected at the

72°C/32 sec step and during the melting step in the melt-curve analysis.

  6  

16SrDNA qPCR, TaqMan™ probe

In order to circumvent problems with detection of unspecific background fluorescence in the 16S

SYBR Green assay, a TaqMan probe based assay (19) was used. The standard curves were

generated by analyzing 10-fold dilutions of DNA from Legionella pneumophila containing from 10

to 100 000 genome equivalents/ µL (geq/ µL). PCR was performed in at total volume of 50 µL with

5 µL template DNA. The master-mix consisted of:

5 µL 10X PCR buffer: 200 mM Tris-HCl, pH 8.4, 500 mM KCl, as supplied with the Platinum Taq

DNA polymerase (Invitrogen);

5 µL 50 mM MgCl2, 2.5 µL 20 µM each primer 16S-331F and 16S-797R, 0.4 µL 15 µM FAM-

labeled 16S-TQM-528R probe, 5 µL dUTP-mix: 1.25 mM each dATP,dCTP and dGTP, 2.5 mM

dUTP, 10 µL of 50% glycerol in PCR grade water, 1 µL 0.83 µM 6-carboxy-x-rhodamine (ROX)

reference dye, 5 µL of the appropriate dilution of IPC, 0.4 µL (2 U) Taq DNA polymerase

(Platinum Taq; Invitrogen), PCR grade water to a final volume of 45 µl

Forward primer: 16S-331F-mod TCCTRCGGGAGGCWGCAGT

Reverse primer: 16S-797R GGACTACCAGGGTATCTAATCCTGTT

Probe: 16S-TQM-528R FAM-CGTATTACCGCGGCTGCTGGCAC-BHQ1

Results

The touch down procedure in the first 16SrDNA qPCR setup resulted in amplification curves with

poor reproducibility (data not shown). The second setup with no touch down procedure improved

the results significantly.

The 16SrDNA qPCR, SYBR green results gave reason to suspect that human DNA was amplified

together with the bacterial DNA. The 16SrDNA qPCR amplicons from all analyzed samples were

run on an agarose gel. The gel showed visible smears corresponding to unspecific amplification and

some specific bands correlating to bacteria amplification. The results from the gel and the PCR did

not correlate well. For instance one sample would show a good amplification curve with a CT value

= 22 and a dissociation curve with only one peak. However, the agarose gel for the exact same

specimens showed no specific band (Figure 3).

  7  

 

Figure 3: For one sample the results of 16SrDNA qPCR, SYBR green is shown: a) amlification curve, b) dissociation curve and c) agarose gel, arrow points to the specific specimen.

a  

b  

c  

  8  

The TaqMan probe based assay gave reliable amplification curves. However, very low CT values

corresponding to very high bacterial DNA yield, made the results difficult to analyze. Therefore, the

specimens were diluted according to their weight until the dilution correlated to a weight between

3-5.6 mg.

The 16SrDNA qPCR (TaqMan™ probe) showed a small difference in bacterial DNA yield when

comparing the two different extraction methods (table 1).

Discussion

This study examines two methods to extract bacterial DNA from cervical mucus plug specimens.

We find no differences between the two methods regarding the DNA yield. Furthermore a

16SrDNA qPCR TaqMan based assay has been optimized in order to quantify the number of

bacteria present in CMP specimens.

In the first qPCR setup a SYBR green assay was preferred since it does not have the same

limitations as a probe regarding the base pairing. We found that the setup using SYBR Green was

less reliable in the presence of large amounts of human DNA, as was the case in the CMP

specimens. This is the risk of using SYBR green in PCR reactions, since it binds to every double

stranded DNA in the specimen regardless of base pairing. In order to circumvent these problems the

16SrDNA TaqMan probe assay was used with good results that only represent amplification of

bacterial DNA.

Furthermore, our results show that the CMP contains large amounts of bacterial DNA. Therefore

specimens should be diluted during the extraction process to get reproducible results.

Genome equivalents / g CMP

Median (Inter quartile range)

Qiagen 52000 (54567)

Bead beating 54000 (24400)

Table 1: 16SrDNA qPCR (TaqMan) genome equivalents / g CMP using two different DNA extraction methods.

  9  

Despite the fact that there was no obvious difference between the two extraction methods, the bead

beating method seems the logical choice in future studies. The bead beating method works by

physical disruption of cells, and so it might be more effective against more recalcitrant bacteria. It is

possible that the DNA yield from the two methods is alike in the amount, but different in the

composition, e.g. they might work on different types of bacteria. To investigate this, the 16SrDNA

amplicons from both techniques had to be analyzed using DNA sequencing, which is an expensive

and comprehensive technology.

In conclusion, this study explores two extraction methods of bacterial DNA from the cervical

mucus plug and finds no difference with regard to bacterial DNA yield. Future studies will

successfully be able to use these methods with subsequent PCR techniques to evaluate the bacterial

composition of the CMP. There is reason to expect that information on the microbiological flora of

the CMP may give important clues in the ongoing research on the infectious causes of preterm birth.

Resume på dansk

Slimproppen udfylder livmoderhalsen, og er således både i kontakt med vagina og livmoderen. I

den vaginale bakterieflora findes mange bakterier, der kan være skadelige, hvis de ascenderer til

barnet, hvor de kan forårsage for tidlig fødsel. Formålet med dette studie var at etablere en metode

til at ekstrahere bakterielt DNA fra slimproppen. Det bakterielle DNA kan efterfølgende bruges til

16SrDNA qPCR, som kan kvantificere mængden af bakterier i slimproppen.

To forskellige ekstraktionsmetoder blev sammenlignet på slimpropprøver fra fem forskellige

kvinder. Den ene metode, Qiagen DNA Mini Kit, beror på en silica-membran baseret teknologi

mens den anden, bead beatiing, fysisk slår cellerne i stykker. For at vurdere hvilken metode, der

frigav den største mængde bakterielt DNA blev prøverne kørt på 16SrDNA qPCR, der også blev

optimeret.

Med dette studie skabes der muligheder for mere dybdegående mikrobiologiske undersøgelser af

slimproppen med hensyn til bakterieantal og –art. Begge redskaber der er nødvendige for at

kortlægge slimproppens barrierefunktion mod ascenderende infektioner, der kan føre til for tidlig

fødsel.

  10  

References

1. Becher N, Hein M, Danielsen CC, Uldbjerg N. Matrix metalloproteinases in the cervical mucus plug in relation to gestational age, plug compartment, and preterm labor. Reprod. Biol. Endocrinol. 2010;8:113.

2. Becher N, Hein M, Danielsen CC, Uldbjerg N. Matrix metalloproteinases and their inhibitors in the cervical mucus plug at term of pregnancy. Am. J. Obstet. Gynecol. 2004 Oct;191(4):1232–9.

3. Hein M, Valore EV, Helmig RB, Uldbjerg N, Ganz T. Antimicrobial factors in the cervical mucus plug. Am. J. Obstet. Gynecol. 2002 Jul;187(1):137–44.

4. Hein M, Helmig RB, Schønheyder HC, Ganz T, Uldbjerg N. An in vitro study of antibacterial properties of the cervical mucus plug in pregnancy. Am. J. Obstet. Gynecol. 2001 Sep;185(3):586–92.

5. Lee D-C, Hassan SS, Romero R, Tarca AL, Bhatti G, Gervasi MT, et al. Protein profiling underscores immunological functions of uterine cervical mucus plug in human pregnancy. J Proteomics. 2011 May 16;74(6):817–28.

6. Helmig R, Uldbjerg N, Ohlsson K. Secretory leukocyte protease inhibitor in the cervical mucus and in the fetal membranes. Eur. J. Obstet. Gynecol. Reprod. Biol. 1995 Mar;59(1):95–101.

7. Hein M, Petersen AC, Helmig RB, Uldbjerg N, Reinholdt J. Immunoglobulin levels and phagocytes in the cervical mucus plug at term of pregnancy. Acta Obstet Gynecol Scand. 2005 Aug;84(8):734–42.

8. Muglia LJ, Katz M. The enigma of spontaneous preterm birth. N. Engl. J. Med. 2010 Feb 11;362(6):529–35.

9. Kasper DC, Mechtler TP, Reischer GH, Witt A, Langgartner M, Pollak A, et al. The bacterial load of Ureaplasma parvum in amniotic fluid is correlated with an increased intrauterine inflammatory response. Diagn. Microbiol. Infect. Dis. 2010 Jun;67(2):117–21.

10. Kundsin RB, Leviton A, Allred EN, Poulin SA. Ureaplasma urealyticum infection of the placenta in pregnancies that ended prematurely. Obstet Gynecol. 1996 Jan;87(1):122–7.

11. Goldenberg RL, Hauth JC, Andrews WW. Intrauterine infection and preterm delivery. N. Engl. J. Med. 2000 May 18;342(20):1500–7.

12. Viscardi RM. Ureaplasma species: role in diseases of prematurity. Clin Perinatol. 2010 Jun;37(2):393–409.

13. Gerber S, Vial Y, Hohlfeld P, Witkin SS. Detection of Ureaplasma urealyticum in second-trimester amniotic fluid by polymerase chain reaction correlates with subsequent preterm labor and delivery. J. Infect. Dis. 2003 Feb 1;187(3):518–21.

  11  

14. Yoon BH, Chang JW, Romero R. Isolation of Ureaplasma urealyticum from the amniotic cavity and adverse outcome in preterm labor. Obstet Gynecol. 1998 Jul;92(1):77–82.

15. Yamamoto Y. PCR in Diagnosis of Infection: Detection of Bacteria in Cerebrospinal Fluids. Clin Diagn Lab Immunol. 2002 May;9(3):508–14.

16. Ho BS, Feng WG, Wong BK, Egglestone SI. Polymerase chain reaction for the detection of Neisseria gonorrhoeae in clinical samples. J Clin Pathol. 1992 May;45(5):439–42.

17. Becher N, Adams Waldorf K, Hein M, Uldbjerg N. The cervical mucus plug: structured review of the literature. Acta Obstet Gynecol Scand. 2009;88(5):502–13.

18. De Boer R, Peters R, Gierveld S, Schuurman T, Kooistra-Smid M, Savelkoul P. Improved detection of microbial DNA after bead-beating before DNA isolation. J. Microbiol. Methods. 2010 Feb;80(2):209–11.

19. Nadkarni MA, Martin FE, Jacques NA, Hunter N. Determination of bacterial load by real-time PCR using a broad-range (universal) probe and primers set. Microbiology (Reading, Engl.). 2002 Jan;148(Pt 1):257–66.