EOC Review Packet Name:

I. Scientific InvestigationA. Steps to the Scientific Method

1. State the Problem – using observations2. Form a Hypothesis – research using many different sources for current findings

a. Scientific Journals are the best place to locate current findings on the newest technologiesb. Encyclopedias are a good place to find information on extinct species or historical theoriesc. State/Local agencies can help research the effects of pesticides on the squirrel population

3. Experiment – testing the hypothesisa. Independent Variable – graphed on the X-axis – “What I change”b. Dependent Variable – graphed on the Y axis – “What I measure”c. Constant – things kept the same across all groupsd. Control – baseline measurement or standard to which other groups are compared

4. Collect / Measure Dataa. Quantitative Data – generally numbers, talking about quantityb. Qualitative Data – generally words – descriptions of quality of things

5. Interpret Data – using tables and graphs, bar graphs compare qualitative information6. Draw Conclusions – including improvements for future experiments

II. Characteristics of Living ThingsA. The Characteristics of Life – all living things are made of cells

1. Synthesis – the ability to make complex substances from simple subunits2. Transport – moving materials around inside the cell or body3. Excretion – removal of waste from the body4. Respiration – turning food into usable energy5. Nutrition – getting food – autotrophs make their own, heterotrophs eat other things6. Growth – increase in size and number of cells7. Regulation – respond to environmental

changes with ability to maintain constant internal environment in its optimal range

8. Reproduction – either sexual or asexualB. Levels of Organization – place the following

biological terms in order from smallest to largest(Biosphere, cell, community, ecosystem, organ, organism, organ system, populations, species, tissue)

C. Carbon Cycle1. Autotrophs use organelles called chloroplasts

in their leaves to collect solar energy2. Photosynthesis occurs so plants can make

glucose to use for energy3. Photosynthesis converts solar energy into

chemical energy4. Photosynthesis uses CO2 H2O and solar

energy to form glucose and O2

5. Animals can not make their own food and must eat from other trophic levels and are called heterotrophs

6. Animals use organelles called mitochondria to perform a process called Cellular Respiration which breaks down food molecules to produce ATP for energy

7. Respiration uses O2 and glucose (C6H12O6 ) to produce CO2 and H2O8. The gas made by respiration is CO2 ; the gas taken in by photosynthesis is CO2

9. The gas taken in by respiration is O2; the gas produced by photosynthesis is O2 10. Equation for Photosynthesis CO2 + H2O + Sunlight C6H12O6 + O2

11. Equation for RespirationD. Nitrogen Cycle

1. Nitrogen is the most abundant element in our planet’s atmosphere. 2. Approximately 78% of the atmosphere is comprised of this important element.

3. Nitrogen is used by life forms to carry out many of the functions of life.

4. This element is especially important to plant life. 5. Yet nitrogen in its gaseous form is almost entirely

unusable to life forms. 6. It must first be converted or ‘fixed’ into a more usable

form. The process of converting nitrogen is called fixation.

7. There are specialized bacteria whose function it is to fix nitrogen, converting it, so that it can be used by plants. There are still other bacteria who do the reverse. That is, they return nitrogen to is gaseous form.

8. After nitrogen is fixed, it can be absorbed, and used by plants, and subsequently by animals.

9. The process of nitrogen being fixed, used by plants and animals, and later returned to the atmosphere is referred to as the nitrogen cycle.

E. Water Cycle 1. Water falls to the ground in the form of

Precipitation2. It percolates through the soil to make ground

water3. Water that doesn’t go into the ground is called

run off4. Water is taen into plants through the roots by

capillary action5. Transpiration is the process of releasing water

vapor into the atmosphere from plant leaves6. Evaporation puts water from oceans and lakes

into the atmosphere7. Water in the atmosphere forms droplets in

clouds by condensation8. In hot places there is probably more evaporation

than condensation9. Places with much ground water probably have

much precipitation

III. Life at the Molecular LevelA. Inorganic Compounds ( no C-H)

1. Water (words to know: hydrogen bonds, acids, bases, pH, capillary action, water, polar, cohesion, adhesion, solvent, bases, resistant to temperature change, surface tension)

2. pH Scale – indicates amount of Acid(H+)/ Base (OH-)

B. Organic Compounds or Macromolecules: there are 4 macromoleculesOrganic molecules have C-H bonds

1. Carbohydrates (terms: starch, cellulose, monosaccharides, dehydration synthesis,glucose, disaccharide, hydrolysis, polysaccharide, lactose, maltose, fructose)

a. Carbohydrates are built to store energy in plants and are broken down to be used as cellular energy to accomplish the characteristics of life.

b. Monosaccharides – monomers (building blocks) of carbohydrate, an example of a simple sugar is glucose

c. 2 simple sugars make a disaccharide, examples are sucrose and lactose

d. a polysaccharide is a carbohydrate made of many sugarse. a polysaccharide found in plant cell walls is cellulosef. a polysaccharide used to store energy in plants is starchg. a polysaccharide used to store energy in animals is glycogenh. sugars are put together using a process called dehydration

synthesis2. Lipids

a. Lipids are macromolecules that are insoluble in water, including fats, oils and wax

b. A monomer of a lipid is a triglyceride which is made of three fatty acids and one glycerol

c. Lipids are used to store energy in animalsd. Plants have a waxy coating on their leaves called a cuticle which

keeps from losing too much moisture or from becoming waterlogged

glucose

Prokaryote – no nucleus

3. Proteinsa. Proteins are made up of amino acids joined together by peptide bondsb. Two amino acids joined is called a dipeptidec. Three or more amino acids joined is called a polypeptided. Another name for a protein is a polypeptidee. Enzymes are a special group of proteins that speed up reactions

4. Nucleic Acidsa. The two types of nucleic acids are DNA and RNAb. The monomer of a nucleic acid is a nucleotide which is made of a sugar, a phosphate and a

basec. DNA is common to all living things and it stores genetic informationd. In DNA adenine bonds with thymine and cytosine bonds with guaninee. Purines = adenine and guaninef. Pyrimidines = thymine and cytosineg. The shape of a DNA is molecule is a double helix, discovered by Watson and Crickh. Replication is a process that makes and exact copy of DNAi. The sugar in DNA is deoxyribose. The sugar in RNA is ribose.j. In DNA adenine bonds with thymine, but in RNA it bonds with uracilk. RNA is single stranded and DNA is double strandedl. DNA is copied by RNA which becomes the recipe for making proteinsm. Genetic engineering is inserting foreign DNA into host DNA to make recombinant DNA to make

insulin, interferon and human growth hormone.IV. Life at the Cellular Level

A. Cell Theory1. All living things are made of cells2. Cells are the basic unit of structure and function of living things3. All cells come from pre-existing cells

B. Development of Cell Theory1. Leewenhoek – first to observe bacteria and protists under a microscope2. Hooke – observed cork and named the cell3. Schleiden – all plants are made of cells4. Schwann – all animals are made of cells5. Spontaneous generation – the idea that living

things come from non-living matter6. Redi – meat/maggot experiment to disprove

spontaneous generation7. Pasteur – meat broth experiment to disprove

spontaneous generation8. Virchow – all cells come from pre-existing cells

C. Types of Cells1. Eukaryotes – have a nucleus and membrane-

bound organelles2. Prokaryotes – only include bacteria (Kingdom

Monera)3. Prokaryotes – do not have organized structures

within the cell except ribosome’s4. Eukaryotes – includes organisms in the

kingdoms protista, fungi, plant and animal5. Both – have DNA (hint: all kingdoms of

organisms have this in common)6. Eukaryotes – go through mitosis7. Prokaryotes – go through binary fission8. Both have ribosome’s to synthesize proteins

D. Cellular Organelles1. Nucleus – command center of the cell; DNA in

the form of chromatin/ chromosomes here2. Nucleolus – small organelle in the nucleus that makes ribosomes3. Ribosomes – small spheres made of rRNA in the cytoplasm that make proteins4. Endoplasmic reticulum – transport system of the cell5. Golgi body / golgi apparatus – collects, packages and distributes proteins6. Lysosomes – contain digestive enzymes to break down old cell parts

Eukaryotic cell – has nucleus

7. Vacuole – storage tank of the cell8. Mitochondria – organelle that conducts cellular respiration (glucose ATP)9. Chloroplast – organelle that conducts photosynthesis10. Centriole – assists in cell division in animal cells only11. Cytoplasm - the jelly like substance in which organelles float inside a cell12. Cell wall – made of cellulose (plants), chitin (fungi) or peptidoglycan (bacteria) – outer boundary of some

cells provides support and structure13. Cell membrane – the outer layer or boundary of animal cells – phospholipid bilayer14. Mitochondria – muscle cells would have a lot of these because they need lots of ATP15. ribosomes – cells that make a lot of protein would need these

E. Differences between Animal and Plant CellsDifferences Plants Animalsshape b/c of cell wall Square, rectangle, regular Round, irregularOrganelles present Chloroplasts, cell wall centriolesNucleus location b/c of vacuole Against the cell wall Middle or anywhere

F. The Fluid Mosaic Model and Movement through the Cell Membrane

1. The cell membrane is composed of phospholipids, proteins and carbohydrates2. The Fluid Mosaic Model describes the Cell Membrane. 3. Passive transport is also called diffusion and it does not require energy4. Passive transport moves molecules from areas of High concentration to low concentration5. Facilitated Diffusion – diffusion where carrier proteins help molecules across the cell membrane6. Osmosis is a type of diffusion involving the movement of water across a semi-permeable membrane7. A nonspecific type of movement that requires energy is called Active transport.8. The movement that requires energy moves molecules from low to high concentrations9. Membrane folding is a type of active transport that requires energy.10. Membrane folding that involves taking in solid particles is called phagocytosis or endocytosis.11. Membrane folding that engulf small amounts of liquids is called pinocytosis.12. Membrane folding that removes particles from the cell is called exocytosis.13. Our cells are made of 95% water therefore 95% of our body is made of water.14. Molecules are transported across the cell membrane by carrier proteins.

V. Cell DivisionA. Mitosis

1. A chromosome is made of two identical parts called sister chromatids2. The parts of a chromosome are held together by a centromere3. Each Chromosome has a short arm4. Each chromosome has a long arm5. Only animal cells have centrioles to help with chromosome movement

6. During anaphase sister chromatids are separated at the centromere and are pulled to opposite ends of the cell.

7. DNA is replicated during Interphase so each cell will have the same information

8. Chromosomes line up along the equator of the cell in Metaphase

9. Loose or uncoiled chromosomes are actually DNA in the form of Chromatin.

10. During Anaphase spindle fibers shorten which pulls the chromosomes to the poles

11. After the nucleus divides, cytokinesis occurs which is division of the cytoplasm

12. In plant cells only, a cell plate forms during telophase.13. In animal cells only, a cleavage furrow forms during

telophase.14. Spindle Fibers are attached to chromosomes at the

centromere.15. Prophase – Chromatin condenses and becomes visible

chromosomes, 16. Telophase – Nuclear membrane begins to form around each

set of chromosomes17. Prophase - nuclear membrane begins to disappear18. Telophase – two daughter cells are formed

B. Other Types of Division and Asexual Reproduction in Organisms 1. Vegetative Propagation – growing new roots for a plant from plant

clippings2. Regeneration – repairing severed appendage (starfish or lizard tail)3. Binary Fission – only occurs in prokaryotes4. Sporulation – new mold growing wehre spores have fallen, also occurs in ferns5. Budding – occurs in yeast and hydra when a tiny bud sprouts from a parent and eventually breaks off to

form a new independent organism6. Mitosis – occurs in single celled eukaryotes like paramecium, splitting the nucleus

C. Meiosis1. Meiosis is a type of cell division that make sex gells or gametes2. The two types of sex cells are eggs and sperm.3. Mitosis consists of 1 division while meiosis consists of 2 divisions4. Binary Fission – only occurs in prokaryotes5. Budding – occurs in yeast and hydra when a tiny bud sprouts from a parent6. For every chromosome your mother gave you there is a matching chromosome your

father gave you with information regarding the same trait. We call these homologous chromosomes

7. When a cell has a full complement of homologs, or homologous chromosomes from each parent the cell is said to be Diploid.

8. Sex Cells have only ONE set of chromosomes, they are called Haploid.9. Homologous chromosomes exchange information during prophase which adds to

diversity.

D. Cell growth1. After a new cell is formed it must get bigger or grow.2. The three things that affect a cell’s size are diffusion, DNA and

Surface Area to volume ratio.3. Cells get bigger by making organic compounds like proteins.4. The process of protein synthesis has two steps – transcription

and translation.5. During Transcription the genetic code for building a protein is

copied from DNA to mRNA.6. Because DNA can’t leave the nucleus the message is carried

out of the nucleus by mRNA.7. Once the message from DNA is copied, the mRNA leaves the

nucleus and travels to the ribosome in the cytoplasm.

1 2 3 4

8. A sequence of 3 bases on mRNA is called a codon, but 3 bases on tRNA is called an anti-codon.9. Each codon is matched to an anticodon to allow the tRNA to add its protein to the growing chain of amino

acids that is becoming the protein.10. Each amino acid is linked together by peptide bonds to form proteins.11. Another name for protein synthesis is translation.12. The sequence of nortogenous bases on DNA carry the genetic code.

E. Transcription and Translation – use a codon chart to transcribe the following DNA sequence:1. For the DNA sequence TACGGCCATTTCGATTTGAGCATC2. The mRNA sequence: AUG | CCG | GUA | AAG | CUA | AAC | UCG | UAG3. Amino acids (from chart) Met – Pro – Val – Lys – Leu – Asp – Ser – STOP4. This protein is made of 6 amino acids

F. DNA Technology1. DNA fingerprinting is used to identify crime suspects

(such as murder and rape)2. Using electrophoresis, scientists can determine an

individuals DNA fingerprint. No two people have the same DNA fingerprint except for identical twins.

3. Human Genome Project is considered a collaborative effort because 13 countries worked on it

4. The objective of the Human Genome project was to sequence all the DNA of a person

5. Scientists wanted to have the sequence so they can use it to determine the sequence of bases to find the genes responsible for certain diseases.

VI. GeneticsA. Vocabulary

1. Heredity – the passing of characteristics from parents to offspring2. Genetics – the study of heredity3. Mendel – Gregor Mendel is the Father of modern genetics. He

studied pea plants.4. Genome – all of the genes of a particular organism5. Trait – an inherited physical characteristic6. Gene – a section of DNA that codes for a trait – located on chromosomes7. Allele – versions of a gene (ex: tall/short, green/yellow)8. Genotype – the type of genes or alleles present in an organisms genome9. Phenotype – an organism’s physical appearance10. Homozygous – two alleles of the same form make up the genotype, Pure-bred (TT or tt)11. Heterozygous – two different alleles, hybrid (Tt)12. Dominant – form of gene that always shows, even if the other copy is recessive13. Recessive – form of a gene ONLY expresses in a homozygous state (must have 2/2 (both) alleles to see

it)

B. Mendelian Genetics1. Punnett square – table used to diagram the probability of certain genotypes in

offspring2. A monohybrid cross only examines ONE trait3. A dihybrid cross looks at TWO traits at a time4. The first generation of the cross is the P or Parental Generation.5. The offspring of the P generation is the F1 (first Filial or first kid) generation6. The offspring of the F1 generation is the F2 generation (second filial)7. The Law of Independent Assortment states that each gene is inherited deparately

from others if they are on different chromosomes.8. The Law of Segregation states that the 2 alleles for each gene deparate as gametes form9. Incomplete Dominance is blending of traits, ex: red flowers + white flowers = pink flowers10. Codominance – both alleles show equally, as in blood type (AB)11. Sex-Linked Traits – controlled by genes on sex chromosomes, ex: colorblindness, hemophilia12. A dihybrid cross of two heterozygotes produces offspring with a 9:3:3:1 phenotype ratio13. A monohybrid cross of two heterozygotes produces offspring with a phenotypic ratio of 3:1 but a genotypic

ratio of 1:2:1

C. Mutations1. Gene Mutations

a. A gene mutation is a change in one or more of the nucleotide bases of DNAb. Mutations are caused by mutagens like UV light or chemicalsc. A point mutation is when 1 nucleotide base in DNA is changed.d. A frameshift mutation occurs if 1 or more nucleotides in DNA are added or deleted; this causes

the codon sequence to be shifted ~ If the original DNA is ATA ACG CCT ATT ~ The number of complete codons is 4 ~ then the mRNA sequence is UAU UGC GGA UAA ~ The amino acid sequence would be Tyr, Cys, Gly, STOP

~If the original DNA were replicated and the “G” was deleted ~Then the DNA sequence would be ATAACGCCTATT ~The number of complete codons would be 3 ~The mRNA sequence is UAU UGG GAU AA ~ The amino acid sequence would be Tyr, Try, Asp

~if the original DNA sequence is replicated and a C was added at the beginning ~Then the DNA sequence would be CATAACGCCTATT ~The number of codons would be 4 ~ The mRNA sequence would be GUA UUG CGG AUA A

~ The amino acid sequence would be Val, Leu, Arg, Iso2. Chromosomal Mutations

a. A chromosomal mutation occurs if there is a change in the number or structure of a single chromosome or whole sets of chromosomes

b. Nondisjunction – occurs when chromosomes don’t separate during meiosisc. Translocation – chromosome pieces are moved onto another chromosomed. Inversion – a segment of chromosome is inserted in reverse ordere. Duplication – a segment of a chromosome is repeatedf. Polyploidy – whole extra sets of chromosomes in the same cellg. In plants and animals sex cells are haploid which means they have half the number of

chromosomes a body cell hadh. Diploid – a cell with 2 sets of chromosomes (one from mom and one from dad)i. Haploid – a cell with 1 set of chromosomes (one from mom or one from dad)

D. Genetic Disorders1. Only a karyotype detects a chromosomal mutation caused by nondisjunction2. Down syndrome is trisomy on the 21st chromosome pair caused by nondisjunction3. Trisomy occurs when there is an extra copy of a chromosome in a diploid cell4. Turner syndrome is monosomy on the 23rd pair caused by nondisjunction

(22 pairs and XO instead of XX)

Karyotype of Kleinfelter Syndrome – Trisomy XXY

VII. Taxonomy – the naming and organization of organisms developed by Carolus Linnaeus based on structural similarities

A. Classification

Fungi

Porifera

Classification Level Catch Phrase to rememberKingdom KingPhylum PhilipClass CameOrder OverFamily ForGenus GoodSpecies Spaghetti

B. Naming Organisms1. Binomial Nomenclature, or “2 name naming system” was developed by Linnaeus2. AN organism’s scientific name is made of its Genus and then its species3. If 2 organisms are in the same genus, they must be in the same family.4. The class of mammals includes such organisms such as rabbits and elephants which are in the same

Phylum but different species.5. Only organisms that can interbreed and produce fertile offspring are in the same species.

C. KingdomsKingdom Cell type Cell outer

boundaryNumber of cells

Type of reproduction

Getting energy

2 examples

Monera (also split into Archae and Eubacteria)

Prokaryote Wall (peptidoglycan)

Unicellular Binary fission AutotrophChemotrophheterotroph

E. ColiM.tuberculosis

Protista Eukaryote Membrane Both, usually uni

Mitosis AutotrophHeterotroph

AmoebaParamecium, Algae

Fungi Eukaryote Wall made of chitin

Multicellular (yeast = uni)

Sporulation(yeast= budding)

Heterotroph Mold, mildew, mushrooms, yeast

Plantae Eukaryote Cell wall made of cellulose

Multi Sexual & asexual

autotroph Fern, moss, dogwood

Animalia Eukaryote Membrane Multicellular Sexual & asexual

Heterotroph Sponge, jellyfish, squid, rabbit, human

D. Kingdom Specimens1. The first and least complex kingdom which includes thousands of types

of bacteria is Monera2. The kingdom Monera consists of unicellular organisms that don’t have

nuclei.3. The next kingdom to evolve was protista which consists of mostly single

celled organisms4. Most Protists are unicellular except for plant-like varieties like seaweed.5. Fungi are heterotrophic, multicellular and are mostly

decomposers who get their nutrients from dead or decaying organisms

6. Fungi are different than plants because fungi have cell walls of chitin

7. The plant kingdom includes multicellular autotrophs with cell walls of cellulose.

8. Kingdom Animalia consists of multicellular heterotrophs with no cell walls.

9. Insects in the animal kingdom are in the Phylum Arthropoda, and called arthropods (jointed appendages) because their legs are segmented

10. Fleas are multicellular heterotrophs with segmented legs, thus they are in the

Kingdom Animalia, Phylum Arthropoda. 11. The highest level of organization for Porifera is tissue.It’s in the animal kingdom

E. Viruses – agents of disease1. Viruses are considered non-living because they can not perform the

characteristics of life without a host cell2. Viruses are made of only 2 organic compounds – Nucleic Acid (DNA or RNA)

and a Capsid made of protein3. The lysogenic cycle is a process by which a virus infects a cell which eventually

bursts releasing newly assembled viruses. 4. A virus infects a cell by injecting its DNA or RNA into a cell.5. The cold and flu are caused by viruses.6. Antibiotics are typically used to fight bacterial infections. The word antibiotic literally

means “against life.” Because viruses are considered non-living antibiotics don’t work against viruses.

7. Vaccines are used to help organisms make antibodies against pathogens like viruses.8. Vaccines are made from killed or weakened virus.9. Vaccines stimulate Active Immunity (B cells to plasma cells to make antibodies)

F. Sexual Reproduction in Plants

Plant Classification

Non-vascular plants- mosses Ferns-vascular, reproduce using spores Gymnosperms (Conifers or Evergreens)-vascular,reproduce using seeds, NO flowers Angiosperms-vascular, seeds, flowers- 2 types: monocots, dicots

VIII. Evolution and Natural SelectionA. Evolution

1. gradual change in characteristics over time2. responsible for diversity among organisms that exist.

B. Types of evolution1. Divergent- related organisms become more distant2. Convergent-distantly related organisms develop similar characteristics

C. Lamarck's theory disproved for lack of evidence1. use and disuse of organs- if you don't use it, you lose it2. inheritance of acquired traits- attained traits passed on

ex. blacksmith passing on muscles to offspring3. ultimately, Lamarck’s theories not accepted due to lack of supporting data

ex. giraffes developed long necks because grass became scarce, their necks had to stretch to reach leaves in upper canopies of trees

Alternation of Generations – plants have a life cycle that alternates between diploid and haploid.

D. Darwin's theory1. sailed on Beagle as the ship's naturalist; visited the Galapagos Island2. "The Origin of Species"- book that supported evidence that living things evolved from other living things3. his theories, though modified, still form the basis of modern evolutionary theory

a. variation exists within a speciesb. all organisms compete for limited spacec. organisms produce more offspring than can survived. natural selection- organisms best suited to environment survive

E. Rate of Evolution1. gradualism- organisms evolve as a result of small adaptive changes2. punctuated equilibrium- short periods of rapid change in a species are separated by long periods of little or no change.

II. Evidence of EvolutionA. Fossils Record- shows organisms get increasingly complex over time

1. Types of fossils fossil= trace of once living organisma. preserved tissue- amber, ice, tar- keeps it from deterioratingb. preserved trace- imprint, mold, cast(mold filled w/ minerals)

2. Determining fossil age: relative dating (a,b) & radiometric dating (c)

a. earliest(oldest)- lower layers of rockb. most recent(newest)- upper layers of rockc. absolute dating uses half-life- amount of time it takes for 1/2 of radioactive element to decay (carbon-14, chlorine 36, uranium 235)

3. Geologic Time Scale- record of Earth's history based on fossils

a. Earth formed 4.6 billion years ago, 1st life 3.5 billion years agob. Precambrian, Paleozoic, Mesozoic, Cenozoic (us)

B. Evidence from Living Organisms (Do similar functions reflect similar structures?no)

1. Anatomy- study of external and internal structures of organisms

a. homologous structures- body parts of different organisms that have the same basic structure. ex. human arm, bird wing, whale fin, bat wing have the same number and arrangement of bonesb. analogous structures- body parts of different organisms that have same function, but different structure ex. bird's wing and butterfly's wingc. vestigial structures- body parts with no apparent function ex. human appendix, tiny hip bones in some snakes

2. Embryology- study of early growth stages and development of embryos

a. embryos of different organisms look very similar=similar genes @ workb. DNA sequences which control early development remain unchanged because of little or no mutations.

3. Biochemistry- study of molecules that make up an organism

Homologous structures = common ancestor

Analogous structures = no common ancestor

Common environment!

a. all organisms use DNA or RNA to carry informationb. the more similar the chemical, the more closely related ex. cytochrome C used in respiration and is found in all organisms carrying on aerobic respiration, also hemoglobin

III. Evolution and Genetics

A. Population- group of organisms that live in same area and interbreed.B. Gene Pool- all the genes in a population, collection of all genes for all traitsC. Evolution can only occur when there is a change in the kinds or % of genes in the gene pool of a population.D. Genetic Equilibrium- frequency of alleles in a population doesn't change from generation to generation. NOT EVOLVING= cheetah, horseshoe crabE. Natural Selection- only organisms well adapted to the environment survive and reproduce; "survival of the fittest"F. Mutation- caused by a change in structure of genes or chromosomes

1. may be lethal, beneficial, or neutral2. adds new genes to the pool3. may remain in population for years w/o being expressed (recessive)

G. Migration- movement of individuals of a species in or out of a populationH. Genetic drift- chance events alter the allelic frequency, small populations.

ex. having more offspring than other members of its species, disasterI. Isolation- geographic (mountains, oceans), reproductive (organisms. of same species cannot mate anymore due to development of different mating times).

IV. Human Change Over Time- Primates- lemur, monkey, ape, humanA. variety of shapes & sizes, share common traits (opposable thumb, flexible elbow, vision dominant sense, brain size related to reorganization of cerebrum*thinking, memory, interpretation)B. humans are unique- bipedal, largest brains of primates, speechC. order of ancestry-Australopithecus afarensis (Lucy), Homo habilis (tool user), Homo erectus (upright man, probably our ancestor), Homo sapiens (include Neanderthal, Cro-Magnon)

IX. EcologyA. the study of organisms and their interactions with the environment

1. An organism is anything living.2. Examples would be humans, animals, plants, bacteria

B. The biosphere

1. The biosphere is the living world2. Includes any organism found in the air, land and water

C. The ecosystem1. The ecosystem is a self supporting area composed of living and nonliving things such asthe rain forest or desert2. An ecosystem produces energy, transfers energy, decomposes and recycles3. An ecosystem is made of two types of factors

a. abiotic factors- nonliving parts on the environment such as water, rocks, sun andtemperatureb. biotic factors- the living parts of the environment such as plants, bacteria andanimals

D. Community1. A community is composed of all of the populations of different organisms living togetherin a given area such as your lawn that contains grass, insects and worms

a. a population is a group of organism that belong to the same species that live in agiven areab. such as a herd of cattle or a gaggle of geese

E. Nutrition1. Autotrophs

a. A group of organisms, known as autotrophs , can use the energy in sunlight and convert water and carbon dioxide into glucose, or food.b. Another term for autotrophs is producers because they produce all of the food that heterotrophs use. Without autotrophs, there would be no life on this planet.c. Example of autotrophs are plants and algae

2. Chemotrophsa. Not all autotrophs receive their energy from the sun. Some autotrophs, deep done in the oceans, NEVER see the sun, and use inorganic substances, such as salt, to get energy. These autotrophs which do not need the sun are known as chemotrophs.b. Example of chemotrophs are bacteria and deep sea worms

3. Heterotrophsa. Organisms that do not make their own food are called heterotrophs.b. Another term for heterotrophs is consumers because they consume other organisms to live.c. Examples of heterotrophs are rabbits, deer or mushrooms- anything that doesn’t make their food but has to eat or absorb it.d. Consumers can be broken down into 5 main groups

1. scavengers- feed on the tissue of dead organismsa. Examples of scavengers are vultures, crows, shrimp

2. herbivores- eat ONLY plantsa. Examples of herbivores are rabbits, deer

3. carnivores - eat ONLY meata. Examples of carnivores are lions, tigers, sharks

4. omnivores - eat both plants and animalsa. Examples of omnivores are bears, humans

5. decomposers- absorb any dead material and break it down into simple nutrients; fertilizer

a. Examples of decomposers are bacteria , mushroomsF. Transfer of Energy

1. When a zebra eats the grass, it does not obtain all of the energy the grass has- much of it is not eaten. Likewise, when a lion eats a zebra, it does not get all of the energy from the zebra. Much of the energy is lost as heat.

a. These two examples of energy transfer show that no organism EVER receives all of theenergy from the organism they just ate.

G. Trophic Levels1. Energy moves from one organism to another when it is eaten.2. Each step in the transfer of energy is known as a trophic level.

a. The main trophic levels are producer, consumer and decomposer3. Food Chain

a. The energy flow from one trophic level to the other is known as a food chain. A food chain is simple and direct. It involves only one organism at each trophic level.

4. Food Weba. Most organisms eat more than JUST one organism. When more organisms are involved, it is known as a food web. Food Webs are complex and involve LOTS of organisms.b. Notice the direction the arrow points- the arrow points in the direction of the energy, NOT what ate what.

5. Biomassa. The total mass of the organic matter at each trophic level is called biomass. Biomass is just another term for potential energy to be eaten and used.b. The transfer of biomass from one level to the other is VERY inefficient. ONLY 10% of the energy from one trophic level is transferred to the next. This is the 10% law.

6. Ecological Pyramida. An ecological pyramid shows the relationships between consumers & producers at different trophic levels in an ecosystem. The pyramid shows which level has the most energy & most number or organisms.

H. Population Ecology1. Limiting Factors

a. A population’s size can depend on a number of factors. These factors that limit the size of a population are called limiting factors. There are 7 limiting factors:

1. Predation: one organism consumes and eats another organismex. an example would be a fox hunting a rabbit

2. Parasitism: one organism lives off the body fluids/flesh of another organismex. an example would be a tick sucking the blood of a dog

3.Competition for food: two organisms eat the same food and compete for this foodex. an example would be hyenas and lions fighting over a dead zebra body

4. Pollution: the environment is unclean and unusable to the organisms that live in itex. an example would be an oil spill occurs and sea birds can no longer use the oily shores to build their nests

5. Availability of water: all organisms need water to surviveex. an example would be a limited amount of water during a drought

6. Disease: a disease in a population where the individuals live in close proximity of each other can kill the whole population

ex. An example would be an outbreak of the ebola virus in a small African village

7. Climate: the weather & climate can limit the size of a populationex. an example would be a hurricane kills a flock of birds living in a tree

2. Limiting factors can be categorized as two types:a. density-dependent limiting factors: limit a population only when the population reaches a certain density.

1. Examples are competition for food and predation2. density-independent limiting factors: these affect a population in the same way regardless of density.

ex. An example is: climate

I. Population Growth Curves1. Exponential Growth

a. Exponential growth occurs when the rate of growth in each new generation is a multiple of the previous generation.

ex. Bacteria exhibit exponential growth; they double with each division and have rapid growth.

J. Exponential Growth CurveK. Growth Rates

1. A population’s size changes over time. This change is known as a growth rate. 2. Growth rate depends on 4 factors:

a. birthsb. deathsc. immigrations: organisms enter a populationd. emigrations: organisms leave a population

L. S shaped curves and carrying capacity1. The carrying capacity is the number of organisms that can be supported by the environmental resources in an ecosystem.2. A carrying capacity graph illustrates that the environment can only produce so muchfood and shelter for a population before the population reaches an equilibrium- the samenumber of births each year equal the same number of deaths.

Carrying Capacity Graph3. Another term for a carrying capacity graph is an S graph.

M. Predation Curve1. A predation curve shows the relationship between a predator and its prey and how onecan affect the other

a. An example is the the lynx (cat) and the rabbit. When the rabbit populationdecreases, the lynx population decreases.

N. Boom and Bust Curve1. A boom and bust curve represents exponential growth followed by a sudden collapse.

a. A boom and bust curve represents an insect population’s cycle through the year.They are abundant in the summer months but are limited in the fall and winter months.

O. Population Interactions1. Two populations of organism can interact with each other 5 ways:

a. competition: organisms try to make use of the same resourcesex. An example is plants competing for water & sun light

b. Predation: one organism (predator) consumes & eats another organism (prey)ex. An example would be a fox eating a rabbit or a lion eating a zebra

c. Parasitism: one organism (parasite) feeds on the tissue of another organism (host)causing pain

ex. An example would be a tapeworm living off of the digested food inside a dog’s gutd. Symbiosis: each organism fills a need for the other

ex. An example would be a remora fish eating parasites off of a shark’s skine. Commentalism: one organism reaps the benefits while the other is unharmed

ex. An example would be a barnacle & a whale- the barnacle attaches itself to the whale’s skin for a home and the whale is unharmed

P. Succession1. Ecological succession is the observed process of change in the species structure of an ecological community over time

a. When the demolished community tries to reestablish itself and begin to grow again, is is known as primary succession.

1. Primary Succession occurs when the area is completely void of any vegetation and new life begins, starting with moss and lichens

2. Secondary Succession occurs when an area was previously inhabited with vegetation, and new growth begins; ex: overgrown farm land; land after forest fires

b. The climax community is when the community has been reestablished- large plants and trees are climax community plants.

X. Human Body Systems (There are NO direct test questions on this section--think about us as compared to other organisms we studied- what adaptations do we have compared to those organisms? AND how do WE maintain homeostasis?)

A. Digestive The digestive system is responsible for both mechanical and chemical

digestion that break down food into molecules so that they can move into the cell and be used for the living process. The mouth, teeth, and tongue begin the chemical digestion by mechanically breaking down food through the chewing process and the addition of saliva. The enzyme amylase breaks down carbohydrates and starts the break down of starches. Food moves from the mouth to the stomach by way of the esophagus. In the stomach, other digestive enzymes and hydrochloric acid begin the breakdown of proteins. The stomach mixes and churns the food.

Food, now in a liquid-like state called chyme, moves from the stomach into the small intestine, where it is absorbed through the villi (walls of the intestine) into the bloodstream where it is delivered and taken in by the cells of the body. The majority of chemical digestion and absorption takes place in the small intestine. Waste materials and unused food are carried back to the large intestine where they mix with roughage and water. The undigested materials are excreted from the body.

B. Circulatory The circulatory system is composed of the heart, arteries, veins, red

blood cells, white blood cells, antibodies, thrombin, water, and plasma. A four chambered heart, controlled by a pacemaker, rhythmically controls the pumping action by alternating contractions of the atria and ventricles. Blood circulates in the body in two loops - arteries carrying oxygenated blood from the heart to all parts of the body, and veins returning deoxygenated blood to the heart and lungs to be reoxygenated. Blood flows through the arteries due to the pumping pressure of the heart. In the veins, blood flow back to the heart (against gravity) is helped by skeletal muscles that squeeze the veins and push blood along and by one-way valves located in the veins themselves.

An auxiliary portion is the lymphatic system, which drains excess tissue fluids back into the circulatory system along with white blood cells that destroy harmful organisms.

C. Skeletal SystemThe skeleton is the basic framework of the human body and is made of

connective tissue - bones and cartilage. Bone is living tissue with vitamins, collagen, and minerals to give it strength and hardness. The process by which the bones harden is called ossification. Bones are joined by cartilage at joints. Joints are classified as to the amount of movements they allow: stationary (skull), hinge (jaw), and ball and socket (hip).

D. Muscular SystemThree human muscle types are skeletal, smooth, and cardiac. All muscle

tissue exerts force when it contracts; therefore muscles are responsible for all movement of the body, voluntary and involuntary. Energy for all movement is derived from an ample supply of mitochondria in the muscle cell. ATP, a high level energy carrier, is produced by the mitochondria for use by other cells and tissue parts during movement of exercise. Muscles are paired to accomplish full movement. Each contracting muscle will be paired with an muscle that works

against it and tendons attach paired muscle groups to bones to complete the movement action. The skeletal muscles make up this grouping of muscles and are mainly voluntary. Smooth muscles are found in the linings of the body such as the digestive tract and blood vessels. They are generally involuntary muscles.

Cardiac muscle is found only in the heart. The heart is the strongest muscle of the body. It is responsible for keeping the blood flowing through the circulatory system at a given pressure. The cardiac muscle is an involuntary muscle.

E. Nervous SystemThe basic unit of the nervous system is the neuron (nerve cell). Its

structure allows electrochemical signals to travel across synapses to activate muscles, glands, or organ tissue. The nervous system is divided into two parts. The first part is the central nervous system, which includes the brain and the spinal cord. The second part is the peripheral nervous system, which is a large network of nerves that totally connect all parts of the body. Receptors located in sense organs (eyes, ears, etc.) and in the skin send information along sensory neurons to the spinal cord and then to the brain where the information is chemically interpreted, causing a motor response.

F. Respiratory SystemRespiration involves actions started by nerves

stimulating muscles and bones to mechanically enlarge the respiratory cavity of the body. The diaphragm contracts and moved downward. The breathing rate is controlled by nerves originating in the brain based on carbon dioxide content. The human nasal passages are adapted to clean, moisten, and warm the air before it enters the lungs by way of the trachea and the bronchi. The lungs are made up of many tiny air sacs called alveoli that are found at the end of the bronchiole in clusters. The exchange of gases between the lungs and the blood vessels occurs in the alveoli.

G. Excretory SystemThe excretory system is made up of the kidney, bladder,

connecting tubes, and capillaries joined to the kidney. Urine is collected by structures in the kidney called nephrons. From the nephrons, the liquid wastes are collected and stored in the bladder. Urine leaves the body through the urethra.

H. Endocrine SystemThe endocrine system produces hormones which travel by way of the

bloodstream to specific target cells. Endocrine glands include the thyroid, adrenals, pancreas, parathyroid, gonads, pituitary, and the hypothalamus. The manner in which the hormone acts on the target cells depends on whether it is a protein or steroid. Each will cause a feedback, which is one way to regulate hormones secreted into the body. Homeostasis depends on the actions of the nervous and endocrine systems. Organs, like the kidney, function based on endocrine stimulation.

I. Integumentary SystemThe integumentary covering of the body is called the skin. Skin consists

of two layers, the epidermis, and the dermis. Skin protects the body, rids the body of mineral salts and wastes, regulates body temperature, and picks up environmental signals. The skin is the bonding or holding agent that keeps the body intact and functioning. Also part of the integumentary system is the nails and hair.

J. Reproductive SystemThe reproductive organs in males and females are called gonads. Gonads produce sex cells called gametes.

Gametes are haploid - they have half the normal amount of chromosomes. When an egg and sperm unite, the resulting fertilized egg, or zygote, has a full set of 46 chromosomes. In the male, the gonads produce sperm and male hormones. In the female, the gonads produce the egg cells. Reproduction starts with the union of a sperm and an egg. Fertilization

occurs in the fallopian tube (the oviduct in human females). The combined cell, called a fertilized egg cell, develops quickly into a ball of many cells that implants itself on the inner wall of the female uterus. Here it develops into a fetus, the name given to the beginning stage of a human being. For nine months the fetus grows, it receives nourishment from the mother’s circulatory system.