Filling the Void: Introducing Aromatic Interactions intoSolvent Tunnels To Enhance Lipase Stability in Methanol

Shalev Gihaz,a Margarita Kanteev,a Yael Pazy,b Ayelet Fishmana

aDepartment of Biotechnology and Food Engineering, Technion-Israel Institute of Technology, Haifa, IsraelbTechnion Center for Structural Biology, Lorry I. Lokey Center for Life Sciences and Engineering, Technion-Israel Institute of Technology, Haifa, Israel

ABSTRACT An enhanced stability of enzymes in organic solvents is desirable underindustrial conditions. The potential of lipases as biocatalysts is mainly limited bytheir denaturation in polar alcohols. In this study, we focused on selected solventtunnels in lipase from Geobacillus stearothermophilus T6 to improve its stability inmethanol during biodiesel synthesis. Using rational mutagenesis, bulky aromatic resi-dues were incorporated to occupy solvent channels and induce aromatic interac-tions leading to a better inner core packing. The chemical and structural characteris-tics of each solvent tunnel were systematically analyzed. Selected residues werereplaced with Phe, Tyr, or Trp. Overall, 16 mutants were generated and screened in60% methanol, from which 3 variants showed an enhanced stability up to 81-foldcompared with that of the wild type. All stabilizing mutations were found in the lon-gest tunnel detected in the “closed-lid” X-ray structure. The combination of Phe sub-stitutions in an A187F/L360F double mutant resulted in an increase in unfoldingtemperature (Tm) of 7°C in methanol and a 3-fold increase in biodiesel synthesisyield from waste chicken oil. A kinetic analysis with p-nitrophenyl laurate revealedthat all mutants displayed lower hydrolysis rates (kcat), though their stability proper-ties mostly determined the transesterification capability. Seven crystal structures ofdifferent variants were solved, disclosing new �-� or CH/� intramolecular interac-tions and emphasizing the significance of aromatic interactions for improved solventstability. This rational approach could be implemented for the stabilization of otherenzymes in organic solvents.

IMPORTANCE Enzymatic synthesis in organic solvents holds increasing industrial op-portunities in many fields; however, one major obstacle is the limited stability ofbiocatalysts in such a denaturing environment. Aromatic interactions play a majorrole in protein folding and stability, and we were inspired by this to redesign en-zyme voids. The rational protein engineering of solvent tunnels of lipase from Geo-bacillus stearothermophilus is presented here, offering a promising approach to intro-duce new aromatic interactions within the enzyme core. We discovered that longertunnels leading from the surface to the enzyme active site were more beneficial tar-gets for mutagenesis for improving lipase stability in methanol during biodiesel bio-synthesis. A structural analysis of the variants confirmed the generation of new inter-actions involving aromatic residues. This work provides insights into stability-drivenenzyme design by targeting the solvent channel void.

KEYWORDS lipase, protein engineering, stability, solvent tunnel, organic solvents,biodiesel

The utilization of enzymes in nonaqueous media has been an ongoing aspiration insynthetic chemistry, as such biotransformations exhibit several advantages over

those in conventional aqueous media. Some of the benefits include an increased

Received 2 September 2018 Accepted 12September 2018

Accepted manuscript posted online 14September 2018

Citation Gihaz S, Kanteev M, Pazy Y, Fishman A.2018. Filling the void: introducing aromaticinteractions into solvent tunnels to enhancelipase stability in methanol. Appl EnvironMicrobiol 84:e02143-18. https://doi.org/10.1128/AEM.02143-18.

Editor Haruyuki Atomi, Kyoto University

Copyright © 2018 American Society forMicrobiology. All Rights Reserved.

Address correspondence to Ayelet Fishman,afishman@tx.technion.ac.il.

ENZYMOLOGY AND PROTEIN ENGINEERING

crossm

December 2018 Volume 84 Issue 23 e02143-18 aem.asm.org 1Applied and Environmental Microbiology

on April 8, 2020 by guest

http://aem.asm

.org/D

ownloaded from

solubility of hydrophobic substrates, the elimination of microbial contamination, and asuppression of water-dependent catabolic side reactions (1–4). These advantagesbecome more imperative when combining biological catalysts together with chemo-catalysts to improve the yields and efficiency of processes (5).

Despite the great interest in biocatalysis in organic solvents, the nontrivial combi-nation of water-based enzymes within nonaqueous media presents many challenges,most importantly, the relatively low stability of enzymes compared to that under theirnatural habitat conditions (2, 6, 7). Conformational changes in the structure of theenzyme are the main reason for deactivation by organic solvents, due to an impairedbalance of hydrophilic-hydrophobic interactions. Moreover, polar (hydrophilic) solventscan penetrate the hydrophilic core of the enzyme, affecting secondary and tertiaryconformational changes while stripping structured water molecules from the proteinhydration shell (2, 8–15).

The growing understanding of enzyme inactivation mechanisms, using both struc-tural and computational tools, has led to development of techniques, such as proteinengineering and immobilization, for the stabilization of enzymes in organic solvents (2,13, 16, 17). Protein engineering methods include (i) random mutagenesis, (ii) rationaldesign, and (iii) semirational design (2, 8, 18–20). It was previously shown that theseapproaches can be applied separately or in combination to tailor enzymes to enhancetheir stability in organic solvents (1, 9, 12, 18, 21, 22).

Protein engineering by rational design requires structural information, and theprecise regions for mutagenesis are identified usually by computational tools or priorknowledge (17, 22–24). One recently developed concept for enzyme stabilization inorganic solvents is the modification of residues buried in tunnels within the proteinstructure. Globular enzymes are composed of clefts, pockets, channels, and cavities,which offer a unique microenvironment for biological functions, such as ligand bindingor enzymatic catalysis. The tunnel properties (diameter, length, hydrophobicity, etc.)may alter substrate specificity or improve organic solvent resistance (2, 25–28). Theidentification of these networks requires computational engines, such as CAVER orMOLE generator, for detecting cavities and tunnels as well as a known structure ormodel of the target protein (29–31). The profound work of Damborsky and coworkerson stabilizing haloalkane dehalogenase (DhaA) has demonstrated the potential for thesaturation mutagenesis of residues found in solvent channels. The random substitu-tions established in these works revealed the effects of small versus bulky residues onboth the activity and stability of DhaA (32, 33).

There is a long history of the utilization of lipases in organic solvents (34, 35). Theyare ubiquitous hydrolytic enzymes possessing two unique features: (i) an “interfacialactivation” phenomenon of enhanced activity at an oil-water interphase, and (ii) a helix“lid” that gates substrate accessibility and exposes the active site toward catalysis(“open/close” conformations) via a conformational change (36). In a microaqueousenvironment, lipases carry out synthesis reactions, such as the transesterification of awide range of natural and unnatural substrates (36–38), and the synthesis of fatty acidmethyl esters (FAMEs), also known as biodiesel (39–41). Biodiesel is a sustainable andrenewable alternative to petroleum-based fossils that can be produced from a widerange of feedstocks (edible and nonedible animal fats and plant oils). In most cases,methanol serves as a second substrate in FAME production (42, 43). Compared withtraditional chemical pathways to synthesize FAMEs, enzymatic routes are preferred withregard to energy consumption and downstream operations. The efficiency of convert-ing oil feedstocks into biodiesel by lipases is mainly restrained by alcohol-inducedinactivation; thus, methanol-stable enzymes are desired (10, 44–46).

The thermophilic bacterial lipase from Geobacillus stearothermophilus T6 (LipT6), waspreviously used for biodiesel synthesis, and protein engineering increased the stabilityof the wild-type recombinant enzyme (LipT6WT) in methanol (47, 48). The crystalstructure of LipT6WT (PDB 4X6U) revealed tight side chain packing and a relatively rigidstructure, whereas the structures of the methanol-stable variants confirmed the en-hancement of the surface hydrogen bond network (47, 48). Furthermore, the helix lid

Gihaz et al. Applied and Environmental Microbiology

December 2018 Volume 84 Issue 23 e02143-18 aem.asm.org 2

on April 8, 2020 by guest

http://aem.asm

.org/D

ownloaded from

was identified (�9, residues F177 to A192) (48) and is expected to have a significantinterphase-triggered conformational change, as was reported by Carrasco-López et al.for a similar lipase from Geobacillus thermocatenulatus analyzed in an open-lid confor-mation (95% sequence identity) (49). Further stabilization of the methanol-stableH86Y/A269T/R374W variant was obtained through immobilization in sol-gel (50).

To date, the solvent tunnel engineering of lipases has not been applied for improv-ing stability in methanol. Most works have aimed to alter enzyme selectivity andsubstrate specificity (26, 31, 51–54). While the previous report on stabilizing DhaAemployed a saturation mutagenesis of tunnel residues (33), herein, a more systematicrational approach was practiced, incorporating bulky aromatic amino acids for intro-ducing new interactions within the LipT6 inner hydrophobic core. Tighter packing of aprotein lipophilic core was previously shown to result in higher stability with acorrelation to thermophilic nature (55). In particular, aromatic interactions have a majorcontributing role in protein folding nucleation, membrane anchoring, and thermody-namic stability (56–60). Solvent tunnels were selected as the target regions for mu-tagenesis due to their void volume and accessibility to the enzyme centroid. Eachsolvent tunnel was carefully and logically examined, and Phe, Tyr, or Trp substitutionswere incorporated. Single variants, as well as their double and triple combinations,were purified and evaluated for stability features, kinetic parameters, and biodieselsynthesis. The X-ray structures of 7 mutants revealed the changes induced by theinclusion of bulky residues. Interestingly, we discovered nontrivial correlations amongthree neighboring stabilizing Phe mutations.

RESULTSTunnel analysis and selection of mutations. An analysis of the LipT6WT structure

(PDB 4X6U) with MOLE 2.0 generator yielded 9 tunnels, and several residues near (4 to5 Å) these channels were identified and selected for mutagenesis (Fig. 1). Overall, 10positions were selected for rational design, and 16 single mutants were generated aspresented in Table 1. The general considerations were (i) the obstruction of solventtunnels with bulky side chains, (ii) the maintenance of the native hydrogen bondnetworks, and (iii) the avoidance of changes to catalytic and metal binding residues.The geometrical and biochemical properties of each residue dictated the choice of thespecific amino acid used for site-directed mutagenesis (Phe, Tyr, or Trp). The differentprimers used for mutagenesis are listed in Table 2.

Screening for enhanced stability in 60% methanol. The mutants were expressedin Escherichia coli, and the soluble cell extract was used for stability evaluation in 60%methanol, as previously described (47, 48). Relative hydrolysis activity values of thedesigned mutants compared with those of LipT6WT are presented in Table 3. Athreshold of a 4-fold increase in stability was used to determine which mutations tofurther combine to investigate a potential additive effect. Of the 16 variants evaluated,only the L184F, A187F, and L360F variants had significant improvements of 81.2-, 5.3-,and 4.5-fold, respectively, compared to the wild type (WT). All three mutations were

FIG 1 Visualization of the LipT6WT solvent tunnels as generated by the computational algorithm MOLE2.0. The �-helix lid (�9) is marked in red. Calcium and zinc metal ions are shown as green and grayspheres, respectively. Solvent tunnels are shown in blue, and target residues intended for mutagenesisare shown as magenta sticks. Catalytic Ser114 is presented in cyan. Numbers in black indicate the tunnelnumbering according to the MOLE job report.

Tunnel Engineering for Lipase Methanol Stability Applied and Environmental Microbiology

December 2018 Volume 84 Issue 23 e02143-18 aem.asm.org 3

on April 8, 2020 by guest

http://aem.asm

.org/D

ownloaded from

found in the vicinity of the longest solvent tunnel (tunnel 1), which is 2.9 Å away fromthe catalytic Ser114 as presented in Fig. 2. L184 and A187 are located on the LipT6 helixlid, while L360 is part of a flexible internal loop. The three mutations were combined inall possible rearrangements to explore their additive effect on LipT6 stability (Table 3).Only two double mutants, the L184F/A187F and A187F/L360F variants, were found tobe more stable than LipT6WT but inferior to the L360F mutant, while the triple mutantwas a very poor catalyst, suggesting a complex association between these threeresidues.

Stability measurements of purified enzymes in 70% methanol. To validate thescreening results, single variants and their double mutant combinations were purified,and their stability in 70% methanol was measured while incubating for up to 6 h (47).The relative activity values (compared with those under stress-free conditions in buffer)are presented in Fig. 3. An expected decrease in activity occurred in all variants after1 h, while LipT6WT lost more than 70% of its activity after 6 h of incubation. The L184F,A187F, and L360F single variants maintained 37%, 47%, and 73%, respectively, of theirhydrolytic activity after 6 h, as was also inferred from the screening results (Table 3). Inaddition, the L184F/A187F and A187F/L360F double mutants showed increases instability compared to that of LipT6WT, preserving more than 48% and 58%, respectively,of their initial activity. Nevertheless, the L184F/L360F double mutant presented a lower

TABLE 1 Residues selected for mutagenesis on the basis of LipT6WT tunnel analysis

Tunnel no.a Tunnel length (Å)b Residue Generated mutation

1 21 L184 F, YA187 F, YL360 F, Y

2 and 3 (Y shape) 13.5 and 13.9 R215 F, Y4 11.5 H154 Y, W5 7.8 I11 W

7 8.5 F226 YK330 Y, W

8 8.8 L380 FF268 Y

aAccording to MOLE 2.0 automatic numbering; tunnels 6 and 9 were unchanged to maintain their richhydrogen bond network.

bAccording to MOLE 2.0 job report.

TABLE 2 Primers for site directed mutagenesis of pET9a-LipT6WT plasmid

Position Original aaa Substitution Nucleotide sequence 5=¡3=b

11 I W GCTAACGATGCGCCATGGGTACTTCTCCACGGG154 H Y TTTGAAGGCGGACATTATTTTGTGTTGAGCGTG

W TTTGAAGGCGGACATTGGTTTGTGTTGAGCGTG184 L F GATCGCTTTTTTGACTTCCAGAAGGCGGTGTTG

Y CGATCGGTTTTTTGACTATCAGAAGGCGGTGTTG187 A F GACTTGCAAAAATTCGTGTTGAAAGCAGCGGC

Y GACTTGCAAAAATACGTGTTGAAAGCAGCGGC215 R F GACCAATGGGGACTGTTTCGCCAGCCAGGTGAA

Y GACCAATGGGGACTGTATCGCCAGCCAGGTGAA226 F Y GAATCATTCGACCAATATTATGAACGGCTCAAACGG268 F Y CGAATACGTATTATTTGAGCTATGCCACAGAACGGACG330 K W ATGAACGGACCATGGCGAGGATCGACAGAT

Y ATGAACGGACCATATCGAGGATCGACAGATCGG360 L F ACAATGTAGATCATTTCGAAGTCATCGGCGTTG

Y CGTACAACGTAGATCATTATGAAGTCATCGGCGT380 L F GCCTTTTATTTGCGATTTGCAGAGCAGTTGGCGL184F/A187Fc L F CGCTTCTTCGACTTCCAAAAATTCGTGTTGaaa, amino acid.bPositions of alterations in mutagenesis primers are indicated in bold.cUsed for the combination of L184F/A187F, while A187F (underlined) was used as the template.

Gihaz et al. Applied and Environmental Microbiology

December 2018 Volume 84 Issue 23 e02143-18 aem.asm.org 4

on April 8, 2020 by guest

http://aem.asm

.org/D

ownloaded from

stability after losing more than 80% of its initial activity after 6 h. As found in thescreening stage, only 5 of 6 mutants were more stable than LipT6WT.

Unfolding temperature of LipT6 mutants. The unfolding temperatures (Tms) ofthe stable mutants (in their purified form) were characterized in buffer (native envi-ronment) and in organic solvents (denaturing environment). The assays were con-ducted using differential scanning fluorimetry (50) with 60% methanol solutions,resembling biodiesel synthesis reaction conditions (Table 4). Furthermore, Tm valueswere also measured in 50% to 70% (vol/vol) solutions of methanol, ethanol, acetonitrile,and dimethyl sulfoxide (DMSO) (see Table S1 in the supplemental material).

The results in Table 4 clearly indicate that all single mutants were more stable thanLipT6WT in both buffer and 60% methanol, while similar results were obtained foradditional organic solvents (Table S1). Among the single mutants, the L360F variant

TABLE 3 Relative activity of LipT6 variants in 60% methanol

Varianta Relative activity ratiob

Single mutantsL360F 81.2 � 8.51A187F 5.3 � 0.72L184F 4.5 � 0.99F268Y 3.46 � 0.22R215F 2.40 � 0.35H154Y 1.89 � 0.25L184Y 1.51 � 0.19R215Y 1.31 � 0.29A187Y 1.22 � 0.43F226Y 1.08 � 0.45H154W 0.94 � 0.04K330Y 0.49 � 0.15K330W 0.30 � 0.08I11W 0.21 � 0.03L360Y 0.19 � 0.09L380F 0.10 � 0.05

Double mutantsA187F/L360F 26.5 � 7.48L184F/A187F 19.9 � 0.89L184F/L360F 0.46 � 0.05

Triple mutantL184F/A187F/L360F 0.29 � 0.06

aEach variant was expressed in E. coli, and the soluble cell extract (CE) was used for the screen. SDS-PAGEanalysis ensured an appropriate expression level, and hydrolysis activity in buffer ensured no drastic activityloss.

bThe relative hydrolysis activity of pNPL was calculated as (E/E0)/(E/E0)WT by comparing the activity in the CEfrom each variant before (E0) and after (E) a 30-min incubation in 60% methanol divided by the same valuefor LipT6WT (E/E0)WT. The results represent the averages from duplicates.

FIG 2 Residues found to influence stability in methanol by tunnel engineering. (A) Closeup view oftunnel 1. (B) Surface visualization. The �-helix lid (�9) is marked in red. The solvent tunnel is shown inblue and target residues are shown as magenta sticks. Catalytic serine is presented in cyan.

Tunnel Engineering for Lipase Methanol Stability Applied and Environmental Microbiology

December 2018 Volume 84 Issue 23 e02143-18 aem.asm.org 5

on April 8, 2020 by guest

http://aem.asm

.org/D

ownloaded from

presented the highest thermal stability improvements (increase in Tm) in buffer and in60% methanol of more than �3°C and �6°C, respectively. Moreover, it displayed ahigher thermal stability in all other solvents tested. The addition of A187F to form theA187F/L360F variant resulted in further Tm improvements of �5°C and �7°C in bufferand 60% methanol, respectively. Surprisingly, the L184F/L360F mutant exhibited alower Tm than LipT6WT, despite the stabilizing effect observed by L184F and L360Fseparately (the same trend was observed in the other organic solvents studied).However, the L184F/A187F double mutant had a minor Tm enhancement in buffer(�1°C) but a substantial stability with an increase in Tm of �7°C in 60% methanol.

Kinetic analysis. To investigate effects of the mutations on enzyme kinetics,4-nitrophenyl laurate (pNPL) hydrolysis was selected on the basis of its wide usage inlipase studies (61–64), including those with LipT6 (47, 48). The kinetic constants (Table5) were calculated on the basis of activity under native conditions without methanol.In general, all variants displayed a decrease in kcat values compared with that ofLipT6WT, with the L184F/L360F double mutant displaying a 70% decline. The A187L andL360F single mutants and L184F/A187L and A187F/L360F double mutants all hadsimilar lower Km constants, while the value for the L184F mutant was similar to that forLipT6WT. The L184F/L360F double mutant had the lowest Km value compared with thatof LipT6WT and also the lowest activity rate. Moreover, the values for the enzymeefficiency parameter kcat/Km for most of the variants were lower than that for LipT6WT,except the L184F/L360F double mutant, which displayed a 2-fold increase. Generally,the L360F mutation had the largest negative impact on kcat in the hydrolysis reaction.

FIG 3 Relative residual activity of LipT6 variants after incubation in 70% methanol. Purified LipT6 mutantswere incubated in 70% methanol for various durations, and their remaining activity was measured andcompared with that under native conditions (marked as 100% in cyan bars). Samples for pNPL hydrolysisassay were collected after 1, 4, and 6 h of incubation.

TABLE 4 Unfolding temperature of LipT6 variants in methanol

LipT6 variant

Tm (°C) in:

Buffer 60% methanol

WTa 66.6 � 0.1 38.9 � 0.3L184F 67.5 � 0.1 41.0 � 0.2A187F 70.0 � 0.2 43.0 � 0.6L360F 69.9 � 0.2 45.6 � 0.2L184F/A187F 67.6 � 0.1 46.1 � 0.2L184F/L360F 65.5 � 0.1 38.1 � 0.1A187F/L360F 72.2 � 0.1 46.2 � 0.1aObtained from Gihaz et al. (50).

Gihaz et al. Applied and Environmental Microbiology

December 2018 Volume 84 Issue 23 e02143-18 aem.asm.org 6

on April 8, 2020 by guest

http://aem.asm

.org/D

ownloaded from

Biodiesel production from waste chicken oil. Purified single and double variantswere used as soluble biocatalysts for biodiesel synthesis from waste chicken oil, with 5:1molar ratio of methanol to oil. The results presented in Fig. 4 emphasize the superiorstability and yield of the A187F/L360F double mutant, which converted 88% of wastechicken oil into FAME (3-fold improvement over the LipT6WT yield after 24 h) under theconditions tested. The L360F single mutant achieved the second-highest FAME yield of59% under the conditions tested (2-fold improvement). The synthesis yields highlycorrelated with the increase in Tm (Table 4), the initial screening results of the solublecell extracts (Table 2), and the results of the pure enzyme-based stability assay in 70%methanol (Fig. 3). Furthermore, the L184F mutant and the L184F/L360F double mutantprovided lower FAME conversions than LipT6WT, as predicted by their Tm values in 60%methanol. Unexpectedly, the A187F and L184F/A187F variants displayed similar in-creases in transesterification activity contrary to their different Tm values. An additiveeffect in terms of stability was observed mainly when combining A187F and L360Fmutations. On the other hand, the L184F mutation had a negative effect in combinationwith L360F and negligible influence when merged with A187F.

Crystal structure determination. In an attempt to gain a deeper understanding ofthe correlation between structure and stability, the crystal structures of all single anddouble mutants were solved at resolutions of 1.2 to 2.7 Å (Fig. 5A to F, in comparisonwith LipT6WT). The crystal parameters and data statistics are summarized in Table S2.Each solved structure was analyzed with two web servers: (i) MOLE 2.0 to reassess thesolvent tunnel distribution in the variants (30) and (ii) Arpeggio to calculate andvisualize the unique interatomic interactions in LipT6 mutants compared with those inLipT6WT. The Arpeggio server uses PDB files to calculate all possible intramolecularinteractions on the basis of the geometrical and biochemical features of the residues(65). It was selected due to its versatility in identifying a wide range of interactions andits straightforward user interphase in comparison with those of other traditional tools.

TABLE 5 Kinetic parameters of LipT6 variants in pNPL hydrolysis

LipT6 variant Km (10�2 mM)a kcat (103 s�1) kcat/Km (103 s�1 · mM�1)

WTb 7.9 � 0.6 4.7 59L184F 8.4 � 0.9 3.0 36A187F 5.4 � 0.6 3.0 55L360F 5.1 � 0.5 2.1 41L184F/A187F 5.1 � 0.4 2.1 41L184F/L360F 1.1 � 0.1 1.3 116A187F/L360F 5.6 � 0.7 1.6 30aValues are means � standard errors of the means.bObtained from Dror et al. (47).

FIG 4 FAME biosynthesis from waste chicken oil using soluble LipT6 variants. Reaction conditions: oil(2 g), water (20%), methanol-to-oil molar ratio, 5:1 (60% MeOH), and soluble lipase (0.04% based on theoil weight), 1,350 rpm, 45°C. The results represent triplicates (n � 3).

Tunnel Engineering for Lipase Methanol Stability Applied and Environmental Microbiology

December 2018 Volume 84 Issue 23 e02143-18 aem.asm.org 7

on April 8, 2020 by guest

http://aem.asm

.org/D

ownloaded from

First, a superposition of all mutant structures with LipT6WT ensured there were nosignificant structural changes in the catalytic triad (Ser114, His359, and Asp318), thecalcium-binding site (Glu361, Gly287, Pro367, and Asp366), the zinc-binding site(Asp62, His88, Asp239, and His82), and the oxyanion hole-stabilizing backbone residues(Phe17 and Glu115) (48). Thus, all changes in the properties of the variants wereassociated directly with the induced mutations. The electron densities around themutated residues in all variants discussed are presented in Fig. S1.

An inspection of the solvent tunnels in the new structures by using the MOLE serverconfirmed the elimination of tunnel 1, which extends from the outer protein surfacetoward the hydrophobic pocket (see Fig. S2). As expected, the phenyl rings obstructedthe channel by occupying its volume. Moreover, no other newly formed tunnels wereidentified close to the active site region or at other locations in the crystal structures ofthe variant.

In all single mutant structures (Fig. 5A to C), the orientation of the phenyl side chainsis toward the former occupied region of tunnel 1. Compared with LipT6WT, the threesingle mutations did not cause any structural changes in the near environment andoverall fold. An analysis with Arpeggio of the new contacts in the mutants revealed new�-� interactions with Phe291 residues in the L184F and A187F variants (Fig. 5A and B).Phe291 is a neighbor to the mutated residues, located on a solvent-accessible loop

FIG 5 X-ray structures of LipT6 designed mutants superimposed with LipT6WT (in gold). (A) L184F ingreen; (B) A187F in pink; (C) L360F in blue; (D) L184F/A187F in cyan; (E) L184F/L360F in brown; (F)A187F/L360F in purple. The �-helix lid in all structures is marked in red, and catalytic S114 is presentedin all figures. New interactions induced in the mutants compared with that in LipT6WT (according toArpeggio server analysis) are marked in dashed lines as follows: �-� in yellow, CH/� in green, andamide-� in blue.

Gihaz et al. Applied and Environmental Microbiology

December 2018 Volume 84 Issue 23 e02143-18 aem.asm.org 8

on April 8, 2020 by guest

http://aem.asm

.org/D

ownloaded from

(a13) and mainly stabilized by CH/� interactions (see Fig. S3). Moreover, Phe184interacts with Phe17, and several CH/� interactions were formed following mutagen-esis. In the L360F variant, a new �-� interaction with the catalytic His359 was gener-ated. This residue is stabilized by several other interactions in LipT6WT (Fig. S3).

An examination of the structures of the double mutants, of which two were morestable than LipT6WT, showed different bond networks depending on the mutationcombinations (Fig. 5D to F). The stable L184F/A187F and A187F/L360F mutants hadsimilar residue positions as in the respective single variants. The L184F/A187F mutant(Fig. 5D) displayed the same interactions found in the L184F and A187F mutants,creating two new �-� interactions with Phe291. In addition, Phe184 and Phe187participated in a new aromatic continuum with Phe291, as was shown in the L184Fvariant. Likewise, similar to those for the two single mutants, the stable A187F/L360Fvariant (Fig. 5F) exhibited new �-� interactions between His359 and Phe360 andbetween Phe291 and Phe187.

In contrast, the methanol-sensitive L184F/L360F variant exhibited a different con-formation of Phe184, due to steric hindrance by Phe360 (Fig. 5E). The movement ofPhe184 also induced a conformational change of Phe291, now facing “out” in a moresolvent-accessible orientation (see Fig. S4). This movement caused the exclusion of �-�or amide-� interactions formerly stabilizing Phe291. In addition, in its “new” orientation,Phe184 was discarded from any �-� interactions, now stabilized by only hydrophobicinteractions. The poor methanol stability of the L184F/L360F variant is therefore linkedto the aromatic rearrangement in the vicinity of the active site, despite the stabilizingeffect of L360F alone due to tunnel 1 obstruction. To further strengthen this hypothesis,the crystal structure of the L184F/A187F/L360F triple mutant was solved (see Fig. S5).The structure displayed the same “flipped” conformation of Phe184 and Phe291occurring in the L184F/L360F mutant. Despite this, Phe187 managed to interact withPhe291 and Phe360 by �-� interactions, but with no effect on the stability of thevariants.

DISCUSSION

Enzyme engineering is one of the major approaches for designing stable biocata-lysts for an organic solvent environment (2, 10, 18, 22). The manipulation of the tunnelsto obtain stability in organic solvents was first introduced with a primarily randomizeddesign of haloalkane dehalogenase DhaA by Koudelakova et al., which increased itsstability in DMSO (33). Most works on tunnel redesign have focused on alteringsubstrate selectivity by influencing substrate access to the active site (26, 31, 52, 53,66–69).

The present work aimed to stabilize LipT6 in methanol by incorporating aromaticresidues into the solvent channels to induce improved hydrophobic packing via�-involving interactions. Some works suggested that such modifications potentiallyrestrict the unnecessary penetration of polar alcohols into the enzyme core (32).Site-directed mutagenesis at selected positions was performed on the basis of thegeometric and biochemical properties of the residues. This approach was indeedsuccessful in obtaining new solvent-stable mutants of LipT6 with improved Tms andbiodiesel synthesis yields. As a rational concept, introducing � interactions withinlipophilic areas in the enzyme inner tunnels reduces screening efforts compared tothose reported with other directed evolution approaches. Dror et al. obtained a 2-foldimprovement in FAME synthesis yield with the LipT6 H86Y/A269T double mutant whencombining mutations selected from random mutagenesis and structure-guided con-sensus libraries. The isolation of these mutations required the screening of more than2,200 colonies (47). A greater improvement in the stability (30-fold higher) in 70%methanol was achieved by Korman et al., who constructed Dieselzyme4 (a Proteusmirabilis lipase variant with 13 mutations, including one introduced disulfide bond),though their overall screening efforts were in an estimated 20,000 colonies (70). On theother hand, a rational approach by Park et al. yielded 7 variants of Candida antarcticalipase B (CaLB) with potentially enriched hydrogen bond networks, while only one

Tunnel Engineering for Lipase Methanol Stability Applied and Environmental Microbiology

December 2018 Volume 84 Issue 23 e02143-18 aem.asm.org 9

on April 8, 2020 by guest

http://aem.asm

.org/D

ownloaded from

mutant possessed 1.5-fold higher stability in 80% methanol (71). Koudelakova et al.discovered stabilizing mutations located in the DhaA access tunnel after screening5,326 colonies from random mutagenesis libraries for stability in 42% DMSO. Therandom positive mutations were added to a previously known stable DhaA variant, anda saturation mutagenesis of position Ala171 in the access tunnel was performed. Thiscombined approach resulted in few stable variants possessing superior 2-fold increasedstability in 40% DMSO (33). Regarding our screening efforts (16 single variants) and theadditive effect accomplished (3-fold improvement in FAME biosynthesis), one canconclude that the introduction of aromatic interactions within solvent tunnels is apromising concept in the quest for solvent-stable enzymes. Moreover, the focus onlong and deep tunnels may have even reduced labor and cost efforts.

Generally, the initial screening results emphasized the dependence on tunnellocation and length. Stabilizing mutations (3 of 6 [50%]) were found exclusively in thelongest solvent pathway (tunnel 1) leading from the surface to the active site. Theoverall structure of LipT6 is rigid and compact, similar to that of other thermophilichomologs in the I.5 family (49, 72, 73). Thus, the peripheral tunnels are situated mostlynear the hydrophilic surface (Fig. 1) and are less prone to stabilization through corehydrophobic interactions. In addition, tunnel 1 is near the active site; thus, the redesignof such surroundings was expected to have some significant outcomes, as was pre-sented by Biedermannova et al. for haloalkane dehalogenase LinB (51). Furthermore,Phe and Tyr mutations had significantly diverse stabilization features when occupyingthe same position (Table 3). For example, the L360F variant was 81.2-fold more stablethan the wild type, while the L360Y variant was less stable (0.19-fold). These contra-dicting outcomes highlight the importance and unique nature of this tunnel, near thehelix lid, which is expected to have a significant structural rearrangement in thepresence of hydrophobic substrates.

Three positions within tunnel 1 were selected for further investigation after muta-tions of the Phe residues resulted in an increased stability in 60% methanol. L184 andA187 are located on LipT6 helix lid (�9), while L360 is found close to the active site. Areanalysis with MOLE 2.0 of the crystal structures of the variants indicated that theintroduced phenyl side chains managed to crowd tunnel 1 (no longer found inmutants) (see Fig. S2 in the supplemental material), as intended, and as describedbeforehand (32, 33). Conversely, Liskova et al. showed that replacing Phe with Gly inDhaA80 caused a decline in stability due to the disruption of intramolecular hydro-phobic packing (32). These findings correlate with our positive results of rationallyreplacing Leu or Ala with Phe residues. The stability measurements of purified enzymesin 70% methanol validated our screening results, as the L360F variant exhibited thehighest residual activity after 6 h followed by stable A187F and L184F mutants. Themelting temperature measurements agreed with the initial stability screening results,as the L360F and A187F mutants presented better thermal stability in both buffer andmethanol (along with other organic solvents, as presented in Table S1). A similarcorrelation between Tm and stability in organic solvents was previously obtained forother LipT6 stable variants (47, 48).

The superior stability of the L360F variant was related to its unexpected �-�stacking interaction with catalytic His359 (Fig. 5C). Kannan and Vishveshwara previouslyreported the existence of one aromatic cluster next to the active site in thermophilicenzymes that was lacking in their mesophilic equivalents (55). An alignment of se-quences homologous to LipT6 performed by Dror et al. showed that Leu360 is not anevolutionarily conserved position; however, the formation of a new aromatic clusterexplains the stability exhibited by this mutant (47, 55).

Both L184F and A187F interacted separately with Phe291 via new aromatic �-�interactions, while the A187F variant had both improved transesterification activity andthermostability. Since the L184F variant exhibited the lowest improvement in Tm andmethanol stability, it can be implied that a minimum stability enhancement thresholdis required for improved biodiesel synthesis in comparison to that with LipT6WT. Aspreviously described by Dror et al., some mutations in LipT6WT induced methanol

Gihaz et al. Applied and Environmental Microbiology

December 2018 Volume 84 Issue 23 e02143-18 aem.asm.org 10

on April 8, 2020 by guest

http://aem.asm

.org/D

ownloaded from

stability but at the same time led to decreased FAME synthesis. One example is theneighboring position Gln185, which was mutated to Leu and was found to inducealcohol stability but a lower transesterification yield of soybean oil (47). This phenom-enon was attributed to a tighter orientation of the LipT6 helix lid, limiting triglycerideaccessibility during biodiesel synthesis. It can be assumed that the L184F mutation hada similar affect as was reported for Q185L. In addition, several studies indicated thatmutations of the lid can alter thermostability along with selectivity (74, 75). Khan et al.recently reviewed the influence of mutagenesis of the lid on thermostability andactivity, highlighting the importance of this domain in lipases (76). Some studiesindicated that a simultaneous change in stability and substrate preferences is caused byan alteration of the residues on the lid (77, 78). Likewise, a decline in activity accom-panied with elevated stability was also apparent after introducing bulky residues in theDhaA access tunnel (32, 33).

A kinetic analysis revealed a general increase in substrate affinity (lower Km) and adecrease in maximum hydrolytic velocity (lower kcat) for most variants. As expected,mutations in the vicinity of the active site affected enzyme kinetics, selectivity, or eventhe mechanism (51, 68, 69). Among the single mutants, the L360F variant displayed thelowest kcat with similar Km values, emphasizing the significant interaction with catalyticHis359. Lid mutations L184F and A187F also affected LipT6 kinetics, as was describedpreviously by Tang et al. for lid mutations of Penicillium expansum lipase (77). Despitethe lower activity rates of the mutants in the hydrolysis reaction, most of themperformed better in an organic solvent environment, leading to higher biodiesel yields(Fig. 4).

The merging of stable mutations in all possible double mutant combinationsrevealed interesting complex correlations with regard to stability in methanol, Tm

values, and FAME synthesis. The highest stabilizing effect was observed in the A187F/L360F variant, which displayed the best FAME yield (88% after 24 h) and Tm improve-ment (Tm increases of �5°C and �7°C compared with those of LipT6WT in buffer and60% methanol, respectively). These findings were also confirmed in the purified en-zyme stability assay (Fig. 3) and by the melting temperatures in other polar solvents(Table S1). Relatedly, Stepankova et al. previously showed that different organic sol-vents confer different destabilizing effects on enzymes (79). The results of a structuralanalysis suggest that new aromatic interactions with both catalytic His359 (by Phe360)and Phe291 (by Phe187) are responsible for the improved performance in the non-aqueous environment. Aromatic interactions were previously found to stabilize xyla-nase, RNase, and many other protein structures by improving hydrophobic packing andintroducing new � interactions (80–83). In addition, these two mutations did noteliminate interactions found in LipT6WT but enriched the existing network and occu-pied tunnel 1. Prior work on LipT6 stabilization highlighted the importance of enhanc-ing the hydrogen bond network among surface residues as well as the interactions withwater molecules (47, 48). Here, we have discovered the significance of �-� stackinginteractions and CH/� interactions within the LipT6 hydrophobic core for improvingmethanol stability. The kinetic properties of the A187F/L360F double mutant revealeda lower hydrolysis reaction rate and a higher affinity toward pNPL (C12). Despite this, thetriglyceride methanolysis rate and yield were 3-fold higher than in the wild type. On thebasis of these observations, we conclude that the major factor influencing FAMEsynthesis in our system is the enzyme stability. This was also shown in other cases (47,48). Dror et al. showed that the LipT6 H86Y/A269T double mutant had a similarhydrolysis performance to that of LipT6WT, though its FAME yield from soybean oil was2-fold higher (47).

The L184F/A187F variant displayed a similar thermostability to that of the A187F/L360F variant, but its transesterification performance was similar to that of the A187Fvariant. The addition of the L184F mutation did not reduce the already improvedtransesterification activity of the A187F variant. Only the L184F/A187F double mutantpossesses two neighboring lid mutations, which may explain this noncorrelative rela-tionship between alcohol stability and FAME synthesis, as was shown previously (76,

Tunnel Engineering for Lipase Methanol Stability Applied and Environmental Microbiology

December 2018 Volume 84 Issue 23 e02143-18 aem.asm.org 11

on April 8, 2020 by guest

http://aem.asm

.org/D

ownloaded from

77). The structures of both the L184F and L184F/A187F variants revealed a �-� stackinginteraction network involving 16 aromatic side chains (see Fig. S6). The improvedthermostability was likely due to this branched aromatic continuum, but no significanttransesterification improvement was observed compared with that of the A187F variant(55).

Interestingly, the L184F/L360F double mutant, comprising two single stabilizingmutations, showed decreased methanol stability, lower Tm (in all solvents tested), andthe lowest kcat, Km, and biodiesel yield. Unlike the effect of L184F on A187F (in theL184F/A187F variant), in combination with L360F, a dramatic decrease in stabilityoccurred. An inspection of the crystal structure of the L184F/L360F double mutantrevealed an aromatic cluster rearrangement involving Phe184, Phe291, and Phe360(Fig. 5 and S3). The steric collision of static Phe360 (found in the same orientation in allmutants) and Phe184 caused a conformational change in the latter, leading to move-ment of Phe291 as well. Subsequently, fewer intramolecular interactions were possible.It was previously shown that helix-stabilizing residues (as Phe291) impact proteinstability when comparing thermophilic and mesophilic homologs (84). In addition, ananalysis of the L184F/A187F/L360F triple mutant affirmed that A187F did not restorestability to the L184F/L360F variant or the favored ring conformation. The fact that thestabilizing mutation L360F did not improve the stability of the L184F or L184F/A187Fvariants demonstrated the significant impact of Phe291 conformation on LipT6 stabilityand organic synthesis capability.

Overall, this new systematic approach of rational tunnel engineering by incorporat-ing aromatic residues to facilitate �-involving interactions, with a focus on deep andlong solvent channels, can be considered for stabilizing other enzymes in organicsolvents.

MATERIALS AND METHODSChemicals. Methanol, glycerol, NaCl, and Triton X-100 were purchased from Bio-Labs (Jerusalem,

Israel). 2-Propanol, ethanol, and sodium citrate were purchased from J.T. Baker (Deventer, The Nether-lands). Sodium formate, DMSO, and sodium acetate were purchased from Merck (Darmstadt, Germany).Ethyl acetate was purchased from Gadot (Haifa, Israel) while acetonitrile and CaCl2 were from SpectrumChemical MFG (Gardena, CA, USA). Trizma base, pNPL, polyethylene glycol (PEG) 400, PEG 3350,heptadecanoic acid methyl ester, and kanamycin were purchased from Sigma-Aldrich (Rehovot, Israel).Waste chicken oil was kindly donated by Miloubar (Miloubar Mixture Institute ACS, Miluot, Israel). Allmaterials used were of the highest purity available.

Bacterial strains, plasmids, and enzymes. Recombinant Geobacillus stearothermophilus T6 lipase(EMBL, AF429311.1) fused to a His tag was expressed in Escherichia coli BL21 cells (DE3; Novagen,Darmstadt, Germany) as previously described (47, 48, 50).

Solvent tunnel analysis using MOLE 2.0. To detect tunnels in LipT6WT (PDB 4X6U), the crystalstructure was analyzed with the MOLE 2.0 online generator (http://old.mole.upol.cz/) using defaultparameters (30). The analysis revealed 9 tunnels, and a superposition display (enzyme structure andcoordinates of the tunnels) was utilized to define the closest residues to these channels (4 to 5 Å directdistance) using Pymol (85). After eliminating essential residues (catalytic, metal binding, and multiplehydrogen bond donor) and inspecting the MOLE 2.0 job review, 10 positions were selected forsite-directed mutagenesis (Table 1), which were mutated into at least one bulky residue (F, Y, or W). Themutants were generated and subsequently evaluated for activity, stability, and structural characteriza-tion.

Site-directed mutagenesis of LipT6. Rational mutagenesis of the pET9a-LipT6WT plasmid wasperformed using the QuikChange protocol for site-directed mutagenesis. The reaction mixture wascomposed of 5 �l Taq polymerase buffer, 2 �l DNA template (50 ng/�l), 1.5 �l of each primer solution(1 �g/�l), 2 �l deoxynucleoside triphosphates (dNTPs; 20 mM A/T/C/G, 1:1:1:1), 0.5 �l Taq polymerase(EurX, Gdansk, Poland), and 37.5 �l distilled water (dH2O). The different primers are listed in Table 2. Taqpolymerase was added and the reaction mixtures were incubated in a thermocycler (Labcycler; Senso-Quest, Göttingen, Germany). The PCR program had an initial denaturation step for 1 min at 95°C, andthen 20 cycles of 30 s at 95°C, 45 s at 65°C, and 6 min at 68°C, followed by a final elongation step for 7min at 68°C. PCR products were run on an agarose gel (1% [wt/wt]) to validate single-band products, andthe template plasmid was digested for 18 h at 37°C with Dpn1 (New England BioLabs, Ipswich, MA, USA).The resulting plasmid was used for transformation and selection on LB agar plates containing 25 �g/mlkanamycin. The plasmids from positive colonies were extracted using a plasmid miniprep kit (Qiagen,Hilden, Germany) and sequenced for verification (HyLabs, Rehovot, Israel).

Soluble lipase activity assay. The soluble lipase hydrolytic activity on pNPL was determined usinga colorimetric assay as described previously (47, 48). This method was also used to determine the specificactivity of purified enzyme samples in buffer and in solvent solutions.

Gihaz et al. Applied and Environmental Microbiology

December 2018 Volume 84 Issue 23 e02143-18 aem.asm.org 12

on April 8, 2020 by guest

http://aem.asm

.org/D

ownloaded from

Stability screen in 60% methanol. The screening for methanol-stable mutants was performed asdescribed previously with a few modifications (47). The TB medium inoculation volume was 35 ml, andafter centrifugation, the cells were resuspended in 9 ml buffer to increase the sensitivity of the method.

Purification of LipT6 variants. LipT6 variants were purified with AKTA Prime Plus (GE HealthcareBio-Sciences AB, Sweden) according to previously described procedures (47, 48).

Tm determination of purified LipT6 variants. Denaturation temperatures were determined with ananoDSF device according to a previously described procedure (50).

Determination of kinetic parameters. Km and kcat values for purified LipT6 variants were deter-mined using the pNPL hydrolysis colorimetric assay in 96-well plates as previously described (47, 48). Theresults were analyzed using SigmaPlot software.

Stability validation of LipT6 variants in 70% methanol. The stability of purified LipT6 variants in70% methanol was determined by measuring the residual hydrolytic activity after incubating for severalhours, as described previously (47, 48).

Enzymatic transesterification of waste chicken oil by soluble lipase. The transesterificationreactions were carried out in triplicates according to the work of Dror et al. (48), with a few modifications.Briefly, 14-ml closed glass vials were filled with 2 g waste chicken oil, and methanol (5:1 alcohol-to-oilmolar ratio) and 400 �l of lipase buffer (2 mg/ml enzyme solution, 0.04% enzyme, and 20% water contentbased on oil weight) were added.

Gas chromatography analysis of FAME. Gas chromatography analysis of FAME formation wascarried out according to the work of Dror et al. (48).

LipT6 variant crystallization, data collection, and structure determination. The crystallization ofLipT6 variants was performed as described previously (48), with a few modifications. The hanging dropcontained 2 �l protein solution (0.5 to 2 mg/ml) and 2 �l crystallization condition (0.2 M sodium citrateand 25% PEG 3350 or 0.2 M sodium formate and 20% PEG 3350). The cryoprotectant solution wascrystallization condition enriched with 25% PEG 400. The X-ray diffraction data of LipT6 variants werecollected at the European Synchrotron Radiation Facility (ESRF), Grenoble, France, with beamlines asdescribed in Table S2 in the supplemental material. The diffraction data were indexed, integrated, andreduced with either MOSFLM (86), Scala (87), autoPROC (88), or EDNA (89). All structures were solved bymolecular replacement using Phaser (90) and the coordinates of the LipT6WT structure (PDB 4X6U).Refinement was performed using PHENIX (91). Manual model building, real-space refinement, andstructure validations were performed using Coot (92). The crystal parameters, beamlines used by theESRF, and data statistics are summarized in Table S2.

Calculation and visualization of interatomic interactions in LipT6 variants. The interactionrepertoire in LipT6WT and other variants was determined by using the PDB file of each mutant and theArpeggio web server (65). The default settings were used to calculate and analyze each structure,including the graphical presentations with Pymol (85) as shown in Fig. 5.

SUPPLEMENTAL MATERIAL

Supplemental material for this article may be found at https://doi.org/10.1128/AEM.02143-18.

SUPPLEMENTAL FILE 1, PDF file, 1.0 MB.

ACKNOWLEDGMENTSThis research was supported by Russell-Berrie Nanotechnology Institute (RBNI) at the

Technion.We thank the staff of the European Synchrotron Radiation Facility (beamlines ID 29,

ID 30a-3) for providing synchrotron radiation facilities and assistance.

REFERENCES1. Doukyu N, Ogino H. 2010. Organic solvent-tolerant enzymes. Biochem

Eng J 48:270 –282. https://doi.org/10.1016/j.bej.2009.09.009.2. Stepankova V, Bidmanova S, Koudelakova T, Prokop Z, Chaloupkova R,

Damborsky J. 2013. Strategies for stabilization of enzymes in organicsolvents. ACS Catal 3:2823–2836. https://doi.org/10.1021/cs400684x.

3. Carrea G, Riva S. 2000. Properties and synthetic applications of enzymesin organic solvents. Angew Chem Int Ed Engl 39:2226 –2254. https://doi.org/10.1002/1521-3773(20000703)39:13�2226::AID-ANIE2226�3.0.CO;2-L.

4. Choi J-M, Han S-S, Kim H-S. 2015. Industrial applications of enzymebiocatalysis: current status and future aspects. Biotechnol Adv 33:1443–1454. https://doi.org/10.1016/j.biotechadv.2015.02.014.

5. Rudroff F, Mihovilovic MD, Gröger H, Snajdrova R, Iding H, BornscheuerUT. 2018. Opportunities and challenges for combining chemo-and bio-catalysis. Nat Catal 1:12–22. https://doi.org/10.1038/s41929-017-0010-4.

6. Lotti M, Pleiss J, Valero F, Ferrer P. 2015. Effects of methanol on lipases:molecular, kinetic and process issues in the production of biodiesel.Biotechnol J 10:22–30. https://doi.org/10.1002/biot.201400158.

7. Wang S, Meng X, Zhou H, Liu Y, Secundo F, Liu Y. 2016. Enzyme stabilityand activity in non-aqueous reaction systems: a mini review. Catalysts6:32. https://doi.org/10.3390/catal6020032.

8. Klibanov AM. 2001. Improving enzymes by using them in organic sol-vents. Nature 409:241–246. https://doi.org/10.1038/35051719.

9. Ogino H, Ishikawa H. 2001. Enzymes which are stable in the presence oforganic solvents. J Biosci Bioeng 91:109 –116. https://doi.org/10.1016/S1389-1723(01)80051-7.

10. Lotti M, Pleiss J, Valero F, Ferrer P. 2018. Enzymatic production ofbiodiesel: strategies to overcome methanol inactivation. Biotechnol J13:e1700155. https://doi.org/10.1002/biot.201700155.

11. Herbst D, Peper S, Niemeyer B. 2012. Enzyme catalysis in organicsolvents: influence of water content, solvent composition and temper-ature on Candida rugosa lipase catalyzed transesterification. J Biotechnol162:398 – 403. https://doi.org/10.1016/j.jbiotec.2012.03.011.

12. Frauenkron-Machedjou VJ, Fulton A, Zhao J, Weber L, Jaeger K-E,Schwaneberg U, Zhu L. 2018. Exploring the full natural diversity of singleamino acid exchange reveals that 40 – 60% of BSLA positions improve

Tunnel Engineering for Lipase Methanol Stability Applied and Environmental Microbiology

December 2018 Volume 84 Issue 23 e02143-18 aem.asm.org 13

on April 8, 2020 by guest

http://aem.asm

.org/D

ownloaded from

organic solvents resistance. Bioresour Bioprocess 5:2. https://doi.org/10.1186/s40643-017-0188-y.

13. Markel U, Zhu L, Frauenkron-Machedjou VJ, Zhao J, Bocola M, Davari MD,Jaeger K-E, Schwaneberg U. 2017. Are directed evolution approachesefficient in exploring nature’s potential to stabilize a lipase in organiccosolvents? Catalysts 7:142. https://doi.org/10.3390/catal7050142.

14. Kumar A, Dhar K, Kanwar SS, Arora PK. 2016. Lipase catalysis in organicsolvents: advantages and applications. Biol Proced Online 18:2. https://doi.org/10.1186/s12575-016-0033-2.

15. Khabiri M, Minofar B, Brezovský J, Damborský J, Ettrich R. 2013.Interaction of organic solvents with protein structures at protein-solvent interface. J Mol Model 19:4701– 4711. https://doi.org/10.1007/s00894-012-1507-z.

16. Woodley JM. 2008. New opportunities for biocatalysis: making pharma-ceutical processes greener. Trends Biotechnol 26:321–327. https://doi.org/10.1016/j.tibtech.2008.03.004.

17. Ebert MC, Pelletier JN. 2017. Computational tools for enzymeimprovement: why everyone can—and should— use them. Curr OpinChem Biol 37:89 –96. https://doi.org/10.1016/j.cbpa.2017.01.021.

18. Woodley JM. 2013. Protein engineering of enzymes for process applica-tions. Curr Opin Chem Biol 17:310 –316. https://doi.org/10.1016/j.cbpa.2013.03.017.

19. Wehrmann M, Klebensberger J. 2018. Engineering thermal stability andsolvent tolerance of the soluble quinoprotein PedE from Pseudomonasputida KT2440 with a heterologous whole-cell screening approach. Mi-crob Biotechnol 11:399 – 408. https://doi.org/10.1111/1751-7915.13036.

20. Mate DM, Alcalde M. 2015. Laccase engineering: from rational design todirected evolution. Biotechnol Adv 33:25– 40. https://doi.org/10.1016/j.biotechadv.2014.12.007.

21. Yu X-W, Tan N-J, Xiao R, Xu Y. 2012. Engineering a disulfide bond in thelid hinge region of Rhizopus chinensis lipase: increased thermostabilityand altered acyl chain length specificity. PLoS One 7:e46388. https://doi.org/10.1371/journal.pone.0046388.

22. Rosenfeld L, Heyne M, Shifman JM, Papo N. 2016. Protein engineering bycombined computational and in vitro evolution approaches. TrendsBiochem Sci 41:421– 433. https://doi.org/10.1016/j.tibs.2016.03.002.

23. Otten LG, Hollmann F, Arends IW. 2010. Enzyme engineering forenantioselectivity: from trial-and-error to rational design? Trends Bio-technol 28:46 –54. https://doi.org/10.1016/j.tibtech.2009.10.001.

24. Widersten M. 2014. Protein engineering for development of new hydro-lytic biocatalysts. Curr Opin Chem Biol 21:42– 47. https://doi.org/10.1016/j.cbpa.2014.03.015.

25. Brezovsky J, Chovancova E, Gora A, Pavelka A, Biedermannova L, Dam-borsky J. 2013. Software tools for identification, visualization and anal-ysis of protein tunnels and channels. Biotechnol Adv 31:38 – 49. https://doi.org/10.1016/j.biotechadv.2012.02.002.

26. Kingsley LJ, Lill MA. 2015. Substrate tunnels in enzymes:structure–function relationships and computational methodology. Pro-teins 83:599 – 611. https://doi.org/10.1002/prot.24772.

27. Gora A, Brezovsky J, Damborsky J. 2013. Gates of enzymes. Chem Rev113:5871–5923. https://doi.org/10.1021/cr300384w.

28. Damborsky J, Brezovsky J. 2014. Computational tools for designing andengineering enzymes. Curr Opin Chem Biol 19:8 –16. https://doi.org/10.1016/j.cbpa.2013.12.003.

29. Chovancova E, Pavelka A, Benes P, Strnad O, Brezovsky J, Kozlikova B,Gora A, Sustr V, Klvana M, Medek P. 2012. CAVER 3.0: a tool for theanalysis of transport pathways in dynamic protein structures. PLoSComput Biol 8:e1002708. https://doi.org/10.1371/journal.pcbi.1002708.

30. Sehnal D, Vareková RS, Berka K, Pravda L, Navrátilová V, Banás P, IonescuC-M, Otyepka M, Koca J. 2013. MOLE 2.0: advanced approach for analysisof biomacromolecular channels. J Cheminform 5:39. https://doi.org/10.1186/1758-2946-5-39.

31. Kaushik S, Marques SM, Khirsariya P, Paruch K, Libichova L, Brezovsky J,Prokop Z, Chaloupkova R, Damborsky J. 2018. Impact of the accesstunnel engineering on catalysis is strictly ligand-specific. FEBS J 285:1456 –1476. https://doi.org/10.1111/febs.14418.

32. Liskova V, Bednar D, Prudnikova T, Rezacova P, Koudelakova T, Sebe-stova E, Smatanova IK, Brezovsky J, Chaloupkova R, Damborsky J. 2015.Balancing the stability–activity trade-off by fine-tuning dehalogenaseaccess tunnels. ChemCatChem 7:648 – 659. https://doi.org/10.1002/cctc.201402792.

33. Koudelakova T, Chaloupkova R, Brezovsky J, Prokop Z, Sebestova E,Hesseler M, Khabiri M, Plevaka M, Kulik D, Kuta Smatanova I, Rezacova P,Ettrich R, Bornscheuer UT, Damborsky J. 2013. Engineering enzyme

stability and resistance to an organic cosolvent by modification ofresidues in the access tunnel. Angew Chem Int Ed Eng 52:1959 –1963.https://doi.org/10.1002/anie.201206708.

34. Angajala G, Pavan P, Subashini R. 2016. Lipases: an overview of itscurrent challenges and prospectives in the revolution of biocatalysis.Biocatal Agric Biotechnol 7:257–270. https://doi.org/10.1016/j.bcab.2016.07.001.

35. Anobom CD, Pinheiro AS, De-Andrade RA, Aguieiras EC, Andrade GC,Moura MV, Almeida RV, Freire DM. 2014. From structure to catalysis:recent developments in the biotechnological applications of lipases.Biomed Res Int 2014:684506. https://doi.org/10.1155/2014/684506.

36. Jaeger K, Dijkstra B, Reetz M. 1999. Bacterial biocatalysts: molecularbiology, three-dimensional structures, and biotechnological applicationsof lipases. Annu Rev Microbiol 53:315–351. https://doi.org/10.1146/annurev.micro.53.1.315.

37. Muralidhar R, Chirumamilla R, Marchant R, Ramachandran V, Ward O,Nigam P. 2002. Understanding lipase stereoselectivity. World J MicrobiolBiotechnol 18:81–97. https://doi.org/10.1023/A:1014417223956.

38. Gupta R, Gupta N, Rathi P. 2004. Bacterial lipases: an overview ofproduction, purification and biochemical properties. Appl Microbiol Bio-technol 64:763–781. https://doi.org/10.1007/s00253-004-1568-8.

39. Fukuda H, Kondo A, Noda H. 2001. Biodiesel fuel production by trans-esterification of oils. J Biosci Bioeng 92:405– 416. https://doi.org/10.1016/S1389-1723(01)80288-7.

40. Al-Zuhair S. 2007. Production of biodiesel: possibilities and challenges.Biofuel Bioprod Biorefin 1:57– 66. https://doi.org/10.1002/bbb.2.

41. Hama S, Noda H, Kondo A. 2018. How lipase technology contributes toevolution of biodiesel production using multiple feedstocks. Curr OpinBiotechnol 50:57– 64. https://doi.org/10.1016/j.copbio.2017.11.001.

42. Cesarini S, Pastor F, Nielsen PM, Diaz P. 2015. Moving towards a com-petitive fully enzymatic biodiesel process. Sustainability 7:7884 –7903.https://doi.org/10.3390/su7067884.

43. Guldhe A, Singh B, Mutanda T, Permaul K, Bux F. 2015. Advances insynthesis of biodiesel via enzyme catalysis: novel and sustainable ap-proaches. Renew Sustain Energy Rev 41:1447–1464. https://doi.org/10.1016/j.rser.2014.09.035.

44. Bajaj A, Lohan P, Jha PN, Mehrotra R. 2010. Biodiesel production throughlipase catalyzed transesterification: an overview. J Mol Catal B Enzym62:9 –14. https://doi.org/10.1016/j.molcatb.2009.09.018.

45. Gog A, Roman M, Tosa M, Paizs C, Irimie FD. 2012. Biodiesel productionusing enzymatic transesterification– current state and perspectives. Re-new Energy 39:10 –16. https://doi.org/10.1016/j.renene.2011.08.007.

46. Christopher LP, Kumar H, Zambare VP. 2014. Enzymatic biodiesel: chal-lenges and opportunities. Appl Energy 119:497–520. https://doi.org/10.1016/j.apenergy.2014.01.017.

47. Dror A, Shemesh E, Dayan N, Fishman A. 2014. Protein engineering byrandom mutagenesis and structure-guided consensus of Geobacillusstearothermophilus lipase T6 for enhanced stability in methanol. ApplEnviron Microbiol 80:1515–1527. https://doi.org/10.1128/AEM.03371-13.

48. Dror A, Kanteev M, Kagan I, Gihaz S, Shahar A, Fishman A. 2015.Structural insights into methanol-stable variants of lipase T6 from Geo-bacillus stearothermophilus. Appl Microbiol Biotechnol 99:9449 –9461.https://doi.org/10.1007/s00253-015-6700-4.

49. Carrasco-López C, Godoy C, de las Rivas B, Fernández-Lorente G, PalomoJM, Guisán JM, Fernández-Lafuente R, Martínez-Ripoll M, Hermoso JA.2009. Activation of bacterial thermoalkalophilic lipases is spurred bydramatic structural rearrangements. J Biol Chem 284:4365– 4372. https://doi.org/10.1074/jbc.M808268200.

50. Gihaz S, Weiser D, Dror A, Sátorhelyi P, Jerabek-Willemsen M, Poppe L,Fishman A. 2016. Creating an efficient methanol-stable biocatalyst byprotein and immobilization engineering steps towards efficient biosyn-thesis of biodiesel. ChemSusChem 9:3161–3170. https://doi.org/10.1002/cssc.201601158.

51. Biedermannová L, Prokop Z, Gora A, Chovancová E, Kovács M, Dambo-rský J, Wade RC. 2012. A single mutation in a tunnel to the active sitechanges the mechanism and kinetics of product release in haloalkanedehalogenase LinB. J Biol Chem 287:29062–29074. https://doi.org/10.1074/jbc.M112.377853.

52. Pavlova M, Klvana M, Prokop Z, Chaloupkova R, Banas P, Otyepka M,Wade RC, Tsuda M, Nagata Y, Damborsky J. 2009. Redesigning dehalo-genase access tunnels as a strategy for degrading an anthropogenicsubstrate. Nat Chem Biol 5:727–733. https://doi.org/10.1038/nchembio.205.

53. Prokop Z, Gora A, Brezovsky J, Chaloupkova R, Stepankova V, Damborsky

Gihaz et al. Applied and Environmental Microbiology

December 2018 Volume 84 Issue 23 e02143-18 aem.asm.org 14

on April 8, 2020 by guest

http://aem.asm

.org/D

ownloaded from

J. 2012. Engineering of protein tunnels: keyhole-lock-key model forcatalysis by the enzymes with buried active sites, p 421– 464. In Lutz S,Bornscheuer UT (ed), Protein engineering handbook, vol 3. Wiley-VCH,Weinheim, Germany.

54. Schmitt J, Brocca S, Schmid RD, Pleiss J. 2002. Blocking the tunnel:engineering of Candida rugosa lipase mutants with short chain lengthspecificity. Protein Eng 15:595– 601. https://doi.org/10.1093/protein/15.7.595.

55. Kannan N, Vishveshwara S. 2000. Aromatic clusters: a determinant ofthermal stability of thermophilic proteins. Protein Eng 13:753–761.https://doi.org/10.1093/protein/13.11.753.

56. Hong H, Park S, Flores Jiménez RH, Rinehart D, Tamm LK. 2007. Role ofaromatic side chains in the folding and thermodynamic stability ofintegral membrane proteins. J Am Chem Soc 129:8320 – 8327. https://doi.org/10.1021/ja068849o.

57. Hunter CA, Lawson KR, Perkins J, Urch CJ. 2001. Aromatic interactions. JChem Soc Perkin 2 2:651– 669. https://doi.org/10.1039/b008495f.

58. Lanzarotti E, Biekofsky RR, Estrin DA, Marti MA, Turjanski AG. 2011.Aromatic–aromatic interactions in proteins: beyond the dimer. J ChemInf Model 51:1623–1633. https://doi.org/10.1021/ci200062e.

59. Maves SA, Sligar SG. 2001. Understanding thermostability in cytochromeP450 by combinatorial mutagenesis. Protein Sci 10:161–168. https://doi.org/10.1110/ps.17601.

60. Yano JK, Poulos TL. 2003. New understandings of thermostable andpeizostable enzymes. Curr Opin Biotechnol 14:360 –365. https://doi.org/10.1016/S0958-1669(03)00075-2.

61. Mohammadi M, Sepehrizadeh Z, Ebrahim-Habibi A, Shahverdi AR,Faramarzi MA, Setayesh N. 2016. Enhancing activity and thermosta-bility of lipase A from Serratia marcescens by site-directed mutagen-esis. Enzyme Microb Technol 93:18 –28. https://doi.org/10.1016/j.enzmictec.2016.07.006.

62. Rathi PC, Fulton A, Jaeger K-E, Gohlke H. 2016. Application of rigiditytheory to the thermostabilization of lipase A from Bacillus subtilis. PLoSComput Biol 12:e1004754. https://doi.org/10.1371/journal.pcbi.1004754.

63. Li G, Fang X, Su F, Chen Y, Xu L, Yan Y. 2018. Enhancing the thermo-stability of Rhizomucor miehei lipase with a limited screening library byrational design point mutations and disulfide bonds. Appl Environ Mi-crobiol 84:e02129-17. https://doi.org/10.1128/AEM.02129-17.

64. Monsef Shokri M, Ahmadian S, Akbari N, Khajeh K. 2014. Hydrophobicsubstitution of surface residues affects lipase stability in organic sol-vents. Mol Biotechnol 56:360 –368. https://doi.org/10.1007/s12033-013-9716-y.

65. Jubb HC, Higueruelo AP, Ochoa-Montaño B, Pitt WR, Ascher DB, BlundellTL. 2017. Arpeggio: a web server for calculating and visualising inter-atomic interactions in protein structures. J Mol Biol 429:365–371. https://doi.org/10.1016/j.jmb.2016.12.004.

66. Marques SM, Daniel L, Buryska T, Prokop Z, Brezovsky J, Damborsky J.2017. Enzyme tunnels and gates as relevant targets in drug design. MedRes Rev 37:1095–1139. https://doi.org/10.1002/med.21430.

67. Fink MJ, Syrén P-O. 2017. Redesign of water networks for efficientbiocatalysis. Curr Opin Chem Biol 37:107–114. https://doi.org/10.1016/j.cbpa.2017.02.013.

68. Marton Z, Léonard-Nevers V, Syrén P-O, Bauer C, Lamare S, Hult K, TrancV, Graber M. 2010. Mutations in the stereospecificity pocket and at theentrance of the active site of Candida antarctica lipase B enhancingenzyme enantioselectivity. J Mol Catal B Enzym 65:11–17. https://doi.org/10.1016/j.molcatb.2010.01.007.

69. Brouk M, Derry N-L, Shainsky J, Zelas ZB-B, Boyko Y, Dabush K, FishmanA. 2010. The influence of key residues in the tunnel entrance and theactive site on activity and selectivity of toluene-4-monooxygenase. J MolCatal B Enzym 66:72– 80. https://doi.org/10.1016/j.molcatb.2010.03.006.

70. Korman TP, Sahachartsiri B, Charbonneau DM, Huang GL, Beauregard M,Bowie JU. 2013. Dieselzymes: development of a stable and methanoltolerant lipase for biodiesel production by directed evolution. Biotech-nol Biofuels 6:70. https://doi.org/10.1186/1754-6834-6-70.

71. Park HJ, Joo JC, Park K, Yoo YJ. 2012. Stabilization of Candida antarcticalipase B in hydrophilic organic solvent by rational design of hydrogenbond. Biotechnol Bioprocess Eng 17:722–728. https://doi.org/10.1007/s12257-012-0092-4.

72. Tyndall JD, Sinchaikul S, Fothergill-Gilmore LA, Taylor P, Walkinshaw MD.2002. Crystal structure of a thermostable lipase from Bacillus stearother-mophilus P1. J Mol Biol 323:859 – 869. https://doi.org/10.1016/S0022-2836(02)01004-5.

73. Arpigny JL, Jaeger K-E. 1999. Bacterial lipolytic enzymes: classificationand properties. Biochem J 343:177–183. https://doi.org/10.1042/0264-6021:3430177,10.1042/bj3430177.

74. Shiraga S, Ueda M, Takahashi S, Tanaka A. 2002. Construction of thecombinatorial library of Rhizopus oryzae lipase mutated in the lid do-main by displaying on yeast cell surface. J Mol Catal B Enzym 17:167–173. https://doi.org/10.1016/S1381-1177(02)00024-3.

75. Santarossa G, Lafranconi PG, Alquati C, DeGioia L, Alberghina L, FantucciP, Lotti M. 2005. Mutations in the “lid” region affect chain lengthspecificity and thermostability of a Pseudomonas fragi lipase. FEBS Lett579:2383–2386. https://doi.org/10.1016/j.febslet.2005.03.037.

76. Khan FI, Lan D, Durrani R, Huan W, Zhao Z, Wang Y. 2017. The lid domainin lipases: Structural and functional determinant of enzymatic proper-ties. Front Bioeng Biotechnol 5:16. https://doi.org/10.3389/fbioe.2017.00016.

77. Tang L, Su M, Zhu L, Chi L, Zhang J, Zhou Q. 2013. Substitution of Val72residue alters the enantioselectivity and activity of Penicillium expansumlipase. World J Microbiol Biotechnol 29:145–151. https://doi.org/10.1007/s11274-012-1167-2.

78. Shih T-W, Pan T-M. 2011. Substitution of Asp189 residue alters theactivity and thermostability of Geobacillus sp. NTU 03 lipase. BiotechnolLett 33:1841. https://doi.org/10.1007/s10529-011-0635-3.

79. Stepankova V, Damborsky J, Chaloupkova R. 2013. Organic co-solventsaffect activity, stability and enantioselectivity of haloalkane dehaloge-nases. Biotechnol J 8:719 –729. https://doi.org/10.1002/biot.201200378.

80. Burley S, Petsko GA. 1985. Aromatic-aromatic interaction: a mechanismof protein structure stabilization. Science 229:23–28. https://doi.org/10.1126/science.3892686.

81. Georis J, Esteves FDL, Lamotte-Brasseur J, Bougnet V, Devreese B, Gian-notta F, Granier B, Frère J-M. 2000. An additional aromatic interactionimproves the thermostability and thermophilicity of a mesophilic family11 xylanase: structural basis and molecular study. Protein Sci 9:466 – 475.https://doi.org/10.1110/ps.9.3.466.

82. Meurisse R, Brasseur R, Thomas A. 2003. Aromatic side-chain interactionsin proteins. Near-and far-sequence his-X pairs. Biochim Biophys Acta1649:85–96. https://doi.org/10.1016/S1570-9639(03)00161-4.

83. Serrano L, Bycroft M, Fersht AR. 1991. Aromatic-aromatic interactionsand protein stability: investigation by double-mutant cycles. J Mol Biol218:465– 475. https://doi.org/10.1016/0022-2836(91)90725-L.

84. Facchiano AM, Colonna G, Ragone R. 1998. Helix stabilizing factors andstabilization of thermophilic proteins: an X-ray based study. Protein Eng11:753–760. https://doi.org/10.1093/protein/11.9.753.

85. DeLano WL. 2002. The PyMOL molecular graphics system: version 1.3.DeLano Scientific LLC, San Carlos, CA.

86. Battye TGG, Kontogiannis L, Johnson O, Powell HR, Leslie AG. 2011.iMOSFLM: a new graphical interface for diffraction-image processingwith MOSFLM. Acta Crystallogr D Biol Crystallogr 67:271–281. https://doi.org/10.1107/S0907444910048675.

87. Leslie AGW. 1992. Recent changes to the MOSFLM package for process-ing film and image plate data, p 30. Joint CCP4 and ESF-EACMB. news-letter on protein crystallography, no. 26. Daresbury Laboratory, War-rington, United Kingdom.

88. Vonrhein C, Flensburg C, Keller P, Sharff A, Smart O, Paciorek W, WomackT, Bricogne G. 2011. Data processing and analysis with the autoPROCtoolbox. Acta Crystallogr D Biol Crystallogr 67:293–302. https://doi.org/10.1107/S0907444911007773.

89. Incardona M-F, Bourenkov GP, Levik K, Pieritz RA, Popov AN, Svensson O.2009. EDNA: a framework for plugin-based applications applied to X-rayexperiment online data analysis. J Synchrotron Radiat 16:872– 879.https://doi.org/10.1107/S0909049509036681.

90. McCoy AJ, Grosse-Kunstleve RW, Adams PD, Winn MD, Storoni LC, ReadRJ. 2007. Phaser crystallographic software. J Appl Crystallogr 40:658 – 674. https://doi.org/10.1107/S0021889807021206.

91. Adams PD, Afonine PV, Bunkóczi G, Chen VB, Davis IW, Echols N, HeaddJJ, Hung L-W, Kapral GJ, Grosse-Kunstleve RW, McCoy AJ, Moriarty NW,Oeffner R, Read RJ, Richardson DC, Richardson JS, Terwilliger TC, ZwartPH. 2010. PHENIX: a comprehensive Python-based system for macromo-lecular structure solution. Acta Crystallogr D Biol Crystallogr 66:213–221.https://doi.org/10.1107/S0907444909052925.

92. Emsley P, Cowtan K. 2004. Coot: model-building tools for moleculargraphics. Acta Crystallogr D Biol Crystallogr 60:2126 –2132. https://doi.org/10.1107/S0907444904019158.

Tunnel Engineering for Lipase Methanol Stability Applied and Environmental Microbiology

December 2018 Volume 84 Issue 23 e02143-18 aem.asm.org 15

on April 8, 2020 by guest

http://aem.asm

.org/D

ownloaded from