enzymatic dysfunction of mitochondrial complex i …by the im cv to synthesize atp. ci functions...

EUKARYOTIC CELL, May 2011, p. 672–682 Vol. 10, No. 51535-9778/11/$12.00 doi:10.1128/EC.00303-10Copyright © 2011, American Society for Microbiology. All Rights Reserved.

Enzymatic Dysfunction of Mitochondrial Complex I of theCandida albicans goa1 Mutant Is Associated with

Increased Reactive Oxidants and Cell Death�

Dongmei Li,* Hui Chen, Abigail Florentino, Deepu Alex, Patricia Sikorski,William A. Fonzi, and Richard Calderone

Georgetown University Medical Center, Department of Microbiology and Immunology, Washington, DC

Received 3 December 2010/Accepted 3 March 2011

We have previously shown that deletion of GOA1 (growth and oxidant adaptation) of Candida albicans resultsin a loss of mitochondrial membrane potential, ATP synthesis, increased sensitivity to oxidants and killing byhuman neutrophils, and avirulence in a systemic model of candidiasis. We established that translocation ofGoa1p to mitochondria occurred during peroxide stress. In this report, we show that the goa1� (GOA31),compared to the wild type (WT) and a gene-reconstituted (GOA32) strain, exhibits sensitivity to inhibitors ofthe classical respiratory chain (CRC), including especially rotenone (complex I [CI]) and salicylhydroxamicacid (SHAM), an inhibitor of the alternative oxidase pathway (AOX), while potassium cyanide (KCN; CIV)causes a partial inhibition of respiration. In the presence of SHAM, however, GOA31 has an enhancedrespiration, which we attribute to the parallel respiratory (PAR) pathway and alternative NADH dehydroge-nases. Interestingly, deletion of GOA1 also results in a decrease in transcription of the alternative oxidase geneAOX1 in untreated cells as well as negligible AOX1 and AOX2 transcription in peroxide-treated cells. To explainthe rotenone sensitivity, we measured enzyme activities of complexes I to IV (CI to CIV) and observed a majorloss of CI activity in GOA31 but not in control strains. Enzymatic data of CI were supported by blue nativepolyacrylamide gel electrophoresis (BN-PAGE) experiments which demonstrated less CI protein and reducedenzyme activity. The consequence of a defective CI in GOA31 is an increase in reactive oxidant species (ROS),loss of chronological aging, and programmed cell death ([PCD] apoptosis) in vitro compared to control strains.The increase in PCD was indicated by an increase in caspase activity and DNA fragmentation in GOA31. Thus,GOA1 is required for a functional CI and partially for the AOX pathway; loss of GOA1 compromises cellsurvival. Further, the loss of chronological aging is new to studies of Candida species and may offer an insightinto therapies to control these pathogens. Our observation of increased ROS production associated with adefective CI and PCD is reminiscent of mitochondrial studies of patients with some types of neurodegenerativediseases where CI and/or CIII dysfunctions lead to increased ROS and apoptosis.

Candida albicans is a pathogen of skin and mucosa or causesblood-borne tissue invasion. To cause disease, the organismutilizes a variety of factors to adhere to, break down hostsubstrates, and invade tissue. There is also evidence that bothglycolytic and nonglycolytic metabolism is critical to survival ofthe organism in the host, a phenomenon termed host niche-specific metabolic adaptation (9, 14, 21, 41, 50). The paradigmis that when blood-borne glucose is plentiful, cells metabolizeby glycolysis to produce energy. However, at host niches lack-ing sufficient glucose, such as within phagocytes, the organismadapts through other pathways, such as the glyoxylate cycle, tominimize carbon loss, while gluconeogenesis is used to in-crease cell glucose levels. Both cycles include participation ofmitochondria. Carbon source preferences and respiratory cir-cuits vary in usage among fungi and yeasts and reflect their lifestyles. For instance, model yeast depends almost exclusivelyupon fermentation as a source of energy. Saccharomyces cerevi-siae is defined as a Crabtree-positive organism, which utilizes

glucose repression of aerobic respiration, in contrast to others,like Candida albicans, which are Crabtree negative and relyupon the oxidation of substrates via the mitochondrial tricar-boxylic acid (TCA) cycle to generate ATP even in the presenceof glucose (7, 51). In fact, S. cerevisiae lacks complex I (CI) ofthe classical respiratory electron transport chain (ETC) as wellas the alternative oxidase (AOX) and parallel respiratorychains, unlike Candida species (18, 55) (see also below).

There are three mitochondrial respiratory pathways in Can-dida species and other fungi: the classical respiratory chain(CRC), the alternative oxidase chain, and the parallel respira-tory (PAR) chain (12, 18, 26–34, 43–46, 52, 58). Of thesepathways, the CRC provides the largest amount of cellularATP and is the major source of respiratory activity and O2

consumption. In Candida parapsilosis, the AOX and CRCpathways are constitutive while the PAR pathway is active onlywhen the CRC and AOX pathways are blocked (46). Thiscompensatory mechanism may allow the cells to adapt to stressconditions (33). The contributions of each of the three respi-ratory pathways can be distinguished by using specific inhibi-tors. Thus, rotenone, 2-thenoyltrifluoroacetone (TTFA), anti-mycin A (AA), potassium cyanide (KCN), and oligomycininhibit CI, CII, CIII, CIV, and CV, respectively, of the CRC,while SHAM (salicylhydroxamic acid) is an inhibitor of the

* Corresponding author. Mailing address: Georgetown UniversityMedical Center, Department of Microbiology and Immunology, SE305Med-Dent Building, 3900 Reservoir Rd. NW, Washington, DC20057. Phone: (202) 687-1796. Fax: (202) 687-1800. E-mail: [email protected].

� Published ahead of print on 11 March 2011.

672

on July 7, 2020 by guesthttp://ec.asm

.org/D

ownloaded from

http://ec.asm.org/

AOX pathway. KCN at higher concentrations (10 mM) is aninhibitor of both the PAR pathway and of CIV of the CRCpathway. In the CRC pathway, CI, CIII, and CIV oxidoreduc-tases of the inner mitochondrial membrane (IM) produce H�

ions which are pumped to the intermembrane space (IMS).The generation of a membrane potential (��M) is then usedby the IM CV to synthesize ATP. CI functions through coen-zyme Q (CoQ), which serves as an intermediate step for elec-tron flow through CIII and CIV. CoQ also provides electronsfor the AOX and PAR pathways. While the three respiratorypathways have been described in Candida species, less isknown about complexes I to IV of the CRC and about thegenes that are associated with the complex functions. A geneencoding the C. albicans NADH dehydrogenase CI protein(NDH51) when deleted resulted in a filamentation defect evenat low concentrations of glucose (45). More recently, it wasshown that in the same ndh51� mutant, the pyruvate dehydro-genase complex protein X (Pdx1) increased by 15-fold, but thefilamentous defect remained (58). The Lpd1 of C. albicans, adihydrolipomide dehydrogenase and part of the pyruvate de-hydrogenase complex, also is required for filamentous growth(35). These data demonstrate a relationship between the CRCpathway and morphogenesis. Metabolic signal networks im-portant to mitochondrial functions are also inadequately de-scribed although the Hog1 mitogen-activated protein kinase(MAPK) appears significant (5).

In animals, plants, and most fungi, mitochondria are indis-pensable for many cell activities (1, 2, 15, 16, 20, 32, 43, 50, 52,59, 60). It is also evident that programmed cell death (PCD)can be initiated through a number of inducers including ROS,the origin of which can be defective mitochondria, as reportedin both mammalian cells and fungi such as C. albicans (11, 13,15, 16, 25, 26, 36, 48, 52, 54, 59). In contrast, cancer cells favorglycolysis, and therapies that focus upon metabolic reprogram-ming of mitochondria have been applied to induce chemosen-sitivity (19). Other inducers of PCD in fungi include the anti-fungal compounds amphotericin B and plagiochin E, farnesol,phytosphingosine, and the �-pheromone of C. albicans (3, 4,17, 54, 56, 57, 59, 60). Farnesol (a quorum-sensing molecule)induced apoptosis through either metacaspase- or caspase-dependent pathways in C. albicans (60). The amphotericin Beffect was observed in biofilms formed in vitro and could bereversed by the addition of an inhibitor of caspase production(4). Indications are that PCD occurs through apoptosis asdeletion of the MCA1 of C. albicans, a homologue of theMCA1 metacaspase of S. cerevisiae, attenuates the oxidativestress cell death response as well as caspase activation (13). Arecent observation on pheromone-induced death (PID) in C.albicans during mating indicates that the mechanism differsfrom that of S. cerevisiae, which requires calcineurin (3).

In our previous report on Goa1p of C. albicans, we showedits requirement for mitochondrial functions including the gen-eration of membrane potential to provide ATP and respiration(8). Using a green fluorescent protein (GFP)-tagged Goa1p,we demonstrated its translocation to mitochondria, especiallyunder stress conditions or when cells are grown on glycerol.GOA1 is also required for virulence in an invasive model ofcandidiasis (8). The objective of this study is to characterize themitochondrial target of Goa1p of C. albicans and relate the

loss of that target to cell functions. It is obvious that dysfunc-tional mitochondria result in profound effects on this fungus.

MATERIALS AND METHODS

Strains. For all experiments, we used SC5314 (wild type [WT]) as well as thegene-reconstituted strain (GOA32) and the goa1 mutant (GOA31) (8).

Growth studies of strains with CRC and AOX inhibitors. For drop plateassays, strains were grown overnight at 30°C in YPD (yeast extract, peptone,dextrose) broth; cells were washed and suspended in phosphate-buffered saline([PBS] 0.1 M; pH 7.4) (8). The sensitivity of strains to inhibitors of complexes Ito V and to AOX was evaluated as follows. Serial dilutions of cells (5 � 101 to5 � 105 cells in 5 �l) were spotted onto YPD agar containing each inhibitor (1�M rotenone, 6 �M TTFA, 8 �M antimycin A, 1 or 10 mM KCN, 20 �Moligomycin, and 2 mM SHAM [final concentrations]). Growth was evaluatedafter 48 h of incubation at 30°C.

Oxygen consumption. Oxygen consumption was measured polarographicallyusing a Clark-type electrode (model 5300; Yellow Springs Instruments, OH).Cells were grown overnight at 30°C in 10 ml of YPD broth and then diluted infresh YPD broth for an additional 3 to 4 h until exponential growth was achieved(32). The cells were collected and washed with PBS, and an equal number of cellsof each strain (5 � 108) was suspended in 2 ml of YPD broth. The cells were thenloaded into a sealed 1.5-ml glass chamber. Changes in oxygen tension in thechamber were measured, and the respiratory rate was calculated as the consump-tion of oxygen over time. In order to quantify oxygen consumption by differentrespiratory pathways, strains were cultured in the presence of classical respira-tory pathway inhibitors (6 �M TTFA, 10 �M rotenone, 10 �M antimycin A, orpotassium cyanide [1 or 10 mM]) for 1 h while the AOX pathway was inhibitedusing 5 mM SHAM before cells were harvested, and O2 consumption wasdetermined. Also, 200 �M flavone was used to measure the contribution ofNADH dehydrogenases to respiration (57).

Transcription of AOX1, AOX2, and alternative NADH dehydrogenases, NDE1and YMX6. Yeast cells were collected from 10-ml cultures of the WT, GOA31,and GOA32 strains grown at 30°C for 16 h in YPD broth. Cells were washedtwice with PBS and divided into three equal aliquots, two of which were treatedwith 5 mM H2O2 or 5 mM SHAM for 30 min while the third was left untreatedfor the same time. Total RNA was extracted using Trizol following a PBS wash.For H2O2- and SHAM-treated samples, cells were washed two additional timeswith PBS. The quality and concentration of RNAs were measured by a nano-spectrophotometer, and approximately 1 �g of the total RNA was subjected tofirst-strand cDNA synthesis (QuantiTect Reverse Transcription; Qiagen). Real-time PCR assays were performed with 20-�l reaction volumes that contained 1�iQ SyBR green Supermix, including a 0.2 �M concentration of each primer and8 �l of a 1:8 dilution of each cDNA from each strain. A standard curve for eachgene was established from WT cells grown at 30°C. WT cDNA was prepared ina series of dilutions (1:4 to 1:256) for each experiment. The primers used forreal-time PCR expression analysis were the following: for 18S rRNA, CGCAAGGCTGAAACTTAAAGG (forward) and AGCAGACAAATCACTCCACC(reverse); for AOX1, GCAACTCCAATCCCAAATCAC (forward) and ACACGATAAACTCCTGCTTCAG (reverse); for AOX2, TCTCCAGCTTTCCATCAACC (forward) and TGGGTAACTGTCACATTCTCAC (reverse) (30, 31);for NDE1, TGCTAACCCAACTCCAAAGG (forward) and CCAGACCAAATCAGCAACAG (reverse); for YMX6, CATCCAACGACCCTAAGATCC (for-ward) and AATGTTCAGCCACCCCAG (reverse).

Quantitative reverse transcription-PCR (qRT-PCR) for each experiment wasperformed in triplicate (Bio-Rad iQ5), and the transcription of AOX1, AOX2,NDE1, and YMX6 genes was normalized to 18S RNA levels. Data are presentedas the means � standard deviations (SD). The 2��CT (where CT is thresholdcycle) method of analysis was used to determine the fold change in gene tran-scription (31).

Spheroplast and mitochondrial preparations. Cells were grown in 250 ml ofYPD broth overnight at 30°C, harvested by centrifugation (5,000 rpm for 10min), washed once with 50 ml of cold water and once with buffer A (1 M sorbitol,10 mM MgCl2, 50 mM Tris-HCl [pH 7.8]), and then centrifuged at 5,000 rpm for10 min.

Cells were then suspended in buffer A (50 ml) supplemented with 30 mMdithiothreitol (DTT) for 15 min at room temperature with shaking (100 rpm) andthen collected and suspended in 15 ml of buffer A with 1 mM DTT containing100 mg of Zymolyase 20T (Seikagaku Biobusiness, Inc.) per 15 g of pelleted cells.Shake cultures (100 rpm) were incubated at 30°C for 60 min or until 90% of cellswere converted into spheroplasts (as determined by light microscopy). Digestionwas stopped by adding 15 ml of ice-cold buffer A. Then spheroplasts were washedtwice with buffer A. Crude preparations of mitochondria were isolated as follows:

VOL. 10, 2011 C. ALBICANS GOA1 IN MITOCHONDRIAL FUNCTIONS 673


.org/D

ownloaded from

http://ec.asm.org/

spheroplasts were suspended in 10 ml of cold buffer B (0.6 M mannitol, 1 mMEDTA, 0.5% bovine serum albumin [BSA], 1 mM phenylmethylsulfonyl fluoride[PMSF], 10 mM Tris-HCl [pH, 7.4]) and then broken mechanically using aDounce homogenizer on an ice bath (18). Cell debris was removed by low-speedcentrifugation (1,000 � g for 10 min). The supernatants containing mitochondriawere centrifuged at 10,500 � g for 10 min, and the pellet was washed twice with20 ml of ice-cold buffer C (0.6 M mannitol, 1 mM EDTA, 1% BSA, 10 mMTris-HCl [pH 7.0]). Mitochondria were suspended in 1 ml of buffer D (0.6 Mmannitol, 10 mM Tris-HCl, [pH 7.0]), and the protein content was determined bythe Biuret method.

Purification of mitochondria. Mitochondrion purification was performed us-ing a two-step gradient according to standard procedures (10, 53). Two millilitersof PB1 buffer (0.3 M mannitol, 10 mM TES [N-tris(hydroxymethyl)methyl-2-aminoethanesulfonic acid], 0.1% [wt/vol] BSA, pH 7.5) containing 30% (vol/vol)Percoll was placed at the bottom of a centrifugation tube (Beckman, Inc.). Then,2 ml of PB2 buffer (0.3 M sucrose, 10 mM TES, 0.1% [wt/vol] BSA, pH 7.5)containing 20% Percoll (vol/vol) was layered on top of PB1 buffer. The crudemitochondrial preparation was layered on top of the gradient, which was thencentrifuged at 40,000 � g for 45 min at 4°C. A whitish band (purified mitochon-dria) was collected from the interface of the Percoll gradients. Purified mito-chondria were washed twice by centrifugation in 3 ml of PB1 buffer for 10 minat 12,600 � g.

Mitochondrial pellets were suspended in 1 ml of cold S1 buffer (272 mMsucrose, 40 mM HEPES, 150 mM KCl, pH 7.5), incubated on ice for 15 min,diluted with 5 ml of S2 buffer (40 mM HEPES, 150 mM KCl, pH 7.5), andcentrifuged at 100,000 � g for 30 min. The pellets were suspended in cold S3buffer (solubilization medium; 750 mM 6-aminohexanoic acid [ε-amino-n-ca-proic acid], 50 mM bis-Tris-HCl, 0.5 mM EDTA, pH 7.0) at a concentration of2 mg of protein/ml. Freshly prepared 10% (wt/vol) n-dodecyl--D-maltoside(DMM) in water (200 �l) was added at a ratio of 1 g of detergent to 1 g ofprotein. The pellets were homogenized by repeated pipetting on ice for 5 minand centrifuged at 108,000 � g for 10 min at 4°C. Supernatants were collected,and protein determinations were done by the Biuret method and blue nativepolyacrylamide gel electrophoresis (BN-PAGE) (see below). Coomassie stainingwas also used to visualize proteins.

Enzymatic assays of CRC CI to CIV. From overnight cultures grown at 30°C,enzyme activities of complexes I to IV (CI to CIV) were measured spectropho-tometrically by standard methods (10, 38). Crude mitochondrial preparationswere first treated with two cycles of freeze-thawing in a hypotonic solution (25mM K2HPO4 [pH 7.2], 5 mM MgCl2), followed by a hypotonic shock in H2O. Atotal of 20 �g of mitochondrial protein from each strain was used in each enzymeassay. Substrates (electron donor and electron acceptor) varied depending uponwhich complex was to be assayed. The reaction for each enzymatic assay wasterminated by adding a complex-specific inhibitor. The activities for each com-plex were indicated by the rate of substrate oxidation or reduction as nM/min/mgof protein. Each complex was assayed in the presence of inhibitors of othercomplexes to ensure that the activity reflected only the enzyme complex ofinterest.

Complex I (NADH:ubiquinone oxidoreductase). Mitochondrial protein wasdissolved in 0.8 ml of H2O and incubated for 2 min at 37°C and then mixed with0.2 ml of a solution containing 50 mM Tris, pH 8.0, 5 mg/ml BSA, 0.24 mM KCN,4 �M antimycin A, and 0.8 mM NADH, the substrate for CI. The reaction wasinitiated by introducing an electron acceptor, 50 �M DB (2,3-dimethoxy-5-methyl-6-n-decyl-1,4 benzoquinone). Enzyme activity was followed by a decreasein absorbance of NADH at 340 nm minus that at 380 nm using an extinctioncoefficient of 5.5 mM�1 cm�1 (38). Additionally, rotenone (4 �M) was intro-duced into the reaction mixture to quantify the rotenone-sensitive complexactivity.

Complex II (succinate:ubiquinone oxidoreductase). Mitochondrial proteinwas added to a solution of 10 mM KH2PO4 (pH 7.8), 2 mM EDTA, 1 mg/mlBSA, 80 �M DCPIP (acceptor; 2,6-dichlorophenolindophenol), 4 �M rotenone,0.24 mM KCN, 4 �M antimycin A, and 0.2 mM ATP (total of 1 ml). As the donorsubstrate, 10 mM succinate was added, and the reaction mixture was incubatedfor 10 min at 30°C. A decrease in absorbance due to the reduction of DCPIP wasmeasured at 600 nm for 5 min using an extinction coefficient of 13.0 mM�1 cm�1.To measure CII-specific activity, 1 mM TTFA (thenoyltrifluoroacetone) wasadded.

Complexes II and III (succinate:cytochrome c reductase). The assay for CIIplus CIII was done under conditions similar to those for CII described aboveusing 10 mM succinate as the donor substrate. The reaction was initiatedfollowing the addition of 40 �M oxidized cytochrome c (incubation, 10 min at30°C), followed by the addition of 1 mM TTFA for an additional 5 min. The

extinction coefficient for cytochrome c reduction at 550 nm is 18.5 mM�1

cm�1 (9).Complex IV. The CIV assay was performed at 550 nm, and the decrease in

absorbance resulting from the oxidation of reduced cytochrome c was measured.To reduce cytochrome c, 5 mg of L-ascorbic acid was mixed with 100 mg ofcytochrome c in 8 ml of 10 mM potassium phosphate buffer, pH 7.0. The reducedcytochrome c solution was then dialyzed against 10 mM potassium phosphatebuffer, pH 7.0, for 20 h at 4°C with three changes of buffer. Reduced cytochromec was then brought to a final volume of 10 ml with 0.1 M phosphate buffer (pH6.8). In a 1-ml reaction medium, 20 �g of mitochondrial protein was added to abuffer containing 10 mM KH2PO4 (pH 6.5), 0.25 M sucrose, 1 mg/ml BSA, and10 �M reduced cytochrome c. Changes in absorbance were measured followingthe oxidation of cytochrome c using 2.5 mM lauryl maltoside to permeabilizemitochondria. Complex specificity was determined in the presence of 0.24 mMKCN (3 min for each part of the assay).

Blue native polyacrylamide gel electrophoresis. Mitochondrial protein wasconcentrated by vacuum centrifugation (53). Ten microliters of BN sample buffer(2�) was mixed with 20 �l of each sample (60 to 80 �g of protein) and loadedonto a BN-PAGE gradient gel (4 to 16%) (Invitrogen, Inc.). One ml of 2� BNsample buffer consisted of 1.5 M 6-aminohexanoic acid, 0.05 M bis-Tris (pH 7.0),65 �l of 10% DMM, 20 �l of proteinase inhibitor mixture, and 100 �l of glycerol.Electrophoresis was performed in an X-Cell SureLock mini-cell system (Invit-rogen) with 200 ml of cathode buffer in the upper (inner) buffer chamber and 150ml of anode buffer in the lower (outer) buffer chamber. The cathode buffer wasprepared from a 10� stock of 500 mM Tricine, 150 mM bis-Tris (pH 7.0; or 75mM imidazole), and 0.02% Serva Blue G-250, supplemented with 0.02% DDM.The 1� anode buffer consisted of 50 mM bis-Tris, pH 7.0. Electrophoresis wascarried out at 4°C and 65 V for 1 h and then raised to 120 V overnight. An in-gelenzyme assay for CRC CI was accomplished as follows: gels were rinsed brieflytwice with MilliQ water and equilibrated in 0.1 M Tris-HCl, pH 7.4 (reactionbuffer), for 20 min. The gels were then incubated in fresh reaction buffer with 0.2mM NADH–0.2% nitroblue tetrazolium (NBT) for 1 h. Reactions were stoppedby fixing the gels in 45% methanol–10% (vol/vol) acetic acid, and then gels weredestained overnight in the same solution. Image processing of gels was doneusing ImageJ software (23).

Flow cytometry assays of ROS. Intracellular ROS production was detected bystaining cells with the ROS-sensitive fluorescent dye DCFDA (2�,7�-dichloro-fluorescein diacetate; Sigma) using a FACScan flow cytometer (488 nm; BectonDickinson) (36). Cells from 25-ml cultures grown at 30°C overnight in YPDmedium were collected and washed twice with PBS. The pellets were suspendedto 1 � 106 cells in 1 ml of PBS and treated with or without 50 �M DCFDA for30 min at 30°C in the dark. Cell fluorescence in the absence of DCFDA was usedto verify that background fluorescence was similar per strain. Cells from eachDCFDA-treated sample were collected and washed twice with PBS after stain-ing. Then, propidium iodide (PI) was added to each sample to measure the deadcells prior to the DCFDA assays. The mean fluorescence for ROS was quantifiedonly in live and standard-sized cells.

Chronological life span. Strains were inoculated in 5 ml of YPD broth andincubated overnight at 30°C. For each strain, 106 cells were inoculated into 50 mlof synthetic glucose (SC) medium without or with 5 mM H2O2 (final concentra-tion) (2). For treated cultures, H2O2 was added daily to maintain concentration.Every 24 h for 21 days, 0.5 ml from each culture was diluted to 2.0 � 103 cells/ml,and 100-�l and 250-�l aliquots were added to YPD agar plates. The plates wereincubated for 48 h at 30°C, and the numbers of CFU were determined. For eachstrain and time point, the percent survival was determined by dividing thenumber of CFU by the cell number obtained by microscopic counts. The per-centage of viable cells reflecting the chronological life span was determined foreach time point.

Determinations of apoptosis in strains by flow cytometry. (i) Caspase assay.Caspase activity was measured using a FLICA (for fluorochrome-labeled inhib-itor of caspases) Poly-Caspase Apoptosis Detection Kit (ImmunochemistryTechnologies, LLC) based on FAM-VAD-FMK (where FAM is carboxyfluores-cein and FMK is fluoromethyl ketone), which binds covalently to active caspasesonce it enters cells. After unbound FAM-VAD-FMK or FLICA reagent iswashed away, the remaining green fluorescent signal is a direct measure of thequantity of caspase-positive cells. The optimal excitation range for FLICA is 488to 492 nm, and the emission range is 515 to 535 nm.

Activity was measured at zero time (overnight cultures; control), and cellswere grown or incubated for a period equivalent in time to 10 or 20 generationtimes (GT) in YPD medium or for 2 and 10 generations in cells treated with 10mM H2O2. Cells were washed with PBS twice prior to the caspase assays. Foroptimal FLICA labeling in C. albicans, cells were adjusted to 2 � 106 in 300 �lof PBS buffer, and 10 �l of 30� FLICA solution was added. Cells were incubated

674 LI ET AL. EUKARYOT. CELL


.org/D

ownloaded from

http://ec.asm.org/

for 1 h at 37°C in the dark and then washed twice with 1 ml of the wash bufferrecommended by the manufacturer. Stained cells were suspended in 400 �l of thesame wash buffer and treated with 2 �l of propidium iodide (200 �g/ml) for 20min at room temperature. A second aliquot of FLICA-treated cells that was notstained with PI was set aside. The percentage of cells with positive PI stainingand negative caspase staining by flow cytometry was excluded from caspasemeasurements. An equal volume of nonstained cells for each time point was setup as a negative control for each experiment.

(ii) TUNEL assays. In addition to caspase assays, we also measured theterminal deoxynucleotidyltransferase-mediated dUTP-biotin nick end labeling(TUNEL) in the same set of strains. The TUNEL assay includes a terminaldeoxynucleotidyltransferase (TdT) that adds Br-dUTP (bromolated dUTP nu-cleotides) to DNA breaks. The incorporation of Br-dUTP results in a greenfluorescent signal (fluorescein isothiocyanate [FITC]) once anti-bromodeoxy-uridine (BrdU) antibody is added. An Apo-BrdU in situ DNA fragmentationassay kit (BioVision) was used to identify DNA strand breaks.

Measurements of TUNEL utilized cells of each strain for similar numbers ofgeneration times as used in the caspase assays. Equal numbers of cells for eachstrain were used in the assays. Cells were grown as indicated above for caspaseassays, again with or without peroxide. Cells were washed with PBS twice, andone half of the total was treated with 10 mM H2O2. Cell numbers were adjustedto 5 � 106 in 0.5 ml of PBS buffer and fixed by adding 5 ml of 1% (wt/vol)p-formaldehyde in PBS on ice for 15 min. After cells were washed twice in PBS,the pellets were suspended in 0.5 ml of PBS and 5 ml of ice-cold 70% ethanol andincubated for 30 min on ice. The residual ethanol was then removed by centrif-ugation, and cells were washed twice with buffer. Pelleted cells (5 � 106) weresuspended in 50 �l of DNA labeling solution, incubated for 1 h at 37°C in thedark, and then washed twice with 1 ml of rinse buffer provided in the kit. Treatedcells were suspended again in 0.1 ml of anti-BrdU antibody and incubated for 30min at room temperature in the dark. Immediately, the positively stained cellswere measured by flow cytometry (excitation wavelength/emission wavelength,488/520 nm). An equal volume of nonstained cells was used as a negative control.PI staining was used to determine the percentage of dead cells.

RESULTS

Drop plate assays: GOA31 is sensitive to rotenone andSHAM inhibitors of mitochondrial respiratory pathways. Wetested each strain for sensitivity to inhibitors of the CRC andAOX respiratory pathways using drop plate assays with andwithout inhibitors. As shown in Fig. 1, GOA31 was more sen-sitive to rotenone (CI) than WT and GOA32 (GOA1-recon-stituted) cells but about equally as sensitive as control strains toantimycin A (CIII), TTFA (CII inhibitor), and oligomycin (CV

inhibitor). Interestingly, GOA31 grew somewhat better in thepresence of 1 mM KCN (CIV inhibitor) but was growth inhib-ited at 10 mM KCN. At this concentration, both the CIV andPAR pathways are inhibited. GOA31 was also more sensitiveto SHAM, an inhibitor of the AOX pathway, than the controlstrains (Fig. 1). These inhibitor sensitivity data suggest that themutant has a dysfunctional CI and CIV and AOX pathway.

Oxygen consumption is reduced in GOA31 by CRC CI andCIV inhibitors. Ruy et al. have shown that the CRC and AOXpathway inhibitors that reduce respiration also inhibit growthin C. albicans (52). Therefore, our objective in these experi-ments was to correlate the growth data from drop plate assays(Fig. 1) with oxygen consumption experiments. To do this, wemeasured oxygen consumption (nM O2 consumption/min/ml/Klett unit) in all strains using inhibitors of the CRC and AOXrespiratory pathways, as well as the NADH dehydrogenasesNde1p and Ymx6p. For the wild type and GOA32 strains, it isapparent that when cells are treated with each inhibitor of theCRC pathway, oxygen consumption drops significantly com-pared to untreated conditions (Table 1). For all three strains,rotenone (CI inhibitor) caused a greater reduction in respira-tion than all other inhibitors. The sensitivity to rotenone isapproximately two times greater than that of KCN comparedto untreated GOA31 cells. Strain GOA31 respires at about 18to 20% of the levels of the WT and the GOA32 strains inuntreated cultures (Table 1). Likewise, rotenone caused themost inhibition in O2 consumption in GOA31 (100-fold re-duction compared to untreated cells) while 1 mM KCN re-duced respiration by about 50%, suggesting deficiencies inCRC CI and CIV. In comparison, when cells were treated withthe AOX inhibitor SHAM, respiration in WT and GOA32decreased by about 30 to 50% compared to untreated cells, butfrom GOA31 cells, in the presence of SHAM, oxygen con-sumption doubled compared to untreated GOA31 cells. Thisobservation suggests a compensatory mechanism under theseconditions that could be due to the PAR pathway since boththe CRC and AOX pathways in GOA31 cells appear compro-mised in cultures, as indicated by the introduction of the AOX

FIG. 1. Drop plate assays. All strains were grown in YPD agar with or without inhibitors of complexes I to V (CI to CV) and the AOX pathwayat the cell concentrations indicated. The concentration of each inhibitor is also shown. Cultures were incubated for 48 h and photographed. GOA31(goa1�/goa1�) is more sensitive than control strains to the CI CRC and the AOX pathway inhibitors.



.org/D

ownloaded from

http://ec.asm.org/

inhibitor SHAM. The PAR pathway is believed to be engagedwhen the AOX and CRC pathways are not, as described in C.parapsilosis (46). In addition, inhibition of the compensatoryincrease in respiration in GOA31 by flavone in SHAM-treatedcells was observed (Table 1), suggesting that the NADH de-hydrogenases may be associated with the compensatory effect.Further, KCN does abrogate the compensatory reaction, sug-

gesting that CIV is contributory to the compensatory reaction.Also, the combination of TTFA and flavone reduced respira-tion by 50% in GOA31 compared to levels in control strains,indicating that a CI defect is responsible for the reduced res-piration in the absence of inhibitors.

Thus, in GOA31, the PAR pathway may take on increasedimportance in maintaining respiratory capacity. Still, growth ofGOA31 is considerably reduced by SHAM in drop plates, soour data with GOA31 do not always support the paradigm thatrespiration inhibitors also affect growth. But there is evidencethat in the case of rotenone, growth and respiration are con-siderably affected. We address the rotenone data in experi-ments with CI below.

Transcription of AOX1, AOX2, and the NDE1 and YMX6NADH dehydrogenases. To explain the increased respiration inGOA31 and poor growth in drop plate assays (Fig. 1) in thepresence of SHAM, we also measured AOX1 and AOX2 tran-scription by quantitative PCR (qPCR) (30, 31). However, in C.albicans there are also two alternative NADH dehydrogenaseorthologs (NDE1 and YMX6) of the S. cerevisiae NDE1 andNDI1 that could account for the compensatory increase inrespiration (42). Thus, transcription of each gene was followedin untreated strains as well as in strains treated with 5 mMH2O2 and SHAM (Fig. 2 and 3).

For cells grown for 30 min in the absence of H2O2, tran-scription of AOX1 and AOX2 is similar in the WT and GOA32strains, but in GOA31 AOX1 but not AOX2 is significantly

TABLE 1. Consumption of oxygen for C. albicans WT, GOA31,and GOA32 strains in the presence of ETC inhibitors

ETC inhibitor

Oxygen consumption in the indicated strain(nmol/min/ml/Klett unit)

WT GOA31 GOA32

No inhibitor 309.6 � 43.0 61.1 � 10.8 320.8 � 37.010 �M Rotenone 17.6 � 1.05 0.6 � 0.3 10.8 � 3.0810 �M AA 58.6 � 10.5 46.0 � 12.0 55.2 � 13.51 mM KCN 59.58 � 3.0 32.43 � 4.12 58.16 � 10.0110 mM KCN 41.66 � 3.4 25.66 � 3.56 45.37 � 3.862 mM Na3N 62.6 � 13.0 47.1 � 10.0 54.1 � 8.015 mM SHAM 165.7 � 28.3 148.0 � 25.6 204.5 � 36.65 mM SHAM �

1 mM KCN65.64 � 4.63 46.97 � 3.56 67.26 � 8.69

6 �M TTFA 83.04 � 10.63 52.88 � 4.53 90.41 � 15.33200 �M Flavone 89.49 � 5.24 63.96 � 8.67 99.09 � 18.866 �M TTFA �

200�M flavone82.70 � 3.86 42.75 � 3.78 80.60 � 2.63

5 mM SHAM �200�M flavone

60.23 � 7.53 39.90 � 5.21 67.18 � 8.51

FIG. 2. Transcription of the AOX genes of C. albicans (AOX1 and AOX2) in WT, GOA31 (goa1�/goa1�), and GOA32 (GOA1/goa1�) strains.Data are presented as the mean fold change (2��CT) � SD. All experiments were performed in triplicate. **, P � 0.001, GOA31 versus WT orGOA32. Overnight cultures were used for RNA extraction. Growth media are indicated. Peroxide or SHAM was added for an additional 30 minprior to extraction.



.org/D

ownloaded from

http://ec.asm.org/

reduced (Fig. 2A). Interestingly, in peroxide-treated cells,AOX1 but not AOX2 increases 2- to 3-fold in WT and GOA32cells while transcription of both genes in GOA31 could not bedetected (Fig. 2B). These data also indicate an important rolefor Aox1p and Aox2p in adaptation of peroxide-stressed cells.In SHAM-treated WT and GOA32 cells, both AOX1 andAOX2 expression slightly increased but not in GOA31 cells(Fig. 2C). We believe that the reduction of AOX1 in untreatedcells and of AOX1 and AOX2 in peroxide-stressed cells inGOA31 is a direct consequence of the loss of GOA1.

Transcription levels of NDE1 and YMX6 were similar in bothparental and GOA32 strains with or without peroxide orSHAM treatments (Fig. 3A and B). However, in GOA31,transcription of both genes was greater than in control strainsin untreated or peroxide-treated cells, but it was reduced inSHAM-treated cells. Nevertheless, transcription of both genesoccurred in GOA31. This observation together with the reduc-tion in the respiration-compensatory increase in GOA31 byflavone (Table 1) suggests that Nde1p and Ymx6p may partic-ipate in the compensatory augmentation of respiration inSHAM-treated cells.

Complex I activity is decreased in the goa1� mutant(GOA31). To understand which of the complexes of the CRCpathway is (are) defective enzymatically and to validate theinhibitor data described above, we assayed each complex (CIto CIV) enzymatically. Previously, we had shown that GOA31compared to control strains had a negligible mitochondrialmembrane potential and reduced ATP synthesis, which couldpoint to reduced activity of CI, CIII, and/or CIV during respi-ration (8). Based upon our observations of inhibitor studies, wepursued experiments to determine the enzymatic activity ofcomplexes I to IV (Table 2). CV was not assayed since growthinhibition of strain GOA31 was not observed with oligomycin(Fig. 1). Our data indicate that the specific activity of CI (nM/min/mg of protein) of GOA31 was decreased by about 80%compared activity in WT cells, while CII, CIII, and CIV activ-ities ranged from 0 to 20% less in GOA31 than in WT cells(P � 0.001, GOA31 versus wild-type cells for CI). These assayswere done with total mitochondrial protein from each strain incontrast to experiments described below, which were per-formed with CI protein only. We believe that the marginal

effect of GOA1 deletion on CII, CIII, and CIV activity isrelated to the severe loss of CI activity that may affect down-stream complexes. Strain GOA32 had specific activities for allcomplexes that ranged from 90 to 100% of wild-type cells(Table 2).

BN-PAGE. CI was also evaluated in GOA31 and controlstrains for both quantity (Coomassie staining) and enzymeactivity by blue native polyacrylamide gel electrophoresis(BN-PAGE) (Fig. 4). We determined that CI is reduced inamount by 80 to 85% in GOA31 cells compared to the geldensity ratios of CI/CIII and CI/CV to WT or GOA32 cellsby ImageJ (Fig. 4A). Also, the in situ assay of CI enzymeactivity demonstrated that strain GOA31 was reduced byapproximately 85% compared to control strains (Fig. 4B).Of importance, the specific activity of CI is the same in WTcells as in GOA32 cells (Fig. 4A and B, compare the proteincontent and enzyme activity). This observation could implyseveral roles for Goa1p including a regulatory activity. Thus,by cell-based assays (Fig. 1 and Table 1), protein content, orenzymatic assays, our data support the hypothesis thatGOA31 has an apparent defect in CI.

ROS production is increased in GOA31. Dysfunction ofCRC activity, especially CI and CIII in human neurodegenera-tive diseases and CI in fungi, is associated with an increase incell ROS (2, 11, 15, 17, 40, 49). Therefore, to determine if asimilar effect occurs in GOA31, a quantitative flow cytometryassay to measure total cell ROS of all strains was employed.The fluorescent dye 2�,7�-dichlorofluorescein diacetate(DCFDA) is widely used in both mammalian and fungal cells

FIG. 3. Transcription of the alternative NADH dehydrogenases NDE1 and YMX6 in strains of C. albicans. Cells were either not treated(control) or treated with 5 mM H2O2 for 30 min; RNA was extracted, and qPCR was performed using primers described in Materials and Methods.GOA31 (goa1�/goa1�) cells show higher expression in untreated and peroxide-treated cells than control cells but smaller increases followingSHAM treatment.

TABLE 2. GOA31 of C. albicans has dysfunctional CI activity

CRC complex

Specific activity in the indicated strain(nM/min/mg of protein)a

WT GOA31 GOA32

I 1,470 � 80 320 � 55* 1,380 � 88II 1,640 � 23 1,340 � 100 1,410 � 105II � III 1,480 � 66 1,180 � 68 1,480 � 71IV 170 � 34 150 � 12 170 � 20

a �, P � 0.001, GOA31 versus the WT and GOA32 strains.



.org/D

ownloaded from

http://ec.asm.org/

to measure intracellular ROS. Once the compound diffusesinto cells, it is hydrolyzed into 2�,7�-dichlorofluorescein(DCFH) by cell esterases and accumulates in viable cells. Asshown in Fig. 5, the level of ROS was dramatically increased by7-fold in strain GOA31 compared to WT and GOA32 levels.The small amount of ROS in stationary-phase cells of WT andGOA32 strains may reflect an adaptation by regulatory mech-anisms that include Goa1p either directly or indirectly.

Chronological life span is decreased in GOA31. Increasedamounts of cell ROS as a result of defective CI induces apop-tosis in mammalian and fungal cells (2, 11, 15, 25, 36, 37, 54,56). To explore this possibility in C. albicans, a suspension of106 cells/ml in SC broth was prepared and incubated with or

without 5 mM H2O2. In treated cultures, we maintained highlevels of H2O2 content by daily replenishing the medium withthis oxidant. At daily intervals for 21 days, aliquots of cells werecounted and plated on YPD medium to determine the numberof CFU of each strain. In untreated cells, within 2 to 3 days, theviability of GOA31 was reduced by 50%, while that ofGOA32 and WT cells remained high, at 80 to 90% (Fig. 6A).At 6 to 7 days of incubation, we could not detect any viablecells of GOA31, in contrast to control strains, which retained aviability of 80 to 90%. Viability of GOA32 began to decreasesignificantly at about 11 to 12 days while wild-type cells re-mained about 80% viable until 18 days, and then this propor-tion steadily decreased. These data indicate that loss of chro-nological life span (decreased viability) of GOA31 is associatedwith an increased level of cell ROS (Fig. 5). Interestingly, lossof viability in all strains treated with H2O2 was equal to that inuntreated cells (Fig. 6B). Our interpretation of these data isthat cell levels of ROS were already high in GOA31 comparedto levels in WT and GOA32 cells so that the addition of H2O2

did not cause a change in chronological life span profiles.Further, WT and GOA32 cells adapted to added peroxide. Todirectly demonstrate that the association of ROS increaseswith a decrease in chronological life span, we treated cells ofGOA31 with the antioxidant N-acetyl cysteine ([NAC] 30mM), which was added several times during the experiment.We found that compared to survival of untreated cells, survivalof GOA31 persisted at about 30% through 10 days and thenbegan increasing thereafter (Fig. 6C).

FIG. 4. BN-PAGE electrophoresis of C. albicans CRC complex proteins in WT, GOA31 (goa1�/goa1�), and GOA32 (GOA1/goa1�) cells.(A) Coomassie stain of purified proteins of CI to CIV. Equal concentrations of total mitochondrial proteins from all strains were separated byBN-PAGE and stained accordingly. CI is significantly reduced in GOA31 compared to levels in the matched set of control strains, WT and GOA32.The molecular markers indicated on the left side are NativeMark (unstained protein standard; Invitrogen). (B) The in-gel enzyme activity of CIin BN-PAGE was assayed within 60 min after incubating the gel in reaction medium (0.1 M Tris-HCl, pH 7.4, 0.2 mM NADH as a substrate, and0.2% NBT). Less CI enzyme activity in the GOA31 (goa1�/goa1�) strain was observed with NBT than in the WT and GOA32 (GOA1/goa1�)strains.

FIG. 5. ROS production in strains. Cells were obtained from over-night-grown cultures, washed twice with PBS, and incubated withDCFDA, which specifically reacts with ROS in viable cells. We showthat ROS in GOA31 (goa1�/goa1�) was increased but not in the WTor GOA32 (GOA1/goa1�) strain (**, P � 0.001).



.org/D

ownloaded from

http://ec.asm.org/

Apoptosis is increased in GOA31. To determine if the de-crease in viability in GOA31 is related to programmed celldeath, we measured caspase activity (Fig. 7). For untreatedcells, caspase activity was determined in cell populations at 0(control), 10, or 20 generation times (GT) (8). Our data indi-cate that the levels of caspase were increased in GOA31 at alltime points compared to levels in the WT and GOA32 strains,which produced negligible caspase activity (Fig. 7A). The dif-ference in caspase activity of GOA31 at 10 and 20 GT was notstatistically significant. The addition of H2O2 to cultures didnot influence the level of caspase at 2 and 10 GT (Fig. 7B). Italso appears that significant apoptosis as determined bycaspase activity had already occurred in overnight washed cul-tures of GOA31 (zero time; control cultures).

TUNEL assays were also established to verify that apoptosishad increased in GOA31 (Fig. 8). In unstressed cells (0, 10, and20 GT), in WT or GOA32, TUNEL assays verified a low levelof apoptosis in untreated or treated cultures, while that ofGOA31 exhibited high levels by 10 and 20 cell generations(Fig. 8A). In cells treated with H2O2, again only strain GOA31showed a marked increase in TUNEL activity at 10 generations

(Fig. 8B). Importantly, propidium iodide staining, which mea-sures necrotic cells, was quite low, in the range of 1 to 2%.

DISCUSSION

Mitochondrial dysfunctions: general considerations. In WTcells of C. albicans, C. parapsilosis, and other fungi, the primaryrespiratory pathway in regard to energy formation and O2

consumption appears to be the CRC (28, 29, 46). The AOXand PAR pathways consume less oxygen and generate lessATP. Although the AOX pathway has been suggested as acompensatory mechanism in case of CRC failure, other dataindicate that both the CRC and at least AOX1 are constitu-tively expressed in fungi (28, 29, 31, 46). S. cerevisiae has threealternative NADH dehydrogenases (NdeI, Nde2, and Ndi1)that oxidize cytosolic NADH and participate in NADH-depen-dent mitochondrial respiration but do not translocate protonsand are only partially sensitive to rotenone (42). These pro-teins are also described in Yarrowia lipolytica (27). Therefore,our thought was that the orthologs in C. albicans (NDE1 andYMX6) might account for the compensatory increase in respi-

FIG. 6. Chronological life span of GOA31 (goa1�/goa1�) cells is significantly less than that of WT or GOA32 (GOA1/goa1�) cells. All strainswere grown in YPD medium overnight, washed, and then incubated in fresh SC medium in the absence (A) or presence (B) of 5 mM H2O2.Samples were removed daily for 3 weeks, and viability was determined by plating on YPD medium again. After 48 h of incubation, the numberof CFU was determined. (C) GOA31 was untreated or treated with the antioxidant N-acetyl cysteine (NAC; 30 mM). NAC was added at the timepoints indicated (arrows). The presence of NAC increased survival of GOA31.



.org/D

ownloaded from

http://ec.asm.org/

ration in SHAM-treated GOA31 cells. We now show thattranscription levels of both NDE1 and YMX6 are lower inGOA31 cells than in control strains when cells are treated withSHAM but that flavone, an inhibitor of these dehydrogenases,did reduce the compensatory respiration in GOA31. The char-acterization of growth mutants in different organisms has dem-onstrated that mitochondria defective in the CRC pathway areable to compensate for these impairments by a process termedretrograde regulation, which includes the induction of certaingenes that under normal conditions are not expressed (48). Weare left with the observation that the compensatory increase inGOA31 respiration in SHAM-treated cells is due to the PARpathway and external NADH dehydrogenases.

Our data support the concept that a major defect has oc-curred in the respiration of GOA31 (loss of oxygen consump-tion, membrane potential, and ATP formation) that is associ-ated with a dysfunctional CRC (8; also this study). We nowdemonstrate that CI is dysfunctional in the GOA31 strain. Two

lines of proof were used to validate this conclusion: in vitroactivity and in situ gel analysis as well as drop plate and respi-ration assays with rotenone. Further, transcription of AOXgenes (AOX1 in untreated cells and AOX1 and AOX2 in per-oxide-treated cells) is downregulated in GOA31, such that onlythe PAR mitochondrial pathway apparently remains intact,similar to what has been shown in C. parapsilosis (46). A re-duction in CI activity is especially detrimental to cells since itprovides 50% of the energy generated by oxidative phos-phorylation. The reduction in CI activity results in a deficiencyin membrane potential (��M) in mitochondria since CI is themajor donor to the proton gradient.

In human cells, CI is the major ROS-generating site inmitochondria, whereas CII, CIII, and CIV could be inhibitedby about 70% without an increase in ROS production (11, 40).During optimum respiration, referred to as state 3 respiration,when oxygen consumption is coupled to ATP production, ROSlevels are low. However, in state 4 respiration, when the CRC

FIG. 7. Caspase activity in strains of C. albicans. Cells of each strain were grown overnight, standardized, and inoculated in YPD medium inthe absence (A) or presence (B) of 10 mM H2O2. Caspase activity was measured using a poly-caspase (FAM-VAD-FMK) apoptosis detection kit(Immunochemistry Technologies, LLC). At designated times, FAM-VAD-FMK was added to cell suspensions. After unbound FAM-VAD-FMKwas washed away, anti-FAM-VAD-FMK antibody was added. The number of cells with green fluorescence is a direct measurement of caspase-positive cells.

FIG. 8. TUNEL assays in strains of C. albicans. In this assay, a terminal deoxynucleotidyltransferase (TdT) adds Br-dUTP (bromolated dUTPnucleotides) to DNA breaks. The incorporation of Br-dUTP results in a green-fluorescent (FITC) signal once anti-BrdU antibody is added. In situDNA fragmentation was assayed in all strains. The cells were either left untreated or were treated with 10 mM H2O2 and collected at the timepoints indicated on the graph. The DNA labeling solution was added for 1 h, and fluorescence was measured by flow cytometry.



.org/D

ownloaded from

http://ec.asm.org/

slows down or is dysfunctional at CI, the production and re-lease of ROS increase (11). An imbalance in ROS is thought toinitiate programmed cell death (PCD) as in several types ofneurodegenerative diseases. In structurally and functionallyintact mitochondria, a large antioxidant defense capacity ne-gates ROS that is formed; therefore, there is little net cellularROS in the matrix of active mitochondria. However, once thisbalance is disturbed, the accumulated ROS will further dam-age mitochondria, causing more free-radical molecules toform. The ROS free radicals are also able to damage biomol-ecules such as nucleic acids, lipids, and proteins. Usually,young cells have very small amounts of net ROS, but as mito-chondria age and become more dysfunctional, larger amountsof ROS are generated, and cell viability decreases. Loss of cellviability is also accompanied by the ROS-induced inactivationof complex protein Fe-S clusters, which is followed by a releaseof iron that induces the formation of hydroxyl radicals (39).Therapies to counter neurodegenerative diseases and evencancer are currently being sought that will alter carbohydratemetabolism to either attenuate or heighten mitochondrial ac-tivity in a disease-specific manner (11, 19).

Our hypothesis is that Goa1p maintains CI activity and thatin its absence, cells have less membrane potential, with anincrease in ROS accumulation and cell death by apoptosis.This is also reminiscent of data in Neurospora Crassa, wheretreatment with phytosphingosine targets complex I (17). Sub-sequently, cell ROS increases, followed by cell death, which isvery similar to what has been described in Podospora anserinaand S. cerevisiae (48).

Complex I. The C. albicans CI is believed to consist of 39proteins, 2 of which are unique to Candida species (22). Com-parative genomics indicates that CI shares structural similaritywith the complex I of other eukaryotes (22). Eukaryotic CIconsists of a conserved core of 14 subunits, present in bacterialNADH:ubiquinone oxidoreductases, plus a variable number ofsupernumerary subunits, e.g., 31 in mammals (24, 36) and 26 inthe yeast Y. lipolytica (1, 22, 47). This species is more closelyrelated to C. albicans, and we have found that all of the Y.lipolytica subunits except one are conserved in the C. albicansgenome (unpublished results). The core subunits include sevenperipheral proteins that serve as binding sites for NADH,flavin mononucleotide (FMN), and iron-sulfur clusters andseven membrane-spanning subunit proteins that collectivelyform an L-shaped structure, with the peripheral arm locatedperpendicular to the mitochondrial inner membrane (22).Many of the supernumerary subunits are conserved across allspecies. Fungal CI has also been investigated in N. crassa (6,44). In that fungus, the lack of a single subunit protein inknockout mutants caused a complete block in the assemblypathway of CI (44). It is important to recognize that followingthe evolutionary recruitment of the core proteobacterial andlower eukaryotic proteins to CI, subsequently, the complexdiversified along the different eukaryotic lineages (mammals,fungi, insects, and nematodes) with new and continuous re-cruitment of subunits (22). Thus, significant differences existamong these lineages to warrant study of the C. albicans CI.Presently, we are pursuing the identification of complex I pro-teins in GOA31 and control strains. Since clearly CI activity isdecreased and there is less CI, we hypothesize that Goa1pregulates complex activity and assembly or is required for its

activity as a part of CI. These defects have been observed inhuman CI-specific disorders (36, 49).

AOX. All indications are that Goa1p is required for tran-scription of the AOX pathway genes in untreated (AOX1) andperoxide-treated cells (AOX1 and AOX2). However, we havenot determined whether the relationship of the AOX pathwayand AOX1 and AOX2 transcription with Goa1p is direct orindirect. Our hypothesis is that Goa1p and Aox1p/Aox2p areeach critical to peroxide adaptation. Additional experimentsare planned to examine the response of both proteins to otherforms of cell stress.

Apoptosis. The consequence of heightened ROS levels as-sociated with CI dysfunction is apparently due to programmedcell death in GOA31. That dysfunctional CI is a source ofheightened ROS and PCD has been demonstrated in N. crassa(17). Phytosphingosine-treated conidia caused increased ROS,evidence of PCD, and reduced viability similar to our currentobservations of GOA31. However, a CI mutant of N. crassawas more resistant to phytosphingosine than wild-type cells,indicating that CI is a target for this compound (17). An im-portant point of this study is, therefore, that CI defects in afungus are associated with ROS and PCD. In GOA31, anincrease in caspase and TUNEL activity accompanies the lossof viability. Our hypothesis that GOA31 cells undergo apop-tosis is based upon the combined application of several assays,as suggested by others (16). In S. cerevisiae, PCD and apoptosisare now thought to have several subroutines, including necro-sis, which phenotypically includes a ruptured plasma mem-brane (15). PCD generally occurs through two types of mech-anisms, extrinsic, as described above, with inducers forcedupon cells, and intrinsic, associated with mitochondrial dys-function and ROS production. Both pathways overlap to agreat degree, making analysis of defects somewhat complex.Carmona-Gutierrez et al. (15, 16) differentiate between repli-cative aging of cells, defined as the number of divisions anindividual mother cell has before death occurs, and chronolog-ical aging, which is distinguished by viability over time of cellsin stationary phase. Based upon our life span experiments (Fig.6), we believe that GOA31 cells have reduced chronologicalaging, which means that Goa1p is essential for cell survival.

In summary, our data demonstrate that Goa1p is requiredfor mitochondrial functions, especially CI activity, and, as aconsequence, is critically important in maintaining nontoxiclevels of ROS. As a result, chronological aging is extended byweeks in comparison to cells that lack GOA1. Although thereare certainly other additional factors that could contribute tothe observed growth defects in the goa1 mutant, it is clear thatCI dysfunction results in the overproduction of ROS that im-pacts survival of C. albicans.

ACKNOWLEDGMENTS

We thank the flow cytometry facility at the Georgetown UniversityCenter Lombardi Cancer Center for helping with the fluorescence-activated cell sorter analysis. We also thank Robert Balaban, Stepha-nie French, Susham S. Ingavale, Quentin Li, John Bennett, and KyungJ. Kwon-Chung at NHLBI and NIAID, NIH, for their advice with theoxygen consumption assays.

REFERENCES

1. Abdrakhmanova, A., et al. 2004. Subunit composition of mitochondrial com-plex I from the yeast Yarrowia lipolytica. Biochim. Biophys. Acta 1658:148–156.



.org/D

ownloaded from

http://ec.asm.org/

2. Aerts, A., et al. 2009. Mitochondrial dysfunction leads to reduced chrono-logical lifespan and increased apoptosis in yeast. FEBS Lett. 583:113–117.

3. Alby, K., D. Schaefer, R. Sherwood, S. Jones, and R. Bennett. 2010. Identi-fication of a cell death pathway in Candida albicans during the response topheromone. Eukaryot. Cell 9:1690–1701.

4. Al-Dhaheri, R. S., and L. J. Douglas. 2010. Apoptosis in Candida biofilmsexposed to amphotericin B. J. Med. Microbiol. 59:149–157.

5. Alonso-Monge, R., S. Cavaheiro, C. Nombela, E. Rial, and J. Pla. 2009. TheHog1 MAPK controls respiratory metabolism in the fungal pathogen Can-dida albicans. Microbiology 155:413–423.

6. Alves, P., and A. Videra. 1998. The membrane domain complex I is notassembled in the stopper mutant E35 of Neurospora. Biochem. Cell Biol.76:139–143.

7. Askew, C., et al. 2009. Transcriptional regulation of carbohydrate metabo-lism in Candida albicans. PLoS Pathog. 5:e1000612.

8. Bambach, A., et al. 2009. Goa1p of Candida albicans localizes to the mito-chondria during stress and is required for mitochondrial function and viru-lence. Eukaryot. Cell 8:1706–1720.

9. Barrelle, C., et al. 2006. Niche-specific regulation of central metabolic path-ways in a fungal pathogen. Cell. Microbiol. 6:961–971.

10. Barrientos, A. 2002. In vivo and in organello assessment of OXPHOS activ-ities. Methods 26:307–316.

11. Bayir, H., and V. Kagan. 2008. Bench-to-bedside review: mitochondrialinjury, oxidative stress and apoptosis—there is nothing more practical than agood theory. Crit. Care 12:206.

12. Camougrand, N., S. Zniber, and M. Guerin. 1991. The antimycin-A insen-sitive respiratory pathway of Candida parapsilosis: evidence for a secondquinone involved specificity in its functioning. Biochim. Biophys. Acta 1057:124–130.

13. Cao, Y., et al. 2009. Candida albicans cells lacking CaMCA1-encoded meta-caspase show resistance to oxidative stress-induced death and change inenergy metabolism. Fungal Genet. Biol. 46:183–189.

14. Carman, A., S. Vylkova, and M. Lorenz. 2008. Role of acetyl coenzyme Asynthesis and breakdown in alternative carbon source utilization in Candidaalbicans. Eukaryot. Cell 7:1733–1741.

15. Carmona-Gutierrez, D., et al. 2010. Apoptosis in yeast: triggers, pathways,subroutines. Cell Death Differ. 17:763–773.

16. Carmona-Gutierrez, D., H. Jungwirth, T. Eisenberg, and F. Madeo. 2010.Cell cycle control of death in yeast. Cell Cycle 9:4046.

17. Castro, A., C. Lemos, A. Falco, N. Glass, and A. Videira. 2008. Increasedresistance of complex I mutants to phytosphingosine-induced programmedcell death. J. Biol. Chem. 283:19314–19321.

18. Cavalheiro, R., et al. 2004. Respiration, oxidative phosphorylation and un-coupling protein in Candida albicans. Braz. J. Med. Biol. Res. 37:1455–1461.

19. Derdak, Z., et al. 2008. The mitochondrial uncoupling protein-2 promoteschemoresistance in cancer cells. Cancer Res. 68:2813–2819.

20. Forsmark-Andree, P., C.-P. Lee, G. Dallner, and L. Ernster. 1997. Lipidperoxidation and changes in the ubiquinone content and the respiratorychain enzymes of submitochondrial particles. Free Rad. Biol. Med. 22:391–400.

21. Fradin, C., et al. 2005. Granulocytes govern the transcriptional response,morphology and proliferation of Candida albicans in human blood. Mol.Microbiol. 56:397–415.

22. Gabaldon, T., D. Rainey, and M. Huynen. 2005. Tracing the evolution of alarge protein complex in the eukaryotes, NADH:ubiquinone oxidoreductase(complex I). J. Mol. Biol. 348:857–870.

23. Gallagher, S. 2010. Digital image processing and analysis with ImageJ.Curr. Protoc. Essent. Lab. Tech. 3:A.3C.1–A.3C.24. doi: 10.1002/9780470089941.eta03cs03.

24. Garbian, Y., O. Ovadia, S. Dadon, and D. Mishmar. 2010. Gene expressionpatterns of oxidative phosphorylation complex I subunits are organized asclusters. PLoS One 5:e9985.

25. Gogvadze, V., and S. Orrenius. 2006. Mitochondrial regulation of apoptoticcell death. Chem. Biol. Interact. 163:4–14.

26. Guerin, M., and N. Camougrand. 1994. Partitioning of electron flux betweenthe respiratory chains of the yeast Candida parapsilosis: parallel working oftwo chains. Biochim. Biophys. Acta 1184:111–117.

27. Guerro-Castillo, S., M. Vazquez-Acevedo, D. Gonzalez-Halphen, and S.Uribe-Carajal. 2009. In Yarrow lipolytica mitochondria, the alternativeNADH dehydrogenase interacts specifically with the cytochrome complexesof the classic respiratory pathway. Biochim. Biophys. Acta 1787:75–85.

28. Helmerhorst, E., M. Stan, M. Murphy, F. Sherman, and F. Oppenheim.2005. The concomitant expression and availability of conventional and al-ternative, cyanide-insensitive, respiratory pathways in Candida albicans. Mi-tochondrion 5:200–211.

29. Helmerhorst, E., M. Murphy, R. Troxler, and F. Oppenheim. 2002. Charac-terization of the mitochondrial respiratory pathways in Candida albicans.Biochim. Biophys. Acta 1556:73–80.

30. Huh, W.-K., and S. Kang. 2001. Characterization of a gene family encodingalternative oxidases from Candida albicans. Biochem. J. 356:595–604.

31. Huh, W.-K., and S. Kang. 1999. Molecular cloning and functional expressionof an alternate oxidase from Candida albicans. J. Bacteriol. 181:4098–4102.

32. Ingavale, S., et al. 2008. Importance of mitochondria in survival of Crypto-coccus neoformans under low oxygen conditions and tolerance to cobaltchloride. PLoS Pathog. 4:e1000155.

33. Joseph-Horne, T., D. Hollomon, and P. M. Wood. 2001. Fungal respiration:a fusion of standard and alternative components. Biochim. Biophys. Acta1504:179–195.

34. Juarez, O., G. Guerra, F. Martinez, and J. Pardo. 2004. The mitochondrialrespiratory chain of Ustilago maydis. Biochim. Biophys. Acta 1658:244–251.

35. Kim, S. Y., and J. Kim. 2010. Roles of dihydrolipoamide dehydrogenaseLpd1 in Candida albicans filamentation. Fungal Genet. Biol. 47:782–788.

36. Lazarou, M., D. R. Thorburn, M. T. Ryan, and M. McKenzie. 2009. Assem-bly of mitochondria complex I and defects in disease. Biochim. Biophys. Acta1793:78–88.

37. Lee, Y.-I., et al. 2004. Human hepatitis B virus-X protein alters mitochondriafunction and physiology in human liver cells. J. Biol. Chem. 279:15460–15471.

38. Lenaz, G., et al. 1995. Under evaluation of complex I activity by the directassay of NADH-coenzyme Q. reductase in rat liver mitochondria. FEBSLett. 366:119–121.

39. Lill, R. 2009. Function and biogenesis of iron-sulphur clusters. Nature 460:831–838.

40. Lin, M., and M. Beal. 2006. Mitochondrial dysfunction and oxidative stressin neurodegenerative diseases. Nature 443:787–798.

41. Lorenz, M., J. Bender, and G. Fink. 2004. Transcriptional response of Can-dida albicans upon internalization by macrophages. Eukaryot. Cell 3:1076–1087.

42. Luttik, M., et al. 1998. The Saccharomyces cerevisiae NDE1 and NDE2 genesencode separate mitochondrial NADH dehydrogenases catalyzing the oxi-dation of cytosolic NADH. J. Biol. Chem. 273:24524–24534.

43. Magnani, T., et al. 2007. Cloning and functional expression of the mitochon-drial alternative oxidase of Aspergillus fumigatus and its induction by oxida-tive stress. FEMS Microbiol. Lett. 271:230–238.

44. Marques, I., M. Duarte, J. Assuncao, A. Ushakova, and A. Videira. 2005.Composition of complex I from Neurospora crassa and disruption of twoaccessory subunits. Biochim. Biophys. Acta 1707:211–220.

45. McDonough, J., V. Bhattacherjee, T. Sadlon, and M. Hostetter. 2002. In-volvement of Candida albicans NADH dehydrogenase complex I in filamen-tation. Fungal Genet. Biol. 36:117–127.

46. Milani, G., et al. 2001. Respiratory chain network in mitochondria of Can-dida parapsilosis: ADP/O appraisal of the electron pathways. FEBS Lett.508:231–235.

47. Morgner, N., et al. 2008. Subunit mass fingerprinting of mitochondria com-plex I. Biochim. Biophys. Acta 1777:1384–1391.

48. Osiewacz, H., and C. Scheckhuber. 2006. Impact of ROS on ageing of twomodel systems: Saccharomyces cerevisiae and Podospora anserina. FreeRadic. Res. 40:1350–1358.

49. Papa, S., A. Sardanelli, N. Capitanio, and C. Piccoli. 2009. Mitochondrialrespiratory dysfunction and mutations in mitochondrial DNA in PINK1familial parkinsonism. J. Bioenerg. Biomembr. 41:509–516.

50. Ramierz, M., and M. Lorenz. 2007. Mutations in alternative carbon utiliza-tion pathways in Candida albicans attenuate virulence and confer pleiotropicphenotypes. Eukaryot. Cell 6:280–290.

51. Rodaki, A., et al. 2009. Glucose promotes stress resistance in the fungalpathogen Candida albicans. Mol. Biol. Cell 20:4845–4855.

52. Ruy, F., A. Vercesi, and A. Kowaltowski. 2006. Inhibition of specific electrontransport pathways leads to oxidative stress and decreased Candida albicansproliferation. J. Bioenerg. Biomembr. 38:129–135.

53. Sabar, M., J. Balk, and C. Leaver. 2005. Histochemical staining and quan-tification of plant mitochondrial respiratory chain complexes using blue-native polyacrylamide gel electrophoresis. Plant J. 44:893–901.

54. Semighini, C., J. Hornby, P. Dumitru, K. Nickerson, and D. Harris. 2006.Farnesol-induced apoptosis in Aspergillus nidulans reveals a possible mechanismfor antagonistic interactions between fungi. Mol. Microbiol. 59:753–764.

55. Seo, B., et al. 1998. Molecular remedy of complex I defects: rotenone-insensitive internal NADH-quinone oxidoreductase of Saccharomyces cerevi-siae restores the NADH oxidase activity of complex I-deficient mammaliancells. Proc. Natl. Acad. Sci. U. S. A. 95:9167–9171.

56. Shirtliff, M., et al. 2009. Farnesol-induced apoptosis in Candida albicans.Antimicrob. Agents Chemother. 53:2392–2401.

57. Velazquez, I., and J. Pardo. 2001. Kinetic characterization of the rotenone-insensitive internal NADH:ubiquinone oxidoreductase of mitochondria fromSaccharomyces cerevisiae. Arch. Biochem. Biophys. 389:7–14.

58. Vellucci, V., S. Gygax, and M. Hostetter. 2007. Involvement of Candidaalbicans pyruvate dehydrogenase complex protein X (Pdx1) in filamentation.Fungal Genet. Biol. 44:979–990.

59. Vogel, R., J. Smeitink, and L. Nijtmans. 2007. Human mitochondrial com-plex I assembly: a dynamic and versatile process. Biochim. Biophys. Acta1776:1215–1227.

60. Wu, X. Z., W. Q. Chang, A. X. Cheng, L. M. Sun, and H. X. Lou. 2010.Plagiochin E, an antifungal active macrocyclic bis(bibenzyl), induced apop-tosis in Candida albicans through a metacaspase-dependent apoptotic path-way. Biochim. Biophys. Acta 1800:439–447.



.org/D

ownloaded from

http://ec.asm.org/

enzymatic dysfunction of mitochondrial complex i …by the im cv to synthesize atp. ci functions...

Documents