ENTOMOPATHOGENIC FUNGI: A COMPONENT OF INTEGRATED TICK MANAGEMENT

FINAL REPORT

September 2007 to December 2009

SUBMITTED TO BecANet

P. O. Box 30772-00100 Nairobi, Kenya

Phone: +254 (20) 8632000; Fax: +254 (20) 8632001/2 Email: icipe@icipe.org Website: www.icipe.org

February 2010

Contact Person: Dr. Nguya Maniania (nmaniania@icipe.org)

2

BIOSCIENCES EASTERN AND CENTRAL AFRICA (BecA)

FINAL REPORT

Donor: CIDA Project Title: Biosciences eastern and central Africa Network (BecANet) Agreement no.: WBS Element: WBS 2233 Project Period: September 1st to December 31st 2009 Reporting Period: September 2007 to December 2009

3

Table of Contents

1. Executive Summary………………………………………………………………………………....4

2. Analytical comments on the variances between the planned activities, as identified in

the previous narrative report, the workplan and activities actually completed. ….. . .4

3. Problems and Difficulties Encountered, if any, and remedial action Taken or to be

Taken……………………………….…………………………………………………………...……20

4. Analysis of changes to any important aspect of the Project which have been or should

be made, for CIDA’s approval……………………………………..……………………..... .. .20

5. Analytical comments on Financial Reports concerning variances between forecasted

and actual expenditures, as they relate to successes or problems encountered and

actions taken, as well as consequences on the financial forecasting for the next

quarter……………………….……………………………….….…………………………………..20

6. Planned activities for the next quarter…………………………………………………..…….20

7. Integration of gender equality measures in the activities……………………………… …21

8. Review of environmental management measures and their effectiveness……………21

9. Progress towards results……………………………………………………………………………21

10. Other important issues affecting Project Implementation……………………...………….22

4

1. Executive Summary The main objective of the BecANet-funded project ‘Entomopathogenic fungi: a component of integrated tick management’ is to tackle the tick menace by using entomopathogenic fungi as the core component of integrated vector pest management

(IVPM). The project has three specific objectives: (a) Bioprospecting for discovery of new fungal isolates highly pathogenic to Amblyoma variegatum and Rhipicephalus appendiculatus, vectors of diseases in livestock; (b) Screening of fungal isolates against

target tick species for strain selection of most potent isolates and (c) Assess the effect of

fungal infection on engorgement, fecundity and fertility of ticks. Surveys were carried out in some parts of Kenya for bioprospecting for discovery of entomopathogenic fungi that could be developed as biological control agents of ticks. A number of fungal isolates was

isolated and some of them have been identified at genera, species and molecular levels.

They include 23 isolates of Beauveria bassiana, 12 isolates of Metarhizium, one isolate each of Isaria (=Paecilomyces) and Lecanicillium (=Verticillium) sp. They are being preserved in culture collections and represent valuable genetic resources. Some of these isolates and

the ones from the culture collections were tested for their virulence against nymphal stage of A. variegatum and R. appendiculatus and adult R. appendiculatus in the laboratory. Two isolates (B. bassiana ICIPE 621and M. anisopliae ICIPE 07) were found to be virulent to

R. appendiculatus nymphs while B. bassiana isolate ICIPE 622 was the most pathogenic to adult R. appendiculatus. On the other hand, B. bassiana ICIPE 666 and M. anisopliae ICIPE 07 were virulent to A. variegatum nymphs. Female A. variegatum and R. appendiculatus exposed to fungal infection through pheromone-bait trap device had significantly longer

engorgement and pre-ovisposition periods than controls. Fungus-infected females significantly ingested less blood and laid less egg masses than did the controls. Similarly,

lesser larvae emerged from eggs laid by fungus-infected females than control females. To meet the high demand for ticks for bioassays, thriving colonies of both R. appendiculatus

and A. variegatum were established at icipe during the project and they are still maintained to supply the PhD student.

2. Analytical comments on the variances between the planned activities,

as identified in the previous narrative report, the workplan and activities

actually completed 2.1 Bioprospecting for discovery for discovery of new fungal isolates highly

pathogenic to Amblyomma variegatum and Rhipicephalus

appendiculatus

2.1.1 Planned Activities:

• Conduct surveys for bioprospecting for new fungal isolates

• Isolation, culture and preservation of collected pathogens in the Germplasm

• Identification of the pathogens

2.1.2 Activities Completed

2.1.2.1 icipe

Surveys for bioprospecting for discovery of new fungal isolates Surveys were carried out in the following localities: Meru (Central province), Kericho and Nguruman (Rift Valley), Bugoma (Western Province), Kuja River, Thomas Odhiambo

campus in Mbita Point and Rusinga Island (Nyanza Province), Muhaka, Mariakani, Shimba hills and KARI/Matuga (Coast Province). Approximately 20 grams of soil samples were randomly collected from grassland where cattle generally graze using a soil auger from a

5

depth of 0-5 cm. Each of the samples was kept in labeled plastic bags before being transferred to the laboratory for isolation of pathogens. In addition to soil samples, ticks were collected from cattle and grass and brought to the laboratory where they were kept

in quarantine. They were fed on rabbit and observed for mortality. Dead ticks were surface-sterilized in 70% alcohol and rinsed thrice in sterile distilled water and transferred to Petri dishes lined with damp filter paper to favor the development of fungus, if any, on the surface of the cadaver.

Isolation, culture and preservation of collected pathogens in the Germplasm

Sampling from soil

Ten grams (10g) of soil were added to 90 ml of sterile distilled water and homogenized by vortexing for 10 min to release fungal propagules from the soil. Aliquots (100µl) were

spread-plated on selective agar media (Veens & Ferron media) by swirling the Petri dishes. The cultures were incubated for 3-7 days at 25 ± 2 oC. Colonies of the fungus that developed on selective media were transferred to Sabouraud Dextrose agar media

supplemented with 1% yeast extract (SDA + Y) to obtain pure cultures.

Sampling from animal

Partially engorged A. variegatum were picked from predilection sites mainly the dulap,

scrotum, udder and belly cows while R. appendiculatus were collected mainly from ears of cows questing in fields. Dragging method was used for larval collection. Ticks were

transferred into flat bottomed tubes which were kept at high relative humidity of 100% in a

partially air tight tin made of aluminum. Ticks were brought to the laboratory and processed for mycosis using surface sterilization method followed by incubation of ticks at 28 ± 2 oC on moist filter paper for development of mycosis. Identification of the pathogens

Conidia of pure culture were harvested by scrapping the surface and were suspended in 10 ml sterile distilled water containing 0.05% Triton X-100. The suspension was vortexed for 5 minutes to produce homogenous conidial suspension. Conidial suspension (0.1 ml) was

spread-plate on SDA plates. A sterile microscope cover slip was planted in a bent position on agar plate. Plates were then incubated at 26 ± 2 ºC. The cover slip was removed 2-5

days (depending on the growth of the isolate) after and placed on a microscopic slide on

which a drop of lactophenol cotton blue had previously been put. The slide was then examined under microscope X 40 magnification. Using the morphological features such as phialides formation and conidiation of the fungus, it was possible to identify the fungal isolates at genus level, and at some extent at species level. However, molecular

characterization will be required to ascertain their identity, especially following the new

changes in the classification of fungal pathogens. Table 1 lists the fungal isolates isolated during the two-year project. All the fungal isolates were isolated from soil samples and none from the host. They have been deposited in the icipe’s Arthropod Germplasm

Centre as shown by their accession numbers.

6

Table 1. List of fungal pathogens and their accession number isolated during the project

Fungal species icipe’s accession

number

Locality

Metarhizium anisopliae ICIPE 653 Rusinga

ICIPE 610 Meru BG3

ICIPE 608 Meru

ICIPE 606 Meru BG7

ICIPE 628 Meru

Icipe 670 Madzimbani Boruba

ICIPE 655 KabutiI

ICIPE 656 Kapiti

ICIPE 657 Kapsorok

ICIPE 677 Athmani Zula

ICIPE 671 River bank of Duduville

ICIPE 665 Ahero plains

Beauveria bassiana ICIPE 676 Athmani Zula(Sprayed

ICIPE 652 Mbita

ICIPE 622 Kapiti Sondu

ICIPE 620 Kapsorok

ICIPE 662 Mariakani

ICIPE 668 Mabokoni

ICIPE 666 Matuga

ICIPE 669 Madzimbani

ICIPE 667 Matuga

ICIPE 627 Sumek 43

ICIPE 629 Maraboi

ICIPE 662 Mariakani

ICIPE 657 Kapsorok 33

ICIPE 623 Ahero plains

ICIPE 621 Motinet

ICIPE 603 Station 6

ICIPE 625 Chepnyiny

ICIPE 40 Kapmonyok

ICIPE 94 Chepmonyok

ICIPE 620 Kapsorok

ICIPE 622 Kapiti sondu

ICIPE 638 Kuja River

Isaria sp. ICIPE 682 A. zula

Lecanicillium sp. ICIPE 681 Mandera

7

2.1.2.2 CABI

Isolation, culture and preservation of collected pathogens in the Germplasm

Ticks collected during the previous surveys in Maragua, Laikipia and Nyandarua districts were maintained in room conditions and mortality monitored daily. Isolation of emerging

fungal pathogens from tick cadavers and soil (isolated using `Galleria bait' method

(Zimmermann, 1986)1) was undertaken. Pure cultures of established pathogens were maintained on agar slopes. Identification of the pathogens

Molecular sequencing of a new fungal isolate (genus: Beauveria) isolated from samples

collected during the biological surveys mentioned above was undertaken, after purification using single spore isolation technique.

This fungal isolate, was identified using partial ITS DNA sequencing analysis and an excellent top match at 100% (Figure 1) was obtained to Beauveria bassiana (Bal-Criv) Vuill. (Yokoyama, et al., 2002)2. This species is a facultative but highly virulent pathogen of

insects, occurring occasionally on other animals, man and other substrata. For a taxonomic treatment, see de Hoog, GS (1972)3. This isolate B. Basiana has been placed in the CABI Genetic Resource Collection (IMI Number 397060) and the ITS sequence is:

GGGTAGTCCTACCTGATTCGAGGTCaACGTTCAGAAGTTGGGTGTTTTACGGCGTGGCCGCGTCGGGGTCCCGGTGCGAGCTGTATTACTGCGCAGAGGTCGCCGCGGACGGGCCGCC

ACTCCATTTCAGGGCCGGCGGTGTGCTGCCGGTCCCCAACGCCGACCTCCCCAAGGG

GAGGTCGAGGGTTGAAATGACGCTCGAACAGGCATGCCCGCCAGAATGCTGGCGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGGATTCTGCAATTCACATTACTTATCGCGTTTCGCTGCGTTCTTCATCGATGCCAGAGCCAAGAGATCCGTTGTTGAAAGTTTTGATTCATTTGTTTTGCCTTGCGGCGTATTCAGAAGATGCTGGAATACAAGAGTTTGAGGTCCCCGGCGGGCCG

CTGGTCCA.

1Zimmermann, G. (1986) The Galleria bait method for detection of entomopathogenic

fungi in. soil. J. Appl. Ent. 102, 213-215. 2 Yokoyama, E. et al. (2002). Group-I intron containing a putative homing endonuclease gene in the small subunit

ribosomal DNA of Beauveria bassiana IFO 31676. Mol. Biol. Evolution 19(11): 2022-2025

3 De Hoog, GS (1972). The genera Beauveria, Isaria, Tritirachium and Acrodontium gen. nov. Studies in Mycology,

1:1-41.

8

Figure 1. Dedongram for tne molecular identification of Beauveria bassiana (Bal-Criv) Vuill.

9

2.2 Strain selection

2.2.1 Planned Activities:

• Establishment of tick colonies

• Screening of fungal isolates against target tick species

2.2.2 Completed Activities

2.2.2.1 icipe

Tick colonies

In order to have the necessary number of ticks for bioassays, colonies of both A. variegatum and R. appendiculatus were established at the Animal Rearing and Quarantine Unit, Duduville, icipe’s Headquarters. Engorged female Amblyomma

variegatum and Rhipicephalus appendiculatus were collected on cattle originating from Marsabit area of Kenya in September 2007. Individual ticks were placed separately in

clean glass vials plugged with cotton wool stoppers. The vials were carefully placed in

Perspex boxes containing moistened cotton wool for transportation to the laboratory. The engorged females were incubated at 85 ± 5 % RH at 12:12 L:D photoperiod for them to lay eggs. Emerging larvae were used to establish the tick colonies. Flat larvae, nymphs and adults were fed on the back of naïve New Zealand white rabbits (Oryctolagus cuniculus).

Each of the developmental stages for each of the tick species (approximately 1000 flat larvae or 200 flat nymphs for R. appendiculatus and 5000 larvae or 100 nymphs for A. variegatum) were introduced separately into cotton bag that was glued onto the shaved skin of the rabbit one day before the tick infestation and the bag was sealed to prevent

the ticks from escaping. A Perspex neck collar was fixed on each of the rabbits to prevent them from removing the cotton bags. Rabbits were kept in individual cages and were fed

with rabbit pellets and water. Each rabbit was used only once to avoid the rabbits

developing resistance to tick infestation. Fully engorged ticks that drop-off were collected daily and kept in glass vials plugged with cotton wool stoppers and kept in clear Perspex chambers at 26 ± 1 oC and 85 ± 5 % RH at 12:12 L:D photoperiod. After molting or hatching, ticks were allowed to sit for about two to three weeks before the next feeding to allow

them to complete their postmolt development. The duration for completion of the three-

host life cycle that is from larvae to flat adult was approximately 6-7 and 4-5 months for A. variegatum and R. appendiculatus. Colony of both R. appendiculatus and A. variegatum

is still being maintained to cater for the need of the BecANet-funded PhD student, Paulin Nana. Screening

Screening was carried out in three steps: tier, pathogenicity and dose-response bioassays. Tier experiments

Fungal isolates isolated during the surveys and some from the icipe’s Arthropod

Germplasm Centre were submitted to a tier process in order to eliminate the non

pathogenic ones. Conidia were harvested by scrapping the surface of 3 week-old sporulating cultures grown on Sabouraud dextrose agar (SDA) in Petri dishes at 26 ± 2 ºC.

Conidia were suspended in 20 ml sterile distilled water containing 0.05 % Triton X-100. The conidial suspension was vortexed for 5 minutes to produce a homogenous conidial suspension. Adult ticks were contaminated by immersion in conidial suspension titred at 1.0 x 109 conidia ml-1 for 30 seconds. Two replicate of 20 ticks were used. Test-ticks were then

transferred to glass tubes and maintained in incubator at 25 ± 2 oC and 85 ± 5 % RH, 12:12LD. Mortality was checked every 3 days up to 11 days.

10

Control mortality was 2.5 and 6.7% in R. appendiculatus and A. variegatum, respectively. Five out of 15 fungal isolates tested against R. appendiculatus were able to cause mortality of over 50%; while 5 out of 12 isolates caused mortality over 50% in A. variegatum

(Table 2). The higher mortality (83%) was obtained with isolate ICIPE 657 in R. appendiculatus while isolate ICIPE 682 caused the highest mortality (75%) in A. variegatum.

Table 2. Pathogenicity of fungal isolates against R. appendiculatus and A. variegatum tick

adults treated by immersion for 30 s in a concentration of 1.0 x 109 conidia ml-1. Mortality

at11 days post-infection

Fungal isolate % mortality

R. appendiculatus A. variegatum

Control 2.5 6.7

ICIPE 78 - 55

ICIPE 656 65 33.3

ICIPE 655 - 33.3 ICIPE 657 82.5 40

ICIPE 603 19.4 12.5

ICIPE 278 5 5.1

ICIPE 682 60 37.5

ICIPE 621 35 75

ICIPE 653 14 -

ICIPE 638 67.5 -

ICIPE 627 55 -

ICIPE 629 27.5 -

ICIPE 662 45 - ICIPE 623 35 -

ICIPE 94 25 -

ICIPE 90 45 -

ICIPE 273 15 -

ICIPE 40 - 13.3

ICIPE 668 - 63.5

ICIPE 669 - 66.7

ICIPE 7 - 55.1

(-) = not tested

Pathogenicity tests

Eleven isolates of M. anisopliae and eight of B. bassiana were selected from the tier bioassays for virulence tests against R. appendiculatus. Conidial suspensions were prepared as described above. Ten (10 ml) of conidial suspension titred at 1.0 x 109 conidia

ml-1 was sprayed on adult ticks using Burgerjon’s spray tower. In the control treatments, ticks were sprayed with 10 ml of sterile distilled water containing 0.05 % Triton X-100. Test-ticks were transferred after 2-4 minutes to glass tubes and maintained in incubator at 25 ±

2 oC and 85 ± 5 % RH, 12:12LD. Mortality was checked daily for 14 days.

11

Isolates of M. anisopliae caused mortality of between 15 and 77% while those of B. bassiana between 20 and 90% (Table 3). One isolate of M. anisopliae did not cause any mortality.

Table 3. Virulence of isolates of B. bassiana and M. anisopliae against adult R. appendiculatus at the concentration of 1.0 x 109 conidia ml-1 14 days post-infection

Fungal isolate Accession number % mortality (X ± SE)

Control 6.9 ± 1.8

Metarhizium anisopliae ICIPE 636 15.0 ± 5.0

ICIPE 637 67.5 ± 2.5

ICIPE640 30 ± 0.0

ICIPE 94 0.0 ± 0.0

ICIPE 90 22.5 ± 7.5

ICIPE 670 66.7 ± 8.8

ICIPE 71 76.7 ± 1.7

ICIPE 07 55.0 ± 2.9

ICIPE 657 40.1 ± 3.9

ICIPE 677 71.7 ± 4.4

ICIPE 656 26.7 ± 3.8

Beauveria bassiana ICIPE 642 27.5 ± 2.5

ICIPE 622 65.0 ± 5.4

ICIPE 620 82.5 ± 7.2

ICIPE 675 73.3 ± 1.7

ICIPE 669 90.0 ± 5.8

ICIPE 625 33.3 ± 7.7

ICIPE 621 20.0 ± 0

ICIPE 668 63.8 ± 7.5

Dose-response mortality of R. appendiculatus and A. variegatum nymphs to selected

fungal isolates

Fungal isolates that were found virulent in the pathogenicity tests were further bioassayed for dose-response mortality against nymph and adult R. appendiculatus, and nymph A.

variegatum. Metarhizium anisopliae ICIPE 07 was included as standard in all the tests for

comparison purpose. Conidial suspension was prepared as described above. Three concentrations (3.0 x 106, 3.0 x 107, and 3.0 x 108 conidia ml-1) were obtained through successive dilutions of the initial stock. Test-ticks were placed in a Petri dish plate lined with

a filter paper and chilled for 3-5 minutes. Ten (10 ml) of conidial suspension was sprayed on them using Burgerjon’s spray tower. In the control treatments, ticks were sprayed with 10 ml

of sterile distilled water containing 0.05 % Triton X-100. Test-ticks were transferred after 2-4 minutes to glass tubes and maintained in incubator at 25 ± 2 oC and 85 ± 5 % RH, 12:12LD.

Mortality was checked daily for 14 days. Dead ticks were surfaced-sterilized in 70% alcohol, rinsed three times in sterile distilled water and placed in a humidified chamber (Petri dish lined with a damp filter paper) to favor the growth of the fungus on the surface.

Treatments were block randomized and consisted of 20 ticks each and the experiment

12

was replicated 3-4 times. Viability of conidia was determined before each bioassay by spread-plating 0.1 ml of the suspension titrated to 3.0 x 106 conidia ml-1 on SDA plates and determining the percentage germination after 24 hours. Four replicates were used for

each isolate. In viability tests 90-95% of conidia germinated. Mortality in the controls was 12.5 and 3.8% in nymph and adult R. appendiculatus, respectively. Mortality of R. appendiculatus nymphs

exposed to fungal treatments varied between 19.0 and 98.3% at the lower concentration of 3.0 x 106, and between 51.7 and 98.3% at the higher concentration of 3.0 x 108 14 days

post-infection (Table 3). Adult mortality of R. appendiculatus varied between 14 and 45.0%

at the lower concentration and between 32.5 and 70.0% at the higher concentration (Table 3b). The standard isolate performed poorly against adult R. appendiculatus. Nymphs were more susceptible to fungal infection than adults.

Table 3a. Mortality (%) of R. appendiculatus nymphs following exposure to different concentrations of M. anisopliae and B. bassiana isolates. Mortality recorded after 14 days.

Table 3b. Mortality (%) of R. appendiculatus adults following exposure to different

concentrations of M. anisopliae and B. bassiana isolates. Mortality recorded after 21 days.

Concentration (conidia ml-1) Treatment

3.0 x 106 3.0 x 107 3.0 x 108

Control 12.5 ± 1.4 12.5 ± 1.4 12.5 ± 1.4

M. anisopliae

Standard (ICIPE 07) 98.3 ± 1.7 100 98.3 ± 1.7

ICIPE 78 26.3 ± 4.7 45.0 ± 2.0 65.0 ± 5.0

B. bassiana

ICIPE 620 19.0 ± 2.9 42.0 ± 7.7 51.7 ± 6.7

ICIPE 621 91.7 ± 6.0 90.0 ± 4.6 96.3 ± 3.8

ICIPE 638 37.5 ± 5.2 53.4 ± 2.4 57.5 ± 5.2

Concentration (conidia ml-1) Treatment

3.0 x 106 3.0 x 107 3.0 x 108

Control 3.8 ± 2.4 3.8 ± 2.4 3.8 ± 2.4

M. anisopliae

Standard (ICIPE 07) 37.5 ± 7.2 33.3 ± 1.7 32.5 ± 5.2

ICIPE 78 27.5 ± 1.4 52.5 ± 14.4 60.0 ± 20.0

B. bassiana

ICIPE 620 31.0 ± 2.9 57.0 ± 7.7 66.7 ± 6.7

ICIPE 621 14.0 ± 3.3 35.0 ± 5.2 60.0 ± 3.2

ICIPE 622 45.0 ± 11.6 37.5 ± 5.0 70.0 ± 22.5

13

Control mortality in A. variegatum nymphs was 5.0%. In fungus-treated nymphs mortality varied from 11.7 to 100% at the lower concentration and from 31.7 to 100% at the higher concentration (Table 4). With exception to M. anisopliae ICIPE 07, mortality was dose-

dependant with all the fungal isolates (Table 4). The standard isolate, M. anisopliae ICIPE 07, was virulent to nymphal stage of both A. variegatum and R. appendiculatus (Tables 3 and 4).

Table 4. Mortality (%) of A. variegatum nymphs following exposure to different

concentrations of M. anisopliae and B. bassiana isolates. Mortality recorded after 14 days.

2.2.2.2 CABI

Spore suspensions 106, 108 and 1010 of 21 days old pure cultures of local Kenyan isolates of B. bassiana and Metarhizium spp. were selected for pathogenicity test against A. variegatum. The adult A. variegatum ticks used in this study were purchased from icipe tick

rearing unit. The ticks were sorted into eight batches (selected at random) according to the number of

treatments i.e. two fungal isolates, three different spores concentration and two controls (untreated control and water without spore suspension), each containing 50 adult ticks and replicated five times. The ticks were inoculated by spraying and then placed in moist

chambers (three 9mm diameter sterile Petri dishes lined with sterile filter paper and

moistened with sterile distilled water. All the ticks, in moist chambers, were kept at 26 ± 2o C and mortality monitored on daily intervals for a maximum of 30 days. This experiment was repeated twice.

To confirm the identity of sporulating fungi from tick cadavers, fungi from the cadavers were cultured on SDA media in Petri dishes (9 mm diameter) at 25°C. The pattern of growth of the fungal cultures was examined using a compound microscope and

compared with the original cultures to confirm that mortality was due to the inoculated fungal agent.

Figures 2 and 3 shows the mortality (untransformed) of the ticks at the diffrent levels of

concentrations of the spores of the fungi Metarhizium and Beauveria species, respectively.

Concentration (conidia ml-1) Treatment

3.0 x 106 3.0 x 107 3.0 x 108

Control 5.0 ± 2.0 5.0 ± 2.0 5.0 ± 2.0

M. anisopliae

Standard (ICIPE 07) 100 ± 0.0 98.3 ± 1.7 100 ± 0.0

ICIPE 637 37.5 ± 5.2 56.3 ± 2.4 57.5 ± 5.2

ICIPE 78 18.8 ± 2.4 27.5 ± 4.3 53.8 ± 2.4

B. bassiana

ICIPE 620 11.7 ± 3.3 13.3 ± 1.7 31.7 ± 1.7

ICIPE 621 31.3 ± 4.7 43.8 ± 3.8 63.8 ± 5.5

ICIPE 622 13.3 ± 1.7 21.7 ± 1.7 35.0 ± 0.0

ICIPE 675 15.0 ± 2.9 25.0 ± 2.0 37.5 ± 4.3

ICIPE 666 55.0 ± 2.9 78.3 ± 6.7 90.0 ± 0.0

14

For the first three weeks after inoculation, the mortality of the ticks was below 50% for all treatments except at the highest spore inoculum (1010) of Metarhizium. Statistical analysis, using Genstat Statistical package, of the corrected mortality (using Aborts formula)

showed that there was a significant difference (P = <0.001; for arcsin-transformed data) in the mortality of the ticks at the different levels of spores concentration 28 days after inoculation. The feasibility and implication of the high dose and the longer time taken to attain 50% mortality of ticks, with respect to control of ticks (as vectors of disease

pathogens in livestock) needs further evaluation.

0

10

20

30

40

50

60

70

80

90

100

0 5 10 15 20 25 30 35

Days after inoculation

Mo

rtal

ity (

%)

Met 106

Met 108

Met 1010

Control

Figure 2: The effect of different spore concentrations of Metarhizium spp. on the mortality

of Amblyomma variegatum.

15

0

10

20

30

40

50

60

70

80

90

100

0 5 10 15 20 25 30 35

Days after inoculation

Mo

rtal

ity

(%)

Bb 106

Bb 108

Bb 1010

Control

Figure 3: The effect of different spore concentrations of Beauveria bassiana on the mortality of Amblyomma variegatum.

2.3 Eeffects of fungal infection on engorgement, fecundity and fertility of

ticks

2.3.1 Planned Activities: • Effect of infection on reproduction potential and engorgement of A. variegatum

• Effect of infection on reproduction potential and engorgement of R. appendiculatus

2.3.2 Completed activities

2,3.2.1 Effect of infection on engorgement and reproduction potential of A. variegatum

The virulence of entomopathogenic fungi has always been measured in terms of mortalities but its impact on feeding and reproduction potential might be higher than that suggested by direct mortality alone. The objective of this experiment was therefore to

investigate whether infection by M. anisopliae isolate ICIPE 07 can reduce the weight of A. variegatum engorging on rabbit, egg mass weights, and egg hatchability. In order to

reflect field situation, ticks deriving from field treatments were used in the experiment.

Field site - The experiment was carried out at the National Veterinary Research Centre, Muguga-Kenya Agriculture Research Institute, in a 2-acre paddock between December 2008 and January 2009. The vegetation was predominantly red oat grass, Themeda

triandra (Liliopsida: Poaceae). The height of the grass was maintained between 5 and10

cm. Fungus - Conidia were produced on long rice as substrate using Milner’s bag process. The

rice was autoclaved for 1 h at 121°C, transferred in polyethylene autoclavable bags inoculated with a 3-day old culture of blastospores (50 ml). Bags were then subjected to

16

vigorous shaking to distribute the inoculum and incubated between 26 and 30oC and 60–75% R.H. for 21 days. The polyethylene bag was then opened and the culture was allowed to dry for 5 days at room temperature. Conidia were harvested by sifting the substrate

through a sieve (295 mm mesh size). The conidia were stored in the refrigerator (4–6°C) before using in field sprays. One litre of emulsifiable conidial suspension titrated at 1 x 109 conidia ml-1 was prepared (consisting of 49.5% sterile distilled water, fungal conidia, 49.5% corn oil (CHEF cooking oil, Premier Oil Mills LTD) and 1% Tween 80). One liter of a control

solution was also prepared in a similar manner without the fungus.

Treatments - Prior to the start of the experiment, semiochemical-baited traps (Nchu et al.,

2010) (Plate 4) were displayed in the paddock in order to trap ticks and ensure that the plot was free of A. variegatum. The trap consisted of a 900-cm2 area made of four 10 cm-wooden pegs hammered to the ground. A 2 x 2 x 2 cm2 rubber sponge impregnated with 16 ng of 1-octen-3-ol and 0.022 mg of attraction-aggregation-attachment pheromone

(AAAP) (ortho-nitrophenol, methyl salicylate and nonanioc acid), dicloromethane (DCM)

and 1-octen-3-ol. AAAP was fixed on the top of each of the four wooden pegs per trap in the presence of CO2. Dry ice used as a source of CO2. The field was divided into 6 plots of 100 m2 each, of which three served as controls and other three as treatments. Plots were

allocated to both treatments randomly. Plots were separated from each other by a buffer zone of 40 m. Three days before application of the treatments, 90 laboratory-reared adult A. variegatum (45 males and 45 females) were seeded in the vegetation and allowed to

acclimatize. Five semiochemical-baited traps were placed at different positions (1 central trap and 4 diagonally placed traps on the inner border of the plots) within the plot. The positions of the diagonally placed traps were changed to new positions by rotating clockwise (45o) while the centrally placed trap was shifted 1 m to the north direction after

14 days. The positions of the 4 traps were changed again after 4 weeks by an inward movement (towards the centre) of 1 m and clockwise rotation (45o) while the central trap

was shifted 2 m to the south direction. The area within the confines of the traps in the test plots were each treated with 250 ml of emulsifiable conidial suspension titrated at 1 x 109

conidia ml-1 using a high volume applicator (1.5 l Model) at a rate of (150 l/hectare) prior to the introduction of the synthetic semiochemicals. In the control plots, traps were treated with the emulsifiable carrier without the fungus. The treatment was repeated after 14 and

28 days soon after rotating the traps in order to cover different sections of the plot as described above. The experiment lasted 6 weeks.

17

Plate 4. Pheromone trap made of wooden pegs and rubber sponge impregnated

with pheromone. The container in the middle contains CO2.

Evaluation of effect of fungal infection on reproduction potential - At 6 week post-treatment, 5 semiochemical-baited traps were deployed in each plot in the morning hours (9.00-12.00 am) in order to attract surviving ticks from the vegetation, initially within the subplots and then beyond to ensure recovery from the entire plot. The positions of the

traps were also changed daily and collection lasted three mornings. Ticks collected in

each plot were transferred in labeled 9-cm-diameter plastic Petri dishes and brought to the laboratory and maintained at 26 ± 1 oC, 85 ± 5 % RH and 12:12 h L:D photoperiod for 2

weeks. Sixteen (16) ticks of both sexes each were selected at random and introduced into cotton bag that was glued onto the shaved skin of the rabbit and the bag was then sealed to prevent the ticks from escaping. A Perspex neck collar was fixed on each of the rabbits to prevent them from removing the cotton bags. Four female and 4 male ticks

were used per rabbit. The engorgement period, the weight of engorged ticks and the pre-oviposition period were recorded after the drop-off. The weight of egg masses was also recorded and 0.1g of the egg mass was sub-sampled and transferred into glass tubes to monitor the hatchability of the eggs. Tubes were maintained in humidified chambers as

described earlier. Female tick mortality was also recorded. Dead ticks were surface-

sterilized with 2.5% sodium hypochlorite and 70% alcohol, and rinsed twice in sterile distilled water, placed into 9-cm diameter Petri dish lined with moistened paper.

Results

No mortality was recorded in the controls while 50% of female ticks died from fungal infection with mycosis in fungus-treated plots (Plate 5). Although fungus-infected female

ticks had a longer period of engorgement, 17 days compared to 14 days in the controls, they ingested low amount of blood compared to the control female ticks (Table 5). They also took longer (16 days) than control females (13 days) before starting laying eggs. The weight of egg masses laid by fungus-treated females was less than the ones laid by control

females (Table 5). Two out of 16 female ticks from fungus treatment failed to lay eggs.

18

Table 5. Effects of fungal infection by M. anisopliae on engorgement weight and reproduction potential of A. variegatum

Treatment Engorgement duration

(day)

Engorgement weight (g)

Pre-oviposition period (day)

Egg mass weight (g)

Hatchability (%)

Control 13.5 ± 1.7 2.4 ± 0.3 13.0 ± 1.3 1.4 ± 0.2 90.0 ± 8.5

M.

anisopliae

17.0 ± 1.5 1.4 ± 0.3 15.8 ± 1.8 0.9 ± 0.3 49.9 ± 18.4

Plate 5. Female A. variegatum showing mycosis by M. anisopliae following treatment in the

field

2,3.2.2 Effect of infection on engorgement and reproduction potential of R. appendiculatus

The experimental procedures described above were used in the present study, except the

site and the time of exposure of ticks to the pathogen because of the cost involved. The

19

experiment was carried out at the icipe’s HQ, Duduville, Nairobi, and ticks were immediately collected after treatment and exposed to rabbits instead of 6 weeks post-infection as in the case of A. variegatum.

Results

Mortality of 13% was recorded in the controls while 40% in fungus-treated plots. Female ticks had a longer period of engorgement (11.8 days) in fungus-treated ticks than in the

control treatment (8.5 days). They also took longer (16.9 days) than control females (13.5 days) before starting laying eggs. Engorgement weight was significantly higher in female

ticks in the control than in fungus-treated ticks. The weight of egg masses laid by fungus-

treated females was less than the ones laid by control females (Table 6). A moribund female was observed laying eggs and those eggs were mycosed was (Plate 6).

Table 6. Effects of fungal infection by M. anisopliae on engorgement weight and

reproduction potential of R. appendiculatus

Treatment Engorgement duration

(day)

Engorgement weight (g)

Pre-oviposition period (day)

Egg mass weight (g)

Hatchability (no. emerged

larvae)

Control 8.5 ± 0.7 3.3 ± 0.4 13.5 ± 1.0 2.3 ± 0.3 3792.3 ± 474.1

M.

anisopliae

11.8 ± 2.1 2.3 ± 0.5= 16.9 ± 1.1 1.5 ± 0.5 2394.8 ± 740.1

Significan

ce

F=27.36;

df=1;P = 0.0001

F= 26.75;df=1; P

= 0.0001

F=59.34;df= 1;P

= 0.0001

F=29.33;df=1;

P = 0.0001

F=26.17;df=1;

P = 0.0001

a b

Plate 6. Moribund Metarhizium-infected female R. appendiculatus (a) still laying eggs; (b) mycosis (green and yellowish) visible on the body (a) and eggs (b).

20

2.2.3 Variance

2.2.3.1 icipe

None 2,3.2.1 icipe

None

2.2.3.2 CABI

3. Problems and difficulties encountered, if any, and remedial action taken

or to be taken

3.1 Problems and Difficulties Encountered

3.1.1 icipe

None

3.1.2 CABI

The identification of fungal pathogens isolated from soil samples and tick cadavers based

morphological characteristics, is not adequate. Use of modern diagnostic tools such as molecular profiling is the best and most accurate means particularly for new isolates but is very expensive. Hence, limitation in the number of isolates that would have been charaterised using this method.

4. Analysis of changes to any important aspect of the Project which have

been or should be made, for CIDA’s approval None

5. Analytical comments on Financial Reports concerning variances

between forecasted and actual expenditures, as they relate to successes

or problems encountered and actions taken, as well as consequences on

the financial forecasting for the next quarter 5.1 icipe

Not applicable.

5.2 CABI

The variance in the budget was due to the change in the planned activities because of

the problems explained in Section 3.1. There are planned ongoing activities during which these funds will be spent.

6. Planned activities for the next quarter 6.1 icipe

Not applicable.

6.2 CABI

Not applicable.

21

7. Integration of gender equality measures in the activities Not applicable

8. Review of environmental management measures and their effectiveness Not applicable.

9. Progress towards results

Deliverables against Work Breakdown Structure (WBS):

9.1 icipe

Consumables

Budgeted: 41,000.00

Actual: 41,937.72

Difference: (937.72)

Travel

Budgeted: 5,000.00

Actual: 5,009.51

Difference (9.51)

Training

Budgeted: 4,000.00

Actual: 4,000.88

Difference (0.88)

Overhead

Budgeted: 10,000.00

Actual: 10,189.62

Difference (189.62)

9.2 CABI

Consumables

Budgeted: 20,000

Actual: 24,554.65

Difference: (4,554.65)

Communication:

Budgeted: 800

Actual: 725.15

Difference: 74.85

Travel:

Budgeted: 8,000

Actual: 2,382.63

Difference: 5,617.37

22

Overhead

Budgeted: 11,200

Actual: 11,200

Difference 0

10. Other important issues affecting Project Implementation None.