energetics of strand-displacement reactions in triple helices: a spectroscopic study

Article No. jmbi.1999.3014 available online at http://www.idealibrary.com on J. Mol. Biol. (1999) 291, 1035±1054

Energetics of Strand-displacement Reactions in TripleHelices: a Spectroscopic Study

Martin Mills1,2, Paola B. Arimondo2, Laurent Lacroix2,TheÂreÁse Garestier2, Claude HeÂ leÁne2, Horst Klump1 andJean-Louis Mergny2*

1Department of BiochemistryUniversity of Cape Town,Republic of South Africa2Laboratoire de BiophysiqueMuseÂum National d'HistoireNaturelle, INSERM U 201CNRS UMR, 8646 ParisFrance

E-mail address of the [email protected]

Present address: J.-L. Mergny, LaBiophysique, 43 rue Cuvier, 75231France.

Abbreviations used: EMSA, electshift assay; FRET, ¯uorescence resotransfer; Pu, purine; Py, pyrimidineTFO, triple helix-forming oligonuclstrand; S, short strand; Ds, duplex �strand; T, triplex; Dss, duplex � twstrands; Ts2, purine triplex with pypyrimidine triplex with purine tail;concentration.

0022-2836/99/351035±20 $30.00/0

DNA triple helices offer exciting new perspectives toward oligonucleo-tide-directed inhibition of gene expression. Purine and GT triplexesappear to be the most promising motifs for stable binding under physio-logical conditions compared to the pyrimidine motif, which forms at rela-tively low pH. There are, however, very little data available forcomparison of the relative stabilities of the different classes of triplexesunder identical conditions. We, therefore, designed a model systemwhich allowed us to set up a competition between the oligonucleotidesof the purine and pyrimidine motifs targeting the same Watson-Crickduplex. Several conclusions may be drawn: (i) a weak hypochromism at260 nm is associated with purine triplex formation; (ii) �H� of GA, GTand TC triplex formation (at pH 7.0) was calculated as ÿ0.1, ÿ2.5 andÿ6.1 kcal/mol per base triplet, respectively. This unexpectedly low �H�for the purine triple helix formation implies that its �G� is nearly tem-perature-independent and it explains why these triplexes may still beobserved at high temperatures. In contrast, the pyrimidine triplex isstrongly favoured at lower temperatures; (iii) as a consequence, in asystem where two third-strands compete for triplex formation, displace-ment of the GA or GT strand by a pyrimidine strand may be observed atneutral pH upon lowering the temperature. This original purine-to-pyrimidine triplex conversion shows a signi®cant hypochromism at260 nm and a hyperchromism at 295 nm which is similar to the duplex-to-triplex conversion in the pyrimidine motif. Further evidence for thistriplex-to-triplex conversion is provided by mung bean-nuclease foot-printing assay.

# 1999 Academic Press

Keywords: triple helix; purine motif; DNA structure; DNA recognition;UV spectroscopy
*Corresponding author
ing author:

boratoire deParis cedex 05,

rophoretic mobilitynance energy; UV, ultraviolet;

eotide; L, longoverhanging single

o overhanging singlerimidine tail; Ts1,Co, initial strand

Introduction

Triple helices were ®rst observed in 1957 forhomopolyribonucleotides (Felsenfeld et al., 1957).After oligonucleotides of any sequence becamereadily available these interactions gave rise to anew approach for sequence-speci®c recognition ofdouble-stranded DNA. When short oligonucleo-tides bind to the major groove of double-helicalDNA at speci®c sequences a local triple helix isformed (Le Doan et al., 1987; Moser & Dervan,1987). Triple helix-forming oligonucleotides (TFOs)can compete with the binding of proteins (FrancËoiset al., 1989; Hanvey et al., 1990; Maher III et al.,1989) and affect transcription of a speci®c gene(Cooney et al., 1988; Grigoriev et al., 1992; Ing et al.,

# 1999 Academic Press

mailto:[email protected]

1036 Strand Displacement in DNA Triplexes

1993; Maher III et al., 1992; Young et al., 1991).TFOs have been used to target mutations tospeci®c sites in selectable genes, in order to achieveinheritable changes in gene expression (Havre et al.,1993; Majumdar et al., 1998; Sandor & Bredberg,1994; Wang et al., 1995, 1996).

At least three structural classes of triple helicesexist that differ in sequence composition and rela-tive orientations of the phosphodiester backbone ofthe third strand. In the ®rst class, called the pyrimi-dine motif, the third strand binds parallel to thepurine strand of the duplex, forming T �A * T andC �G * C� triplets (de los Santos et al., 1989; LeDoan et al., 1987; Moser & Dervan, 1987; Rajagopal& Feigon, 1989). The pKa of the imino group ofcytosine, which must be protonated (Lavelle &Fresco, 1995), is well below 7, making triplex for-mation pH-dependent (HuÈ sler & Klump, 1995;Manzini et al., 1990). In the second and the thirdclass, guanine-rich oligonucleotides bind to thepurine strand of the duplex by reverse Hoogsteenhydrogen bonds, forming either C �G * G andT �A * A triplets (GA oligonucleotides) or C �G * Gand T �A * T triplets (GT oligonucleotides). In theseclasses, the third strand is usually oriented antipar-allel to the purine strand of the duplex, but itshould be noted that GT oligonucleotides can alsobind in a parallel orientation forming HoogsteenC �G * G and T �A * T base-triplets (Giovannangeliet al., 1992; Sun et al., 1991). Some triple helices arehybrids between these different classes: an antipar-allel GTA triplex is formed when reverse Hoogs-teen C �G * G, T �A * T and T �A * A triplets arepresent in the same structure (Mills & Klump,1998) and a parallel TCG triplex has beendescribed with C �G * G, T �A * T and C �G * C� tri-plets (Giovannangeli et al., 1992). GT, GA, GTAand TCG triple helices often require high divalentcation concentration and a high divalent/mono-valent cation concentration ratio.

The binding of a third strand oligonucleotide toa target duplex generally results in a thermodyna-mically weaker interaction than observed for theduplex formation itself (Plum, 1998; Shafer, 1998).To compare the binding of different oligonucleo-tides, it is therefore critical to determine the par-ameters that govern the relative stabilities ofdifferent classes of triplexes at/or near physiologi-cal conditions (i.e. near neutral pH, low divalent/monovalent cation ratio). Here we have examineda system where there is competition between aGA/GT and a pyrimidine third strand for thesame target duplex. Most experiments were per-formed at near neutral pH, in the presence of vari-ous concentrations of divalent ions, and at aconstant monovalent cation concentration (0.1 M).We used a model system, with an oligopurine-oligopyrimidine target duplex of nine base-pairs,allowing the formation of nine base-triplets(T �A * T and C �G * C� in the pyrimidine (TC)motif, T �A * A and C �G * G in the purine (GA)motif, T �A * T and C �G * G in the GT motif (Mills &Klump, 1998)). UV melting was used to monitor

the stability of the various complexes and, basedon the tm values, phase diagrams were constructedindicating the relative stabilities of the complexes.Previous reports have compared GA and GT oligo-nucleotides but results have not demonstrated aclear or consistent set of rules, and only a fewarticles deal with a comparison of all three types ofoligodeoxynucleotide third strands (Faucon et al.,1996; Paes & Fox, 1997; Roy, 1993; Scaria & Shafer,1996).

The sequence design used in this study is basedon an oligonucleotide which was shown to forman intramolecular pyrimidine triple helix (Millset al., 1996). The initial sequence was rearranged tobe asymmetric to allow for a unique orientation ofthe third strand (Figure 1, central part). The loopdirects the ``third strand'' to an antiparallel orien-tation (for GA, GT and GTA third strands) or aparallel orientation (for a CT third strand) withrespect to the purine strand of the duplex. Theasymmetry of the sequence also allows a core Wat-son-Crick duplex to form in all cases without inter-ference from the additional third strand. Thestabilities of these complexes were compared withthe stability of the short Watson-Crick duplex,formed with two short strands of identical length(Figure 1, left). Another consequence of thiscovalent link of the third strand with one strand ofthe duplex is to increase the stability of the triplexand to speed up the kinetics of triplex formation asa result of the intramolecular nature of the reactiononce the duplex is formed. As a result, all meltingcurves shown in this study were perfectly revers-ible and no hysteresis was obtained (i.e. the melt-ing pro®les obtained when heating or cooling thesample were superimposed, in contrast to whatwas observed for intermolecular triplexes; RougeÂeet al., 1992). The hairpin-plus-single-strand systemallowed relatively short strands to be used to forma triplex which is distinguishable from the duplexby UV melting experiments. As a further bonus itexcludes alternative secondary structures(Kandimalla & Agrawal, 1995; Vo et al., 1995).

Results

Melting behavior of the duplex and of theindividual triplexes

The sequences of all oligonucleotides are givenin Table 1. The melting of the intermolecularduplex (9Py1/9Pu1) is monophasic, concentration-dependent and pH-independent in the pH range 5to 7.8 (see Figure 2(a) for the melting at pH 7.5 andFigure 2(b) for the melting at pH 6.0). The tm wasdetermined to be 36 �C at 3 mM strand concen-tration, in the presence of 0.1 M LiCl and 10 mMMgCl2.

The melting of the pyrimidine triplex(22Py.TC1/9Pu1) is biphasic at pH 6.8 or higherand monophasic below this pH (see Figure 2(b) foran example of a monophasic curve at pH 6.0). AtpH 7.0 the two transitions are partially merged

Figure 1. Possible complexes resulting from the association of two strands. Left: two short strands (S) form an anti-parallel duplex (D). Center: one long strand (L) may associate with a short strand (S) to form a duplex � overhangingsingle strand (Ds) or a triplex (T). Depending on the nature of the long strand, T may be a purine (T2) or a pyrimi-dine (T1) triplex. Right: two long strands (L) may form a duplex � two overhanging single strands (Dss) or twodifferent triplex � overhanging single-strand structures (Ts1 and Ts2). Ts2 refers to a purine triplex with a pyrimidinetail, Ts1 to a pyrimidine triplex with a purine tail.

Strand Displacement in DNA Triplexes 1037

and accurate determination of the respective tm

values, and consequently of the thermodynamicparameters, is dif®cult. At pH 7.5 (Figure 2(a)) thetwo transitions are reasonably resolved: the ®rst,low-temperature transition is assigned to the con-version from a triplex to a duplex � tail (Ds), andthe second transition at higher temperature to themelting of the duplex into single strands (S � L).From the scheme presented in Figure 1 (center),one can see that the ®rst transition should corre-spond to an intramolecular rearrangement,whereas the second transition involves the separ-ation of two strands. As expected for an intramole-cular reaction, the tm of the ®rst transition wasconcentration-independent, whereas the tm of thesecond transition increased when higher strandconcentrations were used (Figure 3(b)).

The melting behavior of the guanine-rich tri-plexes (GT, GA and GTA) was different: under allconditions tested, the transitions were monophasic(Mills & Klump, 1998), in agreement with a relatedsystem (Vo et al., 1995). These transitions are verysimilar in shape as well as in the observed hyper-chromicity, which is identical to what is observedduring the melting of the duplex, but they areshifted to higher temperatures, especially in thecase of a GTA third strand (Figure 2(a) and (b)).These transitions could be analyzed as two-state

bimolecular processes; they give excellent linear®ts according to this model, as shown inFigure 3(a). The GT and GA third strands were ofsimilar af®nity, judging from their melting tem-peratures (39.5 and 40 �C). The mixed third strand(in 22Pu.GTA1) has the highest tm (43.5 �C) as pre-viously observed (Mills & Klump, 1998).

Variations in the sequence of the reverse Hoogs-teen domain made a signi®cant difference in bind-ing of the target 9Py1 strand: at pH 7.0 the tm ofthe 22Pu.GTmut oligomer was only 36 �C, as com-pared to 40 �C for the ``wild-type'' 22Pu.GT1strand. In a similar way the tm values of the22Pu.GTAmut and 22Pu.GAmut oligomers werereduced to 38 �C and 35 �C, respectively, as com-pared to 43 �C and 40 �C for the 22Pu.GTA1 and22Pu.GA1 strands. In other words, the introductionof a single mismatch in the reverse Hoogsteen partof the 22mer destabilizes the structure, and leadsto melting temperatures closer or identical to thetm of the short duplex (36 �C). To con®rm thereverse Hoogsteen base pairing, we designed a 22-mer (called 22Pu.7), where four of the ®ve gua-nines in the Watson-Crick part were replaced by 7-deazaguanine, a base analog that destabilizes tri-plexes. When mixed with 9Py1, the tm of 22Pu.7was only 35.5 �C, as compared to 40 �C for the22Pu.GT1 strand and 36 �C for 9Pu1. This indicates

Table 1. List of the oligonucleotides tested in this study

Name Sequence e(� 10ÿ3)

System 19Pu1 GAAGAGAGG 1049Py1 CCTCTCTTC 6922Py.TC1 CCTCTCTTCCCTTCTTCTCTCC 16822Py.TT1 CCTCTCTTCCCTTTTTTTTTTT 17222Pu.GT1 GAAGAGAGGCCTTGGTGTGTTG 21822Pu.GT mut GAAGAGAGGCCTTGGTGGGTTG 21922Pu.7 GAA7A7A77CCTTGGTGTGTTG 21822Pu.GA1 GAAGAGAGGCCTTGGAGAGAAG 23522Pu.GA mut GAAGAGAGGCCTTGGAGGGAAG 23222Pu.GTA1 GAAGAGAGGCCTTGGAGAGTTG 22722Pu.GTA mut GAAGAGAGGCCTTGGAGGGTTG 22422Pu.TT1 GAAGAGAGGCCTTTTTTTTTTT 20622Pu.co1 GAAGAGAGGCCTTAGGAAAGGG 235System 29Pu2 GGAGAGAGA 1059Py2 TCTCTCTCC 6922Py.TC2 TCTCTCTCCCCTTCCTCTCTCT 16822Pu.GT2 GGAGAGAGACCTTTGTGTGTGG 21922Pu.GA2 GGAGAGAGACCTTAGAGAGAGG 238System 39Pu3 AGAGAGAGG 1059Py3 CCTCTCTCT 6822Py.TC3 CCTCTCTCTCCTTCCTCTCTCT 16822Pu.GT3 AGAGAGAGGCCTTGGTGTGTGT 220System 49Pu4 GAAGAGAGA 1079Py4 TCTCTCTTC 6822Py.TC4 TCTCTCTTCCCTTCTTCTCTCT 17022Pu.GT4 GAAGAGAGACCTTTGTGTGTTG 219System 511Pu5 GAAGAGAGGAG 12711Py5 CTCCTCTCTTC 8426Py.TC5 CTCCTCTCTTCCCTTCTTCTCTCCTC 19826Pu.GT5 GAAGAGAGGAGCCTTGTGGTGTGTTG 26026Pu.GA5 GAAGAGAGGAGCCTTGAGGAGAGAAG 282System 613Pu6 GAAAGAGAGGAGG 14913Py6 CCTCCTCTCTTTC 9930Py.TC6 CCTCCTCTCTTTCCCTTCTTTCTCTCCTCC 17030Pu.GT6 GAAAGAGAGGAGGCCTTGGTGGTGTGTTTG 30030Pu.GA6 GAAAGAGAGGAGGCCTTGGAGGAGAGAAAG 326

Column 1 lists the abbreviated name, followed by the primary sequence of the oligonucleotide (column 2),and the extinction coef®cient calculated according to Cantor & Warshaw (1970) (right column). The abbreviatedname follows the convention de®ned in Experimental Procedures: the length of the oligomer (in nucleotides) isfollowed by the nature of the strand involved in the Watson-Crick duplex (Pu or Py), and, for long oligonucleo-tides, the nature of the third strand is then given (TC, GA, GT, GTA or control sequence, unable to form a stabletriplex). The last digit corresponds to the system number. The sequence is written 50 ! 30 for all oligonucleo-tides. 7 stands for 7-deazaguanine. For long oligonucleotides (22 bases or more) the primary sequences havebeen designed with the following rules: the Watson-Crick complementary bases are located at the start of thesequence (50). They are followed by the same connecting loop (CCTT, bold caracters), then by the triplex part(underlined).


that this foldback oligomer, which is unable toform stable Hoogsteen or reverse Hoogsteenbonds, has a reduced binding af®nity. All theseresults are in excellent agreement with purine tri-plex formation.

It should also be noted that the heating of eachindividual strand alone (9Pu1, 9Py1, 22Py.TC1,22Pu.GA1, 22Pu.GT1 or 22Pu.GTA1) did not showany cooperative melting behavior under all testedexperimental conditions, except for the 22Py.TC1oligomer at pH 6.0 or lower. The 22Pu.GA1 strandshowed some gradual increase in absorbance butno cooperative melting curve (Mills & Klump,1998). The absence of self-association of the gua-nine-rich strands is probably due to the in¯uence

of the monovalent cation used in this study (Li�).We performed a few experiments in the presenceof potassium instead of lithium: tm values werecomparable for system 1, but alternative structures(G-quartets) were observed when longer oligonu-cleotides were investigated (systems 5-6).

As further proof of triplex formation, we per-formed preliminary 1H NMR studies for system 5(not shown). The exchangeable imino protonregions of the spectra were compared for the11Py5/11Pu5 (duplex), 11Py5/26Pu.GT5 (GT tri-plex) and 26Py.TC5/11Pu5 (TC triplex) mixtures.At pH 6.2, in the presence of 0.1 M LiCl and10 mM MgCl2, the spectra of the three sampleswere very different. The duplex showed a few

Figure 2. Denaturation pro®les obtained for the 9Py1/9Pu1 mixture (�), 9Py1/22Pu.GTA1 (diamonds) 9Py1/22Pu.GT1 (triangles) and 22Py.TC1/9Pu1 (circles). Y-axis: absorbance values at 260 nm; ÿ0.2 offsets for the triplexes.Experimental conditions: 10 mM sodium cacodylate buffer, 0.1 M LiCl, 10 mM MgCl2. (a) Upper part: at pH 7.5. (b)Lower part: at pH 6.0.


peaks in the 12.5-14 ppm region, corresponding toH-bonded imino protons of T �A and G �C base-pairs. The pyrimidine triplex was evidenced by thepresence of well-resolved extra H-bonded iminopeaks, especially in the 14.5-15.2 region, which aretypical of protonated cytosine imino protons (delos Santos et al., 1989; Rajagopal & Feigon, 1989).The spectrum of the 11Py5/26Pu.GT5 mixture wasalso different, and extra H-bonded imino protonswere observed in the 12 to 14.4 ppm region, ascompared to the duplex. The extra resonances arein excellent agreement with the formation ofreverse Hoogsteen hydrogen bonds with the baseof the third strand: each base triplet should lead to

the presence of one H-bonded imino resonance inthe spectrum (H1 for guanine, H3 for thymine).

Analysis of the thermodynamic parameters

The melting pro®les were treated according tothe method described in Experimental Procedures.Examples of such curves at pH 6.0 are given inFigure 3(a). As can be seen from this Figure, mostmelting pro®les gave excellent linear ®ts. Thisallowed us to estimate ÿ�H�/R from the slope ofthe curve and �S�/R from the Y-intercept, whereR is 1.98 cal molÿ1 kÿ1. The numerical results forall oligonucleotides at three different pH values are

Figure 3. Thermodynamic analysis of the meltingpro®les. (a) Upper part: Y-axis: natural logarithm of theaf®nity constant for the reaction, calculated from themelting pro®les at 260 nm. 9Py1/9Pu1 mixture (�),9Py1/22Pu.GTA1 (diamonds), 9Py1/22Pu.GT1 (invertedtriangles) 9Py1/22Pu.GA1 (triangles) and 22Py.TC1/9Pu1 (circles). Experimental conditions: 10 mM sodiumcacodylate buffer, 0.1 M LiCl, 10 mM MgCl2 (pH 6.0).X-axis: reciprocal of the temperature (in K). In thisrepresentation, the slope of the ®t is directlyproportional to the �H� of the reaction. (b) Lower part:concentration dependence of the Tm values for the22Pu.GT1/9Py1 triplex (triangles) and for the22Py.TC1/9Pu1 triplex (circles) at pH 6.0. Vertical axis:reciprocal of the melting temperature (K). Horizontalaxis: natural logarithm of the strand concentration (M).


summarized in Table 2 (column �H�(a)). Most ofthe graphs run parallel to each other. As anexample, GA triplex melting gives a straight lineparallel to the duplex line ®t, but shifted to higherY-values. This result means a similar �H� valuecompared to the duplex, but a more favorable (i.e.,less negative) entropy of formation; the existenceof a third strand does not provide any extra favor-able enthalpy of binding. At each temperature, theaf®nity constant is shifted by approx 0.8 unit ona log scale, which means that the equilibriumconstant of the complex formed by the 9Py1/22Pu.GA1 mixture is 2.2 times the af®nity constantof the duplex at the same temperature. In contrast,

the slope of the linear ®t for the pyrimidine triplexis more pronounced (at this pH, a single transitionis obtained for the 22Py.TC1/9Pu1 mixture, whichcorresponds to a triplex-to-single strands equili-brium). At pH 6.0 the �H� values of the duplex,the GA (purine) triplex, the GT triplex and the TC(pyrimidine) triplex formed from single strandswere ÿ67, ÿ69, ÿ80 and ÿ119 kcal/mol, respect-ively. These values were the same, within exper-imental error, at pH 7.0 and 7.5 for the duplex andthe GA/GT/GTA triplexes. An independent meth-od to con®rm these �H� values is provided by theanalysis of the concentration dependency of themelting temperatures (Shafer, 1998). Four to ®vestrand concentrations were tested in the range1-20 mM. An example of a 1/Tm versus ln(Co) plotis given in Figure 3(b). We only determined �H� atpH 6.0 by this method. The results are summarizedin Table 2 (column �H�(b)). There is reasonableagreement between these two independent datasets (�H�(a) is given ®rst): ÿ67 and ÿ70 kcal/molfor the duplex, ÿ69 and ÿ71 kcal/mol for the GAtriplex, ÿ80 and ÿ76 kcal/mol for the GT triplex,ÿ79 and ÿ75 kcal/mol for the GTA triplex and,®nally, ÿ119 and ÿ107 kcal/mol for the TC triplex.This agreement supports the assumption of a two-state model chosen for the determination of theparameters from the analysis of meltingtransitions.

The values of �H�(a) and �H�(b) given inTable 2 correspond to the formation of a triplexfrom randomly coiled single strands (T$ S � L,see Figure 1); they do not give a proper estimate of�H� for triplex formation when a third strand isadded to a duplex. It was possible to obtain thisinformation at pH 7.5 for the pyrimidine triplex, asthe two transitions were well separated. The �H�of duplex-to-triplex formation was calculated to beÿ59 kcal/mol. Such uncoupling between the melt-ing of a double and a triple helix was not observedfor the guanine-rich triplexes, which never gaverise to two independent melting transitions. Inother words, the Ds species displayed in Figure 1are not observed. To estimate the �H� of thirdstrand binding to a duplex, an indirect methodwas required. As thermodynamic values are statefunctions, they are independent of the reactionpath. It is therefore possible to split arti®cially the(T$ S � L) transition into (T$ Ds) and(Ds$ S � L). The analysis of the melting pro®lesas well as of the concentration dependency of thesetransition temperatures allowed us to measure�H� and �S� for the (T$ S � L) transition:

�H��T$ Ds� ��H��T$ S� L�ÿ�H��Ds$ S� L�

�S��T$ Ds� ��S��T$ S� L�ÿ�S��Ds$ S� L�

�G��T$ Ds� ��G��T$ S� L�ÿ�G��Ds$ S� L�


The �H� and �S� values for (Ds$ S � L) couldbe determined: (i) from the melting of the duplexitself (D$S � S); (ii) from the melting of a duplexwith a overhanging non-complementary tail(9Py1/22Pu.co1); and (iii) from the second tran-sition of the 22Py.TC1/9Pu1 at high pH. Thesethree transitions occurred in the same temperaturerange, and gave �H� values ranging fromÿ65 kcal/mol to ÿ72 kcal/mol. We chose theshort duplex as a reference, and the result of thecomputations is given in Table 2, right (��H� and��G�(0 �C) columns). Several conclusions may bedrawn from these results: (i) �H� of pyrimidine tri-plex formation (T$ Ds) varies between ÿ51 andÿ59 kcal/mol, i.e. ÿ6.1(�0.5) kcal/mol of base-tri-plet; (ii) �H� of GT triplex formation (T$ Ds) isfound between ÿ13 and ÿ16 kcal/mol, i.e.ÿ2.5(�0.2) kcal/mol per base-triplet; (iii) the �H�of purine (GA) triplex formation (T$ Ds) isvery close to 0 (ÿ2 to �1 kcal/mol, i.e.ÿ0.1(�0.2) kcal/mol per base-triplet); (iv) �H� ofthe GTA triplex formation is intermediate betweenthe values found for the GT and GA triplexes(ÿ1.3(�0.3) kcal/mol per base-triplet).

In summary, �H� for GT triplex formation isroughly one third of the value found for the TC tri-plex, whereas �H� for GA triplex formation isclose to 0. This less favorable enthalpy of triplexformation for the GT and GA triplexes is compen-

Table 2. Thermodynamic parameters obtained for triplex an

Oligos Type pH tm (�C)�H�(a)

(kcal/mol)�H�(b)

(kcal/mol) (ca

9Py1/9Pu1 6.0 36 ÿ67.1 ÿ707.0 36 ÿ64.67.5 35.5 ÿ66.8

9Py1/22Pu.co1 6.0 35 ÿ72.0

7.0 35 ÿ70.27.5 34 ÿ66.7

9Py1/22Pu.GA1 6.0 39 ÿ69.2 ÿ71

7.0 39.5 ÿ63.77.5 39.5 ÿ66.3

9Py1/22Pu.GT1 6.0 40 ÿ80.5 ÿ76

7.0 40 ÿ80.47.5 40 ÿ80.1

9Py1/22Pu.GTA1 6.0 43 ÿ79.4 ÿ75

7.0 43.5 ÿ77.57.5 43.5 ÿ76.0

9Pu1/22Py.TC1 6.0 43 ÿ118.7 ÿ107

tm1 7.5 16 ÿ59.07.0 27 (2 poorly resolved transition

tm2 7.5 37 ÿ72.27.0 37 (2 poorly resolved transition

All experiments were performed in 10 mM sodium cacodylate b�0.5 �C; �H�(a), �5 kcal/mol; �H�(b), �10 kcal/mol; �S�, �7 cal mwere calculated from the ln(K) versus 1/Tm plots (strand concentrexample). �H�(b), which is given only at pH 6.0, is deduced fromthe melting temperature (see Figure 3(b), for example). The two stsingle transition, except for the Pyrimidine triplex system (22Py.TCtm2, see Figure 2). Average values of two to four experiments are rethe 9Pu1/9Py1 values.

sated for by a more favorable entropic contri-bution. This leads to an interesting observation: atlow temperature (0 �C), and even at pH 7.5, themost stable triplex (i.e. the triplex with a morenegative �G� of formation) is the pyrimidine tri-plex, despite the fact that its tm is lower than the tm

of the guanine-rich triplexes (16 �C instead of 40-43 �C). This illustrates that the Tm alone cannotre¯ect the stability of the various complexes if their�H� values of formation are very different. Thisled us to investigate the possibility of exchangebetween pyrimidine and guanine-rich third strandsas a function of temperature.

Competition of the guanine-rich and thepyrimidine strand for the binding to thecore duplex

The observation that the �G�(0 �C) of pyrimidinetriplex formation was more negative than the�G�(0 �C) of a GA, GT or GTA triplex encouragedus to determine whether, upon lowering the tem-perature, a pyrimidine third strand could displacea guanine-rich third strand from the major grooveof a DNA duplex to form a pyrimidine triplex plusan overhanging purine strand. To test this hypoth-esis, we mixed two long strands (L � L), in themanner described for Figure 1, right panel. The fol-lowing mixtures were prepared: 22Py.TC1/

d duplex formation in system 1

�S�l molÿ1 Kÿ1)

�G�(0 �C)(kcal/mol) �tm (�C)

��H�(kcal/mol)

��G�(0 �C)(kcal/mol)

ÿ190 ÿ15.2ÿ182 ÿ15.0ÿ190 ÿ15.1

ÿ200 ÿ15.9 ÿ1.0 ÿ4.9 ÿ0.7ÿ191 ÿ15.4 ÿ1.0 ÿ5.2 ÿ0.2ÿ190 ÿ14.8 ÿ1.5 ÿ0.1 �0.3

ÿ193 ÿ16.2 �3.0 ÿ2.1 ÿ1.0ÿ177 ÿ15.5 �3.5 �0.9 ÿ0.5ÿ180 ÿ15.5 �4.0 �0.5 ÿ0.5

ÿ230 ÿ17.7 �4.0 ÿ13.7 ÿ2.5ÿ230 ÿ17.4 �4.0 ÿ15.8 ÿ2.4ÿ229 ÿ17.3 �4.5 ÿ13.3 ÿ2.4

ÿ224 ÿ18.3 �7.0 ÿ12.3 ÿ3.1ÿ217 ÿ17.6 �7.5 ÿ12.9 ÿ2.6ÿ213 ÿ18.0 �8.0 ÿ9.2 ÿ2.9

ÿ348 ÿ23.6 �7.2 ÿ51.4 ÿ8.4ÿ205 ÿ3.4 n/a ÿ59.0 ÿ3.4

s)ÿ205 ÿ16.3 �1.5 ÿ5.4 ÿ1.1

s)

uffer in 0.1 M LiCl and 10 mM MgCl2. All tm values are givenolÿ1 Kÿ1; �G�(0 �C), �0.4 kcal/mol. The �H�(a) and �S� values

ation 3 mM), which gave linear ®ts (r > 0.99, see Figure 3(a) forthe concentration dependence (strand concentration, 1-20 mM) ofrands were mixed at an equimolar ratio. These mixtures gave a1/9Pu1), which gave two transitions at pH 7.0 and 7.5 (tm1 andported. �tm, ��H� and ��G�(0 �C) are obtained by subtracting

Figure 4. Melting pro®les of the complexes formed bylong strands (see Figure 1) Denaturation pro®les of the22Py.TC1/9Pu1 (circles) and 22Py.TC1/22Pu.GT1 (opendiamonds) at pH 7.0, recorded at two different wave-lengths: (a) Upper part: 260 nm. The two melting pro-cesses are indicated (Tm1 and Tm2). (b) Center: 295 nm.Only the ®rst melting process is observed at this wave-length (Tm1). (c) Lower part: fraction of folded oligonu-cleotide (y) as a function of temperature. Circles:22Py.TC1/9Pu1 (y calculated from the experimentalpoints at 295 nm). Diamonds: 22Py.TC1/22Pu.GT1 (ycalculated from the experimental points at 295 nm). Bro-ken line: theoretical reconstruction of the y versus T plotfor the 22Py.TC1/22Pu.GT1 complex.


22Pu.GT1, 22Py.TC1/22Pu.GA1 and 22Py.TC1/22Pu.GTA1, and compared with the reference pyri-midine triplex 22Py.TC1/9Pu1. The melting pro-®les of 22Py.TC1/22Pu.GT1 and 22Py.TC1/9Pu1(pH 7.0) are compared in Figure 4 at two differentwavelengths. As stressed before, the melting of thepyrimidine triplex (22Py.TC1/9Pu1) at neutral pHgave rise to two transitions at 260 nm, which werenot resolved: i.e. the melting of the duplexoccurred in a temperature range where the triplexwas not fully dissociated. A signi®cant hyperchro-mism at 295 nm was observed, as described forDNA structures involving cytosine protonation(i.e. i-DNA, Hoogsteen duplexes and pyrimidinetriplexes (EscudeÂ et al., 1996; Lavelle & Fresco,1995; Mergny et al., 1995). This hyperchromism isthe result of the difference in absorption (e)between cytosine and N3-protonated cytosine.Therefore, at this wavelength we can follow theT$ Ds transition without any interference fromthe second transition (duplex dissociation). A tm of27 �C for the 22Py.TC1/9Pu1 pyrimidine triplexwas determined (Figure 4(b)).

In contrast, the 22Py.TC1/22Pu.GT1 complexshowed two well-resolved transitions at 260 nm(tm1 and tm2, Figure 4(a)) but only one transition at295 nm (tm1, Figure 4(b)). Similar results wereobtained for the 22Py.TC1/22Pu.GA1 and22Py.TC1/22Pu.GTA1 complexes (tm values shownin Table 3). The second transition occurred at high-er temperatures and always corresponded to thevalues obtained for the corresponding guanine-richtriplex under identical conditions (40, 43.5 and40 �C for the GA, GTA and GT triplexes, respect-ively). Not only were the tm values identical, butthe shapes and hyperchromisms were also verysimilar. These results strongly suggest that, uponlowering the temperature, the guanine-rich triplexis ®rst formed without any interference from thepyrimidine hanging strand. Upon further loweringof the temperature, a new transition was observedfor the 22Py.TC1/22Pu.GT1 complex. This tran-sition had a lower tm1 than that of the correspond-ing pyrimidine triplex (18 �C instead of 27 �C) butsimilar hyper-/hypo-chromisms at 260 and295 nm. This lower temperature (tm1) transitionwas not observed when the 22Py.TT1 and22Pu.GT1 oligos were mixed whereas the hightemperature transition (Tm2) was not affected (notshown: 22Py.TT1 is an oligonucleotide with a T9 30tail, unable to form a stable pyrimidine triplex).These results suggest that the pyrimidine tail doesnot hamper GA/GT or GTA triplex formation.How can we explain the lower temperature (tm1)transition? The change in absorbance at 295 nmsuggests that protonated cytosines are involved inthe process. Furthermore, a Hoogsteen-comp-lementary pyrimidine third strand is required: thecontrol oligonucleotide 22Py.TT1 is unable to giverise to this phenomenon. These observations takentogether strongly suggest that a pyrimidine triplexis formed at low temperature, i.e. that the pyrimi-dine single strand extension is able to displace the

GT strand from the major groove of DNA. Thismodel is strenghtened by the following obser-vation: from the ln(K) versus 1/T curves, it is poss-ible to calculate at every temperature the cost ofremoving the reverse Hoogsteen GT strand: this�G� cost varies between 2.4 (at 0 �C) and 0.8 kcal/mol (at 45 �C) for the GT strand. One can (i) deter-mine the �G�(T) of pyrimidine triplex formation

Table 3. tm values (in �C) obtained for triplex and duplex formation in systems 1 to 6 at pH 7.0

Systemnumber: 1 2 3 4 5 6

OligosSequence: GAAGA-

GAGGGGAGA-

GAGAAGAGA-

GAGGGAAGA-

GAGAGAAGAG-

AGGAGGAAAGAG-

AGGAGG

Duplex 36 34 36.5 29 47.5 54GA triplex 39.5 44 - - 53 59.5GT triplex 40 37 41 29.5 51 58.5GTA triplex 43.5 - - - - -TC triplex (tm1) 27 26 21 29.5a 26 30.5TC/GA triplexes (tm1) 18 18 - - 18 16TC/GT triplexes (tm1) 18 21 18 26 19 15TC/GTA triplexes (tm1) 16 - - - - -

The sequences of all oligonucleotides are given in Table 1. All experiments were performed in a 10 mM sodium cacodylate bufferwith 0.1 M LiCl and 10 mM MgCl2. In all systems involving 22Py.TC, two transitions were obtained (except system 4); and only thetm of the lowest transition is indicated (tm1). This tm was determined at 295 nm. Average of two independent experiments. -, notdetermined. a, Only one transition was observed. Most strand displacement experiments were performed with a GT and not a GAguanine-rich strand, as the GA and TC third strands may also form a canonical, undesired Watson-Crick duplex; this alternativestructure complicates the analysis.


for the 22Py.TC1/9Pu1 complex from the meltingpro®le at 295 nm (Figure 4(b), circles); (ii) take intoaccount the cost of removing the GT third strand;and (iii) recalculate the equilibrium curve of the22Py.TC1/22Pu.GT1 mixture after this operation.The result of this competition is a melting curvewith a tm of 16 �C (as compared to 18 �C for theexperimental curve; tm1, see Figure 4(c)). Thisdemonstrates that a third strand replacement ispossible, and that the actual experimental curve®ts reasonably well with the calculated data. Simi-lar results were observed for the 22Py.TC1/22Pu.GA1 and 22Py.TC1/22Pu.GTA1 complexes.In the latter case, as the thermal stability of theGTA triplex is increased compared to the GT andGA triplex, it is not surprising to ®nd a slightlylower tm1 (16 instead of 18 �C).

Finally, as expected, tm1 was concentration-independent (not shown) but pH-dependent (statediagram shown in Figure 5(a)), in contrast to tm2,which was concentration-dependent and pH-inde-pendent. The cytosines in the third strand must beprotonated at the N3 position in order to form thepyrimidine triplex at low temperatures, whereasguanine-rich triplexes do not require protonation.Therefore, the equilibrium between the two tri-plexes should be pH-dependent. This was indeedobserved in the pH range 6.5 to 7.5. Above pH 7.5,tm1 disappeared, and below pH 6.5 only two con-formers were present: the pyrimidine triplex (Ts1)and the single strands (L � L). In the presence ofmagnesium, the duplex species (Dss, Figure 1,right) was never dominant at any pH or tempera-ture. At pH 6, upon lowering the temperaturefrom 50 �C, the pyrimidine triplex was formeddirectly from the (L � L) single strands, whereasabove pH 6.5, the GT triplex was formed ®rst fromthe (L � L) single strands before transition to thepyrimidine triplex took place at lower tempera-tures.

Sequence effects

The unusual triplex-to-triplex conversiondescribed above was observed in the context of aselected sequence (system 1). We wanted to inves-tigate whether the same phenomenon would alsobe observed for other sequences. Toward this goal,we designed three other systems of identical lengthto system 1 (systems 2, 3 and 4) and two other sys-tems using longer oligonucleotides (systems 5 and6, resulting in the formation of 11 and 13 base-pairs/base-triplets, respectively: the state diagramsfor these two systems are presented in Figure 5(b)and (c), respectively). The sequences of all theseoligonucleotides are given in Table 1, and the tm

values obtained at 3 mM strand concentration forthe different possible structures are given inTable 3. One of the common features of all thesesystems is an asymmetrical sequence which allowsthe core duplex to form without interference fromthe extending third strand.

Figure 6 presents a selection of the ®rst deriva-tive plot of some of the melting pro®les obtainedwith system 5 (11 and 26-mers) at 20 mM strandconcentration. Several conclusions can be drawnfrom these pro®les: (i) as expected, the meltingtemperature of the longer duplexes is shifted tohigher temperatures as compared to shorterduplexes (Figure 5(b) and (c)) and the tm is concen-tration-dependent, in agreement with a bimolecu-lar process. (ii) In the case of the pyrimidinetriplex, two transitions were observed, which cor-respond to triplex-to-duplex conversion (tm1) andduplex-to-single strand conversion (tm2), respect-ively. tm1 was concentration-independent (notshown), whereas tm2 was concentration-dependent.The tm of the second transition was always within0.5 deg.C of the tm of the duplex, and the shape ofthe melting curves was very similar. The lowtemperature transition was associated with a hypo-chromic effect at 295 nm, indicating cytosinedeprotonation upon third strand release (not

Figure 5. tm values as a function of pH for threedifferent systems. Experimental conditions: 10 mMsodium cacodylate buffer, 0.1 M LiCl, 10 mM MgCl2;3 mM strand concentration. Except at low pH, the melt-ing pro®les were biphasic, with two tm values: tm1(circles) and tm2 (squares). The lines plotted on the statediagram represent the midpoints of each melting tran-sition, therefore delineating regions of the pH versustemperature space where different species dominate(Plum, 1998). Note that the duplex � tail species (Ds) isabsent from these diagrams. In other words, at thismagnesium concentration, only single strands andtriplexes are observed at this pH and temperaturerange. The value for the upper transition (tm2) is concen-tration-dependent. (a) Upper part: 22Py.TC1/22Pu.GT1(duplex of 9 bp, system 1). (b) Center: 26Py.TC5/26Pu.GT5 (duplex of 11 bp). (c) Lower part: 30Py.TC6/30Pu.GT6 (duplex of 13 bp).


shown). (iii) In contrast, for the GT triplex, a singleconcentration-dependent transition was observed,at a signi®cantly higher temperature than for theduplex. The amplitude of this transition is also

20 % larger than the amplitude of the duplex(Figure 6). (iv) In the case of the 26Py.TC5/26Pu.GT5 mixture, two transitions were observed.The highest transition was very similar to thetransition of the GT triplex, not only in tm, but alsoin shape and amplitude. The ®rst concentration-independent transition was obtained at a lowertemperature than the pyrimidine triplex, but alsoinvolved a change of absorbance at 295 nm. Byanalogy with system 1, which was morethoroughly characterized, we attributed tm1 toan intramolecular TC-to-GT triplex conversion(Ts1 $ Ts2), and tm2 to the dissociation of the GTtriplex into single strands (Ts2$ L � L). Identicalresults were observed for systems 2, 3 and 6.

However, this triplex exchange phenomenonwas not observed for all sequences: system 4 haddifferent behavior from the others (see Table 3).For this sequence, the G�C content of the duplexhad been reduced: a G �C base-pair in system 2was replaced by an A �T base-pair in system 4.This single substitution caused an expecteddecrease in duplex stability (�tm � 5-7 �C), and anincrease in the pyrimidine triplex stability atpH 7.0: the primary sequence of the duplex allowsthe formation of alternating T �A * T and C �G * C �triplets, a very favorable case according to a modelstudy (Roberts & Crothers, 1996b). In contrast, weobserved a concomitant decrease in the GT triplexstability. The dissociation of the pyrimidine triplexyielded a monophasic transition, even at pH 7.0,suggesting that the triplex dissociated into singlestrands without any signi®cant amount of double-stranded intermediate at all temperatures. In thiscase, when the 22Pu.GT4 and 22Py.TC4 oligonu-cleotides were mixed, no GT triplex was formed atany temperature, and below 27 �C the predominantform was the pyrimidine triplex.

Therefore, in the presence of 10 mM MgCl2, theguanine-rich triplex (GT) is the predominant com-plex at 37 �C for systems 1, 2, 3, 5 and 6. All theirduplex target sequences have a G�C content high-er than 50 % (®ve G �C � four A �T base-pairs forsystem 1-3, six G �C � ®ve A �T for system 5, andseven G �C � six A �T for system 6). The situationwas reversed in system 4 (®ve A �T � four G �C)and a large difference in the relative stability of thedifferent triplexes was observed.

Influence of magnesium concentration

The magnesium divalent ion has an importantin¯uence on the stability of triplexes, especially forpurine-rich third strands. We investigated theeffect of magnesium concentration on the stabilitiesof the duplex, and of the TC and GT triplexeswhich occur in systems 1 and 5. The results con-cerning system 5 are summarized in Figure 7,where the tm values of the different species are pre-sented as a function of magnesium concentration,displayed on a log scale (phase diagram). Qualitat-ively similar results were obtained with system 1(not shown). Several conclusions can be drawn

Figure 6. First derivative meltingpro®les for the 11/26-mers (system5). Experimental conditions: 10 mMsodium cacodylate buffer, 0.1 MLiCl, 10 mM MgCl2 (pH 7.0);20 mM strand concentration. Thearea under each peak is directlyrelated to the hyperchromismassociated with the melting ofthe structure. 11Py5/11Pu5 (�),26Py.TC5/11Pu5 (circles), 11Py5/26Pu.GT5 (inverted triangles),26Pu.TC5/26Pu.GT5 (open dia-monds).


from these results: (i) the stability of the 11Py5/11Pu5 duplex, as well as the stabilities of the con-formers of 26Py.TC5/11Pu5, increase with increas-ing magnesium concentration (Figure 7(a)). Thehigh transition temperature for the 26Py.TC5/11Pu5 mixture was identical (within experimentalerror) to the unfolding temperature of the 11Py5/11Pu5 duplex, showing again that the presence ofan overhanging strand had little effect, if any, onthe stability of the duplex. (ii) The stability of theGT triplex, shown in Figure 7(b) for the 11Py5/26Pu.GT5 complex, was more affected by the pre-sence of magnesium. At 1 mM MgCl2 its tm wasidentical to the tm of the duplex, arguing againstthe formation of a stable triplex. (iii) When the26Py.TC5 and 26Pu.GT5 oligonucleotides weremixed, two transitions were observed which haveopposite magnesium dependencies. The higher tm

(tm2) matches the tm of the 11Py5/26Pu.GT5 mix-ture at all magnesium concentrations. The lower tm

(tm1), which corresponds to the TC-to-GT triplexconversion at 10 mM MgCl2, decreases when mag-nesium concentration increases. This is the result ofa differential effect of magnesium on the two typesof triplexes. As the stability of the guanine-rich tri-plex is more dependent on the presence of mag-nesium than that of the pyrimidine triplex, thebalance between the two triplexes is shifted by achange in magnesium concentration. Meltingexperiments were also performed at pH 6.0 in thepresence of various concentrations of magnesium(1-20 mM) and only one transition was observed inall cases, which corresponded to the pyrimidine tri-plex dissociating into single strands (not shown).

To con®rm the effect of magnesium on the rela-tive stabilities of the oligonucleotides, mung beannuclease footprinting was performed in the pre-sence of different concentrations of magnesium

chloride on system 6 at pH 7.0. The results are pre-sented in Figure 8. The addition of 13Pu6 or30Pu.GT6 to the radiolabeled 30Py.TC6 leads toan alteration in the cleavage pattern. As expected,a protection of the sequence involved in Watson-Crick duplex formation was observed (lanes 2, 3, 5and 6). In contrast, a strong enhancement of clea-vage in the region of the CCTT loop was obtained.The situation in the triplex region (i.e. the 30 side ofthe oligonucleotide, corresponding to the longestfragments in the denaturing gel) was more com-plex. Partial protection was observed at both mag-nesium concentrations in the presence of the 13Pu6oligonucleotide, showing that TC triplex formationeffectively occurred at this pH (lanes 2 and 5).When the unlabeled 30Pu.GT6 was added to theradiolabeled 30Py.TC6 oligonucleotide, a footprintin the triplex region was obtained only at low mag-nesium concentration (lane 3), whereas at 10 mMMgCl2, strong reactivity was seen (lane 6).

These observations were con®rmed qualitativelywhen the other strand was radiolabeled(30Pu.GT6, lanes 7-12). As a result of the lowerreactivity of mung bean nuclease with the labeledstrand alone (lanes 7 and 10), no clear footprint ofthe duplex region was seen in the presence of13Py6 or 30Py.TC6. Nevertheless, a strong hyper-reactivity of the loop region was found (lanes 8, 9,11 and 12), and a partial footprint was seen in thetriplex region. The footprint in the triplex regionwas symmetrical to the footprint observed whenthe other 30-mer was labeled: at low magnesiumconcentration, the nucleotides on the 30 side of the30Py.TC6 labeled strand were protected from clea-vage (lane 3), whereas the 30 nucleotides of the30Pu.GT6 oligomer were cleaved (lane 9). Thisresult is in agreement with pyrimidine triplex for-mation at low magnesium concentration. In con-

Figure 7. tm values as a functionof MgCl2 concentration. Experimen-tal conditions: 10 mM sodiumcacodylate buffer, 0.1 M LiCl,1-20 mM MgCl2 (pH 7.0); 3 mMstrand concentration. The meltingpro®les were biphasic, with two tm

values: tm1 (circles) and tm2(squares). (a) Upper part:26Py.TC5/11Pu5 mixture. Thesingle tm for the 11Py5/11Pu5duplex is also given for comparison(®lled triangles). (b) Lower part:26Py.TC5/26Pu.GT5 mixture. Thesingle tm values for 11Py5/11Pu5duplex (�) and for 11Py5/26Pu.GT5 (open triangles) are alsogiven for comparison.


trast, the reverse situation was obtained at highermagensium concentration: the pyrimidine thirdstrand was cleaved (lane 6), whereas the GT thirdstrand was partially protected (lane 12).

The magnesium concentration may therefore actas a switch between two triplex structures. A slightdifference is nevertheless observed between theresults deduced from spectroscopic and footprint-ing experiments: from the phase diagram shown inFigure 5(c), one would expect the pyrimidine tri-plex to be the predominant species at low tempera-ture, even at high magnesium concentration. Inour mung bean assay, the purine strand was ableto replace the pyrimidine strand at 10 mM mag-nesium, possibly as a result of slightly differentincubation conditions. Nevertheless, both exper-iments con®rm the differential sensitivity of thesetriplexes to magnesium concentration, and showthat a change of temperature or of divalent cationconcentration may induce this strand exchangephenomenon.

Discussion

Intramolecular versus intermolecular triplexes

There are a number of ways of combining threestrands to form a triple helix: (i) intermolecularlyfrom three separate strands (Le Doan et al., 1987;Moser & Dervan, 1987); (ii) by a hairpin or a circletargeting a single strand (Giovannangeli et al.,1991; Kandimalla & Agrawal, 1995; Kool, 1991;Pascolo & ToulmeÂ, 1996; Xodo et al., 1990); or (iii)intramolecularly using a single strand, where allthree sequences involved in the triplex are linkedtogether. Intramolecular triplexes have facilitatedhigh resolution NMR studies (Macaya et al., 1991,1992; Radhakrishnan et al., 1991a,b, 1992; SkleÂnar& Felgon, 1990) and have simpli®ed thermodyn-amic studies on DNA triplexes (Plum & Breslauer,1995; Rentzeperis & Marky, 1995; VoÈ lker et al.,1993, 1997; VoÈ lker & Klump, 1994). In most of theexperiments described here, the third strand is

Figure 8. Mung bean nucleasefootprinting assays on system 6.The radiolabeled strand at 3 mMstrand concentration (30Py.TC6 or30Pu.GT6 shown at the top of theFigure) was incubated overnight atpH 7.0 alone (é, lanes 1, 4, 7, 10)or with an indicated complemen-tary strand (3 mM) at 6 �C in thepresence of 0.5 or 10 mM MgCl2.1 ml of mung bean nuclease wasadded to the samples, and the clea-vage reaction was performed for 45minutes at 4 �C. The samples wereanalyzed on a denaturing 20 %polyacrylamide gel. The position ofthe bases involved in Watson-Crickbase-pairing, the loop and thetriplex region are indicated on theright.


covalently linked to one strand of the duplex, via aCCTT loop. Therefore, the triplex-to-duplex tran-sition corresponds to an intramolecular reaction(cf. Figure 1). The thermodynamic paramatersdeduced from this type of complex are differentfrom those determined for an intermolecular reac-tion. This difference mainly concerns the entropicfactor, �S�, as the covalent link between two inter-acting strands corresponds to a high local concen-tration and a reduction of the conformational spaceof the system (VoÈ lker et al., 1997). It is generallyaccepted that the enthalpic factor, �H�, is notgreatly affected by the molecularity of the reactionand that the folding of the loop plays a signi®cantbut limited role in the enthalpic stability of thefolded form (VoÈ lker et al., 1997). For these reasonswe did not discuss in great detail the �S� valuesfound, but rather focused on the calculated �H�.The size of the loop (4 bases) was chosen to allowsuf®cient ¯exibility (Mills et al., 1996). The resultsobtained here could be of interest when discussingH-DNA (an intramolecular triplex), and help todetermine which of the two strands may fold backto form a local triple helix (Roberts & Crothers,1996a). Finally, this system might be useful whenrecognition of single-stranded DNA or RNA by cir-cular or hairpin oligonucleotides is contemplated.

Nevertheless, in order to establish whether the�H� values for guanine-rich triplexes could beapplied to intermolecular triplexes, we performedsome preliminary experiments in a differentsequence context, in which a 16-base long purine

oligonucleotide (d-50-AGGAGGAAAAGGAGGA-30) could bind to a 40 bp DNA duplex whichincluded the oligopyrimidine-oligopurine targetsequence d-50-AGGAGGAAAAGGAGGA-30/50-TCCTCCTTTTCCTCCT-30. The af®nity of the thirdstrand for the duplex was tested by EMSA exper-iments at three different temperatures in a 50 mMHepes buffer (pH 7.0) containing 0.1 M LiCl,10 mM MgCl2, with a radiolabeled third strand,and increasing concentrations of the target duplex,in order to minimize the self-association of thethird strand (Arimondo et al., 1998; Noonberg et al.,1995). Although bandshift techniques tend tounderestimate binding af®nities (Aich et al., 1998),the apparent Kd values determined at 4 �C, 20 �Cand 37 �C were identical (0.3 mM; not shown) ingood agreement with close-to-zero �H� values ofpurine triplex formation. It should be noted thatgel-shift assays could not be performed with sys-tems 1-4, as the lifetimes of the complexes were tooshort to keep the strands associated duringgel migration (90-150 minutes, depending ontemperature).

Interference with competing structures

GT or GA oligonucleotides are prone to formintra- or intermolecular structures such as G-quad-ruplexes (Cheng & Van Dyke, 1997). Such struc-tures are stabilized by physiological concentrationsof potassium cations, making this self-associationlikely in vivo. As a result, the ability of the triplex-


forming oligonucleotide to bind to its intended tar-get is reduced (Cheng & Van Dyke, 1993; Milliganet al., 1993; Olivas & Maher III, 1995a,b). Purine oli-gonucleotides also have the potential to formanother competing structure, a G �A parallelduplex (Arimondo et al., 1998; Noonberg et al.,1995). In most experiments presented here, lithiumwas used as the monovalent ion to minimize G-quartet formation. Indeed, none of the investigatedoligonucleotides exhibited a transition whenheated individually in the buffer used for mostexperiments.

Accuracy of the thermodynamic values and ofthe two-state model

One may argue that our thermodynamic par-ameters were obtained through model-dependentdeterminations. We nevertheless believe that ourmeasurements accurately re¯ect the �H� and �S�values of duplex and triplex formation. Our con®-dence is based on several observations.

(1) We followed the melting of the duplex andthe purine triplex at eight different wavelengths(ranging from 245 nm to 295 nm), in two indepen-dent experiments. Excellent agreement between thedifferent thermodynamic values determined ateach wavelength was obtained (not shown). Suchanalysis, although not as informative as a true 3-Dmelting curve deconvolution (Haq et al., 1997), wasnevertheless useful, and gave wavelength-indepen-dent thermodynamic values.

(2) An excellent ®t of our experimental data withthe theoretical curves reconstructed using thethermodynamic parameters was obtained (notshown).

(3) The values deduced from the shapes of thecurves were in excellent agreement with thosededuced from the concentration-dependence of theTm (see Table 2 for numerical values) (Shafer,1998). This comparison has often been used to con-®rm the two-state approximation (Breslauer et al.,1986; Freier et al., 1986). More recently, thisapproach has been used for short mismatchedduplexes (Peyret et al., 1999). A 15 % agreementbetween the two values is considered to be suf®-cient to validate a two-state assumption, and ourvalues fall within this range.

(4) Using temperature-dependent �H� valueswould not greatly improve the ®ts, and all ourdata can be satisfactorily interpreted using�Cp � 0. We also selected experimental conditionsthat destabilize self-structures of the oligonucleo-tides. In our case, triplex formation is a simpleequilibrium, not a coupled equilibrium betweenunfolding of the third strand and triplex formation,which would result in apparently strong tempera-ture-dependent �H� values (Kamiya et al., 1996)..

(5) Very short oligonucleotides have been stu-died. Most systems involve the formation of onlynine base-pairs or nine base-triplets, and it is notsurprising that these simple systems obey two-

state behavior (Breslauer et al., 1986; Marky et al.,1987), contrary to polynucleotides, which exhibitedmore complex behavior.

(6) A fair agreement between the calorimetricand the van t'Hoff �H� value was obtained for asimilar (but not identical) pyrimidine triplex, alsoinvolving the formation of nine base-triplets(VoÈ lker et al., 1993). We would like to point outthat reported discrepancies between the van't Hoff�H� and the calorimetric �H� might often be theresult of kinetically non-reversible systems; it is dif-®cult to extract equilibrium constants from a curvewhich is not recorded at equilibrium. For example,using only a heating curve leads to a systematicoverestimation of the Tm and �H� values of thereaction.

Slow kinetics of intermolecular triplex formationresult in an hysteresis phenomenon, which can beinterpreted provided that both heating and coolingpro®les are compared (Mergny & Lacroix, 1998;RougeÂe et al., 1992). In our case all cooling andheating pro®les were superimposable as a result ofthe covalent link between the potential third strandand either strand of the duplex.

GT/GA versus pyrimidine triplexes

TC, GA and GT triplexes share some fundamen-tal features: (a) there must be an oligopurinesequence in the duplex and (b) the orientation ofthe two ``homologous'' strands (purine or pyrimi-dine) has to be antiparallel. The rules governingthe orientation of the third strand in GT triplexesare a bit more complex. They have been shown tobe sequence-dependent (Sun et al., 1991). All cano-nical triplets formed in the Hoogsteen (C �G * C�and T �A * T) or in the reverse Hoogsteen mode(T �A * T, T �A * A and T �A * G) are based on the for-mation of two hydrogen bonds between the basein the third strand and the purine of the Watson-Crick base-pair. In contrast to these shared proper-ties, there are numerous factors that allow one todistinguish between the two classes of triplex: (i)the lack of isomorphism of most base-triplets; (ii)the positive charge on each cytosine in the thirdstrand of a pyrimidine triplex; (iii) the exactlocation of the third strand in the major groove ofDNA; (iv) the stacking interactions in the thirdstrand. All these factors, and perhaps others, mightexplain the large differences in thermodynamicparameters. The decrease in the entropic barrier forguanine-rich triplex formation might be in partattributed to solvent effects. Positive changes inentropy could be associated with the removal ofwater from apolar groups, and it is possible thatthere are more water molecules freed upon GT orGA triplex formation than upon pyrimidine triplexformation. The necessity to protonate cytosine inthe third strand (Lavelle & Fresco, 1995) alsoexplains the larger �H� values found with pyrimi-dine triplexes at near neutral pH. The enthalpychange associated with each cytosine protonationis approx. ÿ5 kcal/mol (Manzini et al., 1990;


Mergny et al., 1995); as ®ve cytosines are present inthe pyrimidine third strand of the model system(system 1), these protonation events account fornearly half of the �H� of triplex formation. Inother words, if cytosine protonation was notinvolved, the �H� of pyrimidine triplex formationwould be only slightly higher than that of the GTtriplex.

A large amount of thermodynamic data havebeen collected for pyrimidine triplexes, mainly byUV-melting and calorimetric measurements. Thisfavorable situation allowed the construction ofphase diagrams (Klump, 1988; Plum & Breslauer,1995) and the determination of parameters thatwere used to predict triplex stability (Roberts &Crothers, 1996b). Apparent equilibrium associationconstants for purine triplexes are generallyobtained using gel mobility shift analysis at a ®xedtemperature. In the presence of a ``high'' divalentcation concentration, but in the absence of mono-valent cations, the purine triplex is far more stablethan the pyrimidine triplex around neutral pH.This situation can be reversed in the presence ofphysiological concentrations of monovalent ions,especially potassium. Under these conditions thestability of a GA triplex is decreased 1000-fold ormore, making it less stable than a pyrimidine tri-plex (Gamper et al., 1997). Therefore, it would beuseful to establish the rules governing the relativestabilities of these triplexes.

The temperature dependencies of the GT, GAand TC triplexes were extremely different, as aresult of different dominating thermodynamic par-ameters. The pyrimidine triplex is enthalpy-driven,whereas the purine triplexes are mainly entropy-driven. GT triplexes behave in an intermediatemanner. Around 37 �C, the stabilities of the GAand GT triplexes were similar in our system, andboth triplexes had identical melting temperatures.However, the small differences in �H� betweenthe GT and the GA triplexes lead to signi®cantdifferences in binding af®nities at lower tempera-tures (see Table 3). In terms of Tm, the GTA triplexwas the most stable of the purine triplexes (Mills &Klump, 1998). Its �H� was intermediate betweenthe values found for the GA and GT triplexes.

Our results on GA triplexes are in excellentagreement with the a recent work on a differentGA triplex (Aich et al., 1998); these authors alsoobserved (by a different technique) that the for-mation of some GA triplexes was actually entropy-driven and that the enthalpy of binding could beunfavorable in some cases. In all cases, the lowenthalpy of triplex formation makes the GA purinetriplex stability almost temperature-independent; itis therefore not surprising to ®nd ``extraordinarystable'' triplexes that are resistant to thermal dis-sociation in a gel (Alunni-Fabbroni et al., 1996;Svinarchuk et al., 1994, 1995). The stability of thesetriplexes is not expected to be affected by anincrease in temperature, and their melting is theresult of duplex disruption. In other words, the GAtriplex only melts when its Watson-Crick template

melts. Therefore, the extraordinary thermal stab-ility of the GA triplex is not necessarily associatedwith a very high af®nity constant at lower tem-peratures. One should not expect a large increasein stability by decreasing the temperature. TC(Pilch et al., 1990), GA (Pilch et al., 1991) and GT(Scaria & Shafer, 1996) triplexes were analyzedusing the same target sequence, G3A4G3/C3T4C3,and different values were obtained. Despite thefact that these results were obtained for a comple-tely different sequence context, with the possibilityof competing self structures not ruled out, a �H�value of ÿ2.0 kcal/mol base-triplet was measuredfor the dissociation of a GT triplex. On a similarsequence (G4T4G4) a �H� of ÿ3.0 kcal/mol base-triplet was reported for a GT triplex (Gondeauet al., 1998). Both results are in fair agreement withour results (ÿ2.5 kcal/mol base-triplet). Larger dis-crepancies were found for the GA triplexes, wherevalues reported in the literature range from ÿ4.5(Scaria & Shafer, 1996) to �0 kcal/mol base-triplet(Aich et al., 1998). Our results are in agreementwith the latter value. The absence of favorableenthalpic components for purine triplex formationis in sharp contrast with most nucleic acid inter-actions described so far.

Strand displacement phenomenon

In the second part of this study we showed thatthe sequence dependence of �H� has interestingconsequences, as it allows the relative stabilities ofpurine and pyrimidine triplexes to be reversedwith temperature. As a consequence, triplex-to-tri-plex conversion was observed under a wide rangeof experimental conditions and in differentsequence contexts. To our knowledge, this type oftransition (triplex-to-triplex) has not been reportedpreviously. To con®rm that the pyrimidine strandwas able to displace the GT triplex, we designed asimple FRET experiment. FRET has been succes-fully used to probe nucleic acids structures (Clegget al., 1992, 1993; Jares-Erijman & Jovin, 1996;Murchie et al., 1989; Tuschl et al., 1994) and provideevidence for triplex formation (Mergny et al., 1994;Scaria et al., 1995; Yang & Millar, 1997; Yang et al.,1994, 1998). The FRET results were qualitatively inagreement with the triplex-to-triplex conversionmodel, but the use of ¯uorescently labeled oligonu-cleotides affected the relative stabilities of thedifferent species (Mergny, 1999) making a directcomparison with data for unmodi®ed oligomersdif®cult (unpublished results).

The different 2-D state diagrams of the oligopur-ine/oligopyrimidine systems (pH versus tempera-ture, and MgCl2 versus temperature in systems 1and 5) illustrate the relative stabilities of the differ-ent complexes. The disordered single strands(L � L) dominate at high temperature, regardlessof pH and magnesium concentration. The pyrimi-dine triplex (Ts1) is the thermodynamically moststable complex at very low temperature, up topH 7.5, and at all magnesium concentrations


tested. The GT (or GA/GTA triplexes) (Ts2) andthe duplex (Dss) share the intermediate phase. Itshould be noted that the phase barrier between theduplex and the GT triplex could not be accuratelydetermined from our experiments, and probablylies between magnesium concentrations of 1 to3 mM. The diagrams of systems 1 and sytems 5are qualitatively similar, but different temperaturelimits were observed (vertical axis). It is obviousthat, in order to observe the duplex with danglingtails (Dss), one has to use high pH and relativelylittle magnesium. Under all other conditions thetriplex-to-single strands conversion does notrequire any double-stranded intermediate.

Finally, it should be stressed that the methodsused here do not allow the determination of kineticparameters. It is therefore dif®cult to propose adetailed pathway for triplex-to-triplex conversion.Two alternative mechanisms may be proposed: (i)either the pyrimidine third strand is able to replacethe guanine-rich strand whenever the latter brie¯yleaves its target (in this case, the elusive reactionintermediate should be a duplex species, and twostrands would compete for re-binding); (ii) or thepyrimidine third strand actually recognizes theguanine-rich triplex, binds to it, and activelyreplaces the GT/GA/GTA third strand, which isthen released. The second scenario, which ressem-bles a recombination event, implies that the reac-tion intermediate should be a quadruplex species.The use of slightly longer oligomers (systems 5and 6) did not allow us to eliminate either of thesetwo hypotheses. If this conversion is still observedwhen the complexes consist of very long triplexeshaving extremely long half-lives, a tetra-strandedintermediate might be formed. Molecular modelswill then have to be proposed in order to somehowaccommodate four bases belonging to four strandsof known orientation.

Conclusion and further developments

The design of the oligonucleotide systems pre-sented here allowed direct comparison of the stab-ilities of GT, GA and TC triplexes. All experimentswere performed with oligodeoxynucleotides (i.e.DNA) with no backbone modi®cation of any sort,and incorporating only canonical bases in the thirdstrand (i.e. A,T,G,C). Under the experimental con-ditions at neutral pH, all types of triplexes (TC/GA/GT/GTA) can be formed, provided that mag-nesium is present in the buffer. In the presence ofMgCl2, the guanine-rich triplex (GA, GT, or GTA)is the predominant complex at 37 �C in systemswhere the duplex core sequences have a G �C-richcontent. The situation was reversed in system 4(®ve AT � four GC), where an increase in the pyri-midine triplex stability and a concomitant decreasein the GT triplex stability was observed. Therefore,the G �C content of the oligopurine-oligopyrimidinecore duplex appears to be a critical factor in deter-mining the thermodynamic stability of the preferedtriplex. It should also be pointed out that the pyri-

midine third strands described here did notinclude any modi®ed base such as 5-methyl cyto-sine that is known to stabilize pyrimidine triplexes(Lee et al., 1984); such modi®cations could shift thebalance between the two conformers.

This study could be extended to mixed DNA/RNA/phosphorothioate third strands and to testbase analogs in either strand. The utilization of cir-cular oligonucleotides in the complexes may alsostrongly in¯uence the choice between the differenttriplexes. It would be interesting to test whether apyrimidine third strand is able to displace a purinetriplex formed with a circular oligonuleotide, as adouble linkage gives a small but signi®cant advan-tage over a single linkage (Vo et al., 1995). In anapproach analogous to the analysis of the effect ofmagnesium concentration, we will also investigatethe relative effects of different ligands, such asspermine (Hampel et al., 1991), ethidium (Mergnyet al., 1991, 1992; Scaria & Shafer, 1991; Waring,1974), BePI (Mergny et al., 1992) and other ligands(Cassidy et al., 1994; Latimer et al., 1995) on therelative stabilities of GA, GT and TC triplexes.

Experimental procedures

Oligonucleotide, polynucleotides and chemicals

Oligodeoxynucleotide probes were synthesized byEurogentec (Belgium) on a 0.2 mmol scale, and treated asdescribed (Mergny et al., 1995). Purity was checked bygel electrophoresis. All concentrations were expressed instrand molarity, using a nearest-neighbor approximationfor the absorption coef®cients of the unfolded species(Cantor & Warshaw, 1970).

Nomenclature

TC, GT, GA and GTA triplexes refer to the nature ofthe bases present in the third strand and involved inHoogsteen or reverse Hoogsteen hydrogen bonds. Con-cerning the base-triplets, as an example, a C �G*G tripletis obtained when base G in a third strand recognizes theWatson-Crick C �G base-pair and forms speci®c hydro-gen bonds (*) with the guanine on the purine-rich strandof the duplex. The sequences of most of the oligodeoxy-nucleotides investigated in the following experiments areshown in Table 1. We adopted the following conventionfor all the oligodeoxynucleotides: the ®rst number indi-cates the length of the oligodeoxynucleotide. The follow-ing Pu/Py label simply indicates whether theoligonucleotide is involved in the purine or pyrimidinepart of the duplex. For long (L) oligonucleotides, this isfollowed by the base content of the third strand, whichallows the formation of TC, GT, GA or GTA triplexes.Finally, the last digit (1-6) allowed us to differentiate thedifferent systems presented in this study.

UV absorption studies

Unless otherwise speci®ed, all experiments were per-formed in a 10 mM cacodylate buffer (pH 7.0) containing0.1 M LiCl and various concentrations of MgCl2 (0-20 mM), at 1-20 mM oligonucleotide strand concen-tration. Thermal denaturation pro®les were obtainedwith a Kontron Uvikon 940 spectrophotometer as


described (Mergny et al., 1998). The temperature of thebath was increased or decreased at a rate of 0.2 deg.C/minute, thus allowing complete thermal equilibrum ofthe nine cuvettes. In contrast to pyrimidine intermolecu-lar triplex formation (RougeÂe et al., 1992), the nature ofthe triplex chosen here allowed fast kinetics of associ-ation and dissociation, and no hysteresis was observed(the cooling and heating pro®les were superimposable).At each temperature, absorbance measurements wereperformed at 260 nm, 295 nm and 405 nm (controlwavelength).

Extraction of the thermodynamic parameters

The quality of most melting curves allowed a thermo-dynamic analysis of the transition using an all-or-nonemodel. For an intramolecular equilibrium, let us de®ne yas the degree of completion of the reaction (0 < y < 1). K,the equilibrium association constant, can be writen asK � kon/koff � y/(1 ÿ y) for an intramolecular phenom-enon. For an intermolecular equilibrium, if we assumeequal stoichiometry between the two partners (A and B),the reaction may be symbolized as:

A� B$ AB;K � kon=koff � y=�Co�1ÿ y�2�where Co is the initial concentration of species A and B.In both cases, as:

�G� � ÿRT ln�K� � �H� ÿ T�S�

Therefore, ln(K) � ÿ (�H�/R) �1/T � (�S�/R)As a consequence, if �H� and �S� are independent of

temperature, one should get a straight line by plottingln(K) as a function of 1/T (in kelvin) (Marky &Breslauer, 1987). Examples of such ®ts are given inFigure 3(a). Finally, at T � Tm, K � 2/Co for an intermo-lecular equilibrium. Therefore:

ln�Co=2� ��H�=R� � �1=Tm� ÿ ��S�=R�ln�Co� ��H�=R� � �1=Tm� ÿ ��S�=R� � ln 2

Electrophoretic mobility shift ssay

The third strand was 32P-end-labeled with bacterio-phage T4 polynucleotide kinase and [g-32P]ATP, accord-ing to the manufacturer's protocol. The binding reactionwas performed overnight at 37, 20 or 4 �C in 20 ml of50 mM Hepes (pH 7.0), 100 mM LiCl, 10 mM MgCl2,10 % sucrose, and 0.1 mg/ml of a non-speci®c double-stranded competitor. The solution contained 0.1 pmol ofthe end-labeled probe (20,000-40,000 cpm). The bindingmixtures were electrophoresed at room temperature for90 minutes (10 V/cm) on a 12 % non-denaturating poly-acrylamide (bis/acryl, 1:19 (w/w)) 50 mM Hepes(pH 7.0) gel, dried and analyzed with a phosphorimagerinstrument SP (Molecular Dynamics).

Mung bean nuclease footprinting assays

The oligonucleotides for mung bean nuclease protec-tion assays were obtained as follows. The oligonucleo-tides were puri®ed on a denaturing 12 % (w/v)polyacrylamide gel to eliminate synthesis side products.The desired product was cut out of the gel and elutedovernight in 10 mM ammonium acetate, 10 mM mag-

nesium acetate. The puri®ed single-stranded DNA wasthen precipitated twice with 70 % ethanol prior to resus-pension in 10 mM Tris buffer (pH 8.0), containing10 mM NaCl. The templates (30Pu.GT6 or 30Py.TC6)were 50 end-labeled with [g-32P]ATP (Amersham Arling-ton Heights, IL) by T4 polynucleotide kinase (New Eng-land Biolabs, Beverly, MA).

The radiolabeled oligonucleotides (20 nM) were incu-bated overnight in the cold room, in 20 mM Hepes(pH 7.0), 0.1 M LiCl, and 0.5 or 10 mM MgCl2 as indi-cated, in the presence of 3 mM of non-radiolabeled oligo-nucleotide and of 3 mM of the indicated oligonucleotide.1 ml of mung bean nuclease (10,000 units/ml, New Eng-land Biolabs) was added to the samples. The reaction at6 �C was performed for 45 minutes. The reaction wasstopped by precipitation in ethanol. The samples wereresuspended in 95 % formamide and heated at 95 �C forfour minutes before being loaded onto a denaturing 20 %polyacrylamide gel (19:1, (w/w) acrylamide:bisacryla-mide) containing 7.5 M urea in 1� TBE buffer.

NMR

1-D NMR spectra of the exchangeable proton regionwere determined at 30 �C. Experimental conditions: 90 %H2O/10 % 2H2O , pH 6.2, 0.1 M LiCl, 10 mM MgCl2.Strand concentration, 150 mM. The NMR experimentswere performed on a 500 MHz varian spectrometerusing the JR sequence (Plateau & GueÂron, 1982) with arepetition delay of ®ve seconds. The chemical shifts werereferenced to DSS and the spectra were normalized tothe intensity of the DSS peak.

Acknowledgements

This work was supported in part by a CNRS/FRDgrant (98N2/0851) and an ECTMR fellowship to P.B.A.We thank J. C. FrancËois and M. RougeÂe for helpfuldiscussions, J. L. Leroy and A. T. Phan for prelim-inary NMR experiments, and P. Steele for constantsupport. The Tm software was written by B. Sun and J. S.Sun.

References

Aich, P., Ritchie, S., Bonham, K. & Lee, J. S. (1998). Ther-modynamic and kinetic studies of the formation oftriple helices between purine-rich deoxyribo-oligo-nucleotides and the promoter region of thehuman c-src proto-oncogene. Nucl. Acids Res. 26,4173-4177.

Alunni-Fabbroni, M., Pirulli, D., Manzini, G. & Xodo,L. E. (1996). (A,G)-oligonucleotides form extraordi-nary stable triple helices with a critical R. Ysequence of the murine c-Ki-ras promoter and inhi-bit transcription in transfected NIH 3T3 cells. Bio-chemistry, 35, 16361-16369.

Arimondo, P. B., Barcelo, F., Sun, J. S., Maurizot, J. C.,Garestier, T. & HeÂleÁne, C. (1998). Triple helix for-mation by (G,A)-containing oligonucleotides: asym-metric sequence effect. Biochemistry, 37, 16627-16635.

Breslauer, K. J., Franck, R., BloÈcker, H. & Marky, L. A.(1986). Predicting DNA duplex stability from thebase sequence. Proc. Natl Acad. Sci. USA, 83, 3746-3750.


Cantor, C. R. & Warshaw, M. M. (1970). Oligonucleotideinteractions. 3. Circular dichroism studies of theconfomation of deoxynucleotides. Biopolymers, 9,1059-1077.

Cassidy, S. A., Strekowski, L., Wilson, W. D. & Fox,K. R. (1994). Effect of a triplex-binding ligand onparallel and antiparallel DNA triple helices usingshort unmodi®ed and acridine-linked oligonucleo-tides. Biochemistry, 33, 15338-15347.

Cheng, A.-J. & Van Dyke, M. W. (1993). Monovalent cat-ion effects on intermolecular purine-purine-pyrimi-dine triple-helix formation. Nucl. Acids Res. 21,5630-5635.

Cheng, A. J. & Van Dyke, M. W. (1997). Oligodeoxyribo-nucleotide length and sequence effects on intramo-lecular and intermolecular G-quartet formation.Gene, 197, 253-260.

Clegg, R. M., Murchie, A. I. H., Zechel, A., Carlberg, C.,Diekmann, S. & Lilley, D. M. J. (1992). Fluorescenceresonance energy transfer analysis of the structureof the four-way DNA junction. Biochemistry, 31,4846-4856.

Clegg, R. M., Murchie, A. I. H., Zechel, A. & Lilley,D. M. J. (1993). Observing the helical geometry ofdouble-stranded DNA in solution by ¯uorescenceresonance energy transfer. Proc. Natl Acad. Sci. USA,90, 2994-2998.

Cooney, M., Czernuszewicz, G., Postel, E. H., Flint, S. J.& Hogan, M. E. (1988). Site speci®c oligonucleotidebinding represses transcription of human c-mycgene in vitro. Science, 241, 456-459.

de los Santos, C., Rosen, M. & Patel, D. (1989). NMRstudy of DNA (R�)n (Y-)n (Y�)n triple helices insolution: imino and amino proton markers of TATand CGC� base-triple formation. Biochemistry, 28,7282-7289.

EscudeÂ, C., Mohammadi, S., Sun, J. S., Nguyen, C. H.,Bisagni, E., Liquier, J., Taillandier, E., Garestier, T.& HeÂleÁne, C. (1996). Ligand-induced formation ofHoogsteen-paired parallel DNA. Chem. Biol. 3, 57-65.

Faucon, B., Mergny, J. L. & HeÂleÁne, C. (1996). Effect ofthird strand composition on triple helix formation:Purine versus pyrimidine oligodeoxynucleotides.Nucl. Acids Res. 24, 3181-3188.

Felsenfeld, G., Davies, D. R. & Rich, A. (1957). For-mation of a three-stranded polynucleotide molecule.J. Am. Chem. Soc. 79, 2023.

FrancËois, J. C., Saison-Behmoaras, T., Thuong, N. T. &HeÂleÁne, C. (1989). Inhibition of restriction endonu-clease cleavage via triple helix fomation by homo-pyrimidine oligonucleotides. Biochemistry, 28, 9617-9619.

Freier, S. M., Kierzek, R., Jaeger, J. A., Sugimoto, N.,Caruthers, M. H., Neilson, T. & Turner, D. H.(1986). Improved free-energy parameters for predic-tions of RNA duplex stability. Proc. Natl Acad. Sci.USA, 83, 9373-9377.

Gamper, H. B., Jr, Kutyavin, I. V., Rhinehart, R. L.,Lokhov, S. G., Reed, M. W. & Meyer, R. B. (1997).Modulation of Cm/T, G/A, and G/T triplex stab-ility by conjugate groups in the presence andabsence of KCl. Biochemistry, 36, 14816-14826.

Giovannangeli, C., Montenay-Garestier, T., RougeÂe, M.,Chassignol, M., Thuong, N. T. & HeÂleÁne, C. (1991).Single-stranded DNA as a target for triple-helix for-mation. J. Am. Chem. Soc. 113, 7775-7777.

Giovannangeli, C., Montenay-Garestier, T., Thuong, N. T.& HeÂleÁne, C. (1992). Triple helix formation by oligo-

deoxynucleotides containing the three bases: T, Cand G. Proc. Natl Acad. Sci. USA, 89, 8631-8635.

Gondeau, C., Maurizot, J. C. & Durand, M. (1998). Cir-cular dichroism and UV melting studies on for-mation of an intramolecular triplex containingparallel T*A:T and G*G:C triplets: netropsin com-plexation with the triplex. Nucl. Acids Res. 26, 4996-5003.

Grigoriev, M., Praseuth, D., Robin, P., Hemar, A.,Saison-Behmoaras, T., Dautry-Varsat, A., Thuong,N. T., HeÂleÁne, C. & Harel-Bellan, A. (1992). A triplehelix-forming oligonucleotide-intercalator conjugateacts as a transcriptional repressor via inhibition ofNF-kB binding to interleukin-2 receptor alpha-regu-latory sequence. J. Biol. Chem. 267, 3389-3395.

Hampel, K. J., Crosson, P. & Lee, J. S. (1991). Polya-mines favor DNA triplex formation at neutral pH.Biochemistry, 30, 4455-4459.

Hanvey, J. C., Shimizu, M. & Wells, R. D. (1990). Site-speci®c inhibition of EcoRI restriction/modi®cationenzymes by a DNA triple helix. Nucl. Acids Res. 18,157-161.

Haq, I., Chowdhry, B. Z. & Chaires, J. B. (1997). Singu-lar value decomposition of 3-D DNA meltingcurves reveals complexity in the melting process.Eur. Biophys. J. 26, 419-426.

Havre, P. A., Gunther, E. J., Gasparro, F. P. & Glazer,P. M. (1993). Targeted mutagenesis of DNA usingtriple helix-forming oligonucleotides linked to psor-alen. Proc. Natl Acad. Sci. USA, 90, 7879-7883.

HuÈ sler, P. L. & Klump, H. H. (1995). Prediction of pH-dependent properties of DNA triple-helices. Arch.Biochem. Biophys. 317, 46-56.

Ing, N. H., Beekman, J. M., Kessler, D. J., Murphy, M.,Jayaraman, K., Zendegui, J. G., Hogan, M. E.,O'Malley, B. W. & Tsai, M. J. (1993). In vivo tran-scription of a progesterone-responsive gene isspeci®cally inhibited by a triplex-forming oligonu-cleotide. Nucl. Acids Res. 21, 2789-2796.

Jares-Erijman, E. A. & Jovin, T. M. (1996). Determinationof DNA helical handedness by ¯uorescence reson-ance energy transfer. J. Mol. Biol. 257, 597-617.

Kamiya, M., Torigoe, H., Shindo, H. & Sarai, A. (1996).Temperature dependence and sequence speci®cityof DNA triplex formation: An analysis using iso-thermal titration calorimetry. J. Am. Chem. Soc. 118,4532-4538.

Kandimalla, E. R. & Agrawal, S. (1995). Single strandtargeted triplex-formation. Destabilization of gua-nine quadruplex structures by foldback triplex-forming oligonucleotides. Nucl. Acids Res. 23, 1068-1074.

Klump, H. H. (1988). Energetics of order/order tran-sitions in nucleic acids. Can. J. Chem. 66, 804-811.

Kool, E. T. (1991). Molecular recognition by circular oli-gonucleotides: increasing the selectivity of DNAbinding. J. Am. Chem. Soc. 113, 6265-6266.

Latimer, L. J. P., Payton, N., Forsyth, G. & Lee, J. S.(1995). The binding of analogues of coralyne andrelated heterocyclics to DNA triplexes. Biochem. CellBiol. 73, 11-18.

Lavelle, L. & Fresco, J. R. (1995). UV spectroscopicidenti®cation and thermodynamic analysis of proto-nated third strand deoxycytidine residues at neu-trality in the triplex d(C � ÿT):[d(A-G)6.d(C-T)6];evidence for a proton switch. Nucl. Acids Res. 23,2692-2705.

Le Doan, T., Perrouault, L., Praseuth, D., Habhoub, N.,Decout, J.-L., Thuong, N. T., Lhomme, J. & HeÂleÁne,


C. (1987). Sequence speci®c recognition, photocros-slinking and cleavage of the DNA double helix byan oligo a thymidylate covalently linked to an azi-dopro¯avine derivative. Nucl. Acids Res. 15, 7749-7760.

Lee, J. S., Woodsworth, M. L., Latimer, L. J. P. &Morgan, A. R. (1984). Polypyrimidine. polypurinesynthetic DNAs containing 5-methyl cytosine formstable duplexes at neutral pH. Nucl. Acids Res. 12,6603-6614.

Macaya, R. F., Gilbert, D. E., Malek, S., Sinheimer, J. S.& Feigon, J. (1991). Structure and stability of X. C.G mismatches in the third strand of intramoleculartriplexes. Science, 254, 270-274.

Macaya, R. F., Schultze, P. & Feigon, J. (1992). Sugarconformation in intramolecular DNA triplexesdetermined by coupling constants obtained by auto-mated simulation of P. Cosy cross peaks. J. Am.Chem. Soc. 114, 781-783.

Maher, L. J., III, Wold, B. & Dervan, P. B. (1989). Inhi-bition of DNA binding proteins by oligonucleotide-directed triple helix formation. Science, 245, 725-730.

Maher, L. J., III, Dervan, P. B. & Wold, B. (1992). Anal-ysis of promoter-speci®c repression by triple-helicalDNA complexes in a eukaryotic cell-free transcrip-tion system. Biochemistry, 31, 70-81.

Majumdar, A., Khorlin, A., Dyatkina, N., Lin, F. L. M.,Powell, J., Liu, J., Feiz, Z. Z., Khripine, Y.,Watanabe, K. A., George, J., Glazer, P. M. &Seidman, M. M. (1998). Targeted gene knockoutmediated by triple helix forming oligonucleotides.Nature Genet. 20, 212-214.

Manzini, G., Xodo, L. E., Gasparotto, D., Quadrifoglio,F., van der Marel, G. A. & van Boom, J. H. (1990).Triple helix formation by oligopurine-oligopyrimi-dine DNA fragments. J. Mol. Biol. 213, 833-843.

Marky, L. A. & Breslauer, K. J. (1987). Calculating ther-modynamic data for transitions of any molecularityfrom equilibrium melting curves. Biopolymers, 26,1601-1620.

Marky, L. A., Kallenbach, N. R., McDonough, K. A.,Seeman, N. C. & Breslauer, K. J. (1987). The meltingbehavior of a DNA junction structure: a calorimetricand spectroscopic study. Biopolymers, 26, 1621-1634.

Mergny, J. L. (1999). Fluorescence energy transfer as aprobe for tetraplex formation: the i-motif. Biochemis-try, 38, 1573-1581.

Mergny, J. L. & Lacroix, L. (1998). Kinetics and Thermo-dynamics of i-DNA Formation: phosphodiester vs.modi®ed oligodeoxynucleotides. Nucl. Acids Res. 26,4897-4903.

Mergny, J. L., Collier, D., RougeÂe, M., Montenay-Garestier, T. & HeÂleÁne, C. (1991). Intercalation ofethidium bromide in a triple stranded oligonucleo-tide. Nucl. Acids Res. 19, 1521-1526.

Mergny, J. L., Duval-Valentin, G., Nguyen, C. H.,Perrouault, L., Faucon, B., RougeÂe, M., Montenay-Garestier, T., Bisagni, E. & HeÂleÁne, C. (1992). Triplehelix speci®c ligands. Science, 256, 1691-1694.

Mergny, J. L., Garestier, T., Rougee, M., Lebedev, A. V.,Chassignol, M., Thuong, N. T. & HeÂleÁne, C. (1994).Fluorescence energy transfer between two triplehelix-forming oligonucleotides bound to duplexDNA. Biochemistry, 33, 15321-15328.

Mergny, J. L., Lacroix, L., Han, X., Leroy, J. L. & HeÂleÁne,C. (1995). Intramolecular folding of pyrimidine oli-godeoxynucleotides into an i-DNA motif. J. Am.Chem. Soc. 117, 8887-8898.

Mergny, J. L., Phan, A. T. & Lacroix, L. (1998). Follow-ing G-quartet formation by UV-spectroscopy. FEBSLetters, 435, 74-78.

Milligan, J. F., Krawczyk, S. H., Wadwani, S. &Matteucci, M. D. (1993). An anti-parallel triple helixmotif with oligodeoxynucleotides containing 20-deoxyguanosine and 7-deaza-20-deoxyxanthosine.Nucl. Acids Res. 21, 327-333.

Mills, M. & Klump, H. H. (1998). Systematic mutation inthe third strand of a Purine motif DNA triple helix:a story of a molecule which hides its tail. Nucleo-sides Nucleotides, 17, 1919-1936.

Mills, M., VoÈ lker, J. & Klump, H. H. (1996). Triple heli-cal structures involving inosine: there is a penaltyfor promiscuity. Biochemistry, 35, 13338-13344.

Moser, H. E. & Dervan, P. B. (1987). Sequence speci®ccleavage of double helical DNA by triple helix for-mation. Science, 238, 645-650.

Murchie, A. I. H., Clegg, R. M., Kitzing, E., Duckett,D. R., Diekmann, S. & Lilley, D. M. J. (1989). Fluor-escence energy transfert shows that the four wayDNA junction is a right handed cross of antiparallelmolecules. Nature, 341, 763-766.

Noonberg, S. B., FrancËois, J. C., Garestier, T. & HeÂleÁne,C. (1995). Effect of competing self-structure on tri-plex formation with purine-rich oligodeoxynucleo-tides containing GA repeats. Nucl. Acids Res. 25,1956-1963.

Olivas, W. M. & Maher, L. J., III (1995a). Competitivetriplex/quadruplex equilibria involving guanine-rich oligonucleotides. Biochemistry, 34, 278-284.

Olivas, W. M. & Maher, L. J., III (1995b). Overcomingpotassium-mediated triplex inhibition. Nucl. AcidsRes. 23, 1936-1941.

Paes, H. M. & Fox, K. R. (1997). Kinetic studies on theformation of intermolecular triple helices. Nucl.Acids Res. 25, 3269-3274.

Pascolo, E. & ToulmeÂ, J. J. (1996). Double hairpin com-plexes allow accommodation of all four base pairsin triple helices containing both DNA and RNAstrands. J. Biol. Chem. 271, 24187-24192.

Peyret, N., Seneviratne, P. A., Allawi, H. T. &SantaLucia, J. (1999). Nearest-neighbor thermodyn-amics and NMR of DNA sequences with internalA.A, C.C, G.G, and T.T mismatches. Biochemistry,38, 3468-3477.

Pilch, D. S., Brousseau, R. & Shafer, R. H. (1990). Ther-modynamics of triple helix formation: spectro-photometric studies on the d(A)10.2d(T)10 andd(C3T4C3).d(G3A4G3).d(C3T4C3) triple helices.Nucl. Acids Res. 18, 5743-5750.

Pilch, D. S., Levenson, C. & Shafer, R. H. (1991). Struc-ture, stability, and thermodynamics of a short inter-molecular purine-purine-pyrimidine triple helix.Biochemistry, 30, 6081-6087.

Plateau, P. & GueÂron, M. (1982). Exchangeable protonNMR without base-line distortion, using strongpulse sequences. J. Am. Chem. Soc. 104, 7310-7311.

Plum, G. E. (1998). Thermodynamics of oligonucleotidetriple helices. Biopolymers, 44, 241-256.

Plum, G. E. & Breslauer, K. J. (1995). Thermodynamicsof an intramolecular DNA triple helix: a calori-metric and spectroscopic study of the pH and saltdependence of thermally induced structural tran-sitions. J. Mol. Biol. 248, 679-695.

Radhakrishnan, I., de los Santos, C. & Patel, D. J.(1991a). Nuclear magnetic resonance structural stu-dies of intramolecular purine-purine-pyrimidine


DNA triplexes in solution. J. Mol. Biol. 221, 1403-1418.

Radhakrishnan, I., Gao, X., de los Santos, C., live, D. &Patel, D. J. (1991b). NMR structural studies of intra-molecular (Y�)n.(R�)n(Y-)n DNA triplexes in sol-ution: imino and amino proton and nitrogenmarkers of G. TA base triple formation. Biochemis-try, 30, 9022-9030.

Radhakrishnan, I., Patel, D. J. & Gao, X. (1992). Three-dimensional homonuclear NOESY-TOCSY of anintramolecular pyrimidine.purine.pyrimidne DNAtriplex containing a central G. TA triple: non-exchangeable proton assignments and structuralimplications. Biochemistry, 31, 2514-2523.

Rajagopal, P. & Feigon, J. (1989). Triple-strand formationin the homopurine homopyrimidine DNA oligonu-cleotides d(G-A)4 and d(T-C)4. Nature, 339, 637-640.

Rentzeperis, D. & Marky, L. A. (1995). Ligand bindingto the Hoogsteen-WC groove of TAT base triplets:Thermodynamic contribution of the thymine methylgroups. J. Am. Chem. Soc. 117, 5423-5424.

Roberts, R. W. & Crothers, D. M. (1996a). Kinetic dis-crimination in the folding of intramolecular triplehelices. J. Mol. Biol. 260, 135-146.

Roberts, R. W. & Crothers, D. M. (1996b). Prediction ofthe stability of DNA triplexes. Proc. Natl Acad. Sci.USA, 93, 4320-4325.

RougeÂe, M., Faucon, B., Mergny, J. L., Barcelo, F.,Giovannangeli, C., Garestier, T. & HeÂleÁne, C. (1992).Kinetics and thermodynamics of triple-helix for-mation: effects of ionic strength and mismatches.Biochemistry, 31, 9269-9278.

Roy, C. (1993). Inhibition of gene transcription by purinerich triplex forming oligodeoxyribonucleotides.Nucl. Acids Res. 21, 2845-2852.

Sandor, Z. & Bredberg, A. (1994). Repair of triple helixdirected psoralen adducts in human cells. Nucl.Acids Res. 22, 2051-2056.

Scaria, P. V. & Shafer, R. H. (1991). Binding of ethidiumbromide to a DNA triple helix. J. Biol. Chem. 266,5417-5423.

Scaria, P. V. & Shafer, R. H. (1996). Calorimetric analysisof triple helices targeted to the d(G3A4G3).d(C3T4C3) duplex. Biochemistry, 35, 10985-10994.

Scaria, P. V., Will, S., Levenson, C. & Shafer, R. H.(1995). Physicochemical studies of thed(G(3)T(4)G(3))*d(G(3)A(4)G(3)).d(C3T4C3) triplehelix. J. Biol. Chem. 270, 7295-7303.

Shafer, R. H. (1998). Stability and structure of modelDNA triplexes and quadruplexes and their inter-actions with small ligands. In Progress in NucleicAcid Rese (Moldave, K., ed.), vol. 59, pp. 55-94,Academic Press Inc, San Diego, CA.

SkleÂnar, V. & Felgon, J. (1990). Formation of a stable tri-plex from a single DNA strand. Nature, 345, 836-38.

Sun, J. S., De Bizemont, T., Duval-Valentin, G.,Montenay-Garestier, T. & HeÂleÁne, C. (1991). Exten-sion of the range of recognition sequences for triplehelix formation by oligonucleotides containing gua-nines and thymines. C. R. Acad. Sci. Paris, seÂrie III,313, 585-590.

Svinarchuk, F., Bertrand, J. R. & Malvy, C. (1994). Ashort purine oligonucleotide forms a highly stabletriple helix with the promoter of the murine c-pim-1 proto-oncogene. Nucl. Acids Res. 22, 3742-3747.

Svinarchuk, F., Paoletti, J. & Malvy, C. (1995). An unu-sually stable purine(purine-pyrimidine) short triplex- The third strand stabilizes double-stranded DNA.J. Biol. Chem. 270, 14068-14071.

Tuschl, T., Gohlke, C., Jovin, T. M., Westhof, E. &Eckstein, F. (1994). Three-dimensional model for thehammerhead ribozyme based on ¯uorescencemeasurements. Science, 266, 785-789.

Vo, T., Wang, S. H. & Kool, E. T. (1995). Targeting pyri-midine single strands by triplex formation: struc-tural optimization of binding. Nucl. Acids Res. 23,2937-2944.

VoÈ lker, J. S. & Klump, H. H. (1994). Electrostatic effectsin DNA triple helices. Biochemistry, 33, 13502-13508.

VoÈ lker, J., Botes, D. P., Lindsey, G. G. & Klump, H. H.(1993). Energetics of a stable intramolecular DNAtriple helix formation. J. Mol. Biol. 230, 1278-1290.

VoÈ lker, J., Osborne, S. E., Glick, G. D. & Breslauer, K. J.(1997). Thermodynamic properties of a confor-mationally constrained intramolecular DNA triplehelix. Biochemistry, 36, 756-767.

Wang, G., Levy, D. D., Seidman, M. M. & Glazer, P. M.(1995). Targeted mutagenesis in mammalian cellsmediated by intracellular triple helix formation.Mol. Cell. Biol. 15, 1759-1768.

Wang, G., Seidman, M. M. & Glazer, P. M. (1996). Muta-genesis in mammalian cells induced by triple helixformation and transcription-coupled repair. Science,271, 802-805.

Waring, M. J. (1974). Stabilization of two-stranded ribo-homopolymer helices and destabilization of a three-stranded helix by ethidium bromide. J. Phys. Chem.143, 483-486.

Xodo, L. E., Manzini, G. & Quadrifoglio, F. (1990). Spec-troscopic and calorimetric investigation on theDNA triplex formed by d(CTCTTCTTTCTTTTCTTTCTTCTC) and d(GAGAAGAAAGA) atacidic pH. Nucl. Acids Res. 18, 3557-3564.

Yang, M. & Millar, D. P. (1997). Fluorescence resonanceenergy transfer as a probe of DNA structure andfunction. Methods Enzymol. 278, 417-444.

Yang, M. S., Ghosh, S. S. & Millar, D. P. (1994). Directmeasurement of thermodynamic and kinetic par-ameters of DNA triple helix formation by ¯uor-escence spectroscopy. Biochemistry, 33, 15329-15337.

Yang, M., Ren, L. Q., Huang, M., Kong, R. Y. & Fong,W. F. (1998). A DNA assay based on ¯uorescenceresonance energy transfer and DNA triplex for-mation. Anal. Biochem. 259, 272-274.

Young, S. L., Krawczyk, S. H., Matteucci, M. D. &Toole, J. J. (1991). Triple helix formation inhibitstranscription elongation in vitro. Proc. Natl Acad. Sci.USA, 88, 10023-10026.

Edited by D. E. Draper

(Received 2 April 1999; received in revised form 1 July1999; accepted 3 July 1999)

http://www.academicpress.com/jmb

Supplementary material for this paper comprisingone Figure is available from JMB Online.

http://www.academicpress.com/jmb

energetics of strand-displacement reactions in triple helices: a spectroscopic study

Documents