embryonic stem cell-derived cd166+ precursors develop into ...users.unimi.it/difrancesco/pdf/2013...

Antonini, Graziella Messina, Dario DiFrancesco and Andrea BarbutiCampostrini, Annalisa Bucchi, Raffaella Milanesi, Mirko Baruscotti, Sara Benedetti, Stefania Angela Scavone, Daniela Capilupo, Nausicaa Mazzocchi, Alessia Crespi, Stefano Zoia, Giulia

Sinoatrial-Like CellsEmbryonic Stem Cell-Derived CD166+ Precursors Develop into Fully Functional

Print ISSN: 0009-7330. Online ISSN: 1524-4571 Copyright © 2013 American Heart Association, Inc. All rights reserved.is published by the American Heart Association, 7272 Greenville Avenue, Dallas, TX 75231Circulation Research

published online June 10, 2013;Circ Res.

http://circres.ahajournals.org/content/early/2013/06/10/CIRCRESAHA.113.301283World Wide Web at:

The online version of this article, along with updated information and services, is located on the

http://circres.ahajournals.org/content/suppl/2013/06/10/CIRCRESAHA.113.301283.DC1.htmlData Supplement (unedited) at:

http://circres.ahajournals.org//subscriptions/

is online at: Circulation Research Information about subscribing to Subscriptions:

http://www.lww.com/reprints Information about reprints can be found online at: Reprints:

document. Permissions and Rights Question and Answer available in the

Request Permissions in the middle column of the Web page under Services. Further information about this process isOffice. Once the online version of the published article for which permission is being requested is located, click

can be obtained via RightsLink, a service of the Copyright Clearance Center, not the EditorialCirculation Research Requests for permissions to reproduce figures, tables, or portions of articles originally published inPermissions:

at UniversitÃ degli Studi di Milano on July 5, 2013http://circres.ahajournals.org/Downloaded from

http://circres.ahajournals.org/content/early/2013/06/10/CIRCRESAHA.113.301283

http://circres.ahajournals.org/content/suppl/2013/06/10/CIRCRESAHA.113.301283.DC1.html

http://www.ahajournals.org/site/rights/

http://www.lww.com/reprints

http://circres.ahajournals.org//subscriptions/

http://circres.ahajournals.org/

DOI: 10.1161/CIRCRESAHA.113.301283 1

Embryonic Stem Cell–Derived CD166+ Precursors Develop into Fully Functional Sinoatrial-Like Cells

Angela Scavone1, Daniela Capilupo

1, Nausicaa Mazzocchi

1,3, Alessia Crespi

1, Stefano Zoia

1, Giulia

Campostrini1, Annalisa Bucchi

1, Raffaella Milanesi

1, Mirko Baruscotti 1, 2

, Sara Benedetti3,4

, Stefania

Antonini1, Graziella Messina 1, Dario DiFrancesco

1,2and Andrea Barbuti

1,2

1Department of Biosciences, Università degli Studi di Milano, via Celoria 26, 20133 Milano, Italy; 2Centro

Interuniversitario di Medicina Molecolare e Biofisica Applicata (CIMMBA), University of Milano; 3Division of Regenerative Medicine, San Raffaele Scientific Institute, Via Olgettina 58, 20132 Milano, Italy,

and; 4Department of Histology and Medical Embriology, Sapienza University of Rome, via Scarpa 14, 00161, Rome, Italy.

Running title: CD166 Recognizes Precursors of Sinoatrial Cells Subject codes: [120] Pacemaker [142] Gene expression [137] Cell biology/structural biology [152] Ion channels/membrane transport [106] Electropysiology Address correspondence to: Dr. Andrea Barbuti Department of Biosciences The PaceLab University of Milano via Celoria 26 20133 Milano, Italy Tel: +39 02 50314941 Fax: +39 02 50314932 [email protected] In May 2013, the average time from submission to first decision for all original research papers submitted to Circulation Research was 15 days.



DOI: 10.1161/CIRCRESAHA.113.301283 2

ABSTRACT Rationale: A cell-based biological pacemaker is based on the differentiation of stem cells and the selection of a population displaying the molecular and functional properties of native sinoatrial node (SAN) cardiomyocytes. So far such selection has been hampered by the lack of proper markers. CD166 is specifically but transiently expressed in the mouse heart tube and sinus venosus, the prospective SAN. Objective: We have explored the possibility to use CD166 expression for isolating SAN progenitors from differentiating embryonic stem cells (ESCs). Methods and Results: We found that in E10.5 mouse hearts CD166 and HCN4, a marker of the pacemaker tissue, are co-expressed. Sorting ESCs for CD166 expression at differentiation day 8, selects a population of pacemaker precursors. CD166+ cells express high levels of genes involved in SAN development (Tbx18, Tbx3, Isl-1, Shox2) and function (Cx30.2, HCN4, HCN1, Cav1.3) and low levels of ventricular genes (Cx43, Kv4.2, HCN2, Nkx2.5). In culture, CD166+ cells form an autorhythmic syncytium composed of cells morphologically similar to and with the electrophysiological properties of murine SAN myocytes. Isoproterenol increase (+57%) and acetylcholine decreases (-23%) the beating rate of CD166-selected cells which indeed express the -adrenergic and muscarinic receptors. In co-cultures, CD166-selected cells are able to pace neonatal ventricular myocytes at a rate faster than their own. Furthermore, CD166+ cells have lost pluripotency genes and do not form teratomas in vivo. Conclusions: We demonstrated for the first time the isolation of a non-teratogenic population of cardiac precursors able to mature and form a fully functional SAN-like tissue. Keywords: Cardiac progenitor cells, pacemaker, sinoatrial node, embryonic stem cells, HCN channels. Nonstandard Abbreviations and Acronyms: SAN sinoatrial node iPSC induced pluripotent stem cells EBs embryoid bodies Iso Isoproterenol Ach acetylcholine BrdU Bromodeoxyuridine nLacZ nuclear LacZ cav3 caveolin-3



DOI: 10.1161/CIRCRESAHA.113.301283 3

INTRODUCTION

The sinoatrial node (SAN) is the natural pacemaker of the heart. Pacemaker cells are specialized myocytes, lacking a stable resting potential, which at the end of an action potential generate a diastolic or “pacemaker” depolarization that drives the membrane potential slowly up to the threshold for firing the next action potential.

In the last two decades, the increasing implantation rate of electronic pacemakers has been primarily

due to isolated sinus node dysfunction.1With the increasing population ageing, dysfunctions of the conduction tissue, which may trigger threatening arrhythmias, are expected to become more and more common.

With the advent of gene- and cell-based therapeutic approaches, researchers have focused their

efforts to the development of a biological pacemaker, that is a cellular substrate able to connect to and induce ectopic spontaneous activity in the host tissue.2,3 Ideally, a biological pacemaker should be composed of cells identical to SAN cardiomyocytes. Cells with pacemaking properties may be generated from pluripotent stem cells (embryonic stem cells, ESCs and induced pluripotent stem cells, iPSC).4-7 Unfortunately, the high self-renewal capacity and plasticity of pluripotent stem cells, which make them interesting for regenerative purposes, represent their greatest disadvantages mainly because these features imply a high teratogenic potential. There is evidence though that in vitro cell commitment/differentiation of ESCs, would eliminate the risk of teratoma formation.5,8

A limiting step in sight of developing therapeutic applications using pluripotent stem cells consists in

the isolation of a homogeneous population of cells with the desired phenotype. We and others have for example shown that mouse ESCs differentiate into cardiomyocytes with the molecular and functional features of mature pacemaker cells; these cells are nonetheless scarce in number and interspersed with other cell types. 4,9 So far, most of the approaches used to isolate cardiomyocytes from pluripotent stem cells involved their genomic modification with reporter genes,9,10 which makes these cells hardly suitable for future clinical applications. Alternative selection methods are hampered by the lack of specific extracellular cardiac markers exploitable for cell sorting. There are however data showing that CD166 is specifically but transiently expressed in the developing mouse heart, including the sinus venosus 11,12 the region from which the SAN develops and that CD166 can be used to enrich human ESCs in immature cardiomyocytes.13 This evidence has led us to hypothesize that CD166 expression, could represent a suitable marker to select, at a specific differentiation stage, precursors of pacemaker cardiomyocyte.

In this work we have developed a protocol to isolate a population of CD166+ pacemaker precursors

from differentiating murine ESCs, and we have shown that these cells develop into a spontaneously beating layer of cells expressing many of the molecular and functional markers characterizing the mature SAN cells. METHODS Detailed Methods are available in the Online Data supplement. The procedures employed in this work conform to National and European directives for the care and use of laboratory animals (D.L. 116/1992; 86/609/CEE). Animal protocols were reviewed and approved both by the local Institutional Review Board and by the Italian Ministry of Health. ESCs culture and differentiation. Mouse ESCs (D3 line, ATCC, and CGR8 line) were grown and differentiated as embryoid bodies (EBs) as previously described4. Flow cytometry sorting. For flow cytometry analysis and sorting, 6, 8, 10, and 15 day-old EBs were collected, enzymatically and mechanically dissociated and incubated with the fluorophore-conjugated antibodies following



DOI: 10.1161/CIRCRESAHA.113.301283 4

manufacturer’s instruction. Analyses were carried out either soon after the sorting procedure or after 24h of cell re-aggregation. Quantitative (q)RT-PCR. Gene expression was quantified by qRT-PCR (Line-GeneK, Bioer) using SYBER® Premix Ex Taq™ II (Takara), 50 ng of cDNA and 500 nmol/L of primers (for primers see online Table I). Data are expressed as 2-ΔCt x 100. Due to the large range of values among the populations, statistical analysis was performed on the logarithm of 2-ΔCt x 100. Electrophysiology. Spontaneous action potentials were recorded by the patch-clamp technique in current clamp mode using the whole-cell configuration. Temperature was kept at 36±1°C. Isoproterenol (Iso) and acetylcholine (ACh) were added to the extracellular solution at the proper concentration from stock solutions. For voltage-clamp recordings only single cells were used. Solutions and voltage protocols were as previously described.4 Immunofluorescence and video-confocal analysis. Samples were fixed in 4%paraformaldehyde, permeabilized and incubated O/N at 4°C with primary and fluorophore-conjugated secondary antibodies as previously described.4 Confocal images were acquired using a video confocal microscopy ViCo (Nikon). Statistics. One-Way ANOVA, followed by Fisher LSD mean comparison or Student’s test for independent populations were used as appropriate. Significance level was set to p=0.05. RESULTS CD166 is co-expressed with HCN4 during heart development.

So far, CD166 is the only marker detected also in the sinus venosus, the prospective SAN.11,12 Here we have evaluated the expression pattern of CD166 in the developing mouse conduction system/SAN, identified as the cardiac regions expressing the pacemaker channel HCN, as previously reported.14,15 As shown in Figure 1, developing hearts of E10.5 mouse embryos, CD166 and HCN4 signals are almost completely overlapped (Figure 1 A-C). At E12.5, HCN4 and CD166 still co-localize in the region corresponding to the developing SAN (Figure 1 D-F), but as previously reported,11 CD166 expression broadens and becomes more evident in ventricles (Figure 1E) and in several extracardiac organs/tissues (Online Figure I).

These data support the use of CD166 as a good candidate to isolate pacemaker cell precursors at early developmental stages. CD166 identifies cardiac-committed cells in differentiating mESC.

We carried out flow cytometry analysis and sorting of cells dissociated from EBs, and labeled with an anti-CD166 antibody, at various differentiation time points; qRT-PCR was then used to quantify the expression of sarcomeric α-actinin, in order to establish when CD166 specifically identifies cardiac-committed cells. Figure 2A shows representative dot plots of the population of viable cells (P1) obtained from the dissociation of EBs and the CD166-negative (CD166P) and CD166-positive (CD166+, P3) subpopulations present at day 6, 8, 10 and 15 of differentiation. The CD166+ population was 1.4 ± 1.3% at day 6 and increased to 12.1±6.4%, 20.7±8.1% and 37.3±9.0% at days 8, 10 and 15, respectively. Following cell sorting, the qRT-PCR revealed significantly higher levels of α-actinin in the CD166+ than in the CD166 populations at day 6 and day 8, while at day 10 and 15 α-actinin expression in CD166+ and CD166was similarly low, indicating the loss of cardiac specificity (Figure 2B). We therefore chose day 8 for selection of CD166+ cells, in order to optimize at one time the yield and cardiac specificity.



DOI: 10.1161/CIRCRESAHA.113.301283 5

To evaluate the purity of the sorting procedure, we compared the expression levels of CD166 in the two populations and in the undifferentiated ESCs; as expected only the CD166+ population showed a high level of expression (Figure 2C). Other cardiac markers such as cTnI, Mef2c and GATA4 were significantly more expressed in CD166+ cells than in CD166 population or in ESCs (Figure 2D).

Since it is known that the cardiac differentiation potential may differ from clone to clone and among different cell lines,16 we repeated the selection using a different ESC line (CGR8). Flow cytometry and qRT-PCR analyses on CGR8 ESCs confirmed that at day 8, α-actinin expression in CD166+ cells was 10-fold higher than in CD166 cells (Online Figure II), indicating that our selection procedure is effective in isolating cardiac precursors, independently from the ESCs line used.

To better characterize the CD166 population we carried out a FACS analysis on cells dissociated

from 8 day-old EBs, to check for the expression of markers typically expressed in cardiovascular precursors (flk-1, Sca-1 and c-kit), in mesenchymal stem cells (CD44 and CD90), and in hematopoietic precursors (CD34).17-20 Representative dot plots of Figure 3 show that although flk-1, Sca-1 and c-kit are expressed in 8 day-old EBs (Q1), the fraction of cells co-expressing one of these markers with CD166 (Q2) is very low. The same is true for the mesenchymal markers CD90 while CD44 was expressed in a small proportion of CD166+ cells. As expected, the hematopoietic marker CD34 was not expressed at all. On average, the fraction of double positive cells was: flk-1+/CD166+, 0.3±0.1%; Sca-1+/CD166+, 0.6±0.1%, c-kit+/CD166+, 3.7±2.8%; CD90/CD166+, 1.0± 0.8%; CD44/CD166+, 6.5±2.3%; CD34/CD166+, 0% (n=3).

We also evaluated the expression of genes whose expression is specifically associated with the endodermal, ectodermal and noncardiac mesodermal lineages in CD166+ cells. qRT-PCR analysis revealed that, in CD166+ cells, the expression levels of the ectodermal marker synaptophysin, the endodermal marker transthyretin and the mesodermal, skeletal muscle-specific marker myoD were low (Online Figure III), further indicating that CD166 recognizes a specific sub-population of cardiac precursors. CD166+ cells express typical SAN genes.

After sorting, and 24h of re-aggregation, most of the CD166+-derived aggregates started to beat spontaneously (see online Video I), and continued to beat vigorously in culture (see online video II) for up to four weeks. Spontaneous contraction was never seen in aggregates derived from CD166 cells. We quantified the fraction of cells expressing -actinin and/or HCN4 at various days after sorting (2, 3 and 4, Online Figure IV). -actinin was expressed in the 77-87% of the CD166+ and in the 15-17% of the CD166- cells while HCN4 was expressed in 82-84% of the CD166+ and 1-16% of CD166- cells (see Online Table II for actual values).

We then compared, by qRT-PCR, the mRNA levels of several genes either expressed in the

embryonic and adult SAN or in ventricles with the levels found in early (just after sorting) or late (3-4 weeks in culture) CD166+ cells (Figure 4). We first analyzed the expression of the transcription factors Tbx18, Tbx3, Isl1 and Shox2, which are important in SAN formation.21-23 The expression of these genes was high in early CD166+ cells and, even though it decreased in late cultures, remained at levels comparable with those found in the SAN and significantly higher than those found in the ventricle.

We next quantified the gene expression of several proteins and ion channels essential for SAN

function.24 In CD166+ cells and SAN, most of these genes (ssTnI, HCN4, HCN1, CaV1.3, Cx30.2) are expressed at significantly higher levels than in the ventricle. Expression of the T-type calcium channel CaV3.2, high in early CD166+ cells, decreased significantly at later stages; nevertheless, this decrease was accompanied by a slight increase of the CaV3.1 isoform the other T-type calcium isoform expressed in the SAN;24,25 a similar isoform switch between CaV3.2 and CaV3.1 has been previously documented during both mouse development and mESCs differentiation.26,27 Connexin 45 (Cx45), an isoform found in all cardiac regions of the embryonic heart, and down-regulated after birth,24,28 was expressed at similar levels in all groups but in early CD166+ cells where its expression was significantly higher. We finally quantified in CD166+ cells, the expression of typical ventricular genes, such as Nkx2.5, Kv4.2, HCN2 and Cx43 and again we found levels similar to those of the SAN rather than those of the ventricle (Figure 4). Taken



DOI: 10.1161/CIRCRESAHA.113.301283 6

together these data indicate that during their in vitro maturation, CD166-selected cells display changes in the gene expression profile which largely recapitulate that of the native SAN cells.

In a subset of experiments we have also evaluated the expression of HCN4, HCN1, ssTnI and Shox2 in CD166 cells; as expected, these markers were significantly less expressed than in CD166+ cells (Online Figure V). HCN and calcium channels are functional in CD166-selected cardiomyocytes.

Since HCN channels are critical for pacemaker activity in both embryonic and adult SAN,29,30 and their ectopic expression induces repetitive spontaneous activity in the ventricle,31 we evaluated the expression of various HCN subunits at the protein level after 1 or 3 weeks in culture (Figure 5). In agreement with qRT-PCR data, we found that, after 1 week in culture, CD166+ cells expressed both HCN1 (Figure 5B) and HCN4 (Figure 5E) together with the cardiac markers α-actinin (α-act, Figure 5A and D) while HCN2, the main ventricular isoform,32 could not be detected in α-act-positive cells (Figure 5G,H). Panel I of Figure 5 shows a staining of rat neonatal ventricular myocytes as a positive control of HCN2 staining.

Interestingly, after 3 weeks in culture, CD166-selected cells acquired also a morphology similar to

that of adult SAN myocytes (Figure 5J,K and M,N) and, like adult SAN cells, showed co-localization of HCN4 and cav3 staining (Figure 5L).33 Furthermore, like SAN, CD166-selected cells expressed negligible levels of the atrial-specific alpha-myosin heavy chain (Myh6) and of the ventricular-specific myosin light chain 2v (mlc2v), suggesting no progression of differentiation towards a chamber phenotype (Online Figure VI).

The distribution of HCN4 staining in 25 days-old CD166-selected cell syncytia was quite similar to that observed in murine SAN slices (Online Figure VII).

Since CD166+ cells express the HCN isoforms (HCN4 and 1), typically found in the SAN, we also

analyzed the If current. CD166-selected cells display the If current both after 1 (Figure 6A left) and 3 weeks

in culture with a voltage dependence comparable to that of native mouse SAN cells (Figure 6 A right); V1/2

were: 77.4±2.4 mV and 73.4±1.2 mV in early (n=7, filled circles) and late (n=3, open circles) CD166-selected cells, and 73.6±1.4 in SAN myocytes (n=9, open squares; see also ref 30).

We evaluated also the contribution of the calcium currents ICaL and ICaT to spontaneous activity of

CD166-selected cells by superfusing the ICaT blocker Ni2+ (50 µM) and the ICaL blocker nifedipine (0.1 µM) during spontaneous AP recordings (Figure 6B); on average, Ni2+ decreased rate by 17.7±2.6% (n=5) and nifedipine by 16.9±6.4% (n=3); these values were not significantly different from those obtained from mouse SAN cells (Ni2+ 21.6±7.5,n=5; nifedipine 16.5±2.2, n=6)

As mentioned earlier, CD166-selected cardiomyocytes maintain their spontaneous activity for more

than 3 weeks in culture; during this period, their beating rate increased (Figure 7A) and the increase was comparable to that of normal mouse embryonic development,34 suggesting a certain degree of maturation. We finally evaluated whether CD166-selected cardiomyocytes were competent to respond to autonomic agonist stimulation, a feature of SAN myocytes important for modulation of cardiac chronotropism. In Figure 7B confocal images of CD166-selected cells double-stained with anti-β1-, β2-adrenergic or anti-M2 muscarinic (M2 Ach) receptors and Cav3 or α-actinin (as indicated) are shown. In Figure 7C, spontaneous action potentials before (Control) and during superfusion of the β-adrenergic agonist isoproterenol (Iso, 1 μmol/L) or the muscarinic agonist acetylcholine (ACh, 0.1 μmol/L) are shown. Upon isoproterenol and acetylcholine stimulation, the beating rate increased by 56.9±8.0% (n=5) and decreased by 22.9±5.4 (n=3), respectively. HCN4 promoter is active and delineates CD166+ cells.

We also generated a clone of ESCs, stably expressing the EGFP under the transcriptional control of the HCN4 promoter (pHCN4-EGFP, see online Methods). pHCN4-EGFP-derived EBs displayed EGFP-positive contracting portions co-expressing caveolin 3 and HCN4 (Online Figure VIII A). As expected, when



DOI: 10.1161/CIRCRESAHA.113.301283 7

CD166+ cells were selected from pHCN4-EGFP EBs, the whole beating layer (online video III) showed the EGFP signal (Online Figure VIII B). CD166-selected cells drive the rate of co-cultured neonatal ventricular myocytes.

We have then evaluated if CD166-selected cells can functions as a pacemaker; to this aim we have employed a widely used co-culture system.35-37 Rat neonatal ventricular myocytes were plated on top of both, spontaneously beating CD166+ cells or of quiescent CD166, or were plated alone. After a few days, when a syncytium was formed, spontaneous rate was calculated from action potentials recordings. Cardiomyocytes in co-culture with CD166+ cells had a mean rate of 1.7±0.19 Hz (n=5, data not shown), significantly higher than the rate obtained from both cardiomyocytes in co-culture with CD166 (0.82±017 Hz, n=6) and from cardiomyocytes alone (0.84 ±0.09 Hz, n=7). These data indicate that CD166+ cells are able to electrically couple and drive an excitable substrate, thus behaving as a biological pacemaker. CD166+ cells have a low proliferative potential in vitro and are not teratogenic in vivo.

One of the major drawbacks of pluripotent stem cells resides in their high proliferative and differentiation potential, leading to teratoma formation. We have quantified CD166+ cell proliferation by BrdU staining; CD166+ cells showed a low proliferative potential at 24h (7.2 ± 2.7%), a value that further decreased at 48h (3.8±1.8%); as expected, the BrdU incorporation rate of undifferentiated ESCs was high (63.5±4.9%). Furthermore CD166+ cells, unlike mES cells, failed to induce teratomas when injected in vivo in CD1 nude mice (see supplementary material and Online Figure IX for details). DISCUSSION

The possibility to generate de novo a population of stem cell-derived pacemaker cardiomyocytes similar if not identical to mature SAN cells would be highly desirable in sight of the development of either a cell-based therapeutic approach aimed at re-establishing the proper cardiac rhythm (biological pacemaker) or as an in vitro cell/tissue model for testing cardioactive drugs. Pluripotent stem cells are particularly attractive for this aim since they can generate spontaneously beating cells with the molecular and functional features typical of SAN/pacemaker myocytes.4,6,7,38

Since pacemaker cells originating from differentiating ESCs are interspersed among other cell

types,4 their specific selection and isolation remains a major challenge. So far, two markers have been found to be expressed both in the heart and in ESC-derived

cardiomyocytes: CD166 (or ALCAM)11-13,39 and CD172a (or SIRPA).40 The fact that SIRPA is expressed in both the fetal and adult human heart (in both atria and ventricles), and that in hESCs, can be used to select a subpopulation enriched in cardiac troponinT-positive precursors, rules against its use as a selection marker for pacemaker precursors. Furthermore, SIRPA could not be detected in mouse heart,40 suggesting that it does not represent an evolutionary conserved protein for cardiac development.

We have instead selected cells expressing CD166. Although this protein is not an established cardiac

marker, it is transiently but specifically expressed in the developing heart tube and sinus venosus the prospective SAN.11, 12. Here we have indeed shown that CD166 expressing cells express also HCN4 (Figure 1), a protein that specifically delineates the SAN region both during embryogenesis14,15,41 and in adulthood.42-

45 HCN4 is also fundamental for sinus node function since its absence is incompatible with life29,30 and mutations in its sequence can cause inherited rhythm disturbances.46

Here we show that freshly selected CD166+, but not CD166 cells, express high levels of HCN4 mRNA and already 1 day after sorting most of the cells express the HCN4 proteins (Online Figure IV). After 4 weeks in culture, CD166-selected cells maintain a high HCN4 expression, and also assume the spindle-shaped morphology typical of SAN cells forming cell agglomerates like those of native SAN (Figure 5J-N and online Figure VI).



DOI: 10.1161/CIRCRESAHA.113.301283 8

CD166+ cells express also high levels of Tbx18, Shox2, Tbx3 and Isl-1 which are known to characterize the pool of mesodermal progenitors which separate early during cardiogenesis15 to originate first the sinus venosus and then the SAN. Isl-1 also identifies a population of HCN4-expressing myocytes in both the adult murine and human SAN, but it is not expressed in the working myocardium.47 After three weeks in culture, the expression level of these genes is still comparable to that found in the SAN, and higher than those found in the ventricle. Our data thus show that CD166 represents an optimal marker for specifically selecting SAN precursors. CD166-based selection has been previously used to isolate cardiovascular precursors from yolk sack.12 At embryonic day 8.5, yolk sack-derived CD166+ cells originate both endothelial and cardiac cells, however if CD166+ cells are selected also for flk-1, only the CD166+/flk-1� population formed cardiomyocytes.12 In agreement with this evidence, our data show a negligible co-expression of CD166 and flk-1.

Other data show however that ESC-derived flk-1+ cardiac precursor express also c-kit and sca-1, 17,48 and that a subpopulation of ESC-derived selected by sca-1 formed α-MHC-positive contracting aggregates.49 CD166+ cardiac precursors do not express significant level of either flk-1 or Sca-1 and very low levels of c-kit, (Figure 3). Whether this means that our CD166+ cells represent a different population or a different stage of the same population of precursors, it remains to be elucidated.

Previously, Rust et al.13 have shown that CD166 selection of differentiating human ESCs results in a population enriched in cells defined as embryonic cardiomyocytes on the base of ion channels and structural proteins expression. We have instead found that mESC-derived CD166+ cells represent a population specifically committed to become SAN myocytes, as indicated by the expression of specific genes (Figure 4) and proteins (Figure 5), and by the electrophysiological properties typical of native adult SAN cells (Figure 6).

Differences between our data and those of Rust et al.13 could arise both from the different species used and, more likely, as a consequence of the different isolation protocols. For example, they isolated cells when CD166 expression peaked; we instead selected cells when the difference in α-sarcomeric actinin expression between CD166+ and CD166 cells was maximal. Other important differences concern the cell proliferation potential of CD166-selected cells. They found a proliferation rate of about 20-30% while our CD166-sorted cells have a much lower proliferation rate (<4% at 48 hrs from sorting). Moreover their cells maintain a high CD166 expression for at least two weeks while in our cells CD166 expression decreased significantly (Online Figure VIII A), as expected during cardiomyocytes maturation.11

Previous attempts to generate pacemaker/SAN myocytes from ESCs have used either a cell engineering9 or a pharmacological approach5,50 but neither one resulted in a homogeneous population. Morikawa et al.9 generated mESCs expressing the EGFP under the transcriptional control of HCN4 gene promoter. Contracting areas of these engineered EBs expressed EGFP, HCN4 and other cardiac proteins but when EGFP+ cells were sorted, the majority did not show spontaneous action potentials but instead expressed the neuronal marker nestin,9 which is in line with the fact that neuronal cells also express HCN4 channels.14 Pharmacological treatment of differentiating ESCs with either 1-ethyl-2-benzimidazolinone (EBIO) or with suramin increased the fraction of sinus node-like cell population by 6 and 3 folds, respectively however these treatments did not prevented contamination by other cell lineages.5,50 In addition to the gene expression pattern, our CD166-selected cardiomyocytes also display the functional properties peculiar of the SAN cardiomyocytes. The main function of SAN myocytes is to spontaneously generate action potentials and to modulate cardiac rhythm so as to account for changes in oxygen demands. CD166-selected cardiomyocytes form a synchronously beating syncytium (see online videos II and III) which fires repetitive and regular action potentials. It is interesting to note that CD166-selected cardiomyocytes, like embryonic hearts,34 increase their beating frequency with time, reaching a rate similar to that previously reported for dissociated adult mouse SAN myocytes.30,51 The similarity between CD166-derived syncytia and mature SAN is further validated by the presence of functional β-adrenergic and cholinergic pathways (Figure 7) that physiologically modulate the response to autonomic stimulation, and by the electrophysiological features analyzed. In particular our data clearly show that the kinetic properties of If



DOI: 10.1161/CIRCRESAHA.113.301283 9

and the effect on rate exerted by the blockade of calcium channels are the same in freshly isolated sinoatrial mayocytes and CD166-selected cells.

Finally, it is important to note that a major concern regarding the use of pluripotent cells relates to their ability to easily generate teratomas in vivo, unless they are committed/differentiated prior of injection.8 In this respect, based on the low proliferation potential, the lack of expression of pluripotency-related genes and the failure to induce teratomas when injected in CD1 nude mice, CD166+ cells represent a safe substrate. Study Limitation.

Despite our CD166-selected cells form a spontaneously beating syncytium and are able to electrically connect to and pace a monolayer of ventricular myocytes in vitro, their ability to engraft within the heart and to drive it at physiological rates remain to be addressed. Similarly, although heart development is quite conserved in mammals, the possibility to translate the present protocol to hiPSC, even though CD166 expression has been already reported in the human heart and in human ESC- and iPSC-derived cardiomyocytes, remains to be elucidated.

Conclusions.

In conclusion we have demonstrated that it is possible to specifically recognize and select mesodermal precursors expressing several transcription factors characterizing those cells that in the embryo will originate the sinus node.21,22 We can thus speculate that once these precursor are isolated from other lineages of the EBs, this condition favors a high level of expression of transcription factors such as Tbx18, Shox-2 and Tbx3 preventing the switch-on of gene programs leading to the working myocardium.22,23 The CD166-selected cells thus maintain the molecular features necessary to develop into fully functional SAN cardiomyocytes. This finding, when applied to human pluripotent stem cells, could pave the path for the development of a cell-based biological pacemaker useful both for clinical and for in vitro pharmacological applications. ACKNOWLEDGMENTS CGR8 cell line was a kind gift of Dr. Marisa Jaconi Département de Pathologie et Immunologie, Centre Médical Universitaire Genève and Prof. Elisbetta Cerbai, Dipartimento di Farmacologia, Università di Firenze. SOURCES OF FUNDING This work was supported by: Fondo per gli Investimenti della Ricerca di Base [FIRB RBLA035A4X] and Programmi di Ricerca Scientifica di Rilevante Interesse Nazionale [PRIN 2008ETWBTW] to DD. DISCLOSURES None. REFERENCES

1. Birnie D, Williams K, Guo A, Mielniczuk L, Davis D, Lemery R, Green M, Gollob M, Tang A.

Reasons for escalating pacemaker implants. Am J Cardiol. 2006;98:93-7.

2. Rosen MR, Brink PR, Cohen IS, Robinson RB. Cardiac pacing: from biological to electronic ... to biological? Circ Arrhythm Electrophysiol. 2008;1:54-61.

3. Cho HC, Marban E. Biological therapies for cardiac arrhythmias: can genes and cells replace drugs and devices? Circ Res. 2010;106:674-85.



DOI: 10.1161/CIRCRESAHA.113.301283 10

4. Barbuti A, Crespi A, Capilupo D, Mazzocchi N, Baruscotti M, DiFrancesco D. Molecular composition and functional properties of f-channels in murine embryonic stem cell-derived pacemaker cells. J Mol Cell Cardiol. 2009;46:343-51.

5. Kleger A, Seufferlein T, Malan D et al. Modulation of calcium-activated potassium channels induces cardiogenesis of pluripotent stem cells and enrichment of pacemaker-like cells. Circulation. 2010;122:1823-36.

6. He JQ, Ma Y, Lee Y, Thomson JA, Kamp TJ. Human embryonic stem cells develop into multiple types of cardiac myocytes: action potential characterization. Circ Res. 2003;93:32-9.

7. Ma J, Guo L, Fiene SJ, Anson BD, Thomson JA, Kamp TJ, Kolaja KL, Swanson BJ, January CT. High purity human-induced pluripotent stem cell-derived cardiomyocytes: electrophysiological properties of action potentials and ionic currents. Am J Physiol Heart Circ Physiol. 2011;301:H2006-H2017.

8. Behfar A, Perez-Terzic C, Faustino RS, Arrell DK, Hodgson DM, Yamada S, Puceat M, Niederlander N, Alekseev AE, Zingman LV, Terzic A. Cardiopoietic programming of embryonic stem cells for tumor-free heart repair. J Exp Med. 2007;204:405-20.

9. Morikawa K, Bahrudin U, Miake J, Igawa O, Kurata Y, Nakayama Y, Shirayoshi Y, Hisatome I. Identification, isolation and characterization of HCN4-positive pacemaking cells derived from murine embryonic stem cells during cardiac differentiation. Pacing Clin Electrophysiol. 2010;33:290-303.

10. Gassanov N, Er F, Zagidullin N, Hoppe UC. Endothelin induces differentiation of ANP-EGFP expressing embryonic stem cells towards a pacemaker phenotype. FASEB J. 2004;18:1710-2.

11. Hirata H, Murakami Y, Miyamoto Y, Tosaka M, Inoue K, Nagahashi A, Jakt LM, Asahara T, Iwata H, Sawa Y, Kawamata S. ALCAM (CD166) is a surface marker for early murine cardiomyocytes. Cells Tissues Organs. 2006;184:172-80.

12. Murakami Y, Hirata H, Miyamoto Y, Nagahashi A, Sawa Y, Jakt M, Asahara T, Kawamata S. Isolation of cardiac cells from E8.5 yolk sac by ALCAM (CD166) expression. Mech Dev. 2007;124:830-9.

13. Rust W, Balakrishnan T, Zweigerdt R. Cardiomyocyte enrichment from human embryonic stem cell cultures by selection of ALCAM surface expression. Regen Med. 2009;4:225-37.

14. Garcia-Frigola C, Shi Y, Evans SM. Expression of the hyperpolarization-activated cyclic nucleotide-gated cation channel HCN4 during mouse heart development. Gene Expr Patterns. 2003;3:777-83.

15. Mommersteeg MT, Hoogaars WM, Prall OW, Gier-de Vries C, Wiese C, Clout DE, Papaioannou VE, Brown NA, Harvey RP, Moorman AF, Christoffels VM. Molecular pathway for the localized formation of the sinoatrial node. Circ Res. 2007;100:354-62.

16. Ward CM, Barrow KM, Stern PL. Significant variations in differentiation properties between independent mouse ES cell lines cultured under defined conditions. Exp Cell Res. 2004;293:229-38.

17. Kattman SJ, Huber TL, Keller GM. Multipotent flk-1+ cardiovascular progenitor cells give rise to the cardiomyocyte, endothelial, and vascular smooth muscle lineages. Dev Cell. 2006;11:723-32.

18. Matsuura K, Nagai T, Nishigaki N, Oyama T, Nishi J, Wada H, Sano M, Toko H, Akazawa H, Sato T, Nakaya H, Kasanuki H, Komuro I. Adult cardiac Sca-1-positive cells differentiate into beating cardiomyocytes. J Biol Chem. 2004;279:11384-91.

19. Oh H, Bradfute SB, Gallardo TD, Nakamura T, Gaussin V, Mishina Y, Pocius J, Michael LH, Behringer RR, Garry DJ, Entman ML, Schneider MD. Cardiac progenitor cells from adult



DOI: 10.1161/CIRCRESAHA.113.301283 11

myocardium: homing, differentiation, and fusion after infarction. Proc Natl Acad Sci U S A. 2003;100:12313-8.

20. Wei F, Wang T, Liu J, Du Y, Ma A. The subpopulation of mesenchymal stem cells that differentiate toward cardiomyocytes is cardiac progenitor cells. Exp Cell Res. 2011;317:2661-70.

21. Bakker ML, Christoffels VM, Moorman AF. The cardiac pacemaker and conduction system develops from embryonic myocardium that retains its primitive phenotype. J Cardiovasc Pharmacol. 2010;56:6-15.

22. Christoffels VM, Smits GJ, Kispert A, Moorman AF. Development of the pacemaker tissues of the heart. Circ Res. 2010;106:240-54.

23. Wiese C, Grieskamp T, Airik R, Mommersteeg MT, Gardiwal A, de Gier-de VC, Schuster-Gossler K, Moorman AF, Kispert A, Christoffels VM. Formation of the sinus node head and differentiation of sinus node myocardium are independently regulated by Tbx18 and Tbx3. Circ Res. 2009;104:388-97.

24. Marionneau C, Couette B, Liu J, Li H, Mangoni ME, Nargeot J, Lei M, Escande D, Demolombe S. Specific pattern of ionic channel gene expression associated with pacemaker activity in the mouse heart. J Physiol. 2005;562:223-34.

25. Mangoni ME, Traboulsie A, Leoni AL, Couette B, Marger L, Le QK, Kupfer E, Cohen-Solal A, Vilar J, Shin HS, Escande D, Charpentier F, Nargeot J, Lory P. Bradycardia and slowing of the atrioventricular conduction in mice lacking CaV3.1/alpha1G T-type calcium channels. Circ Res. 2006;98:1422-30.

26. Mizuta E, Miake J, Yano S, Furuichi H, Manabe K, Sasaki N, Igawa O, Hoshikawa Y, Shigemasa C, Nanba E, Ninomiya H, Hidaka K, Morisaki T, Tajima F, Hisatome I. Subtype switching of T-type Ca 2+ channels from Cav3.2 to Cav3.1 during differentiation of embryonic stem cells to cardiac cell lineage. Circ J. 2005;69:1284-9.

27. Mizuta E, Shirai M, Arakawa K, Hidaka K, Miake J, Ninomiya H, Kato M, Shigemasa C, Shirayoshi Y, Hisatome I, Morisaki T. Different distribution of Cav3.2 and Cav3.1 transcripts encoding T-type Ca(2+) channels in the embryonic heart of mice. Biomed Res. 2010;31:301-5.

28. Alcolea S, Theveniau-Ruissy M, Jarry-Guichard T, Marics I, Tzouanacou E, Chauvin JP, Briand JP, Moorman AF, Lamers WH, Gros DB. Downregulation of connexin 45 gene products during mouse heart development. Circ Res. 1999;84:1365-79.

29. Stieber J, Herrmann S, Feil S, Loster J, Feil R, Biel M, Hofmann F, Ludwig A. The hyperpolarization-activated channel HCN4 is required for the generation of pacemaker action potentials in the embryonic heart. Proc Natl Acad Sci U S A. 2003;100:15235-40.

30. Baruscotti M, Bucchi A, Viscomi C, Mandelli G, Consalez G, Gnecchi-Rusconi T, Montano N, Casali KR, Micheloni S, Barbuti A, DiFrancesco D. Deep bradycardia and heart block caused by inducible cardiac-specific knockout of the pacemaker channel gene Hcn4. Proc Natl Acad Sci U S A. 2011;108:1705-10.

31. Qu J, Plotnikov AN, Danilo P, Jr., Shlapakova I, Cohen IS, Robinson RB, Rosen MR. Expression and function of a biological pacemaker in canine heart. Circulation. 2003;107:1106-9.

32. Schweizer PA, Yampolsky P, Malik R, Thomas D, Zehelein J, Katus HA, Koenen M. Transcription profiling of HCN-channel isotypes throughout mouse cardiac development. Basic Res Cardiol. 2009;104:621-9.



DOI: 10.1161/CIRCRESAHA.113.301283 12

33. Barbuti A, Terragni B, Brioschi C, DiFrancesco D. Localization of f-channels to caveolae mediates specific beta2-adrenergic receptor modulation of rate in sinoatrial myocytes. J Mol Cell Cardiol. 2007;42:71-8.

34. Zhou YQ, Foster FS, Parkes R, Adamson SL. Developmental changes in left and right ventricular diastolic filling patterns in mice. Am J Physiol Heart Circ Physiol. 2003;285:H1563-H1575.

35. Potapova I, Plotnikov A, Lu Z, Danilo P, Jr., Valiunas V, Qu J, Doronin S, Zuckerman J, Shlapakova IN, Gao J, Pan Z, Herron AJ, Robinson RB, Brink PR, Rosen MR, Cohen IS. Human mesenchymal stem cells as a gene delivery system to create cardiac pacemakers. Circ Res. 2004;94:952-9.

36. Xue T, Cho HC, Akar FG, Tsang SY, Jones SP, Marban E, Tomaselli GF, Li RA. Functional integration of electrically active cardiac derivatives from genetically engineered human embryonic stem cells with quiescent recipient ventricular cardiomyocytes: insights into the development of cell-based pacemakers. Circulation. 2005;111:11-20.

37. Kehat I, Khimovich L, Caspi O, Gepstein A, Shofti R, Arbel G, Huber I, Satin J, Itskovitz-Eldor J, Gepstein L. Electromechanical integration of cardiomyocytes derived from human embryonic stem cells. Nat Biotechnol. 2004;22:1282-9.

38. Yanagi K, Takano M, Narazaki G, Uosaki H, Hoshino T, Ishii T, Misaki T, Yamashita JK. Hyperpolarization-activated cyclic nucleotide-gated channels and T-type calcium channels confer automaticity of embryonic stem cell-derived cardiomyocytes. Stem Cells. 2007;25:2712-9.

39. Lin B, Kim J, Li Y, Pan H, Carvajal-Vergara X, Salama G, Cheng T, Li Y, Lo CW, Yang L. High-purity enrichment of functional cardiovascular cells from human iPS cells. Cardiovasc Res. 2012;95:327-35.

40. Dubois NC, Craft AM, Sharma P, Elliott DA, Stanley EG, Elefanty AG, Gramolini A, Keller G. SIRPA is a specific cell-surface marker for isolating cardiomyocytes derived from human pluripotent stem cells. Nat Biotechnol. 2011;29:1011-8.

41. Hoogaars WM, Tessari A, Moorman AF, de Boer PA, Hagoort J, Soufan AT, Campione M, Christoffels VM. The transcriptional repressor Tbx3 delineates the developing central conduction system of the heart. Cardiovasc Res. 2004;62:489-99.

42. Yamamoto M, Dobrzynski H, Tellez J, Niwa R, Billeter R, Honjo H, Kodama I, Boyett MR. Extended atrial conduction system characterised by the expression of the HCN4 channel and connexin45. Cardiovasc Res. 2006;72:271-81.

43. Liu J, Dobrzynski H, Yanni J, Boyett MR, Lei M. Organisation of the mouse sinoatrial node: structure and expression of HCN channels. Cardiovasc Res. 2007;73:729-38.

44. Brioschi C, Micheloni S, Tellez JO, Pisoni G, Longhi R, Moroni P, Billeter R, Barbuti A, Dobrzynski H, Boyett MR, DiFrancesco D, Baruscotti M. Distribution of the pacemaker HCN4 channel mRNA and protein in the rabbit sinoatrial node. J Mol Cell Cardiol. 2009;47:221-7.

45. Chandler NJ, Greener ID, Tellez JO et al. Molecular architecture of the human sinus node: insights into the function of the cardiac pacemaker. Circulation. 2009;119:1562-75.

46. Baruscotti M, Barbuti A, Bucchi A. The cardiac pacemaker current. J Mol Cell Cardiol. 2010;48:55-64.

47. Weinberger F, Mehrkens D, Friedrich FW, Stubbendorff M, Hua X, Muller JC, Schrepfer S, Evans SM, Carrier L, Eschenhagen T. Localization of islet-1-positive cells in the healthy and infarcted adult murine heart. Circ Res. 2012;110:1303-10.



DOI: 10.1161/CIRCRESAHA.113.301283 13

48. Baba S, Heike T, Yoshimoto M, Umeda K, Doi H, Iwasa T, Lin X, Matsuoka S, Komeda M, Nakahata T. Flk1(+) cardiac stem/progenitor cells derived from embryonic stem cells improve cardiac function in a dilated cardiomyopathy mouse model. Cardiovasc Res. 2007;76:119-31.

49. Lam ML, Hashem SI, Claycomb WC. Embryonic stem cell-derived cardiomyocytes harbor a subpopulation of niche-forming Sca-1+ progenitor cells. Mol Cell Biochem. 2011;349:69-76.

50. Wiese C, Nikolova T, Zahanich I, Sulzbacher S, Fuchs J, Yamanaka S, Graf E, Ravens U, Boheler KR, Wobus AM. Differentiation induction of mouse embryonic stem cells into sinus node-like cells by suramin. Int J Cardiol. 2011;147:95-111.

51. Cho HS, Takano M, Noma A. The electrophysiological properties of spontaneously beating pacemaker cells isolated from mouse sinoatrial node. J Physiol. 2003;550:169-80.



DOI: 10.1161/CIRCRESAHA.113.301283 14

FIGURE LEGENDS Figure 1. CD166+ expression in the developing cardiac conduction system. A,D, Hematoxilin & eosin staining of E10.5 (A) and E12.5 hearts; ra, right atrium; la, left atrium, rv, right ventricle; lv, left ventricle; avc, atrioventricular canal; rsh right sinus horn; rscv, right superior caval vein. B,C,E,F, confocal images of adjacent slices of E10.5 (B,C) and E12.5 heart (E,F) showing the expression of CD166 and HCN4 proteins. Figure 2. CD166 recognize cardiac precursors. A, Representative dot-plots of CD166 and CD166+ populations (P2 and P3 gates respectively) obtained by flow cytometry analysis of cells dissociated from EBs (P1 gate); at different time points of differentiation. B, qRT-PCR analysis of cardiac α-actinin (α-act) in CD166+ (white bars) and CD166 (gray bars) at the various times. C, D, quantitative expression analysis of CD166 (C) and of the cardiac genes, cTnI, Mef2c and GATA4 (D) in unsorted ESCs and in CD166+ and CD166 cells sorted at day 8 of differentiation. * indicates p<0.05 v CD166+. Figure 3. Flow cytometry characterization of the CD166+ population. Representative dot plots showing the proportion of CD166+ cells co-expressing cardiovascular (Flk-1, Sca-1 and c-kit), mesenchymal (CD90 and CD44) and hematopoietic (CD34) markers at day 8 of differentiation. Figure 4. Comparison of gene expression in early and late CD166+ cells, SAN and ventricle. qRT-PCR analysis of transcription factors (Tbx18 Tbx3, Isl1 and Shox2), structural proteins and ion channel (ssTnI, HCN4, HCN1, CaV1.3, CaV3.2, CaV3.1, Cx 30.2 and Cx 45) involved in SAN development and function and of ventricular genes (Nkx2.5, Kv 4.2, HCN2 and Cx43). * denotes p<0.05 vs SAN; # denotes p<0.05 vs ventricle. Figure 5. HCN channel expression in CD166-selected cells. Confocal images of CD166-selected cells, after 1 (A-H) or 3 (J-L) weeks in culture, labeled with either the cardiac proteins α-actinin (α-act, green) or caveolin3 (cav-3, green) and the various HCN isoforms (red). Neonatal ventricular myocytes were used as positive control for HCN2 staining (I, red). Nuclei were stained with DAPI. M,N, Phase contrast images of a single CD166-derived cells 25 days after cell sorting (M), and of an acutely dissociated mouse SAN cell (N). Calibration bars 50 μm. Figure 6. Functional comparison between CD166-selected cells and SAN myocytes. A left, representative If traces recorded from single CD166-selected cells after 1 week in culture ; right, mean

activation curves obtained from CD166-selected cells after 1 (filled circles) and 3 weeks (open circles) in cultures and from mouse SAN myocytes (open squares); lines represent the best fitting by the Boltzmann equation. B, Representative action potentials recorded from CD166-selected cells (top panels) and SAN cells (bottom panels) in control (Tyrode) and during superfusion of either 50 mol/L Ni2+ or 100 nmol/L nifedipine. Figure 7. Autorhythmic activity of CD166+-derived cells and autonomic modulation. A, Mean rate calculated from spontaneously beating CD166-selected cells at different time points in culture; insets show representative action potential traces. B, confocal images showing co-expression of caveolin3 with β1 and β2-adrenergic receptors and of α-actinin with M2 muscarinic receptors. Nuclei were stained with DAPI. Calibration bars 50 μm. C, spontaneous action potentials recorded in control and during perfusion of 1 μmol/L isoproterenol (Iso) and 0.1 μmol/L acetylcholine (Ach) from CD166-selected cells; the bar graph shows the mean rate changes caused by the autonomic agonists.



DOI: 10.1161/CIRCRESAHA.113.301283 15

Novelty and Significance What Is Known?

Embryonic stem cells (ESCs) may differentiate into cardiomyocytes with nodal-, atrial-, or ventricular-like properties.

Selection of ESC-derived cardiomyocytes is hampered by the lack of specific extracellular markers.

In the mouse, CD166 is transiently expressed in the developing heart. What New Information Does This Article Contribute?

During early heart development, CD166 is co-expressed with the HCN4 subunit of the pacemaker channels, the best known marker of the sinus node (SAN).

Cultured CD166+ cells, selected from differentiating mouse ESCs, express high levels of many genes involved in SAN development and function but express low levels of genes of the working myocardium, thus representing bona fide precursors of pacemaker cells.

Cultured CD166-selected cells acquire the morphological and functional properties of mature SAN

myocytes, and are able to electrically drive an excitable cellular substrate, thus behaving like a biological pacemaker.

Dysfunctions of the conduction tissue could trigger life-threatening arrhythmias that are often treated by implantation of electronic pacemakers. Electronic devices, however, present several limitations that may be overcome by developing a stem-cell based biological pacemaker. Here, we report the development of a protocol, based on the selection CD166-expressing cells, which allows the recognition and isolation of SAN precursors from ESC. CD166+ cells express several genes involved in SAN development and present the typical molecular and electrophysiological properties of mature SAN cardiomyocytes. CD166-selected cells are also able to pace in vitro a substrate of newborn ventricular myocytes, thus behaving as a pacemaker. The translation of these findings, to pluripotent stem cells of human origin, could aid the development of a biological pacemaker useful for in vitro pharmacological testing and for future clinical applications.



Figure 1



Figure 2

at UniversitÃ

degli Studi di Milano on July 5, 2013

http://circres.ahajournals.org/D

ownloaded from


Figure 3



Figure 4



Figure 5



Figure 6



Figure 7

at UniversitÃ

degli Studi di Milano on July 5, 2013

http://circres.ahajournals.org/D

ownloaded from


SUPPLEMENTAL MATERIAL

Detailed Methods

Mouse embryo tissue sections staining

Mouse embryos at developmental stage E10.5 and E12.5 were isolated from CD1 females’ mice, collected in cold PBS and fixed in 4% paraformaldehyde (PFA) for 1 or 2 hours respectively. The embryos were washed

twice in PBS, dehydrated by washing in PBS containing increasing concentration of sucrose (10, 20 and

30%), included in O.C.T compound and frozen in liquid nitrogen-cooled isopentane. Serial 8-µm-thick sections were cut with a Leica cryostat (Leica Microsystems GmbH, Wetzlar, Germany). Cryosections were

incubated in PBS with 1%BSA and 0.1%TritonX-100 for 1 hour at room temperature (RT) and then blocked with 10% donkey serum in PBS for 30 minutes at RT. The specimens were incubated with the primary

antibody (anti-CD166, Santa Cruz Biotechnology, Inc. 1:50 or anti-HCN4 Santa Cruz 1:50) overnight at 4°C

followed by secondary staining, for 1 hour at RT, with Alexa Fluor (488) donkey anti-goat secondary antibody, diluited 1:250 in PBS. Slides were then washed three times in PBS, incubated with Hoescht

(1mg/ml for 5min at RT), washed, mounted using Fluorescence Mounting Medium (Dako) and analyzed at fluorescence microscopes (Leica).

Cell culture and differentiation. Mouse ES cells (D3 line, ATCC, and CGR8 line) were grown in suspension in ES-medium containing ES-

DMEM (ATCC), 15% Knock-Out Serum Replacement (Gibco), 0.1 mmol/L Non Essential Amino Acids

(Gibco), 0.1 mmol/L β-mercaptoethanol (Sigma), 2 mmol/L L-glutamine (Gibco), 103 U/ml Leukemia Inhibitory Factor (LIF, Chemicon), 100 U/ml Penicillin and 0.1 mg/ml Streptomycin (Euroclone).

ES cells were differentiated as previously described.1 ES cells were cultured as hanging drops (20 µl/500

cells) for 2 days to form EBs which were then grown for 5 days in low-attachment dishes. At day 7, EBs

were plated on tissue culture dishes coated with gelatin 0.1% (Type B, Sigma) in differentiating medium

containing: DMEM (Invitrogen), 4 mmol/L L-glutamine (Gibco), 0.1 mmol/L Non Essential Amino Acids

(Gibco), 0.1 mmol/L β- mercaptoethanol (Sigma), 20% Fetal Bovine Serum (FBS) (Invitrogen), 100 U/ml Penicillin, 0.1 mg/ml Streptomycin (Euroclone).

ES cells engineering. For the generation of the cell clone constitutively expressing the nuclear LacZ (nLacZ) reporter gene, ES

cells were generated as previously described.2 Briefly, ES cells colonies were dissociated to single cells and

then incubated overnight (O/N) with 1 ml of third generation nLacZ (CMV promoter) lentiviral suspension at

MOI 1 with polybrene (8 µg/ml, Sigma Aldrich). After one day cells were centrifuged, washed once in PBS (Euroclone) and then cultured in growing medium. Lentiviral particles were produced and titered as

previously described. 2

The pHCN4-EGFP clone was obtained as follows: a 841 bp sequence located 2.30 Kb upstream of the 5’ ATG of the HCN4 gene, and corresponding to its promoter

3 (pHCN4), was cloned from mouse genomic

DNA and inserted into the expression vector pEGFP-N1 (Clontech) after removal of the constitutive CMV

promoter. The resulting pHCN4-EGFP plasmid carries the enhanced green fluorescent protein (EGFP) under

the transcriptional control of the pHCN4. 2x106 mouse ES D3 cells were nucleofected (Mouse ES

nucleofector kit VPH-1001, A24 program, Amaxa) with 10 µg of pHCN4-EGFP plasmid and plated in 3 100 mm dishes in ES-medium. To induce plasmid integration, cells were kept under stringent selection (600

μg/ml of geneticin) for at least two weeks, changing the medium every two days. After this period, the

geneticin concentration was lowered to 300 μg/ml.

Flow cytometry and cell sorting

For flow cytometry analysis and sorting EBs were collected and washed twice in PBS, incubated with Tryple

Express (Gibco) for 10 min at 37°C under gentle agitation, and then mechanically dissociated. The cell suspension was centrifuged at 310 x g for 15 min and resuspended in PBS plus 1 mmol/L CaCl2, 10% FBS

and 5 mmol/L EDTA. Cells were incubated with the fluorophore-conjugated antibodies for 30 min on ice, in

the dark and under gentle agitation, following manufacturer’s instruction. The antibodies used were: APC rat anti-mouse Flk-1 (BD Biosciences), PE-Cy7 rat anti-mouse c-kit (BD Biosciences), FITC rat anti-mouse

Sca-1 (BD Biosciences), APC rat anti-mouse CD90.2 (BD Biosciences) V450 rat anti-mouse CD44 (BD



Biosciences), PE-Cy7 Rat anti-mouse CD34 (Santa Cruz), PE Rat anti-mouse CD166 (eBioscience). After

incubation, cells were washed twice in PBS and resuspended in PBS plus 1 mmol/L CaCl2, 5 mmol/L

EDTA, filtered through a 70 m sterile mesh and analyzed by a FACSAriaTM

flow cytometer and sorter (BD Biosciences). For each antibody used, the appropriate isotype control and unstained cells were used to set the

FACS conditions.

For subsequent analyses cells were used just after the sorting procedure (day8) or were re-aggregated by gravity for 24h in low-adhesion culture dishes in differentiating medium and subsequently plated at either

high density to allow the formation of a compact layer or low density for electrophysiological analysis, in

silicon inserts (Giemme). After about 3 hours, the inserts were removed.

Neonatal cardiomyocytes (co-)cultures.

Neonatal rat cardiomyocytes were isolated as previously described 4. For co-culture experiments, either

2.5x105 re-aggregated CD166+ or CD166- were plated in square silicon supports (0.03 cm

2, Ibidi). After 4

hours the support was removed and the culture medium was changed the next day. After 3-4 days, 8x105 rat

neonatal ventricular myocytes were plated, in a delimited area using a cloning cylinder, both on top of

CD166+ or CD166- cells and on a distal empty area in the same dish. The inserts were removed after about 3 hours. Co-cultures were kept in differentiating medium for at least 3-4 days before electrophysiological

analysis.

Teratoma Assay All animal procedures were conformed to Italian law and approved by the San Raffaele Animal Care and

Use Committee (IACUC 355). CD-1 nude mice were housed in Charles River Laboratories and/or at San

Raffaele Scientific Institute animal house in specific pathogen-free (SPF) conditions. ES cells or FACS-sorted ES-selected CD166+ cells were resuspended in 100 µl of diluted Matrigel™ (1:10, Cultrex) and

injected with a 20G syringe (BD) in the left dorsal flank of CD-1 nude mice. After the development of the

teratoma, mice were euthanized and the teratoma processed for further analysis (see the section below).

Hematoxilin & eosin and x-gal stainings

Teratomas were fixed O/N in 4% paraformaldehyde (Sigma) at 4°C under gentle agitation. Small fragments

were dehydrated in growing concentration of sucrose (7%, 15% and 30% in PBS), to remove water, and then included in OCT (Tissue-Tek) with isopentane (VWR). 8µm-thick tissue sections were cut at the cryostate

and stained with hematoxylin/eosin (H&E) (Sigma) and X-gal (Invitrogen) according to standard protocols.

RNA extraction and quantitative (q)PCR

Total RNA was extracted with Trizol (Invitrogen). 1 μg of RNA from each sample was treated with DNase I

(Fermentas) to eliminate residual genomic DNA and reverse transcribed using the Superscript KIT (Invitrogen) with random hexamers following the manufacturer’s protocol. Gene expression was quantified

by real-time qPCR (Line-GeneK, Bioer); experiments were carried out using SYBER® Premix Ex Taq

™ II

(Takara) using 50 ng of cDNA and 500 nmol/L of each primer. All primer pairs had efficiency 95%. qPCR conditions were: first step at 50°C for 2 min, second step at 95°C for 20 sec followed by 45 cycles at 95°C

for 30 sec, 60°C for 30 sec and 72°C for 30 sec. The melting curve analysis (60°C to 96°C) was performed at the end to verify the presence of a single amplicon. Each sample was performed in triplicate and the mean

cycle threshold (Ct) of the gene of interest was normalized to the mean Ct of the housekeeping (hk) gene.

For α-actinin quantification, experiments were performed using both the hypoxanthine guanine

phosphoribosyl transferase (HPRT) and Glyceraldehyde-3-phosphate dehydrogenase (GAPDH, data not shown) as hk genes; since α-actinin expression pattern was similar with both hk genes, expression of all the

other genes was quantified using only HPRT.

Electrophysiology

For electrophysiology, cells were placed onto the stage of an inverted microscope and were superfused with

Tyrode solution containing (mmol/L): 140 NaCl, 5.4 KCl, 1.8 CaCl2, 1 MgCl2, 5.5 D-glucose, 5 Hepes-

NaOH; pH 7.4. Patch-clamp pipettes had resistances of 3-6 M when filled with the intracellular-like solution containing (mmol/L): 130 K-aspartate, 10 NaCl, 5 EGTA-KOH, 2 CaCl2, 2 MgCl2, 2 ATP (Na-

salt), 5 creatine phosphate, 0.1 GTP (Na-salt), 10 Hepes-KOH; pH 7.2. Spontaneous action potentials were

recorded by the patch-clamp technique in current clamp mode using the whole-cell configuration.



Temperature was kept at 36±1°C. Isoproterenol (Iso) and acetylcholine (ACh) (Sigma) were added to the

Tyrode solutions at the proper concentration from concentrated stock solutions. For voltage-clamp

recordings only single cells were used. 1 mmol/L BaCl2 and 2 mmol/L MnCl2 were added to the Tyrode

solution to improve dissection of If. To record If, hyperpolarizing test steps to the range -45/ -125 mV were

applied from a holding potential of -35 mV, followed by a fully activating steps at -125 mV. Each test step

was long enough to reach steady-state current activation. Activation curves were obtained from normalized tail currents measured at -125 mV and fitted to the Boltzmann distribution: y=(1/(1+exp((V-V1/2)/s), where

V is voltage, y fractional activation, V1/2 the half-activation voltage, and s the inverse-slope factor.

Immunofluorescence and video-confocal analysis

Samples were fixed in PFA (4%) on ice for 30 minutes, rinsed for 20 min with PBS containing 0.1 mol/L glycine, permeabilized with 1.5% (v/v) Triton X-100 in PBS for 30 min and then incubated in 0.3% Triton

X-100, 1% (w/v) Bovine Serum Albumin (BSA), 10% (v/v) Normal Donkey Serum in PBS for 1 hour.

Samples were incubated O/N at 4°C with primary antibodies in PBS, 0.3% Triton X-100, 1% Bovine Serum

Albumin (BSA), and 2% Serum. The antibodies used were: mouse anti-α-actinin (1:700, Sigma); mouse anti-caveolin-3 (1:500, BD Biosciences); rabbit anti-HCN1, -HCN2 and -HCN4 (1:100, Alomone Labs); rabbit

anti-β1 (1:50, Santa Cruz) and anti-β2 adrenergic receptors (1:50, Santa Cruz) and anti-muscarinic M2

receptors (1:200, Santa Cruz), chicken anti-GFP (1:1500, Abcam). Samples were then washed in PBS and incubated for 1 hour with the appropriate fluorophore-conjugated secondary antibodies (donkey anti-mouse

Alexa488; donkey anti rabbit Alexa594, goat anti-chicken Alexa 488, 1:1000 , goat anti-rabbit Alexa 405

1:500, Molecular Probes) in PBS, 0.3% Triton X-100, 1% Bovine Serum Albumin (BSA), and 2% Normal Donkey Serum. After a final washout in PBS, coverslips were mounted with Vectashield mounting medium

with or without DAPI (Vector). Confocal images were acquired using a video confocal microscopy ViCo

(Nikon). The proportion of cells expressing -actinin and/or HCN4 was calculated as the ratio between the number of cells not labeled and the total number of nuclei visible in each image. For each time point, three or

more fields from at least two different experiments were counted.

BrdU proliferation assay

CD166+ cells (24 and 48h after sorting) and ES cells, were incubated for 1h in culture medium with 50

μmol/L of 5-Bromo-2′-deoxyuridine (BrdU, Sigma) in a 5% CO2 incubator at 37°C. Cells were then washed

twice in PBS and fixed in EtOH 95% and Acetic acid 5% for 20 min at RT. Cells were washed once with 1.5 mol/L HCL for 10 min then rinsed twice in PBS and finally permeabilized with 0.25% Triton X-100 in PBS

for 5 min. Cells were incubated with the mouse anti-Bromo-deoxyuridine (clone BU-1, GE Healthcare) for

1h at 4°C. Samples were washed three times with PBS and once with 0.25% Triton X-100 for 5 min and

incubated with the donkey anti-mouse Alexa488 secondary antibody for 40 min in the dark at RT. After a final washout in PBS, coverslips were mounted with Vectashield mounting medium with DAPI

(Vector).Proliferation was evalutated by counting the proportion of BrdU-positive cells in several

microscopy fields (> 9 fields from 3 different experiments)

Supplementary Results

Pluripotent gene analysis and in vivo teratoma assay.

One of the major drawbacks of the use of pluripotent stem cells resides in their high teratogenic potential. In order to avoid teratoma formation, it is essential to purify a committed population of cells with a limited

proliferative potential and in which pluripotency genes have been turned off. To this aim, after selection,

CD166+ cells were allowed to re-aggregate in suspension for 24 hours and then plated. CD166+ cells express negligible levels of the pluripotency genes Oct4, Nanog and Rex1 that were instead expressed at

significantly higher levels in both CD166 and undifferentiated ESCs (Online Figure VIII A). Moreover, since CD166 expression is upregulated in several tumors, we have evaluated its expression in

CD166-selected cells after 8 and 25 days in culture; as expected from maturing cardiac cells, CD166 was

significantly downregulated with time (Online Figure VIII A). Given the low yet present proliferative potential of CD166+ cells and given the fact that even few

undifferentiated ESCs can generate a teratomas in vivo,5 we performed a teratogenic assay by subcutaneously

inoculating either 5x105 matrigel-embedded CD166+ or ESCs, constitutively expressing nLacZ, (Online Figure VIII B-E), in CD1 nude mice. As expected, ESCs transplanted mice (n=3) developed a teratoma

within two weeks from the injection (Online Figure VIII F-K) while those injected with CD166+ (n=4) did



not develop any teratoma even when CD166+ cells were increased to 1.5x106. Mice injected with CD166+ cells have been followed-up for more than one year. These data confirm that CD166+ cells have lost the

pluripotency and thus the teratogenic features typical of ESCs and suggest that CD166+ precursors may

represent a suitable and safe cell source for in vivo applications

Online Figure legends

Online Figure I CD166+ expression in extracardiac tissues

confocal images obtained from slices of E10.5 (A,B) and E12.5 (C;D) embryos showing the expression of CD166 in extracardiac tissues/organs. Ltg, laryngo-tracheal groove; mg, mid gut; e, esophagus; rcca, right

common carotid artery; dta, descending thoracic aorta

Online Figure II. Selection of CD166+ cells from CGR8 ESC line. Flow cytometry analysis of CD166-

expressing cells derived from 8 day-old EBs obtained from ES-CGR8 line (Left). α-actinin (α-act)

expression by qRT-PCR in CD166 positive and negative cells derived from the CGR8 cell line (right). *

denotes p<0.05

Online Figure III. Comparison of ectodermal, endodermal and non-cardiac mesodermal gene

expression in CD166-positive and negative cells. Expression levels of synaptophysin (ectoderm) tranthyretin (endoderm) and MyoD (non-cardiac mesoderm) in CD166+ and CD166- cells. brain, liver or

skeletal (sk) muscle and fibroblasts or ventricles were used as positive and negative controls, respectively. *

indicates p<0.05 versus the other groups.

Online Figure IV. Expression of -actinin and HCN4 in cultured CD166+ and CD166 cell aggregates.

Confocal images of sorted CD166+ and CD166cells fixed after the day after re-aggregation (day2) and after the subsequent two days. Cell aggregates were co-stained with antibodies against the cardiac protein

sarcomeric α-actinin and the pacemaker channel HCN4, a typical marker of sinoatrial cells 6-8

.Nuclei were

stained with DAPI. Calibration bars 50 μm.

Online Figure V. SAN genes expression in CD166 cells. Comparison in the expression of the typical

SAN genes HCN4, HCN1, ssTnI and Shox2 by qRT-PCR between CD166 and CD166+ cells. * denotes

p<0.05.

Online Figure VI. Late CD166 cells do not show any enrichment of specific atrial or ventricular genes.

Comparison of the expression levels of the atrial marker Myh6 and of the ventricular marker mlc2v in late CD166 cells, SAN and either atria or ventricle. * denotes p<0.05 vs atria or ventricles.

Online Figure VII. Comparison between CD166+ cells and native mouse SAN cells. Confocal images of

a 25 day-old CD166-selected cell aggregate and of a mouse SAN slice labeled with an antibody anti-HCN4 (red). Nuclei were stained with DAPI. Calibration bars 50 μm.

Online Figure VIII. Analysis of pHCN4-EGFP EBs and corresponding CD166-selected cells. A, confocal images of a 24 day-old pHCN4-EGFP EB showing overlapping expression of GFP (green), cav-3

(red) and HCN4 (blue). B, epifluorescence microscopy images of pHCN4-EGFP CD166-selected cells (left)

together with the corresponding phase contrast field (right). Calibration bars 50 μm.

Online Figure IX. CD166+ cells do not express pluripotency markers and are not teratogenic in vivo. A, qRT-PCR analysis of the pluripotency genes, Oct4, Nanog and Rex1 and comparison of CD166

expression in CD166-selected cells after 8 and 25 days in culture. * denotes p<0.05 vs ES; # denotes p<0.05 vs CD166-; § denotes p<0.05 vs day 8. B, phase contrast image of single nLacZ ES cells stained by x-gal. C,

flow cytometry analysis of nLacZ-ES cell isolated from day8 EBs showing that the proportion of CD166+

cells is similar to that of control (non-infected) ES cells. D,E, sorted CD166+ LacZ cells form a spontaneously beating syncytium (D and online video IV) positive to x-gal staining (E). F-K, hematoxylin

and eosin and x-gal staining of the teratoma, providing examples of differentiation of injected mESC, into

derivatives of the three germ layers: ectoderm (F,G, squamous epithelium), endoderm (H,I, cartilage) and



mesoderm (J,K, gut-like structure with mucinous epithelium and glands). X-gal staining was performed on

sections adjacent to those used for H&E. Calibration bars 100 μm.

References

1. Barbuti A, Crespi A, Capilupo D, Mazzocchi N, Baruscotti M, DiFrancesco D. Molecular composition

and functional properties of f-channels in murine embryonic stem cell-derived pacemaker cells. J Mol Cell

Cardiol. 2009;46:343-51.

2. Messina G, Biressi S, Monteverde S, Magli A, Cassano M, Perani L, Roncaglia E, Tagliafico E, Starnes L,

Campbell CE, Grossi M, Goldhamer DJ, Gronostajski RM, Cossu G. Nfix regulates fetal-specific

transcription in developing skeletal muscle. Cell.2010;140:554-66.

3. Kuratomi S, Kuratomi A, Kuwahara K, Ishii TM, Nakao K, Saito Y, Takano M. NRSF regulates the

developmental and hypertrophic changes of HCN4 transcription in rat cardiac myocytes. Biochem Biophys

Res Commun. 2007;353:67-73.

4. Avitabile D, Crespi A, Brioschi C et al. Human cord blood CD34+ progenitor cells acquire functional

cardiac properties through a cell fusion process. Am J Physiol Heart Circ Physiol. 2011;300:H1875-H1884.

5. Lawrenz B, Schiller H, Willbold E, Ruediger M, Muhs A, Esser S. Highly sensitive biosafety model for

stem-cell-derived grafts. Cytotherapy. 2004;6:212-22.

6. Hoogaars WM, Tessari A, Moorman AF, de Boer PA, Hagoort J, Soufan AT, Campione M, Christoffels

VM. The transcriptional repressor Tbx3 delineates the developing central conduction system of the heart.

Cardiovasc Res. 2004;62:489-99.

7. Mommersteeg MT, Hoogaars WM, Prall OW, Gier-de Vries C, Wiese C, Clout DE, Papaioannou VE,

Brown NA, Harvey RP, Moorman AF, Christoffels VM. Molecular pathway for the localized formation of

the sinoatrial node. Circ Res. 2007;100:354-62.

8. Brioschi C, Micheloni S, Tellez JO, Pisoni G, Longhi R, Moroni P, Billeter R, Barbuti A, Dobrzynski H,

Boyett MR, DiFrancesco D, Baruscotti M. Distribution of the pacemaker HCN4 channel mRNA and protein

in the rabbit sinoatrial node. J Mol Cell Cardiol. 2009;47:221-7.



Online Figures

Online Figure I



Online Figure II



Online Figure III



Online Figure IV



Online Figure V



Online Figure VI



Online Figure VII



Online Figure VIII



Online Figure IX



Gene Name Accession

number Primer Forward Primer Reverse

α-actinin actin, alpha, cardiac 1 (Actc1) NM_009608.3 gcttccgctgtccagaga atgccagcagattccatacc

CaV1.3 calcium channel, voltage-dependent, L type, alpha 1D subunit (Cacna1d) NM_028981.2 gttgtaagtgcggtagaaagca ctggtgcctcttgcatagttt

CaV3.1 calcium channel, voltage-dependent, T type, alpha

1G subunit (Cacna1g) NM_009783.2 taacctgcttgtcgccatt actcgtatcttcccgtttgc

CaV3.2 calcium channel, voltage-dependent, T type, alpha 1H subunit (Cacna1h) NM_021415.4 cctgctggacactgtggtt ggagcatgaaaagaagaccaa

CD166 activated leukocyte cell adhesion molecule, (alcam) NM_009655.2 cttcagtgtttggggaatgg ttatgccttcaggctgtcct

cTnI troponin I, cardiac 3 (Tnni3) NM_009406.3 gcaggtgaagaaggaggaca cgatattcttgcgccagtc

Cx 30.2 gap junction protein, delta 3 (Gjd3) NM_178596.2 cactaccgcttctggctctt tggagtagatgacgaacagca

Cx43 gap junction protein, alpha 1 (Gja1) NM_010288.3 ttcttttgacttcagcctcca ccatgtctgggcacctct

Cx 45 gap junction protein, gamma 1 (Gjc1) NM_008122.3 gggtaacaggagttctggtga ctagcaggcgagtcaggaag

GATA-4 transcription factor GATA-4 NM_008092.3 ggaagacaccccaatctcg catggccccacaattgac

HCN1 potassium/sodium hyperpolarization-activated

cyclic nucleotide gated channel 1 NM_010408.2 ggcgaggtcataggtcatgt cgcctttcaaggttaatcaga

HCN2 potassium/sodium hyperpolarization-activated

cyclic nucleotide gated channel 2 NM_008226.2 caagggcagcccgaac gctgcccgcctcatc

HCN4 potassium/sodium hyperpolarization-activated cyclic nucleotide gated channel 4 NM_001081192.1 ccatcaatggcatggtga ccttgaagagggcgtagga

HPRT hypoxanthine guanine phosphoribosyl transferase 1 NM_013556.2 gcagtacagccccaaaatgg ggtccttttcaccagcaagct

Isl1 ISL1 transcription factor, LIM/homeodomain (Isl1) NM_021459.4 agcaacccaacgacaaaact ccatcatgtctctccggact

Kir3.1 potassium inwardly-rectifying channel, subfamily J,

member 3 (Kcnj3) NM_008426.1 gaacagttcgaggttgtcgtc gaacagttcgaggttgtcgtc

Kv4.2 potassium voltage-gated channel, Shal-related

family, member 2 (Kcnd2) NM_019697.3 tgggctactgagcaaccag tggatccagatttgcttatgaa

Mef2c myocyte enhancer factor 2C NM_025282.2 tctgccctcagtcagttgg cgtggtgtgttgtgggtatc

MyoD myogenic differentiation 1 NM_010866.2 cgacaccgcctactacagtg tatgctggacaggcagtcg

Nanog homeobox transcription factor Nanog NM_028016.2 ttcttgcttacaagggtctgc agaggaagggcgaggaga

Nkx2.5 NK2 transcription factor related, locus 5 NM_008700.2 gacgtagcctggtgtctcg gtgtggaatccgtcgaaagt

Oct4 POU domain, class 5, transcription factor 1

(Pou5f1) NM_013633.2 gttggagaaggtggaaccaa ctccttctgcagggctttc

Rex-1 zinc finger protein 42, Zfp42 NM_009556 cagcagctcctgcacacaga gggcactgatccgcaaac

Shox2 Short stature homeobox protein 2 NM_013665.1 aacgtaggtgctttaaggatgc gaaaggacaagggcgtcac

ssTnI troponin I, skeletal, slow 1 (Tnni1) NM_021467.5 tgaagaaagaagacacagaaaag gccagacatagcctcaca


http://www.ncbi.nlm.nih.gov/nucleotide/142373266?report=genbank&log$=nucltop&blast_rank=1&RID=VCKT051301N


Syp synaptophysin NM_009305.2 ctggcagacatggacgtg cttgaccacccggaactg

Tbx3 T-box transcription factor TBX3 (T-box protein 3) NM_190852.1 ttgcaaagggttttcgagac tgcagtgtgagctgcttct

Tbx18 T-box transcription factor TBX18 (T-box protein

18) NM_023814.4 ccgagactctgggaggaac tgatggcctccagaatgc

Ttr transthyretin NM_013697.4 catgaattcgcggatgtg gatggtgtagtggcgatgg

Myh6 Cardiac alpha-myosin heavy chain NM_010856.4 tgctcagagctcaagaaggat cccagccatctcctctgtta

Mlc2v myosin light chain 2v NM_010861.3 ggacacatttgctgcccta atcgtgaggaacacggtga

Online Table I. Complete description of the gene analyzed, accession number and sequences of the primers pairs used



Online Table II. Percentage of CD166+ and CD166cells expressing -actinin or HCN4.

Numbers into brackets represents the number of fields in which cells have been counted.

Online Video I. CD166+ cell aggregates 24 hours after sorting. The video shows spontaneously beating CD166+ cell clusters plated after 24 hours of reaggregation in low adhesion dishes, at different

magnifications

Online Video II. CD166-selected cells 21 days after sorting. The video shows a spontaneously and

vigorously beating CD166-selected cellular syncytium 21 days after sorting

Online Video III. pHCN4-EGFP CD166-selected cells 10 days after sorting The video shows a

spontaneously beating CD166-selected cellular syncytium obtained from engineered ES cells expressing the

EGFP under the transcriptional control of the HCN4 gene promoter.

Online Video IV. nLacZ CD166-selected cells 10 days after sorting. The video shows a spontaneously

beating CD166-selected cellular cluster obtained from engineered ES cells constitutively expressing the

nLacZ gene

-actinin HCN4

CD166+ CD166 CD166+ CD166

Day2 77.2±6.3% (3) 15.6±1.3% (4) 82.1±8.8%(3) 16.4±1.6% (4)

Day3 84.6±2% (4) 16.7±1.6%(6) 83.3±2% (3) 1.2±1.2% (5)

Day4 87.6±1.7% (11) 17.3±7.4% (6) 84.2±2.9% (6) 4.6±2.6% (6)



embryonic stem cell-derived cd166+ precursors develop into ...users.unimi.it/difrancesco/pdf/2013...

Documents