Effects of magnesium alloys extracts on adult human bone marrow-derived stromal cell

viability and osteogenic differentiation

This article has been downloaded from IOPscience. Please scroll down to see the full text article.

2010 Biomed. Mater. 5 045005

(http://iopscience.iop.org/1748-605X/5/4/045005)

Download details:

IP Address: 129.25.131.235

The article was downloaded on 13/03/2013 at 05:06

Please note that terms and conditions apply.

View the table of contents for this issue, or go to the journal homepage for more

Home Search Collections Journals About Contact us My IOPscience

IOP PUBLISHING BIOMEDICAL MATERIALS

Biomed. Mater. 5 (2010) 045005 (9pp) doi:10.1088/1748-6041/5/4/045005

Effects of magnesium alloys extracts onadult human bone marrow-derivedstromal cell viability and osteogenicdifferentiationChunxi Yang1,2, Guangyin Yuan3, Jia Zhang3, Ze Tang2, Xiaoling Zhang2

and Kerong Dai1,2,4

1 Department of Orthopedics, Ninth People’s Hospital, Shanghai Jiao Tong University School ofMedicine, 639 Zhizaoju Road, Shanghai 200011, People’s Republic of China2 Lab of Osteopaedic Cellular & Molecular Biology, Institute of Health Sciences, Shanghai Institutes forBiological Sciences (SIBS), Chinese Academy of Sciences (CAS) & Shanghai Jiao Tong UniversitySchool of Medicine (SJTUSM), Shanghai 200025, People’s Republic of China3 National Engineering Research Center of Light Alloys Net Forming (LAF), School of MaterialsScience and Engineering, Shanghai Jiao Tong University, 800 Dongchuan Road, Shanghai 200240,People’s Republic of China4 Engineering Research Center of Digital Medicine, Ministry of Education, 1954 Huashan Road,Shanghai 200030, People’s Republic of China

E-mail: krdai@163.com

Received 6 March 2010Accepted for publication 27 May 2010Published 23 June 2010Online at stacks.iop.org/BMM/5/045005

AbstractIn this study, adult human bone marrow-derived stromal cells (hBMSCs) were cultured inextracts of magnesium (Mg) and the Mg alloys AZ91D and NZ30K for 12 days. We studiedthe indirect effects of Mg alloys on hBMSC viability. Alkaline phosphatase activity and theexpression of osteogenic differentiation marker genes were used to evaluate the effects of theMg alloys on the osteogenic differentiation of hBMSCs. The results indicate that �10 mMconcentration of Mg in the extracts did not inhibit the viability and osteogenic differentiationof hBMSCs. However, the results suggest that the high pH of the extracts, which is a result ofthe rapid corrosion of Mg and the Mg alloys, is unfavorable to the viability and osteogenicdifferentiation of hBMSCs.

(Some figures in this article are in colour only in the electronic version)

1. Introduction

Degrading magnesium (Mg) and Mg alloys are a new classof implant materials suitable for tissue engineering, especiallyin orthopedic surgery. Recent reports have suggested thatMg and Mg alloys could potentially be used as biodegradableorthopedic implant materials due to their biodegradability andgood mechanical properties, such as high tensile strength andYoung’s modulus that is closer to that of bone than currentlyused materials such as stainless steel and titanium alloys

[1–4]. Interestingly, Mg was proposed as a bone implantmaterial as far back as the 1930s [5].

For use as a biomaterial for orthopedic surgery, thebiological effects of alloying materials on tissues and cells,particularly in bone regeneration, must be investigated [3–6]. Witte evaluated four Mg alloys (AZ31, AZ91, WE43 andLAE442) in the femora of guinea pigs and found that thecorrosion layer of all the alloys tested was in direct contactwith the surrounding bone [2]. Gu conducted a study onbinary Mg alloys and found that the extracts had no significanttoxicity on osteoblasts (MC3T3-E1) [6]. In contrast, Serre

1748-6041/10/045005+09$30.00 1 © 2010 IOP Publishing Ltd Printed in the UK

Biomed. Mater. 5 (2010) 045005 C Yang et al

Table 1. ICP-AES analyzed results of the chemical composition of pure Mg, AZ91D and NZ30K.

Chemical compositon (mass%)

Alloy Code Al Nd Mn Zn Zr Fe Si Ni Cu Mg

Pure Mg 0.003 – 0.004 0.007 – 0.004 0.004 <0.001 <0.001 >99.950AZ91D 8.951 – 0.249 0.790 – 0.004 0.005 0.001 0.007 BalanceNZ30K 0.002 2.980 0.001 0.216 0.49 0.003 0.002 0.001 0.001 Balance

substituted different levels of Ca ions with Mg ions in apatitecrystals of type I collagen sponges and reported that low Mgcontent decreases the proliferation and activity of osteoblast-like cells. This study also showed that a high Mg content has atoxic effect on bone cells [7]. Thus, given these contradictorystudies, it is evident that further research on the response ofbones to Mg alloys is necessary.

In the present study, we used human bone marrow-derivedstromal cells (hBMSCs) as an in vitro model to evaluatethe effects of pure Mg and Mg alloys on bone regeneration.hBMSCs are a type of adult stem cell used for their ability todifferentiate into various types of cells, including osteoblastsand regenerating bone tissue [8]. hBMSCs are also widelyused as ‘seed’ cells in tissue engineering, particularly inbone tissue engineering, and as a valid model for evaluatingbiomaterials as bone implant materials in vitro [9–11].Therefore, we studied the effects of Mg and Mg alloyson hBMSC adhesion, viability, proliferation and osteogenicdifferentiation. The alloys used are the commonly used alloyMg-9Al-1Zn-0.2Mn (AZ91D) and a rare earth containing alloyMg-3Nd-0.2Zn-0.5Zr (wt%, referred to as NZ30K), that, inprevious studies, exhibited much better corrosion resistancethan that of AZ91D in a 5% NaCl solution [12].

2. Materials and methods

2.1. Material and extract preparation

A magnesium ingot with a commercial purity of 99.95 wt%was used in the study. AZ91D and NZ30K alloys weremelted and cast using commercial pure Mg (99.95%), pureAl (99.99%), high purity Zn (99.999%) and master alloys Al-10Mn, Mg-30Zr and Mg-25Nd, in a mixed gas atmosphereof SF6 and CO2 using a mild steel crucible. The commercialAZ91D magnesium alloy had a nominal composition of 9%Al, 1% Zn and the balance of Mg. NZ30K had a compositionof 3% Nd, 0.2% Zn, 0.5% Zr and the balance of Mg. Theanalyzed chemical compositions of the experimental materialsby inductively coupled plasma atomic emission spectrometry(ICP-AES, Perkin Elmer 7300DV, USA) are listed in table1 and confirmed that the analyzed composition agreed withthe nominal composition. Disk samples with diameters of50 mm and heights of 3 mm were cut from the ingot. Allthe samples were ground with Al2O3 abrasive paper up to1200 grits and polished with 1 μm diamond abrasive paste.The samples were then ultrasonically cleaned in ethanol for10 min and sterilized with ethylene oxide for 12 h.

Extracts were prepared according to ISO 10993 [6,13].Disk samples with diameters of 50 mm and heights of 3 mmwere immersed in a 35.2 ml cell culture medium, Dulbecco’s

modified Eagle’s medium (DMEM, GibcoTM, Invitrogen),supplemented with 10% fetal bovine serum (FBS, Hyclone) forthe surface area to extraction medium ratio of 1.25 cm2 ml−1,and the immersions were kept in a humidified atmosphere with5% CO2 at 37 ◦C. The extraction medium was collected every24 h, and the supernatant was removed, centrifuged and thenrefrigerated at 4 ◦C for use within 3 days. The pH values of theextraction media were measured. Alloy element ions inthe extraction medium were measured using ICP-AES beforethe cytotoxicity test. These studies also used extraction mediawith adjusted pH values in which the pH values of the extractswere adjusted to between pH 7.3 and 7.5, equal to the pH valueof the normal medium, by the addition of 1 M hydrochloricacid.

2.2. hBMSC isolation, expansion and characterization

All experimental protocols involving bone marrow collectionwere approved by the Ethics Committee of Shanghai Jiao TongUniversity School of Medicine, China. hBMSCs were isolatedand expanded according to the methods reported by Pittenger[8] and Fang [14] with some modifications. Then aspirateswere placed on tissue culture dishes in DMEM containing10% fetal bovine serum and 1% penicillin/streptomycinsolution (Invitrogen) in a 37 ◦C, 5% CO2 environment. Non-adherent cells were removed in three washes with a phosphatebuffer solution (PBS) after 3 days. The adherent cells wereallowed to reach 80% confluence, after which they werepassaged. At the end of the second passage, the hBMSCswere cryopreserved until use. The hBMSCs with less thanfive passages were used in the following experiments. Toanalyze cell surface marker expression, flow cytometry wasperformed using previously reported methods [14]. Cellswere harvested using 0.25% trypsin-EDTA and washed withPBS containing 0.1% bovine serum albumin (BSA). 1 × 106

cells were then suspended in PBS/BSA. Aliquots of the cellsuspension (100 μl) were incubated (30 min on ice) with5 μl of each of the following antibodies: anti-CD34 andanti-CD44 conjugated with phycoerythrin (CD34-PE, CalTagLaboratories, Burlingame, CA, USA; CD44-PE, Invitrogen,Carlsbad, CA, USA), anti-CD71 and anti-CD90 conjugatedwith fluoresceine isothiocyanate (CD71-FITC, CD90-FITC,Becton-Dickinson, Germany), anti-CD105 conjugated withallophycocyanine (CD105-APC, Serotec, NC, USA), and anti-CD45 conjugated with peridinin chlorophyll protein (anti-CD45-PerCP, Becton-Dickinson, Germany). The cells werewashed, suspended in 100 μl 2% formalin and immediatelyanalyzed using a flow cytometer (FACSCalibur, Becton-Dickinson, Germany). A minimum of 10 000 events werecollected.

2

Biomed. Mater. 5 (2010) 045005 C Yang et al

2.3. Cytotoxicity test

Cytotoxicity tests were carried out by indirect contactaccording to ISO 10993 [13]. The hBMSCs were culturedin a cell culture medium (DMEM, GibcoTM, Invitrogen)supplemented with 10% fetal bovine serum, 100 U ml−1

penicillin and 100 mg l−1 streptomycin (Hyclone), andextraction medium in a 37 ◦C atmosphere containing 5%CO2. Cells grown in the cell culture medium were used as thenegative control, and cells grown in the cell culture mediumsupplemented with 5% DMSO (dimethyl sulfoxide, Sigma)were used as the positive control. Cells were incubated in96-well cell culture plates (Corning) at 1 × 103 cells/100 μlmedium in each well (six wells per group) and incubated for4 h to allow attachment. The medium was then replacedwith 100 μl/well of extract, and negative control or positivecontrol medium, and all media were changed every 2 days. Thecytotoxicity tests were performed after the cells were culturedin the extracts for 1, 2, 4 and 6 days using the alamarBlue R©

cell viability reagent as described in the manufacturer’sinstructions (Invitrogen). The fluorescence of alamarBlue wasread on a Cytofluor micro-plate reader (BIO-TEK Instruments,Inc., Vermont, USA) with excitation and emission wavelengthsof 530 nm and 590 nm, respectively. And fluorescenceintensity at 590 nm emission (530 nm excitation) of DMEMwith 10% fetal bovine serum or extracts without cells wasbackground control, respectively. The percentage differenceof cell viability between the treated and control cells wascalculated based on the average of six replicates, accordingto the protocol and to a previous report [15], as follows:

Cell viability

= FI 590(test) − FI(background control)

FI590(negative control) − FI(background control)× 100%.

FI 590 is the fluorescence intensity at 590 nm emission or530 nm excitation. FI (background control) is the fluorescenceintensity at 590 nm emission or 530 nm excitation of the normalcell culture medium or extracts without cells.

2.4. Evaluation of hBMSC viability using calcein-AM andethidium homodimer-1

The hBMSCs were treated according to the method describedin the cytotoxicity test. After the cells were incubated in theextracts for 1 and 4 days, hBMSC viability was assessed usingthe vital dyes calcein acetoxymethyl (calcein-AM, Sigma)and ethidium homodimer-1 (EthD-1, Sigma) [16]. The cellsincubated in 96-well plates were washed once with 1×PBS andincubated with calcein-AM and EthD-1 (final concentrationsof 1 μg ml−1 and 4 μg ml−1, respectively) for 20 min. Thesamples were then washed with 1×PBS and examined for 1 h.The cells were observed and recorded with an invertedepifluorescence microscope (Olympus 1×2-ILL 100).

2.5. Alkaline phosphatase activity

For osteogenic differentiation, the hBMSCs were treatedwith a cocktail of 100 nM dexamethasone, 10 mMβ-glycerophosphate and 50 μM ascorbic acid-2-phosphate

(Sigma-Aldrich, St Louis, MO, USA) [8]. The hBMSCswere seeded in 6-well plates at 2 × 105 cells/well or in 12-well plates at 5 × 104 cells/well and cultured for 6 or 12days in the full extracts or the adjusted pH value extractsrespectively, as described above. The osteogenic cocktail andculture media were changed every 2 days. The cells seeded in12-well plates were washed with PBS at day 12, and alkalinephosphatase (ALP) staining was performed as described in themanufacturer’s instructions (Rainbow, Shanghai, China) [9].The level of ALP activity was determined after culture for6 or 12 days. ALP activity was determined at a wavelengthof 405 nm using p-nitrophenyl phosphate (pNPP, Sigma) asthe substrate. The total protein content was determined withthe BCA method in aliquots of the same samples with thePIERCE (Rockford, IL) protein assay kit, results read at562 nm and data calculated according to a series of albumin(BSA) standards. The results are normalized to the totalprotein content as determined by the BCA method, whichhas been described previously [9].

2.6. RNA extraction and quantitative polymerase chainreaction

The hBMSCs were seeded in 6-well plates at a density of 2 ×105 cells/well and cultured for 6 or 12 days in full extracts orthe adjusted pH value extracts, respectively, and the osteogeniccocktail and media were changed every 2 days. Total RNAfrom the hBMSCs cultured in media containing differentextracts was isolated using the TRIZOL reagent (Invitrogen).Equivalent amounts of RNA samples were reverse transcribedfor first strand cDNA synthesis (RevertAidTM M-MuLV,Fermentas) using oligo (dT) [17]. The cDNA produced wasthen used for quantitative polymerase chain reaction (Q-PCR)to amplify β-actin, ALP, pre-procollagen type I (COL I), therunt family transcription factor RUNX2/Cbfα1 (osteoblast-specific factor-2), osteopontin (OPN) and osteocalcin (OC),using a real-time PCR machine (Roche, LightCycler480), areal-time PCR kit (SYBR Premix EX Taq, Takara) and β-actinas the housekeeping gene for normalization. The primers areshown in table 2.

2.7. OPN enzyme-linked immunosorbent assay

Osteopontin is a secreted protein that is a middle-stagemarker of osteogenic differentiation. The enzyme-linkedimmunosorbent assay (ELISA kit, catalog No DOST00)against human osteopontin available from R&D Systems(Minneapolis, MN) was applied for the quantitativedetermination of human OPN in cell culture supernatesaccording to the protocol provided by the manufacturer and Li[18]. The hBMSCs were seeded in 6-well plates at a densityof 2 × 105 cells/well and cultured for 6 and 12 days in fullextracts. The medium and hBMSCs were collected and storedat −70 ◦C. These medium samples were thawed and vortexedfor 10 s. The sample, or standard, was added at 50 ml/wellto the plate, mixed with 100 ml/well assay diluent that wasprovided with the kit, and incubated at room temperature for2 h. Each well was rinsed four times with a wash buffer, and200 ml of secondary antibody conjugated with horseradish

3

Biomed. Mater. 5 (2010) 045005 C Yang et al

Table 2. Real-time RT-PCR primer sequence of target genes.

Gene Refseq accession no Primer sequence 5′–3′ Amplicon (bp)

human ALP NM 000478.3 F: CAACCCTGGGGAGGAGACR: GCATTGGTGTTGTACGTCTTG

78

human COLI NM 000088.3 F: CCTGAGCCAGCAGATCGAGAAR: GGTACACGCAGGTCTCACCAGT

194

human OC NM 199173.3 F: GGCGCTACCTGTATCAATGGCR: TGCCTGGAGAGGAGCAGAACT

208

human OPN NM 001040060.1 F: CTGAACGCGCCTTCTGATTGR: ACATCGGAATGCTCATTGCTCT

149

human RUNX2 NM 001015051.3 F: TACCTGAGCCAGATGACGR: CAGTGAGGGATGAAATGC

169

human β-actin NM 001101.2 F: CCAACCGCGAGAAGATGAR: CCAGAGGCGTACAGGGATAG

97

peroxidase was added to each well and allowed to incubate atroom temperature for 2 h. Each well was thoroughly rinsedwith a wash buffer four times, and 200 ml of the substratesolution was added to each well. The plate was incubatedat room temperature in the dark for 30 min before 50 ml ofa stop solution was added to each well. Absorbance wasread at 450 nm with a correction of 570 nm. The sampleswere then run in duplicate and compared against the humanosteopontin standard. OPN levels are normalized to the totalprotein content of the hBMSCs as determined by the BCAmethod:

OPN level(ng ml−1)

= OPN measured value (ng ml−1) × the ratio.

The ratio =the total protein content of the hBMSCs in the objective groupthe total protein content of the hBMSCs in the control group .

2.8. Statistical analysis

All measurements were collected from three replicates(cytotoxicity test, N = 6) and are presented as mean values ±one standard deviation (SD). Non-parametric one-wayANOVA, followed by the multiple comparisons post hoctest and Dunnett t-tests, was performed (using SPSS 16.0software) treating the no-extract group as a control. Significantdifferences were defined as p < 0.05.

3. Results

3.1. Characterization of the hBMSCs

The expression patterns of all surface antigens studied weresimilar for the hBMSCs obtained from the bone marrow ofthree donors. Flow cytometric analysis showed that more than94% of the hBMSCs expressed the stromal cell markers CD44,CD90 and CD105, but not the hematopoietic/endothelial cellmarkers CD34 and CD45. Less than 10% of the cells expressedCD71 (figure 1). The results indicated that the harvestedhBMSCs match the known phenotype of human bone marrowstromal cells by surface marker expression.

3.2. Corrosion product concentrations and pH value ofextracts

The pH values of the extraction media were 8.6 ± 0.25 (Mg),8.37 ± 0.04 (AZ91D) and 8.41 ± 0.05 (NZ30K). Theconcentrations of released ions are shown in table 3. Theconcentration of Mg ions was highest in the Mg extracts(Mg: 10.286 mM) followed by the NZ30K extracts (Mg:5.9028 mM) and the AZ91D extracts (Mg: 3.3998 mM).Of note, the concentration of Mg in a normal cell culturemedium (10% FBS, DMEM) is 0.94 mM according to theproduct information for DMEM (Sigma), and in healthy adultsubjects, serum Mg concentrations are maintained at stablelevels between 0.75 and 0.96 mM [19].

3.3. Effects of corrosion products on hBMSC viability

Figure 2 shows the hBMSCs that were cultured in 100% Mg,AZ91D or NZ30K extraction medium for different durations(1, 2, 4 and 6 days). The viability of the hBMSCs decreasedin normal extracts groups, while the hBMSCs maintainedapproximately normal viability in the three kinds of adjustedpH extraction media compared with those in the negativecontrol medium after 6 days in culture. Figure 3 shows thehBMSCs cultured in different extracts for 1 and 4 days andthen stained with calcein-AM and EthD-1. The number ofcells cultured in the extracts and the negative control mediumincreased with culture time, while the number of cells culturedin the positive control medium decreased with culture time.There was no significant difference in the shape of the viablecells (green) between the negative control group and the extractgroups. Only a few apoptotic cells (red fluorescence inthe nuclei) were seen in each group, while most cells wereapoptotic in the positive control group.

3.4. ALP activity

As shown in figure 4(a), the cells in the three extraction mediadisplayed lower ALP activity than the hBMSCs cultured inthe negative control medium for 6 and 12 days (P < 0.05or P < 0.01). The same results are shown in figure 4(c) asassessed by ALP staining. However, the hBMSCs culturedin the adjusted pH value extracts and in the negative controlmedium displayed normal ALP activity after 6 and 12 days(figures 4(b) and (c), P > 0.05).

4

Biomed. Mater. 5 (2010) 045005 C Yang et al

(a) (b) (c)

(d) (e) ( f )

Figure 1. Characterization of hBMSCs: surface markers. hBMSCs were labeled with monoclonal antibodies to five surface markers andexamined by flow cytometry. Relative numbers of hBMSCs are presented as a function of the fluorescence intensity for CD44 (b), CD90(b), CD105 (d, f ), CD34 (c, e), CD71 (c, f ) and CD45 (d, e). The results represent one representative experiment of three performed.

Table 3. ICP-AES analyzed results of the chemical composition of the control medium, extracts of pure Mg, AZ91D and NZ30K.

Chemicalcompositon Control medium Pure Mg AZ91D NZ30K

Mg MM 0.94 ± 0.02 10.29 ± 3.63 3.4 ± 0.13 5.9 ± 1.52mg l−1 22.85 ± 0.46 250 ± 78.88 82.63 ± 20.47 143.47 ± 14.1

Nd MM 0.0004 ± 0.0003mg l−1 0.06 ± 0.04

Zn MM 0.0079 ± 0.0002 0.0082 ± 0.0003 0.0281 ± 0.0002 0.0170 ± 0.0005mg l−1 0.52 ± 0.02 0.54 ± 0.02 1.84 ± 0.02 1.11 ± 0.03

Zr mM 0.0013 ± 0.0003mg l−1 0.10 ± 0.03

Al mM 0.0193 ± 0.0006mg l−1 0.52 ± 0.02

3.5. Expression of osteogenic differentiation marker genes

The expression of ALP was significantly suppressed in thehBMSCs cultured for 6 and 12 days in Mg, AZ91D andNZ30K extraction media compared with the control medium(figure 5(a), P < 0.05). However, the expression of ALP wasnormal in the hBMSCs cultured in the three kinds of extractionmedia with adjusted pH values (figure 5(b), P > 0.05). Theexpression of other osteogenic differentiation gene markersin the hBMSCs cultured in the different extracts is shownin figure 6. The Q-PCR results from the hBMSCs culturedin the adjusted pH value extracts are not shown becausegene expression of the tested genes was not significantlyinfluenced by the pH value in our results. We found thatexpression of COL I, RUNX2/Cbfα1 and OC in hBMSCsdid not differ among the groups treated with Mg, AZ91D andNZ30K extracts compared to the control group (figure 6, P >

0.05). The expression of OPN was significantly increased in

the hBMSCs cultured in Mg, AZ91D and NZ30K extracts withthe osteogenic cocktail for 6 and 12 days (figures 6(a) and (b),P < 0.05 or P < 0.01).

3.6. Osteopontin measurement

The levels of OPN m-RNA were significantly increased inthe hBMSCs cultured in Mg, AZ91D and NZ30K extracts.However, levels of the OPN protein did not significantlydiffer among the groups treated with Mg, AZ91D and NZ30Kextracts compared to the control group (figure 7, P > 0.05).

4. Discussion

4.1. Corrosion of Mg and Mg alloys in a cell culture medium

The overall corrosion reaction of Mg in aqueous environmentsgiven below has been reported in other articles [3, 4]:

5

Biomed. Mater. 5 (2010) 045005 C Yang et al

(a)

(b)

Figure 2. hBMSC viability expressed as a percentage of the viability of cells in the control group. The viability of the hBMSCs cultured inMg, AZ91D and NZ30K extracts significantly decreased. However, it did not happen when the hBMSCs were cultured in adjusted pHextracts. All data are presented as the mean ± SD of six replicate cultures and compared to negative control (∗P < 0.05, ∗∗P < 0.01).

Figure 3. hBMSCs cultured in different extracts, negative control medium and positive control medium for 1 day and 4 days and thenstained with calcein-AM and EthD-1. No significant differences in shape and density of viable cells (green) were observed between thecontrol, Mg, AZ91D and NZ30K group either for 1day or 4 days. Few apoptotic cells (red fluorescence in the nuclei) were detected in theextract groups and control group, while most cells in the positive control group cultured for 4 days were apoptotic (the scale bar = 200 μm).

Mg(s) + 2H2O(aq) → Mg(OH)2(s) + H2(g).

Body fluids contain either electrolytes, similar to SBF(simulated body fluid), or various organic molecules such asproteins and glucose, and most of these molecules can be foundin a cell culture medium. Therefore, we applied a cell culturemedium containing 10% FBS to test the extraction of Mg andits alloys. In this study, we found that the concentrations ofreleased Mg ions and the pH values in the extraction media

were highest in the Mg group followed by the NZ30K groupand the AZ91D group. However, in a previous study, Changfound that NZ30K was significantly more resistant to corrosionthan AZ91D in a 5% NaCl solution [12]. These results suggestthat Mg alloys may have different amounts of corrosion indifferent corrosive environments. In Gu’s study, Mg and ninebinary Mg alloys presented different quantities of released ionsin SBF, Hank’s solution and cell culture medium [6]. Witte

6

Biomed. Mater. 5 (2010) 045005 C Yang et al

(a)

(b)

(c)

Figure 4. The relative ALP activity in hBMSCs under osteogenicconditions for 6 and 12 days was analyzed. The ALP activity inhBMSCs of the extracts groups (a) and the adjusted pH valueextracts groups (b) were compared to the control group (mean ± SDof three replicate cultures, ∗P < 0.05, ∗∗P < 0.01). ALP staining ofdifferentiating hBMSCs cultured in 12-well plates with the additionof the control medium or different extracts (c). ALP-positive cellsare shown in purple.

found that the corrosion of AZ91D and LAE442 measuredin in vitro corrosion tests using substitute ocean water as themedium was in opposition to the corrosion rates obtained fromin vivo tests [20]. Our results suggest that the organic materialswithin corrosive environments can have huge effects on thecorrosion rates of Mg alloys.

4.2. Effects of Mg, AZ91D and NZ30K on hBMSC viability

The assessment of cytotoxicity is critical for evaluating Mgalloys as biomaterials, and such approaches were adoptedin previous studies [6]. However, no studies have beenconducted using hBMSCs, which are key cells in the humanskeletal system. In this study, alamarBlue, a novel, one-step and highly sensitive fluorometric assay was employedto evaluate cytotoxicity. The viability of hBMSCs culturedin normal extracts was inhibited, but the viability of hBMSCscultured in adjusted pH extracts was kept normal. These resultsindicate that high pH value of extracts inhibited the viability of

(c)

(a)

(d)

(b)

Figure 5. Transcript levels detected by Q-PCR for ALP fromhBMSCs cultured in the extracts (a, b) and the extracts (c, d) withthe osteogenic differentiation cocktail after 6 or 12 days. The ALPgene expression was significantly suppressed in the hBMSCscultured in Mg, AZ91D and NZ30K extracts for 6 (a) and 12 days(b) compared with cells cultured in negative control medium, butALP gene expression was not suppressed in the hBMSCs cultured inextracts with adjusted pH values (c, d). Data are expressed as thefold ratio relative to the expression of the respective gene in thehBMSCs cultured in control medium after normalization to β-actinand are presented as the mean ± SD of three replicate cultures(∗P < 0.05, ∗∗P < 0.01).

hBMSCs. However, the high concentration of Mg (�10.286mM) or Mg with small quantities of aluminum, neodymiumand zirconium did not induce significant cytotoxicity in thehBMSCs. Furthermore, the normal extracts did not causehBMSC death, which was confirmed by the assessment usingthe vital dyes (figure 3).

4.3. Effects of Mg, AZ91D and NZ30K corrosion products onhBMSC osteogenic differentiation

During hBMSC osteogenesis, ALP appears temporally andlocally during the early stage of bone regeneration [21].In this study, ALP gene expression was downregulated(figures 5(a), (c)) and ALP activity was suppressed in the

7

Biomed. Mater. 5 (2010) 045005 C Yang et al

(a)

(b)

Figure 6. Transcript levels detected by Q-PCR for osteoblasticmarkers in hBMSCs cultured in the extracts containing theosteogenic differentiation cocktail for 6 and 12 days (a and b).Q-PCR reactions were performed using primers for osteoblasticgenes, including COL I, RUNX2/Cbfα1, OPN and OC. Data areexpressed as the fold ratio relative to the expression of the respectivegene in the hBMSCs cultured in control medium after normalizationto β-actin, and are presented as the mean ± SD of three replicatecultures (∗P < 0.05, ∗∗P < 0.01).

hBMSCs cultured in Mg, AZ91D and NZ30K extraction mediawith high pH values (Mg: 8.6 ± 0.25, AZ91D: 8.37 ± 0.04,NZ30K: 8.41 ± 0. 05) but not in media with adjusted pHvalues (pH 7.30–7.40) at 6 and 12 days of culture (figures 4and 5). These results indicate that different levels of Mg ions(10.286 mM, 5.9028 mM and 3.3998 mM) do not suppresshBMSC osteogenic differentiation. However, the alkalineenvironments of the extracts suppress ALP gene expressionand ALP activity. The extracellular matrix protein OPNis a highly phosphorylated sialoprotein that is a prominentcomponent of mineralized extracellular matrices of bone and isproduced by osteoblasts, and it was secreted during osteogenicdifferentiation and upregulated in osteoblasts associated withbone formation and mineral deposits [22]. However, theprotein OPN did not increase in the extract groups. Manymechanisms are involved in the regulation of translation [23].Some mechanics may induce that it was not correlated to OPNgene expression.

5. Conclusions

The conspicuous alkaline environment that is a result of rapidcorrosion of Mg or its alloys is disadvantageous to hBMSCviability and osteogenic differentiation. The extracts did notinhibit hBMSC viability and osteogenic differentiation, as Mg

Figure 7. The secretion of osteopontin from the hBMSCs wasmeasured by the ELISA kit after 6 and 12 days in culture. Levels ofthe OPN protein did not significantly differ among the groupstreated with Mg, AZ91D and NZ30K extracts, compared to thecontrol group (P > 0.05).

concentration was �10.286 mM. Therefore, the manipulationof pH values is a critical problem for using Mg alloys asorthopedic biomaterials.

Acknowledgments

This work was supported by the National Basic ResearchProgram (973 Program) (grant no 2007CB936101), theProgram for the Shanghai Key Laboratory of OrthopedicImplants (grant no 08DZ2230330), National Basic ResearchProgram (2010CB945600) and National Science andTechnology Project (2009ZX09503-024). The authors wouldalso like to thank Ms Mary Fong and Ms Mingdong Zhong(Shanghai Sada University) for language errors corrected inthis manuscript.

References

[1] Xu L, Pan F, Yu G, Yang L, Zhang E and Yang K 2009In vitro and in vivo evaluation of the surface bioactivity of acalcium phosphate coated magnesium alloy Biomaterials30 1512–23

[2] Witte F, Kaese V, Haferkamp H, Switzer E,Meyer-Lindenberg A, Wirth C J and Windhagen H 2005In vivo corrosion of four magnesium alloys and theassociated bone response Biomaterials 26 3557–63

[3] Staiger M P, Pietak A M, Huadmai J and Dias G 2006Magnesium and its alloys as orthopedic biomaterials: areview Biomaterials 27 1728–34

[4] Witte F, Hort N, Vogt C, Cohen S, Kainer K U, Willumeit Rand Feyerabend F 2008 Degradable biomaterials based onmagnesium corrosion Curr. Opin. Solid State Mater. Sci.12 63–72

[5] McBride E D 1938 Absorbable metal in bone surgery J. Am.Med. Assoc. 111 2464–7

[6] Gu X, Zheng Y, Cheng Y, Zhong S and Xi T 2009 In vitrocorrosion and biocompatibility of binary magnesium alloysBiomaterials 30 484–98

[7] Serre C M, Papillard M, Chavassieux P, Voegel J C andBoivin G 1998 Influence of magnesium substitution on acollagen-apatite biomaterial on the production of a

8

Biomed. Mater. 5 (2010) 045005 C Yang et al

calcifying matrix by human osteoblasts J. Biomed. Mater.Res. 42 626–33

[8] Pittenger M F, Mackay A M, Beck S C, Jaiswal R K,Douglas R, Mosca J D, Moorman M A, Simonetti D W,Craig S and Marshak D R 1999 Multilineage potential ofadult human mesenchymal stem cells Science 284 143–7

[9] Sun H, Wu C, Dai K, Chang J and Tang T 2006 Proliferationand osteoblastic differentiation of human bonemarrow-derived stromal cells on akermanite-bioactiveceramics Biomaterials 27 5651–7

[10] Service R F 2000 Tissue engineers build new bone Science289 1498–500

[11] Huang Y, Jin X, Zhang X, Sun H, Tu J, Tang T, Chang Jand Dai K 2009 In vitro and in vivo evaluation of akermanitebioceramics for bone regeneration Biomaterials 30 5041–8

[12] Chang J, Peng L, Guo X, Atrens A, Fu P, Ding W and Wang X2008 Comparison of the corrosion behaviour in 5% NaClsolution of Mg alloys NZ30K and AZ91D J. Appl.Electrochem. 38 207–14

[13] ISO Part 5 and Part 12: Test for in vitro cytotoxicity, andSample preparation and reference materials ISO 10993

[14] Fang B, Wan Y Z, Tang T T, Gao C and Dai K R 2009Proliferation and osteoblastic differentiation of human bonemarrow stromal cells on hydroxyapatite/bacterial cellulosenanocomposite scaffolds Tissue Eng. A 15 1091–8

[15] Nociari M M, Shalev A, Benias P and Russo C 1998 A novelone-step, highly sensitive fluorometric assay to evaluatecell-mediated cytotoxicity J. Immunol. Methods213 157–67

[16] Decherchi P, Cochard P and Gauthier P 1997 Dual stainingassessment of Schwann cell viability within wholeperipheral nerves using calcein-AM and ethidiumhomodimer J. Neurosci. Methods 71 205–13

[17] Shi X, Wang Y, Ren L, Huang W and Wang D A 2009 Aprotein/antibiotic releasing poly(lactic-co-glycolicacid)/lecithin scaffold for bone repair applications Int. J.Pharm. 373 85–92

[18] Li D, Tang T, Lu J and Dai K 2009 Effects of flow shear stressand mass transport on the construction of a large-scaletissue-engineered bone in a perfusion bioreactor Tissue Eng.A 15 2773–83

[19] Arnaud M J 2008 Update on the assessment of magnesiumstatus Br. J. Nutr. 99 (Suppl 3) S24–36

[20] Witte F, Fischer J, Nellesen J, Crostack H A, Kaese V,Pisch A, Beckmann F and Windhagen H 2006 In vitro andin vivo corrosion measurements of magnesium alloysBiomaterials 27 1013–8

[21] Stucki U, Schmid J, Hammerle C F and Lang N P 2001Temporal and local appearance of alkaline phosphataseactivity in early stages of guided bone regeneration. Adescriptive histochemical study in humans Clin. OralImplants Res. 12 121–7

[22] Denhardt D T, Noda M, O’Regan A W, Pavlin D andBerman J S 2001 Osteopontin as a means to cope withenvironmental insults: regulation of inflammation, tissueremodeling, and cell survival J. Clin. Invest. 107 1055–61

[23] Dever T E 2002 Gene-specific regulation by generaltranslation factors Cell 108 545–56

9