effects of exogenous 5-aminolevulinic acid on ... · effects of exogenous 5-aminolevulinic acid on...

©FUNPEC-RP www.funpecrp.com.brGenetics and Molecular Research 14 (2): 6401-6412 (2015)

Effects of exogenous 5-aminolevulinic acid on photosynthesis, stomatal conductance, transpiration rate, and PIP gene expression of tomato seedlings subject to salinity stress

Y.Y. Zhao*, F. Yan*, L.P. Hu, X.T. Zhou, Z.R. Zou and L.R. Cui

College of Horticulture, Northwest A&F University, Yangling, Shaanxi, China

*These authors contributed equally to this study.Corresponding author: Z.R. ZouE-mail: [email protected]

Genet. Mol. Res. 14 (2): 6401-6412 (2015)Received July 30, 2014Accepted January 21, 2015Published June 11, 2015DOI http://dx.doi.org/10.4238/2015.June.11.16

ABSTRACT. The effects of exogenous 5-aminolevulinic acid (ALA) on photosynthesis, plant growth, and the expression of two aquaporin genes in tomato seedlings under control and salinity conditions were investigated. Exogenous ALA application significantly improved net photosynthetic rate (Pn), total chlorophyll content, and plant biomass accumulation of tomato seedlings under salinity stress. As revealed by real-time PCR analyses, after treatment with ALA alone, expression of both LePIP1 and LePIP2 in the two tomato cultivars was up-regulated at 2 h and subsequently decreased to normal levels. Under salinity stress, transcript levels of LePIP1 in both leaves and roots of salt-sensitive cultivars (cv. Zhongza No.9) increased significantly and were considerably higher than in cultivars exposed to ALA alone. In contrast, the expression levels of LePIP1 and LePIP2 in cvs. Jinpeng No.1 cultivars were slightly lower under salinity stress than under ALA treatment. In addition, transcript levels of both LePIP1 and LePIP2 in the roots of Jinpeng No. 1 cultivars were considerably lower than those

Y.Y. Zhao et al. 6402


in the roots of Zhongza No. 9 cultivars under salinity stress, regardless of ALA supplementation, implying that Jinpeng No. 1 cultivars had a better capacity to maintain membrane intrinsic protein stability. Further, ALA application distinctly counteracted the up- or down-regulation of LePIP1 and LePIP2 in both cultivars under salinity stress, in accordance with the improvements instomatal conductance, transpiration rate, and Pn of tomato leaves. The results presented here indicate that ALA controls aquaporin expression, thus, presumably ALA regulates water homeostasis and enhances salt tolerance of tomato seedlings.

Key words: Salinity stress; 5-aminolevulinic acid; Aquaporin; Tomato

INTRODUCTION

Salinity is one of the major threats to agricultural crop production worldwide. Soil salinity increases water potential in the apoplast of root cells and induces osmotic stress, thus, significantly reducing water uptake by roots. Plant growth and development is strongly depen-dent on the uptake and utilization of water. A number of reports have demonstrated that aqua-porins play a vital role in regulating plant water movement and cellular osmotic potential un-der stress conditions (Srivastava et al., 2010; Liu et al., 2012). Different responses have been observed in the transcript levels of aquaporins under drought, salinity, and cold stress (Suga et al., 2002; Jang et al., 2004; Li et al., 2008), and these are thought to contribute to water trans-port and stress tolerance of plants. For example, over expression of a wheat aquaporin gene (TaAQP8) in transgenic tobacco enhanced plant salt tolerance (Hu et al., 2012). Meanwhile, the responses of aquaporin isoforms to phytohormones (gibberellic acid and abscisic acid) have been observed in many species, including radish (Suga et al., 2002), maize (Zhu et al., 2005), rice (Li et al., 2008), and so on. Thus, there may be a relationship between aquaporin expression and ALA treatment in improving tomato salt tolerance.

Adaption of plants to salinity stress is a genetically complex procedure. Numerous ap-proaches have been used to alleviate salinity stress of various crops; one of which is the use of plant growth regulators (PGRs). In recent years, 5-aminolevulinic acid (ALA), a key precursor in the biosynthesis of all porphyrin compounds, including vitamin B12, chlorophyll, heme, and phytochrome, is considered to be a new PGR. ALA is reported to have the ability to promote plant growth and enhance stress tolerance, such as chilling (Korkmaz et al., 2010), drought (Liu et al., 2013), and salinity (Youssef and Awad, 2008; Naeem et al., 2012). Watanabe et al. (2000) evalu-ated12 different PGRs and found ALA to be the most effective in improving the salt tolerance of cotton. Thus far, research conducted on ALA has mainly focused on photosynthesis (Liu et al., 2013), chlorophyll accumulation (Memon et al., 2009), the antioxidant system (Nishihara et al., 2003; Sun et al., 2009), and ion uptake (Naeem et al., 2010). Although ALA has been reported to be capable of enhancing the salt tolerance of various plants, data on the molecular mechanism of exogenous ALA application are limited. Naeem et al. (2010) reported that spraying ALA on oilseed rape improved leaf water relations under salinity stress. Our previous research found that ALA could regulate the transcription of aquaporins in cucumber leaves and enhance the salt toler-ance of the plants (Yan et al., 2014). Therefore, it is of interest to analyze the effects of ALA on the expression of aquaporins in tomato seedlings and to determine the interaction between aquaporin expression and water content of tomato leaves under different salinity conditions.

6403Tomato salt tolerance and aquaporin gene expression


Tomato (Solanum lycopersicum) is one of the most popular vegetables in protect-ed cultivation worldwide and is valued for its remarkable nutritional value. However, over-cropping and fertilization exacerbate soil secondary salinization in facility cultivation, which dramatically reduces plant growth and fruit yield of tomato plants. Our previous research has found that foliar spray with a low concentration of ALA may enhance the salt tolerance of tomato seedlings. The objective of this research was to determine the effect of ALA on photo-synthesis and plant growth of tomato seedlings under salinity stress, and to determine the ef-fect of ALA on PIP aquaporin gene expression and its relationship with stomatal conductance (gs) and transpiration rate (E) in tomato leaves. In gene expression studies, one can concentrate on only a few genes, which are seemingly of paramount relevance in salinity tolerance. Thus, the current research on salt tolerance focused on two aquaporins from the plasma membrane intrinsic proteins (PIPs) subgroup: LePIP1 and LePIP2.

MATERIAL AND METHODS

Plant materials and stress treatments

Two tomato (S. lycopersicum) cultivars, cvs. Zhongza No. 9 (salt-sensitive) and Jin-peng No. 1 (relatively salt-tolerant), were used in this study. Seeds were surface-sterilized in 0.1% HgCl2 for 5 min and washed with distilled water before sowing in washed commix medi-um (Xintiandi Co., Yangling, Shaanxi, China). When seedlings had four true leaves, seedlings of similar size were transplanted into plastic containers (12 plants per container) filled with 40 L of half-strength Hoagland nutrient solution (pH 6.5 ± 0.1, electrical conductivity: 1.4-1.8 dS/m, solution temperature: 20°-25°C) (Hoagland and Arnon, 1950) and aerated continuously with an air pump. Plants were grown in an environmentally-controlled greenhouse with day/night temperatures of 30° ± 2°/20° ± 2°C, a photoperiod of 14 h light (800 μmol photons∙m-

2·s-1)/10 h dark, and relative humidity between 65 and 85%. The plastic containers were ar-ranged in a randomized block design and the solution was renewed every four days.

After a two week acclimatization period, seedlings were separated into four groups: 1) control, sprayed with distilled water; 2) ALA, sprayed with 50 mg/L ALA (Sigma Chemical Co., St. Louis, MO, USA); 3) NaCl, treated in 100 mM NaCl and sprayed with distilled water; 4) NaCl+ALA, treated in 100 mM NaCl and sprayed with 50 mg/L ALA. The spraying treat-ment was applied between 7:00 and 8:00 a.m., both surfaces of all tomato leaves were sprayed with ALA solution or distilled water. The leaves and roots of tomato seedlings were collected in triplicate at 2, 4, 8, 12, and 24 h after treatment and frozen immediately into liquid nitrogen before storing at -80°C.

Analyses of chlorophyll content, net photosynthetic rate, and plant growth

Fully expanded mature leaves, used to measure chlorophyll content, were collected in triplicate on day 10 of the salt treatment. Leaf pieces (100 mg) were soaked in 10 mL of 80% aqueous acetone for 24 h in the dark. Chlorophyll content was calculated according to the method of Arnon (1949).

Net photosynthetic rate (Pn) was measured simultaneously with a LiCor-6400 portable photosynthesis system (LI-Cor Inc., Lincoln, NE, USA). All measurements were carried out with an internal light resource with PAR 800 μmol photons∙m-2·s-1.



Dry and fresh weights of the tomato plants were measured 10 days after treatment. Six seedlings of each treatment were divided into shoots and roots and weighed immediately after harvesting and then dried in an oven at 75°C for 72 h and weighed again.

Analyses of stomatal conductance and transpiration rate

Stomatal conductance and transpiration rate were measured with a LiCor-6400 portable photosynthesis system (LI-Cor Inc., Lincoln, NE, USA) at 2, 4, 8, 12, and 24 h after salt treat-ment. All measurements were replicated six times, and the means ± SD were used for analysis.

RNA extraction

Total RNA from leaves and roots of tomato seedlings was extracted and purified using the RNA simple Total RNAKit (TIANGEN, China) following the manufacturer protocol. To remove any contaminating genomic DNA prior to cDNA synthesis, the RNA was treated with RNase-free DNAse I (Invitrogen, USA) following the manufacturer protocol, and the con-centrations were accurately quantified spectrophotometrically by absorbance at 260 nm. The quality of RNA was assessed by calculating the ratio of A260/A280 nm. In order to monitor the integrity of RNA, total RNA samples were run on 1% agarose TAE gels and stained with ethidium bromide.

Real-time PCR

LePIP1 and LePIP2 were acquired from the National Center for Biotechnology Infor-mation with the following Accession Nos. AY725511 and BT014251, respectively. The details of the primers used for real-time PCR are provided in Table 1 (He et al., 2011). The actin-x gene (X55749) was used as an internal control. Quantitative real-time PCR was performed as described previously (Yan et al., 2014). PCR amplification was performed using these primers and template cDNA under the following conditions: 1 cycle at 94°C for 3 min, followed by 40 cycles of 94°C for 30 s, 60°C for 30 s, and 72°C for 30 s (Table 1). The data were collected dur-ing the extension step (72°C for 30 s). Values for the cycle threshold (Ct) were determined using iQ5.0 software. Relative transcript levels were calculated as the ratio of AQP gene expression against actin-x. The data were analyzed using the 2-∆∆Ct method (Livak and Schmittgen, 2001), the reactions were replicated three times, and the means ± SD were used for analysis.

Statistical analysis

All data presented are mean values for each treatment. Analysis of variance (ANOVA) was calculated using the SAS 8.1 software (SAS Institute, Cary, NC, USA). Significant differences among treatments were determined using the Duncan multiple comparison tests at the P < 0.05 level.

RESULTS

Effect of ALA on Pn, chlorophyll content, and biomass accumulation

Pn and chlorophyll content decreased rapidly for both tomato cultivars under salinity



conditions (Figures 1A and B). ALA treatment increased Pnby 27.72 and 31.37% for ‘Zhongza No. 9’ and ‘Jinpeng No. 1’, respectively, under salinity conditions. Meanwhile, the chlorophyll content of tomato seedlings was noticeably enhanced by exogenous ALA application, regard-less of salinity.

The fresh and dry weights of shoots and roots (Figures 1C, D, E, and F) of tomato seedlings were significantly reduced after 10 days of salinity treatment compared with the con-trol (P < 0.05). This effect was greater in ‘Zhongza No. 9’ (64.88, 59.07, 53.37, and 44.79%, respectively) than in ‘Jinpeng No. 1’(36.21, 30.31, 28.25, and 27.59%, respectively). Exog-enous ALA significantly alleviated the salt induced growth reduction in both cultivars. The dry weight of shoots and roots of ‘Zhongza No. 9’ were enhanced by 60.06 and 32.76%, respec-tively, and by 25.71 and 20.32% for ‘Jinpeng No. 1’, respectively. The results indicate that salinity stress remarkably inhibits the growth of both tomato cultivars, especially ‘Zhongza No. 9’, and treatment with ALA can significantly alleviate seedling damage.

Table 1. Primers used for RT-PCR analysis of gene expression in the roots and shoots of tomato seedlings.

Gene Primer sequence (5' to 3') Accession No.

LePIP1 F: ATGACGCACCCATACAAC AY725511 R: TGCTAACAATGCTCCCAC LePIP2 F: AAGGATTACAAAGAGCCACC BT014251 R: ACCAAAAGCCCAAGCAAC Actin-x F: GATGGTGTCAGCCACAC X55749 R: ATTCCAGCAGCTTCCATTCC

F indicates forward and R indicates reverse.

Figure 1. Effects of 5-aminolevulinic acid (ALA) on net photosynthetic rate (Pn) (A), chlorophyll content (B) and biomass (C, D, E, and F) of tomato seedlings subject to NaCl stress. Different letters denote statistically significant differences by the Duncan multiple comparison tests (P < 0.05).

Effect of ALA on stomatal conductance and transpiration rate

During salinity stress, gs (Figures 2A and B) and E (Figures 2C and D) of tomato seedling leaves decreased drastically, reaching a minimum after 12 h of treatment. However, exogenous ALA noticeably increased gs and E in both cultivars regardless of salinity, and more so in ‘Jinpeng No. 1’.



Figure 2. Effects of 5-aminolevulinic acid (ALA) on stomatal conductance (gs) and transpiration rate (E) of tomato seedlings subject to NaCl stress. A and C, ‘Zhongza No.9’; B and D, ‘Jinpeng No.1’. Data are reported as means of six replicates ± SD.

Differential response of LePIP1 and LePIP2 genes to ALA treatment

The expression level of LePIP1 in the leaves of both cultivars was up-regulated 2 h af-ter ALA treatment and then returned to normal/decreased levels (Figure 3A). Similar patterns were observed in the expression of LePIP2 in the leaves of both salt-sensitive and salt-tolerant tomato cultivars, both of which reached maximal levels at 2 h and decreased to normal levels after 4 h (Figure 3 B).

In the roots of tomato seedlings, the expression patterns were slightly different for both aquaporin genes. After the first 4 h of ALA treatment, LePIP1 expression in ‘Jinpeng No. 1’ plants was induced by 2.1-fold of that in the control plants, and was subsequently down-regulated to normal levels at 8 h. LePIP2 gene expression in ‘Jinpeng No. 1’ plants was almost the same as that of LePIP1. In the roots of the salt-sensitive cultivar (Zhongza No. 9) plants, both the LePIP1 and LePIP2 genes were down-regulated initially, followed by an increase after 8 or 12 h of ALA application, respectively, reaching maximum expression at 24h. Thus, the response and regulation of LePIP1 and LePIP2 genes to ALA treatment was slightly faster in the salt-tolerant tomato cultivar compared to the salt-sensitive cultivar (Figures 3C and D).

Differential response of LePIP1 and LePIP2 genes to salinity stress

Salinity stress resulted in increased levels of the LePIP1 gene within the first 2 h (2.1-fold higher than that of the control), but remarkably expression decreased after 4 h of treatment in the leaves of ‘Jinpeng No. 1’ plants. In contrast, the transcription of LePIP1 in the leaves of ‘Zhongza No. 9’ plants was initially depressed and then gradually increased by 2.9-



fold after 12 h of salinity stress. However, there were no significant changes in the transcript levels of the LePIP2 gene in the leaves of both cultivars (Figures 4A and B).

During salinity stress, a remarkable 4.8-fold increase in the relative expression of the LePIP1 gene was observed in the roots of ‘Zhongza No. 9’ plants at 12 h. Compared to the ‘Zhongza No. 9’ plants, the transcript level of LePIP1 in the roots of ‘Jinpeng No. 1’ showed no significant changes (Figure 4 C). For LePIP2 in the roots of ‘Jinpeng No. 1’, there was a slight increase in expression after treatment began and then expression was gradually down-regulated to normal levels. In the ‘Zhongza No. 9’ plants, expression decreased within 4 h of salt treat-ment, followed by an increase in expression, reaching maximum expression at 8 h (Figure 4D). The results indicate that under salinity stress, the transcript levels of both the LePIP1 and LePIP2 genes are higher in the salt-sensitive tomato cultivar than in the salt-tolerant cultivar.

Figure 3. Relative expression of LePIP1 (A, C) and LePIP2 (B, D) genes in the leaves and roots of tomato seedlings exposed to 5-aminolevulinic acid (ALA) treatment. A. and B. Expression patterns of LePIP1 and LePIP2 genes in the leaves; C. and D. expression patterns of LePIP1 and LePIP2 genes in the roots. Amount of transcript was normalized to the tomato actin-x expression level. Data are reported as means of three replicates ± SD.

Figure 4. Relative expression of LePIP1 (A, C) and LePIP2 (B, D) genes in the leaves and roots of tomato seedlings subjected to NaCl stress. A. and B. Expression patterns of LePIP1 and LePIP2 genes in the leaves; C. and D. expression patterns of LePIP1 and LePIP2 genes in the roots. Amount of transcript was normalized to the tomato actin-x expression level. Data are reported as means of three replicates ± SD.



Differential response of LePIP1 and LePIP2 genes to ALA under salinity stress

As shown in Figure 5A, LePIP1 gene expression in the leaves of ‘Jinpeng No. 1’ plants was up-regulated to 3.2-fold at 2 h following ALA application under salinity stress, after which there was a drastic decrease. In the ‘Zhongza No. 9’ plants, LePIP1 gene expression was initially depressed and was then up-regulated to 1.7-fold following 4 h of ALA and salinity treatment. Subsequently, the expression level decreased rapidly. For LePIP2 in the leaves of both cultivars, the transcript levels were almost the same as those under salinity treatment alone (Figure 5B).

Different trends in LePIP1 expression levels were noted in the roots of salt-sensitive and salt-tolerant tomato cultivars. In the roots of salt-sensitive tomato cultivar plants, LePIP1 expression increased rapidly by 3.4-fold of that in the control plants and peaked at 8 and 12 h. In the salt-tolerant plants, the transcript levels decreased after the treatment began, and then drastically increased by 4-fold (Figure 5 C). Similar to that of LePIP1, LePIP2 also increased and peaked at 12 h in the roots of salt-sensitive tomato cultivar plants. By comparison, LePIP2 was slightly down-regulated and showed little variation in the salt-tolerant tomato cultivar plants during the measurement time (Figure 5D).

Figure 5. Relative expression of LePIP1(A, C) and LePIP2 (B, D) genes in the leaves and roots of tomato seedlings subjected to NaCl and 5-aminolevulinic acid (ALA) stress. A. and B. Expression patterns of LePIP1 and LePIP2 genes in the leaves; C. and D. expression patterns of LePIP1 and LePIP2 genes in the roots. Amount of transcript was normalized to the tomato actin-x expression level. Data are reported as means of three replicates ± SD.

DISCUSSION

Soil salinity influences plant water up-take, photosynthesis and many other physi-ological metabolic activities, thus, strongly inhibiting plant growth. When salinity stress was induced in tomato seedlings, ‘Jinpeng No. 1’ plants demonstrated greater capacity for photo-synthesis than ‘Zhongza No. 9’ plants. Compared with the control plants after 10 days of treat-ment, the declines in total chlorophyll content were less drastic in plants of the salt-tolerant ‘Jinpeng No. 1’. In addition, further salinity tolerance was conferred to tomato seedlings fol-lowing ALA treatment, as revealed by increasing Pn and chlorophyll content. Both the greater



Pn and the reduced chlorophyll degradation could be due to lower water loss from the leaves. Salt tolerance is usually assessed as the percent biomass production in saline versus control conditions (Munns, 2002). In this experiment, tomato plant growth was noticeably restrained by salinity stress; the fresh and dry weights of tomato seedlings were significantly reduced after 10 days of salinity treatment. Moreover, the decrease in weight was much more severe in ‘Zhongza No. 9’ plants compared to ‘Jinpeng No. 1’ plants. Exogenous ALA application re-markably reduced the damage caused by salinity stress and improved plant biomass accumula-tion in both tomato cultivars, which is consistent with previous research on cotton (Watanabe et al., 2000) and potato (Zhang et al., 2006).

Salinity stress decreases osmotic pressure dependent hydraulic conductance in melon roots (Carvajal et al., 2000). Likewise, root hydraulic conductance and E in citrus were remark-ably reduced by long-term salt treatments (Rodriguez-Gamir et al., 2012). We also detected a marked reduction in gs and E in tomato leaves when exposed to salinity stress. As expected, ALA application significantly increased the gs and E of tomato leaves under control and stress conditions, especially in ‘Jinpeng No. 1’ plants. The same results have been observed in oil-seed rape (Naeem et al., 2010). Previous research has also demonstrated the ability to improve gs and E of watermelon and pakchoi plants under different conditions by exogenous ALA treatment (Sun et al., 2009; Memon et al., 2009). Furthermore, Naeem et al. (2011) reported that foliar spray with ALA improved relative growth rate, leaf osmotic potential, and relative water content in oilseed rape under salinity conditions.

The gs and E are strongly related to leaf osmotic potential and relative water content. The results obtained for salinity treatment on pepper plants suggests that a decrease in gs is in agreement with aquaporin functionality (Cabañero and Carvajal, 2007). Either, greater gs and E or improved leaf osmotic potential and relative water content could be due to higher root water uptake. In our study, an obvious increase in gs and E was observed following treatment with ALA, indicating one possible method of how tolerance was conferred to plants by ALA. Thus, we speculated on a reason for ALA improving gs and E by analyzing the expression of related aquaporins in the leaves and roots of the tomato seedlings.

Higher gs and E in leaves are beneficial for root water uptake and photosynthesis, and are, thus, beneficial for both plant growth and tolerance to abiotic stress. Aquaporins play an important role in plant water transport between cells and organelles and the medium under osmotic stress. A number of studies have established that aquaporins can be regulated sig-nificantly and differentially by various environmental stress conditions. For example, various aquaporin isoforms (of both the PIP1 and PIP2 subgroups) in roots of Brassica juncea demon-strated up-regulation upon salinity stress imposition, whereas they were down-regulated upon thiourea supplementation (Srivastava et al., 2010). Nevertheless, this down-regulation was found to contribute to a lower decline in the water retention ability of roots and was accom-panied by transcriptional down-regulation under salinity conditions, hence, enabling plants to conserve water at an early stage of salinity stress. In contrast, transcription levels of both LePIP1 and LeTIP genes in the roots were reduced under salt stress, and colonization of the tomato roots with arbuscular mycorrhizal fungi (AMF) distinctly enhanced this effect. How-ever, colonization by AMF resulted in a drastic increase in the expression of LePIP1, LePIP2, and LeTIP genes in the leaves (Ouziad et al., 2006).

Water uptake and flow across cellular membranes is a fundamental requirement for plant growth and development. Aquaporins are known to significantly contribute to water movement in plants. Additionally, up- or down-regulation of aquaporin genes significantly



induces cellular membrane water permeability (Siefritz et al., 2001; Aharon et al., 2003), and either induced or suppressed regulation has been observed during osmotic stress. Katsuhara et al. (2003) observed that HvPIP2; 1 expression was decreased in the roots of barley under NaCl stress, while transcription levels of HvPIP1; 3 and HvPIP1; 5 remained unchanged. Recently, Li et al. (2008) reported that the expression of OsTIP1; 1, OsTIP1; 2, OsTIP2; 2, and OsTIP4; 3 was considerably induced under 150 mM NaCl treatment, and the transcription levels of OsTIP1; 1 and OsTIP1; 2 increased by 3- to 12-fold. Research on radish seedlings suggests that NaCl stress results in up-regulation of RsPIP2.1 expression, while polyethylene glycol treatment significantly down-regulates RsPIP2.1 expression (Suga et al., 2002). Martre et al. (2002) utilized antisense RNA to depress transcription of AtPIP1 and AtPIP2 and found that transgenic plants showed a lower tolerance to water deficit. A previous study showed that TaAQP (a PIP1 subgroup gene) is up-regulated under salt stress and enhances salt tolerance in transgenic Nicotiana tabacum L. (Hu et al., 2012). However, over-expression of the AtPIP1; 2 gene in transgenic tobacco resulted in increased sensitivity to drought and salt stress (Aha-ron et al., 2003). Based on these results, it can be concluded that transcriptional regulation of aquaporins and their response to various environmental stimuli are very intricate procedures and depend on species, stress conditions, and evenplant organs. Differential expression lev-els of aquaporin isoforms may play important roles in water uptake and flow across cellular membranes under stress conditions. To date, research on the transcriptional regulation of aqua-porins under salinity stress has mainly focused on PIPs and TIPs. Up-regulation of some of these isoforms could facilitate water permeability of membranes; meanwhile an increase in transcripts of aquaporins in plasma membranes may increase intracellular water loss, espe-cially under stress conditions. Down-regulation of some aquaporin isoforms may play a role in limiting initial water loss during the early stages of salt stress and subsequently up-regulation by some aquaporins could enhance uptake of water and maintain better cellular water homeo-stasis in plants under high cellular salt conditions (Shao et al., 2008).

In our experiment, dynamic control of LePIP1 and LePIP2 transcript levels in leaves and roots of tomato seedlings were assayed after exposure to ALA, NaCl, and NaCl+ALA. The results indicate slight up-regulation in the expression of both LePIP1 and LePIP2 genes following spraying with ALA, which is in accordance with our previous research on cucum-ber (Yan et al., 2014). In addition, the response and regulation of LePIP1 and LePIP2 genes under ALA treatment was slightly faster and more stable in the salt-tolerant tomato cultivar compared to the salt-sensitive cultivar. When our tomato seedlings were subjected to salin-ity stress, numerous different responses were observed in both cultivars. LePIP1 expression levels in the leaves of plants from ‘Jinpeng No. 1’ plants were up-regulated at 2 h, followed by a noticeable decrease, while the expression levels of LePIP1 in roots and LePIP2 in leaves and roots of ‘Jinpeng No.1’ plants did not show significant changes during the experimen-tal period. By comparison, salinity stress remarkably induced the transcription of LePIP1 in leaves and roots of ‘Zhongza No. 9’ plants by 2.9- and 4.8-fold, respectively, compared to control levels. The results demonstrate that transcripts of both the LePIP1 and LePIP2 genes in roots and the LePIP1 gene in leaves of ‘Zhongza No. 9’ plants were higher than those in ‘Jinpeng No. 1’ plants, implying that the salt-sensitive species was more severely influenced by salinity. However, Liu et al. (2012) found that the salt-tolerant Malus species had relatively higher levels of aquaporin transcript. The differences in results may be due to the transcript differences between species. Our previous research has shown that low concentration ALA treatment can induce changes in CsPIP1:1 and CsNIP transcriptional expression in cucum-



ber leaves subjected to NaCl stress, which is beneficial for maintaining water homeostasis in plants and is correlated with whole-plant resistance to salinity (Yan et al., 2014). In this study, the effect of ALA on salinity stressed tomato seedling aquaporin gene transcription was also investigated. Transcripts of LePIP1 in leaves and roots of ‘Jinpeng No. 1’ plants were partially up-regulated by ALA application, while slight down-regulation was observed in the expres-sion levels of LePIP2. For the salt-sensitive tomato cultivars, ALA may delay and counteract the up-regulated expression of LePIP1 and LePIP2 genes in both leaves and roots of tomato seedlings subjected to salinity stress. These results are partially inconsistent with the results observed for cucumber (Yan et al., 2014). The differences in LePIP1 and LePIP2 gene expres-sion between ‘Jinpeng No. 1’ and ‘Zhongza No. 9’ plants under salinity conditions may play important roles in determining the salinity tolerance of the plants. Higher expression levels of PIPs and lower gs and E was detected in salt-sensitive cultivars under salinity conditions, implying LePIP1 and LePIP2 may mediate stress sensitivity by enhancing water loss in the plant. Hence, the ability to maintain better water homeostasis by ALA application presumably enabled our tomato plants to tolerate those salinity conditions and accumulate more chlo-rophyll and biomass. However, many more studies need to be conducted to investigate the expression patterns of each aquaporin gene to determine the molecular mechanism by which ALA enhances plant salt tolerance and its relationship with water transport.

ACKNOWLEDGMENTS

Research supported by the China Agriculture Research System (#CARS-25-D-02) and the Innovation Project of the Department of Science & Technology of Shaanxi Province (#2011KTDZ02-03-02). The authors gratefully thank all colleagues at the Key Laboratory of Protected Horticultural Engineering in Northwest, Ministry of Agriculture, China, and the State Key Laboratory of Crop Stress Biology for Arid Areas, NWAFU, China.

REFERENCESAharon R, Shahak Y, Wininger S, Bendov R, et al. (2003). Over expression of a plasma membrane aquaporin in transgenic

tobacco improves plant vigor under favorable growth conditions but not under drought or salt stress. Plant Cell 15: 439-447.

Arnon DI (1949). Copper enzymes in isolated chloroplasts. Polyphenoloxidase in Beta vulgaris. Plant Physiol. 24: 1-15.Cabañero FJ and Carvajal M (2007). Different cation stresses affect specifically osmotic root hydraulic conductance, involving

aquaporins, ATPase and xylem loading of ions in Capsicum annuum L. plants. J. Plant Physiol. 164: 1300-1310.Carvajal M, Cerda A and Martinez V (2000). Does calcium ameliorate the negative effect of NaCl on melon root water

transport by regulating aquaporin activity. New Phytol. 145: 439-447.He ZQ, He CX, Yan Y, Zhang ZB, et al. (2011). Regulative effect of arbuscular mycorrhizal fungi on water absorption and

expression of aquaporin genes in tomato under salt stress. Acta Hort. Sin. 38: 273-280.Hoagland DR and Arnon DI (1950). The water-culture method for growing plants without soil. Berkeley, California.Hu W, Yuan Q, Wang Y, Cai R, et al. (2012). Over expression of a wheat aquaporin gene, TaAQP8, enhances salt stress

tolerance in transgenic tobacco. Plant Cell Physiol. 53: 2127-2141.Jang JY, Kim DG, Kim YO, Kim JS, et al. (2004). An expression analysis of a gene family encoding plasma membrane

aquaporins in response to abiotic stresses in Arabidopsis thaliana. Plant Mol. Biol. 54: 713-725.Katsuhara M, Koshio K, Shibasaka M, Hayashi Y, et al. (2003). Over-expression of a barley aquaporin increased the

shoot/root ratio and raised salt sensitivity in transgenic rice plants. Plant Cell Physiol. 44: 1378-1383.Korkmaz A, Korkmaz Y and Demirkıran AR (2010). Enhancing chilling stress tolerance of pepper seedlings by exogenous

application of 5-aminolevulinic acid. Environ. Exp. Bot. 67: 495-501.Li GW, Peng YH, Yu X, Zhang MH, et al. (2008). Transport functions and expression analysis of vacuolar membrane

aquaporins in response to various stresses in rice. J. Plant Physiol. 165: 1879-1888.



Liu CH, Li C, Liang D, Wei ZW, et al. (2012). Differential expression of ion transporters and aquaporins in leaves may contribute to different salt tolerance in Malus species. Plant Physiol.Biochem. 58: 159-165.

Liu D, Wu LT, Naeem MS, Liu HB, et al. (2013). 5-Aminolevulinic acid enhances photosynthetic gas exchange, chlorophyll fluorescence and antioxidant system in oilseed rape under drought stress. Acta Physiol. Plant 35: 2747-2759.

Livak KJ and Schmittgen TD. (2001). Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C (T)) Method. Methods. 25: 402-408.

Martre P, Morillon R, Barrieu F, North GB, et al. (2002). Plasma membrane aquaporins play a significant role during recovery from water deficit. Plant Physiol. 130: 2101-2110.

Memon SA, Hou XL, Wang LJ, Li Y (2009). Promotive effect of 5-aminolevulinic acid on chlorophyll, antioxidative enzymes and photosynthesis of Pakchoi (Brassica campestris ssp. chinensis var. communis Tsen et Lee). Acta Physiol. Plant. 31: 51-57.

Munns R (2002). Comparative physiology of salt and water stress. Plant Cell Environ. 25: 239-250.Naeem MS, Jin ZL, Wan GL, Liu D, et al. (2010). 5-Aminolevulinic acid improves photosynthetic gas exchange capacity

and ion uptake under salinity stress in oilseed rape (Brassica napus L.). Plant Soil 332: 405-415.Naeem MS, Rasheed M, Liu D, Jin ZL, et al. (2011). 5-Aminolevulinic acid ameliorates salinity-induced metabolic, water-

related and biochemical changes in Brassica napus L. Acta Physiol. Plant 33: 517-528.Naeem MS, Warusawitharana H, Liu H, Liu D, et al. (2012). 5-Aminolevulinic acid alleviates the salinity-induced changes

in Brassica napus as revealed by the ultrastructural study of chloroplast. Plant Physiol. Biochem. 57: 84-92.Nishihara E, Kondo K, Parvez MM, Takahashi K, et al. (2003). Role of 5-aminolevulinic acid (ALA) on active oxygen-

scavenging system in NaCl-treated spinach (Spinaciaoleracea). J. Plant Physiol. 160: 1085-1091.Ouziad F, Wilde P, Schmelzer E, Hildebrandt U, et al. (2006). Analysis of expression of aquaporins and Na+/H+ transporters

in tomato colonized by arbuscular mycorrhizal fungi and affected by salt stress. Environ. Exp. Bot. 57: 177-186.Rodriguez-Gamir J, Ancillo G, Legaz F, Primo-Millo E, et al. (2012). Influence of salinity on pip gene expression in citrus

roots and its relationship with root hydraulic conductance, transpiration and chloride exclusion from leaves. Environ. Exp. Bot. 78: 163-166.

Shao HB, Chu LY, Shao MA and Zhao CX (2008). Advances in functional regulation mechanisms of plant aquaporins: their diversity, gene expression, localization, structure and roles in plant soil-water relations (Review). Mol.Membr. Biol. 25: 179-191.

Siefritz F, Biela A, Eckert M, Otto B, et al. (2001). The tobacco plasma membrane aquaporin NtAQP1. J. Exp. Bot. 52: 1953-1957.

Srivastava AK, Suprasanna P, Srivastava S and D’Souza SF (2010). Thiourea mediated regulation in the expression profile of aquaporins and its impact on water homeostasis under salinity stress in Brassica juncea roots. Plant Sci. 178: 517-522.

Suga S, Komatsu S and Maeshima M (2002). Aquaporin isoforms responsive to salt and water stresses and phytohormones in radish seedlings. Plant Cell Physiol. 43: 1229-1237.

Sun YP, Zhang ZP and Wang LJ (2009). Promotion of 5-aminolevulinic acid treatment on leaf photosynthesis is related with increase of antioxidant enzyme activity in watermelon seedlings grown under shade condition. Photosynthetica 47: 347-354.

Watanabe K, Tanaka T, Hotta Y, Kuramochi H, et al. (2000). Improving salt tolerance of cotton seedlings with 5-aminolevulinic acid. Plant Growth Regul. 32: 99-103.

Yan F, Qu D, Zhao YY, Hu XH, et al. (2014). Effects of exogenous 5-aminolevulinic acid on PIP1 and NIP aquaporin gene expression in seedlings of cucumber cultivars subjected to salinity stress. Genet. Mol. Res. 13: 2563-2573.

Youssef T and Awad MA (2008). Mechanisms of enhancing photosynthetic gas exchange in date palm seedlings (Phoenix dactylifera L.) under salinity stress by a 5-aminolevulinic acid-based fertilizer. J. Plant Growth Regul. 27: 1-9.

Zhang ZJ, Li HZ, Zhou WJ, Takeuchi Y, et al. (2006). Effect of 5-aminolevulinic acid on development and salt tolerance of potato (Solanum tuberosum L.) microtubers in vitro. Plant Growth Regul. 49: 27-34.

Zhu CF, Schraut D, Hartung W, Schäffner AR (2005). Differential responses of maize MIP genes to salt stress and ABA. J. Exp. Bot. 56: 2971-2981.

effects of exogenous 5-aminolevulinic acid on ... · effects of exogenous 5-aminolevulinic acid on...

Documents