early growth factor response 1 (egr-1) negatively...
TRANSCRIPT
Early Growth Factor Response 1 (Egr-1) Negatively Regulates Expression of Calsequestrin ( CSQ) in Cardiomyocytes in Vitro
By
Amanda Kasneci
Faculty of Graduate Studies
Department of Medicine, Division of Experimental Medicine
McGill University, Montreal
February 2008
A thesis submitted to McGill University
in partial fulfillment of the requirements of the degree of Master of Sciences (M.Sc.)
in Experimental Medicine
© Amanda Kasneci 2008
1+1 Library and Archives Canada
Bibliothèque et Archives Canada
Published Heritage Bran ch
Direction du Patrimoine de l'édition
395 Wellington Street Ottawa ON K1A ON4 Canada
395, rue Wellington Ottawa ON K1A ON4 Canada
NOTICE: The author has granted a nonexclusive license allowing Library and Archives Canada to reproduce, publish, archive, preserve, conserve, communicate to the public by telecommunication or on the Internet, loan, distribute and sell theses worldwide, for commercial or noncommercial purposes, in microform, paper, electronic and/or any other formats.
The author retains copyright ownership and moral rights in this thesis. Neither the thesis nor substantial extracts from it may be printed or otherwise reproduced without the author's permission.
ln compliance with the Canadian Privacy Act some supporting forms may have been removed from this thesis.
While these forms may be included in the document page count, their removal does not represent any loss of content from the thesis.
• •• Canada
AVIS:
Your file Votre référence ISBN: 978-0-494-51289-0 Our file Notre référence ISBN: 978-0-494-51289-0
L'auteur a accordé une licence non exclusive permettant à la Bibliothèque et Archives Canada de reproduire, publier, archiver, sauvegarder, conserver, transmettre au public par télécommunication ou par l'Internet, prêter, distribuer et vendre des thèses partout dans le monde, à des fins commerciales ou autres, sur support microforme, papier, électronique et/ou autres formats.
L'auteur conserve la propriété du droit d'auteur et des droits moraux qui protège cette thèse. Ni la thèse ni des extraits substantiels de celle-ci ne doivent être imprimés ou autrement reproduits sans son autorisation.
Conformément à la loi canadienne sur la protection de la vie privée, quelques formulaires secondaires ont été enlevés de cette thèse.
Bien que ces formulaires aient inclus dans la pagination, il n'y aura aucun contenu manquant.
ABSTRACT
Hear1 failure represents an important cause of death in Western Countries. The
pathophysiology of heart failure is mainly associated with abnormalities in intracellular
calcium control. We previously showed that Egr-1 negatively regulates expression of
sodium-calcium exchanger (NCX) in vivo and in vitro. Here we tested the hypothesis that
Egr-1 regulates expression of calcium storage proteins in the sarco-endoplasmic reticulum
(SER), calsequestrin (CSQ) and/or ER, calreticulin (CRT) directly or indirectly via Egr-
1:NFAT (nuclear factor of activated T-cells) formation. Secondarily, we hypothesized
that this will reduce calcium mobilization. We found that undifferentiated 1293F cells,
overxpressing Egr-1, have reduced CSQ compared to control H9c2 cells. We
demonstrated that Egr-1 negatively regulates CSQ but not CRT expression. The Egr-1
mediated decrease in CSQ is linked to decreased calcium availability. Repression is by a
novel NAB-independent (NGFI-A binding protein) activity localized to a.a. region
1-307. We conclu de that Egr-1-mediated reductions in calcium storage protein expression
alter calcium availability for cardiac contraction/relaxation.
11
RÉSUMÉ
Les maladies cardiovasculaires représentent une cause importante de mortalité
dans les pays occidentaux. La pathophysiologie des maladies cardiovasculaires est
principalement associée aux anomalies dans le control intracellulaire du calcium. Nous
avons précédemment prouvé qu'Egr-1 contrôle négativement l'expression de l'échangeur
de sodium-calcium de type 1 (NCXl) in vivo et in vitro. Ici nous avons examiné
l'hypothèse qu'Egr-1 contrôle l'expression des protéines d'emmagasinage du calcium dans
le réticulum sarcoendoplasmique (RSE), la calsequestrin (CSQ) et/ou dans le réticulum
endoplasmique, la calréticulin (CRT) directement ou indirectement par la formation
d'Egr-l:NFAT (Nuclear factor of activated T cells). Secondairement, nous avons présumé
que ceci réduira la mobilisation de calcium. Nous avons constaté que dans les cellules
indifférenciées d'I293F, lesquelles surexpriment Egr-1, CSQ est réduite comparé aux
cellules de control H9c2. Nous avons démontré qu'Egr-1 contrôle négativement CSQ
mais pas l'expression de CRT. La diminution de CSQ, régulée par Egr-1, est liée à la
disponibilité diminuée du calcium. Cette répression est indépendante du facteur de
répression NAB (NGFI-A binding protein) et elle est localisée dans la région des a.a
1-307. Nous concluons que la réduction de l'expression des protéines d'emmagasinage de
calcium, controlée par Egr -1, changent la disponibilité du calcium pour
contraction/relaxation cardiaque.
111
TABLE OF CONTENTS
ABSTRA CT ....................................................................................................................... ii RÉSUMÉ ........................................................................................................................... iii TABLE OF CONTENTS ................................................................................................. iv LIST OF FIGURES ......................................................................................................... vi LIST OF TABLES .......................................................................................................... vii ABBREVIATIONS ........................................................................................................ viii ACKNOWLEDGEMENTS ............................................................................................. ix
CHAPTER I - LITERA TURE REVIEW ....................................................................... 1 Introduction ................................................................................................................... 2 1.1 Egr-1, the mas ter regula tor ............................................................................... 3
1.1.1 Egr-1 structure ............................................................................................... 4 1.1.2 Egr-1 transcription ......................................................................................... 4 1.1.3 Role of NAB in Egr-1 repression .................................................................. 6 1.1.4 Role ofNuclear Factor of Activated T-cells (NFAT) ................................... 7 1.1.5 Egr-1 and apoptosis ....................................................................................... 8 1.1.6 Role of Egr-1 in cardiovascular pathology ................................................... 9
1.2 Calsequestrin ....................................................................................................... 9 1.2.1 Calsequestrin structure ................................................................................ 10 1.2.2 Calsequestrin function ................................................................................. 12 1.2.3 CSQ2 role in CPVT ..................................................................................... 13
1.3 Calreticulin ........................................................................................................ 14 1.3.1 Calreticulin structure ................................................................................... 14 1.3.2 Calreticulin function .................................................................................... 15 1.3.3 Calreticulin, a component ofCa2
+ /calcineurin/NFAT/GATA-4 pathway .. 16 1.3.4 Calreticulin in cardiovascular pathology ..................................................... 17
1.4 Rationale and Hypothesis ................................................................................ 19
CHAPTER II- MATERIALS AND METHODS ........................................................ 21 2.1 Materials and Antibodies ...................................................................................... 22 2.2 Ce li culture ............................................................................................................. 22
2.2.1 Preparation of H9c2 cells for transfection ................................................... 23 2.2.2 Differentiation of H9c2 cells ....................................................................... 23 2.2.3 Cell culture of transfected cells ................................................................... 23
2.3 Stable and transient transfection procedures ..................................................... 23 2.3.1 Stable transfection ....................................................................................... 25 2.3.2 Transient transfection .................................................................................. 25 2.3.3 Determination of the DNA concentration used for transfection ................. 26
2.4 Prote in isolation ..................................................................................................... 26 2.4.1 Prepartion of whole celllysate .................................................................... 26 2.4.2 Tissue Homogenisation ............................................................................... 27
2.5 Colorimetrie prote in assays .................................................................................. 27 2.5.1 Bio-Rad Protein Determination Assay ........................................................ 27 2.5.2 Sulforhodarnine B (SRB) colorimetrie assay .............................................. 28
lV
2.6 Immun ob lot 1 Western Blot Analysis .................................................................. 28 2.7 Reciprocal co-immunoprecipitation and Western blots .................................... 30 2.8 In vitro chromatin immunoprecipitation (ChiP) ............................................... 30 2.9 In vivo chromatin immunoprecipitation (ChiP) ................................................ 31 2.10 Polymerase Chain Reaction (PCR) .................................................................... 32 2.11 Bacterial Transformation ................................................................................... 34 2.12 Small-scale (miniprep) preparation of plasmid DNA ...................................... 34 2.13 Nucleic acid electrophoresis ............................................................................... 35
2.13.1 Agarose gel electrophoresis ofDNA .......................................................... 35 2.13.2 Acrylamide gel electrophoresis of DNA ..................................................... 36
2.14 Fluorescence measurement of cytosolic free Ca2+ concentration .................... 36
2.15 Densitometry and statistical analyses ................................................................ 37
CHAPTER III - RESUL TS ............................................................................................ 38 3.1 Cell growth is not significant during the differentiation process ............................ 39 3.2 Egr-1 transactivation reduces CSQ expression ....................................................... 41 3.3 Egr-1/NAB protein protein binding is not involved in CSQ regulation ................. 43 3.4 Egr-1 protein binds to the CSQ2 promoter ............................................................. 43 3.5 Egr-1/NF AT3 interaction and CASQ regulation .................................................... 4 7 3.6 Microspectrofluorometry of control and Egr-1 overexpressing H9c2 cells ............ 52 3.7 CSQ2 rescue of I293F calcium dynamics ............................................................... 56
CHAPTER IV - DISCUSSION ...................................................................................... 59 4.1 Cyclosporin A reduces CSQ2 expression ............................................................... 60 4.2 Altered calcium dynamics in I293F mutants ........................................................... 61 4.3 Other pro teins are involved in CASQ2 repression in 1293F cells ........................... 62 4.4 Novel mechanism of CSQ2 repression in I293F mutants ....................................... 62 4.5 Egr-1-DNA/protein-protein interactions could be absent ....................................... 63 4.6 Egr-1 :NFAT3 binding is not repressive .................................................................. 64 4.7 Cell-specific repression ........................................................................................... 65
SUMMARY AND CONCLUSION ................................................................................ 66 FUTURE PERSPECTIVES ........................................................................................... 67 REFERENCES ................................................................................................................ 68
v
LIST OF :FIGURES
CHAPTER 1 - Literature Review
Figure 1.1 Modular structure of the zinc fin ger Egr-1 transcription factor ............... 5
Figure 1.2 Schematic representation of the quaternary complex formed by RyR2, CSQ2, junctin and triadin ............................................. 11
Figure 1.3 Calreticulin involvement in the Ca2+ /calcineurin/NFAT/GATA-4
pathway ............................................................................. 18
CHAPTER 2 - Materials and Methods
Figure 2.1 Modular structure of the Egr-1 mutants ........................................ 24
CHAPTER 3 - Results
Figure 3.1 Cells do not grow significantly during the differentiation process ......... .40
Figure 3.2 CRT and CSQ expression in Egr-1 overexpressing H9c2 cells ............ .42
Figure 3.3 NAB expression as a function of differentiation in Egr-1 overexpressing cells .............................................................. .44
Figure 3.4 Egr-1 binding to CASQ promoter DNA ....................................... .46
Figure 3.5 NFAT involvement in CSQ regulation ........................................ .49
Figure 3.6 Evaluating NF AT /Egr-1 interactions ........................................... 50
Figure 3.7 CSQ2 expression decreases with cyclosporin treatment. ........................ 51
Figure 3.8 Effect of Egr-1 modifications of the [Ca2+]i dynamics ....................... 54
Figure 3.9 1293F cells respond to ATP, but not caffeine with transient elevation of [Ca2+]1 ..................................................•............. 55
Figure 3.10 CSQ expression increases in 1293F cells following transfection ............ 57
Figure 3.11 Proposed mechanism of CSQ2 expression regulation ........................ 58
Vl
LIST OF TABLES
CHAPTER 2 - Materials and Methods
Table 1
Table 2
mouseCSQ2 chromatin immunoprecipitation primer sequences .......... 33
ratCSQ2 chromatin immunoprecipitation primer sequences ............... 33
VIl
BSA:
CRT: CSQ1: CSQ2: CVPT:
DNA:
Egr-1: ER:
FBS:
GAPDH:
IP3:
LB:
MEF2C:
NAB: NCXI: NFAT: NGFI-A:
PBS: PLB:
RyR2:
SERCA2a: SR:
TBS:
ABBREVIATIONS
bovine serum albumin
calreticulin skeletal calsequestrin cardiac calsequestrin Catecholaminergic polymorphie ventricular tachycardia
deoxyribonucleic acid
Early growth response factor 1 endoplasmic reticulum
fetal bovine serum
glyceraldehyde-3 phosphate dehydrogenase
inositol 1 ,4,5-triphosphate (InsP3) receptor/ Ca2+ release channel
Luria Broth
myocyte enhancer factor 2C
NGFI-A-binding protein sodium calcium exchanger 1 nuclear factor of activated T-cells nerve growth factor induced A
phosphate buffer saline phospholamban
cardiac ryanodine receptors
sarcoendoplasmic reticulum A TPase sarcoplasmic reticulum
tris buffer saline
viii
ACKNOWLEDGEMENTS
Firstly, 1 would like to express my sincere appreciation and gratitude to my
supervisor Dr. Lorraine Chalifour for offering me the opportunity to work with her in the
Lady Davis Institute. 1 am also indebted to her for her generous support and guidance
throughout the duration of my study.
1 would like to thank Dr. Svjetlana Komorova and Naomi Kemeny for
collaborating with us on this project.
1 would also like to thank Melissa Meilleur, Annie Calvé and Tomoko Sugahara
for their assistance during the course of this work and Dr.Krikor Bijian for accepting to
review my thesis and for his advices. Also, 1 would like to thank Laurie Desfosses for
helping me with bacterial transformation, Tanya Kahawita for her company during the
long hours at the lab and Mike Giovinazzo for changing my gaz tank and allowing me to
use all the equipments in his lab. Finally, 1 want to express my deepest gratitude to my
family for all their support.
This study was supported by a grant from the National Science and Engineering
Research Council of Canada to LC and grants from the Canadian Institute for Health
Research and the Canadian Fund for Innovation to SVK.
ix
CHAPTERI
LITERA TURE REVIEW
INTRODUCTION
Cardiovascular disease, more specifically heart failure (HF) is the leading cause of
death in women in the majority of developed countries. Currently, 1 in 3 women are
dying from heart disease in the United States alone (Dullum 2008). The high mortality
associated with HF is partly due to the severe complications like premature death that
arises from ventricular arrhythmias (Kirchhefer, Klimas et al. 2007). Abnormalities in the
calcium-handling process play an important role in the pathophysiology of cardiac
disorders such as heart failure and other cardiomyopathies (Liu and Priori 2007).
Control of the levels of calcium (Ca2+) is critical for the proper function of the
mammalian heart as either too low or too high intracellular Ca +2 concentration is
incompatible with life. Thus, Ca2+ levels are very tightly regulated in the cardiac
myocytes to pre vent Ca2+ -mediated cell damage (Bootman, Collins et al. 2001; Case,
Eisner et al. 2007). Calcium requirements for contraction are met by Ca2+ mobilization
from the intracellular store, the sarcoplasmic reticulum (SR) (Dibb, Graham et al. 2007).
The cardiac sarcoplasmic reticulum, a membranous organelle that acts as a Ca2+ reservoir,
is an active component of excitation-contraction coupling (Periasamy, Bhupathy et al.
2007). Deregulations in SR function are believed to constitute the principal basis for
reduced intracellular Ca2+ and contractile dysfunctions observed in human cardiac
disorders and most animal models (Smith 2007).
The heart is equipped with many transport and storage proteins that are involved
in the maintenance of intracellular calcium homestasis (Bers, Pogwizd et al. 2002). Two
storage proteins in direct contact with the sarcoplasmic reticulum are calsequestrin
(CASQ) and calreticulin (CRT). Mutations in CASQ or CRT proteins are associated with
2
a number of cardiopathological conditions such as arrhythmias and bradycardias,
respective! y (Michalak, Lynch et al. 2002; Song, Alcalai et al. 2007). Expression of both
of these proteins is likely also to be regulated at the level of transcription to alter protein
levels. For example, Egr-1, a transcription factor, regulates expression of sodium-calcium
ex changer 1 (NCX -1) transport protein (Wang, Dostanic et al. 2005).
1.1 Egr-1, the master regulator
Earl y growth response 1 (Egr-1 ), is the zinc fin ger containing transcription factor
product of an immediate early gene located on human chromosome 5q23-q31
((Khachigian 2006). Egr-1 is also known as NGFI-A (nerve growth factor induced)
because it is induced in PC12 cells by nerve growth factor(de Belle, Mercola et al. 2000).
Egr-1 has a short half life of 90 minutes but this can be greatly extended after certain
stimuli such as stress that lead to its phosphorylation (de Belle, Mercola et al. 2000).
Many stimuli, such as acute mechanical injury and shear stress, trigger overexpression of
the Egr-1 gene whereas it is normally poorly expressed in the artery wall (Khachigian
2006).
Egr-1 is considered as a master regulator because it regulates the expression of
numerous genes involved in differentiation, growth and environmental signais.
Oligonucleotide-based microarray analysis revealed that Egr-1 protein altered expression
of a number of transcription factors, signaling and growth factors and cytokines among
others (Khachigian 2006).
3
1.1.1 Egr-1 structure
Like many other transcription factors, Egr-1 has a modular structure, i.e. distinct
regions within the molecule have different functions (Fig.l.1 ). As such, the Egr-1
molecule is composed of a DNA-binding, repression and activation domains. The DNA
binding domain is composed of three C2H2 zinc finger motifs which form a complex with
its cognate DNA-binding site. Egr-1 preferentially binds to OC-rich sequences (Thiel and
Cibelli 2002). The DNA-binding domain comprises also a nuclear localization signal
(NLS). Nuclear localization is an important mode of regulation of transcription factor
function, which does not require DNA binding perse (Matheny, Day et al. 1994). The
extended N-terminus activation domain of Egr-1 spans amino acids 3-218 but is not weil
characterized. The transcription factor' s repression or inhibitory domain is located
between the activation and the DNA-binding domain (a.a. 281-314), and serves as a
binding site for the transcriptional co-factors NGFI-A binding pro teins 1 and 2 (NAB 1,
NAB2). Both co-factors neutralize
Egr-1 activation function (Thiel and Cibelli 2002).
1.1.2 Egr-1 transcription
Transcription of the Egr-1 gene is mediated by five serum response elements
(SRE) located in the egr-1 promoter and by the Ras-Raf-MEK-ERK signaling pathway
(Thiel and Cibelli 2002; Khachigian 2006). Synthesis of Egr-1 mRNA following serum
and p1ate1et-derived growth factor stimulation requires activation of the Ras-Raf-MEK
ERK signaling pathway. SRE-mediated transcription is dependent on binding of Elk1,
Sap1 or Sap2 proteins to DNA and serum response factor (SRF) (Thiel and Cibelli 2002).
4
NLS
Figure 1.1- Modular structure of the zinc finger Egr-1 transcription factor
Egr-1 molecule is composed of a DNA-binding, a repression and an activation domain. The DNA-binding domain is composed of three C2H2 zinc finger motifs which form a complex with its cognate DNA-binding site. The nuclear localization signal (NLS) s found within this domain. The inhibitory domain is located between the activation and the DNA-binding domain. lt functions as a binding site for the transcriptional co-repressor proteins NAB 1 and NAB2.
Modifiedfrom Thiel, G. and G. Cibelli, Regulation oflife and death by the zincfinger transcription factor Egr-1. J Cel! Physiol, 2002. 193(3): p. 287-92. Copyright 2002.
5
1.1.3 Role of NAB in Egr-1 repression
Egr-I activity is tightly regulated parti y through the function of NAB I and NAB2.
Binding of these corepressors controls activation of Egr-I target genes and signaling
pathways (Kumbrink, Gerlinger et al. 2005). NAB 1 and NAB2 are corepressors that bind
to Egr-1 by direct protein-protein interactions with a conserved RI region (a.a 2I8-3I4)
(Lucerna, Mechtcheriakova et al. 2003). NAB I and NAB2 are nuclear proteins and share
a high degree of homology (Srinivasan, Mager et al. 2006).
NAB I is an active repressor that is constitutively expressed in most cells. lt resides
exclusively within the nucleus, thus does not interfere with Egr-I nuclear localization. In
fact, the RI region is the sole point of contact between the 2 proteins (Swirnoff, Apel et
al. I998).
NAB2 is a more patent regulator of Egr-I function as it is induced by the same
environmental stimuli that resulted in Egr-I expression. NAB2 expression, however, is
delayed by severa! hours compared to that of Egr-I and is tissue specifie (Miano and Berk
I999).More importantly, NAB2 promoter containing numerous Egr-I binding sites and a
regulatory region containing Egr-I/Sp-I sites, necessary for basal promoter activity.
Egr-I was shawn to induce Nab2 transcription by activation of its promoter, supporting as
Egr-I-NAB2 negative feedback mechanism (Kumbrink, Gerlinger et al. 2005). In arder to
regulate Egr-1 activity, NAB2 requires interaction with the chromodomain helicase
DNA-binding protein 4 (CHD40), a subunit of the nucleosome remodeling and
deacetylase (NuRD) complex (Srinivasan, Mager et al. 2006). This negative feedback
loop has important physiological and pathological consequences. In addition, NAB2 may
reduce Egr-I mediated angiogenesis (Lucerna, Mechtcheriakova et al. 2003) and restrict
6
scarring during healing (Houston, Campbell et al. 2001). Thus, the role of Nab2 is to
downregulate Egr-1 signaling.
1.1.4 Role of Nuclear Factor of Activated T -cells (NFAT)
Severa} studies show that Egr-1 mediated gene expression requues functional
cooperation between Egr-1 and other transcription factors such as NFA T (Khachigian
2006). Nuclear factor of activated T cells (NFAT) is a transcription factor that controls
interleukin 1 and 4 (IL-l and IL-4) gene expression. Transcriptional activation requires
NFAT dependent binding of AP-l factor to the complex, in addition to NFAT binding to
DNA (Tsytsykova, Tsitsikov et al. 1996). The NFAT protein family consists of 5
members. NFATl and NFAT2 are predominate1y expressed in lymphoid tissue. NFAT4
is expressed in the thymus; NFAT3 is present in non-lymphoid tissue while NFAT5 is a
nuclear protein expressed ubiquitously (25).
NF AT activation is regulated by calcineurin, a Ca +2 dependent phosphatase.
Following its activation by Ca +2 -calmodulin, calcineurin interacts with NFA T and
dephosphorylates serine residues within its regulatory domain. Dephosphorylation reveals
two nuclear localization sequences required for nuclear import (van Rooij, Doevendans et
al. 2002). NFAT-calcineurin signaling is required for cardiomyocyte hypertrophy,
suggesting NFAT plays a key role during developmental maturation of the myocardium
(van Rooij, Doevendans et al. 2002).
Egr-1/NFAT interactions are observed in a variety of physiological and pathological
systems. During the inflammatory process, Egr-1 and two members of the NFAT protein
family (NF A Tl and NFAT2) form heterodimers and regulate tumor necrosis factor alpha
7
(TNFalpha) gene transcription. This interaction is considered essential for human
cytokine expression (Decker, Nehmann et al. 2003).
Moreover, Egr-1 cooperates with NFAT2 in kidney cells. More specifically, Egr-1
and NF A T2 bind independently to the membrane type 1 matrix metalloproteinase
promoter (MTl-MMP) and regulate its transcription (Alfonso-Jaume, Mahimkar et al.
2004 ). Recently, Egr-1 was shown to physically interact with NFA T in endothelial cells,
synergistically enhancing tissue factor (TF) gene expression. Both factors are required for
TF upregulation in response to vascular endothelial growth factor (VEGF) (Schabbauer,
Schweighofer et al. 2007).
1.1.5 Egr-1 and apoptosis
Egr-1 involvement in growth and proliferation is well established. However,
emerging evidence implicates Egr-1 in regulation of apoptosis (Thiel and Cibelli 2002).
Egr-1 directly induces synthesis of p53 tumor suppressor gene in melanoma cells. The
p53 tumor suppressor promoter contains an Egr-1 site. In addition, Egr-1 modulates the
activity of the transcription factor c-Jun, a basic region leucine zipper protein. c-Jun plays
a key role in neuronal apoptosis. lt is activated by phophorylation of serine residues. Egr-
1 was found to further potentiate activity of c-Jun through direct protein-protein
interaction (Thiel and Cibelli 2002). More importantly, Egr-1 directly regulates
expression of PTEN gene via a functional GC sequence that acts as an Egr-1 binding site
within the 5' untranslated region. PTEN is a lipid phosphatase that opposes the action of
phosphoinositide 3-kinase, a cell survival protein (Thiel and Cibelli 2002). lt is important
to note that overexpression of Egr-1 protein alone is not sufficient to induce apoptosis in
cerrebellar granule cells (Thiel and Cibelli 2002). For efficient apoptosis to take place in
8
tumor cells, formation of a regulatory network between Egr-1, p53 and p73 is required
(Yu, Baron et al. 2007). Thus, Egr-1 function as a pro-apoptotic protein requires the
presence of other co-factors.
1.1.6 Role of Egr-1 in cardiovascular pathology
Despite a number of studies implicating Egr-1 in pathological conditions such as
atherosclerosis and cardiac hypertrophy (Khachigian 2006), there are reports describing
Egr-1 's cardioprotective role. In fact, Egr-1 was shown to negatively regulate expression
of the sodium-calcium exchanger-1 (NCX-1) in cardiomyocytes in vitro and in vivo
(Wang, Dostanic et al. 2005). The NCX-1 is an integral membrane protein which removes
one intracellular calcium ion and introduces three extracellular sodium ions (Bers,
Pogwizd et al. 2002). Although NCX-1 is essential for the proper functioning of the heart,
its expression is elevated in end-stage cardiac failure (Wang, Dostanic et al. 2005). In
addition, studies performed in Egr -1 deficient fe male mi ce show th at Egr -1 limits
doxorubicin's (DOX) cardiotoxic effects and its presence is crucial for dexrazone's
(DZR) protective effect of the heart (Saadane, Yue et al. 2001).
1.2 Calsequestrin
Casquestrin (CSQ) is the major Ca2+ -storing protein in the internai sarcoplasmic
reticulum of skeletal (CSQ1) and cardiac (CSQ2) muscle cells. It is a high capacity (40 to
50 mol of Ca2+ /mol of CSQ), low affinity (Kd:~ 1mM) Ca2
+ buffer, binding most of the
calcium in the SR (50-90%) and preventing its intra-sarcoplasmic precipitation (Frank,
Mesnard-Rouiller et al. 2001). The presence of high Ca2+ stores makes CSQ an essential
9
element of excitation-contraction coupling, respiration and heart beat (Beard, Laver et al.
2004).
1.2.1 Calsequestrin structure
Cardiac calsequestrin protein is located in the junctional sarcoplasmic reticulum
(jSR) of mammalian myocardium. 1t is a condensed polymer anchored to the membrane
by binding to the jSR membrane proteins, junctin, triadin-1 and ryanodine receptor Ca2+
release channels (Fig.l.2) to form a well-defined quaternary complex (Chopra,
Kannankeril et al. 2007). Calsequestrin is a highly acidic protein, where 37% of its total
amino acid content is composed of either aspartic (Asp) or glutamic (Glu) acid,
concentrated mostly in the C-terminal tail (Gyorke and Terentyev 2007). The
calsequestrin monomer is composed of three almost identical tandem domains, 1, Il, Ill.
Each domain has a topology similar to that of E.coli thioredoxin, i.e. 2 a-helices
bordering the 2 sides of the ~-structure core (Beard, Laver et al. 2004). Calsequestrin
structure undergoes major changes when it binds calcium. Thus, while at low Ca2+
concentration CSQ is present in soluble form; at high Ca2+ concentration the protein
precipitates and forms fibrils or needle crystals (Gyorke, Hagen et al. 2007).
The polymerization of calsequestrin protein is calcium dependent. In the absence
of calcium, CSQ is unfolded due to charge repulsion. Increased Ca2+ concentration causes
the CSQ thioredoxin domains to come together as the charge repulsion is shielded. With
further increases in Ca2+ concentration, formation of dimers takes place that eventually
assemble to forma linear polymer(Gyorke and Terentyev 2007).
10
>3mM Ca2+
>SmM ca<> .. D p
Figure 1.2-Schematic representation of the quaternary complex formed by RyR2, CSQ2, junctin and triadin.
Ml-M4 represent the four transmembrane domains of RyR2 (ryanodine receptors). At low lu minai calcium concentration, CSQ2 ( cardiac calsequestrin) is present as a mon omer bound to triadin and junction. As calcium concentration is increased above 3mM, formation of polymerie CSQ2 occurs. With further increases in calcium concentrations, the dimers assemble to form a polymer. Following polymerization, CSQ2 dissociates from triadin and junctin.
From Gyorke, S. and D. Terentyev, Modulation of ryanodine receptor by luminal calcium and accessory proteins in health and cardiac disease. Cardiovasc Res, 2007. Copyright 2007.
11
1.2.2 Calsequestrin function
Animal models lacking the CSQ2 gene, as well as the presence of human
homozygous nonsense CSQ2 mutation indicate that CSQ2 is not essential for survival.
CSQ2 plays a dual role in cardiomyocytes: it acts as a Ca2+ reservoir in the SR and it
actively modulates the Ca2+ release process (Kirchhefer, Klimas et al. 2007). CSQ2
supplies the calcium necessary for contraction and controls free Ca2+ dynamics near the
regulatory sites of the RyR2 channels. As a modulator, it regulates RyR2 channels
opening and closing through protein-protein interactions involving triadin and junctin
(Gyorke and Terentyev 2007). CSQ2 knockout mice are viable and maintain functional
SR Ca2+ storage and near normal contractile fonction. A significant expansion of the SR
volume compensates for the ablation in CSQ2 fonction as storage protein. Thus, CSQ2
main fonction appears to be that of inhibitory regulator of RyR2 channels in response to
high SR Ca2+ load or ~-adrenergic stimulation (Knollmann, Chopra et al. 2006). CSQ2-/
knockout m1ce also develop polymorphie ventricular tachycardia following
catecholamine infusion (Knollmann, Chopra et al. 2006). The susceptibility to develop
cardiac arrhythmias is not an all or none phenomenon. Indeed, even a 25% reduction in
CSQ2 expression is sufficient to cause premature spontaneous SR Ca2+ release in
myocytes following catecholamine infusion in vivo. These results suggests that CSQ2
role as a RyR2 channels modulator and that of a storage protein are independent (Chopra,
Kannankeril et al. 2007).
Mouse hearts overexpressing CSQ2 by 10 to 20-fold develop hypertrophy and
subsequent heart failure. In these mice, SR Ca2+ content is significantly increased. In
12
addition, it was observed that chronic overexpression of CSQ2 correlates with a marked
increase in triadin and junction protein expression as well as important changes in SR
morphology (Gyorke, Hagen et al. 2007).
Other potential functions have been attributed to calsequestrin such
phosphorylation and oxidative protein folding. Both of these roles require further
investigation (Beard, Laver et al. 2004).
1.2.3 CSQ2 role in CPVT
Catecholaminergic polymorphie ventricular tachycardia (CPVT) is a rare
arrhythmogenic disorder observed in children and adolescents in the absence of structural
heart disease. The mortality rate associated with the disease is quite high, ranging from
30% to 50%. Patients die at a young age, 20 to 30 years, from syncopai events and sudden
cardiac death due to stress-induced ventricular tachycardia (Postma, Denjoy et al. 2002).
In contrast to CVTP caused by mutations in the RyR2 gene which autosomal dominant,
CSQ2-related CVTP is autosomal recessive (Postma, Denjoy et al. 2002). CSQ2-related
CVTP is caused by nonsense mutations in the coding sequence of Casq2 gene. Due to the
rareness of the disease, only few of these mutations have been examined and
characterized in vitro (Liu and Priori 2007). Results show that sorne of these mutations
impair SR Ca2+ storing and interfere with CSQ2 Ca2
+ buffering capacity while others
compromise CSQ2-RyR2 interaction. Interestingly, heterozygous CSQ2 mutations that
cause a catecholaminergic ventricular tachycardia phenotype exist (Liu and Priori 2007).
Clinical studies identified 3 nonsense mutations in the cardiac calsequestrin gene in three
families. More importantly, one of these mutations, R33X appears to be the first
autosomal dominant mutation for CSQ2 (Postma, Denjoy et al. 2002).
13
1.3 Calreticulin
Calreticulin (CRT) is a major Ca2+ binding chaperone found in the endoplasmic
reticulum (ER). It binds calcium with high affinity and high capacity. The endoplasmic
reticulum (ER) is the equivalent of the SR but for non-muscle cells. However, emerging
evidence indicate that the ER and the SR may coexist in muscle cells (Lynch, Chilibeck et
al. 2006). In fact, it is believed that the SR and the ER represent functionally distinct
compartments in cardiomyocytes. It is suggested that the SR Ca2+ stores is responsible for
control of excitation-contraction coupling of the cardiomyocyte, while the ER
compartment provides Ca2+ necessary for housekeeping functions and transcriptional
regulation (Lynch, Chilibeck et al. 2006). Similarly to the SR, the ER is an important
organelle involved in regulation of Ca2+ homeostasis. In addition, it participates in protein
and lipid synthesis (Michalak, Guo et al. 2004).
1.3.1 Calreticulin structure
Calreticulin protein is a ubiquitous protein, highly conserved with more than 90%
amino acid identity in mammals. The high conservation suggests a general function in
living cells (Kageyama, Ihara et al. 2002). The CRT molecule is divided into 3 distinct
regions: a P-domain, a globular N-domain and aC-domain. The P-domain has an unusual
structure. It forms an extended and curved arm that connects to the other 2 domains. In
addition, the elongated arm acts as an attachment point for other chaperones such as
ERp57 (Michalak, Guo et al. 2004). The globular N-terminal domain is believed to form
anti-parallel ~-sheets like calnexin. Calreticulin and calnexin share a great degree of
amino acid sequence identity and are functionally similar (Michalak, Lynch et al. 2002).
The N- and P- domain of calreticulin form the N-terminal region which is involved in
14
chaperone function of the protein. It interacts with misfolded proteins and glycoproteins
and binds A TP, Zn 2+ and Ca2+ with high affinity. It is the C-terminal region of calreticulin
that binds calcium with high capacity and is involved in calcium storage of ER in vivo
(Michalak, Guo et al. 2004).
1.3.2 Calreticulin function
Calreticulin is highly expressed in embryonic rat heart but its expressiOn 1s
significantly downregulated after birth (lmanaka-Yoshida, Amitani et al. 1996;
Kageyama, Ihara et al. 2002). lt is considered a cardiac embryonic gene as it is highly
active in the developing heart (Michalak, Lynch et al. 2002). Its expression is regulated
by Nkx2.5, an important transcription factor involved in regulation of gene expression
during cardiac development (Kageyama, Ihara et al. 2002). CRT represents one of the
most important Ca2+ buffers in the ER as it binds more than half the calcium stores in the
lumen of the ER (Lynch, Chilibeck et al. 2006).
Many important roles have been attributed to calreticulin. CRT modulates Ca2+
transport by interacting with the sarcoplasmic/endoplasmic reticulum Ca2+ -A TPase 2b
(SERCA2b). CRT is also shown to interact with inositol 1,4,5-triphosphate (IP3)
receptor/ Ca2+ release channel and to alter their function (Mesaeli, Nakamura et al. 1999;
Lynch, Chilibeck et al. 2006). CRT expression is very sensitive to changes in ER calcium
concentration. The protein's expression is significantly increased once the ER Ca2+ stores
are emptied. In addition, CRT is a component of protein quality process control. Ca2+ is a
crucial element of the chaperone-substrate complex formation. Thus, even small
fluctuations in ER Ca2+ content can impact the ER protein folding machinery (Lynch,
Chilibeck et al. 2006). Most importantly, CRT is considered essential for cardiac
15
development as CRT -deficient cells exhibit impaired nuclear import of NF A T3 (Mesaeli,
Nakamura et al. 1999).
1.3.3 Calreticulin, a component of Ca2+ /calcineurin/NFAT/GATA-4 pathway
The Ca2+ /calcineurin/NFAT/GATA-4 signaling pathway is one of the first to have
been studied in order to examine the trajectory of extracellular signais to the nucleus
(Bueno, van Rooij et al. 2002). Calcineurin is a phosphatase heterodimer composed of 2
distinct subunits A and B. Calcineurin A contains the catalytic site of the enzyme while
calcineurin B contains the regulatory Ca2+ binding domain. Calcineurin activity is
regulated by Ca2+ -calmodulin binding. At low calcium concentration, calcineurin is
inactive while at high calcium concentrations it is active. Calcineurin physically interacts
with NF AT members. This interaction results in NF AT nuclear import as described
previously (section 1.1.5). In the nucleus, NFAT3 induces expression of fetal cardiac
genes via a mechanism involving its direct interaction with GATA-4 (Molkentin, Lu et al.
1998). This pathway is of high significance as calcineurin has shown to induce cardiac
hypertrophy in vivo and in vitro (Molkentin, Lu et al. 1998; Bueno, van Rooij et al.
2002). In this pathway (Fig.1.3) CRT regulates calcineurin activity by affecting Ca2+
release from the ER (Mesaeli, Nakamura et al. 1999).
CRT and calcineurin interaction is observed in another signaling pathway as weil.
CRT positively controls its own expression by acting upstream of calcineurin and
myocyte enhancer factor in the heart. Calcineurin activates expression of MEF2C the
same way as it does NFAT. MEF2C nuclear import follows with CRT gene upregulation
(Lynch, Chilibeck et al. 2006).
16
1.3.4 Calreticulin in cardiovascular pathology
Severa! animal models have been used to study CRT in cardiac pathology. Mice
overexpressing CRT have an increased amount of intracellularly stored calcium. CRT
overexpression interferes with development of pacemaker activity (Lynch, Chilibeck et
al. 2006). These animais develop bradycardia associated with sinus node dysfunction as
weil as cardiac black and death. Interestingly, this phenotype is very similar to that seen
in children suffering from complete heart black (Michalak, Lynch et al. 2002). CRT
deficiency is embryonic lethal in mice. The lethality results from lesions in cardiac
development (Lynch, Chilibeck et al. 2006). Mice lacking the CRT gene show a
significant decrease in ventricular wall thickness and deep intrabecular recesses in
ventricular wall thickness (Michalak, Guo et al. 2004). Surprisingly, this embryonic
lethality can be reversed by expression of cardiac-specific calcineurin. However, the mice
die postnatally due to other complications such as growth retardation (Michalak, Lynch et
al. 2002; Lynch, Chilibeck et al. 2006).
17
~ Ca2
•/
(éRT) Ca~-\,
Ca2•
ER/SR
Figure1.3-Calreticulin involvement in the Ca2+ /calcineurin/NFAT/GATA-4 pathway
Calreticulin regulates release of Ca2+ from the endoplasmic reticulum. Increased
intracellular Ca2+ binds to calmodulin (CaM) and activated calcineurin. Calcineurin
dephophorylates NFAT which translocates in the nucleus. NFAT interacts with GATA-4 and activates transcription of genes essential for cardiac development.
From Mesaeli, N., et al., Calreticulin is essentialfor cardiac development. 1 Cell Biol, 1999. 144(5): p. 857-68. Copyright 1999.
18
1.4 Rationale and Hypothesis
The 533 amino acid (a.a.) transcription factor early growth response gene-1
(Egr-1) contains transcriptional activation (a.a. 1-218), repressor (R1) (a.a. 281-314) and
sequence-specifie DNA binding domains (a.a. 332-419) (Thiel and Cibelli 2002). Egr-1 is
increased after receptor activation, hypoxia and mechanical stresses in many animal
models of heart disease (Bruneau, Piazza et al. 1996; Saadane, A1pert et al. 1999; Yan,
Mackman et al. 1999; Thiel and Ci belli 2002; Dostanic, Servant et al. 2004) and Egr-1
binding sites are present in such genes as ANF (atrial natriuretic factor), a-MHC (alpha
myosin heavy chain), B-MHC (beta myosin heavy chain), and skeletal actin. In a previous
report we showed that Egr-1 was a negative regulator of the sodium calcium exchanger-1
(NCX1) (Wang, Dostanic et al. 2005). Altered expression of these proteins is a hallmark
feature of rodent hypertrophy and their change in expression is thought to aid contraction.
Egr-1 -/- mice are viable and display no life threatening phenotypes (Lee, Tourtellotte et
al. 1995) suggesting that Egr-1 expression is not required for cardiomyocyte
development. However, deficient mice show a reduced ability to withstand stressful
conditions (Saadane, Alpert et al. 2000; Saadane, Yue et al. 2001; Heon, Bernier et al.
2003). The data are consistent with the idea that Egr-1 integrates stimulus: transcription
coupling in cardiac remodeling and, further, that the products of its target genes are
responsible for the compensatory physiological alterations necessary for continued heart
function.
The Egr-1-mediated decrease in NCX1 expression prompted us to examine other
proteins involved in maintaining calcium homeostasis. Calcium homeostasis and
signaling are vitally important to cardiac function because it is the cycle of calcium entry
19
and exit that controls contraction and relaxation (Lakatta, Maltsev et al. 2003). Calcium
entering cardiomyocytes by voltage-dependent L-type calcium channels triggers calcium
release from the sarcoendoplasmic reticulum (SER) via the ryanodine receptor 2 (RyR2)
to initiate contraction. Relaxation is established by the combined action of sodium
calcium exchanger-1 (NCX1) to remove calcium to the cell exterior and the
sarcoendoplasmic reticulum A TPase (SERCA2a) to re-seques ter calcium to the SER.
Calcium for release is stored in the SER principally by low-affinity high-capacity
calsequestrin (CSQ2) binding. When calcium is high in the SER, CSQ2 forms linear
polymers that have a high calcium binding capacity. When calcium is reduced, CSQ2
binds to RyR2 to reduce its ability to open. Thus, CSQ2 participates in calcium storage
and release (Lakatta, Maltsev et al. 2003).
In this report we show that Egr-1 negatively regulates the expression of CSQ2 in
vzvo and in vitro through a novel mechanism. We found caffeine-induced calcium
dynamics were absent in cells harboring a highly active Egr-1 mutant, 1293F (Fig.2.1).
The reduced calcium dynamics correlated with significantly reduced CSQ2 expression
and no change in calreticulin, SERCA2a or phospholamban expression. We conclude that
Egr-1 reduces CSQ2 expression and so impacts calcium dynamics.
20
CHAPTERII
MATERIALS AND METHODS
2.1 Materials and Antibodies
Immobilon P membrane was purchased from Millipore (Bedford, MA). Chelex
lOO molecular biology grade resin was purchased from Bio-Rad (CA). Protein A
Sepharose CL-4B was purchased from GE Healthcare (Sweden). SuperFect Reagent was
purchased from Qiagen (Mississauga, ON). Acrylamide/bis (37.5:1) 40%, TEMED and
ammonium persulfate (APS) were purchased from BioShop (ON, Ca). Yeast extract was
purchased from Difko laboratories (Detroit, Michigan). Bio-tryptone was purchased from
Bioshop. CASQ (PA1-319), CRT (PAl-903), and PLB (MA3-922) polyclonal antibodies
were purchased form Affinity BioReagents (Golden, CO). NFATc4 sc-13036, SERCA2
(N-19) sc-8096 and Egr-1 sc-189 antibody was purchased from Santa Cruz
Biotechnology (Santa Cruz, CA). NAB mouse monoclonal antibody was a gift from Dr
Judith Johnson (GE). GAPDH (RDI-TRK5G4-6C5) was purchased from Fitzgerald
(MA). Secondary antibodies and enhanced chemiluminescent detection kit (supersignal
westpico chmiluminescent substrate) were purchased from Pierce (Rockford, IL).
2.2 Cell culture
Rat embryonic heart H9c2 are adherent cells and were cultured in Dulbeco
Modified Eagles Medium (DMEM), Multicell, Wisent Laboratories supplemented with
10% fetal bovine serum (FBS Qualified) Invitrogen, and 5% Penicillin/Streptomycin
antibiotics (Sigma). Ali celllines were incubated at 37°C in an atmosphere of 95% air and
5% C02.
22
2.2.1 Preparation of H9c2 cells for transfection
The day before transfection cells were washed once with TD (50mM Tris pH 7,
150mM NaCl), trypsininized/EDTA (lnvitrogen) and then plated in 10 cm2 petri dishes
for transfection experiment the following day.
2.2.2 Differentiation of H9c2 cells
Differentiation of H9c2 cells to a cardiac lineage was established by treating cells
at ~ 80% confluency with reduced serum (1%) and 10-8M retinoic acid (RA) added daily
for 3 days. Protein lysates were prepared on the 3rd day when the cells are considered to
represent ventricular cardiomyocytes (Sucharov, Mariner et al. 2003).
2.2.3 Cell culture of transfected cells
H9c2 stahly transfected with plasmids containing cytomegalovirus immediate
early (CMV) promoter-driven wild type Egr-l(wtEgr-1), WT1-Egr-1 (Fig.1A) fusion
protein (WT-1 1-307 amino acid region linked to the 337-427 amino acid zinc finger
region of Egr-1) and CMV -driven 1293F Egr-1 (Fig.1B), harbouring a mutation in the Rl
region, were maintained in 400 !lglml G418 as described in (Wang, Dostanic et al. 2005).
2.3 Stable and transient transfection procedures
These procedures are used in arder to introduce plasmid DNA into mammalian
cells. For both procedures SuperFect Reagent was used. SuperFect transfection reagent is
a specifically designed activated dendrimer that assembles DNA into compact structures
facilitating its entry into the cell. The resulting SuperFect-DNA complexes possess a net
23
A
I293F
B
1 307 337 427
Figure 2.1-Modular structure of the Egr-1 mutants
(A). Structure of the highly active Egr-1 mutant harboring a mutation (1293F) in the R1 regmn.
Mod(fiedfrom Thiel, G. and G. Cibelli, Regulation of l(fe and death by the zincfinger transcriptionfactor Egr-1. J Cell Physiol, 2002.193(3): p. 287-92. Copyright 2002.
(B). Structure of the WT 1-Egr-1 fusion protein. Wilms tumor (WT -1) 1-307 amino ac id region is linked to the 337-427 arnino acid zinc fin ger region of Egr-1.
Modifiedfrom Madden, S. L., D. M. Cook, et al. (1991 ). "Transcriptional repression mediated by the WTJ Wilms tumor gene product." Science 253(5027): 1550-3.
24
positive charge which allows them to bind to negatively charged receptors present on the
surface of eukaryotic cell.
2.3.1 Stable transfection
Transfection was done m 10 cm2 petri dishes when cells reached about 80%
confluency. DNA (10 J.Lg) were diluted in 300 J.!l DMEM medium containing no serum,
proteins or antibiotics. SuperFect Reagent (60 J.Ll) was added to the DNA solution and the
samples were then incubated for 10 minutes at room temperature to allow transfection
complex formation. Media was removed from dishes by aspiration and cells were washed
once with TD. Medium (3ml) containing serum and antibiotics were added to the
transfection complex. The total volume was then added to the 10 cm2 petri dishes. Cells
were incubated with transfection complexes at 37°C and 5% C02 for 3 hours. Medium
containing complexes was then removed and cells were washed 3 times with TD. Fresh
cells growth medium containing serum and antibiotics was added to the cells which were
incubated for another 48 hours. Following this period cells were passaged 1: 10 into usual
growth medium containing 400 [.tg/ml G418 selection factor. Cells were maintained in
selective medium under normal growth conditions until colonies appeared.
DNA/SuperFect ratios and appropriate transfection conditions were established following
optimization guide1ines of SuperFect Transfection Reagent Handbook.
2.3.2 Transient transfection
Differentiated H9c2-1293F cells were transfected with CMV-driven cardiac CSQ
(pclneo-cardiac CSQ, gift from Dr. Gerhard Meissner, University of North Caro lina). The
transfection was done in 35mm petri dishes when cells reached about 80% confluency.
25
DNA (2 jlg) were diluted in 50Jll DMEM medium containing no serum, proteins or
antibiotics. SuperFect (12 Jll) Reagent was added to the DNA solution and the samples
were then incubated for 10 minutes at room temperature to allow transfection-complex
formation. Media was removed from dishes by aspiration and cells were washed once
with TD. Medium (400 Jll) containing serum and antibiotics were added to the
transfection complex. The total volume was then added to the 35mm petri dishes. Cells
were incubated with transfection complexes at 37°C and 5% C02 for 3 hours. Medium
containing complexes was then removed and cells were washed 3 times with TD. Fresh
cells growth medium containing 1% serum, retinoic acid and antibiotics was added to the
cells which were incubated for another 48 hours. Cells were assayed for expression of
cardiac CSQ gene.
2.3.3 Determination of the DNA concentration used for transfection
The concentration of DNA was determined spectrophotometrically by measuring
absorption of the samples at 260 nm. The quality of nucleic acids i.e. contamination with
salt and protein was checked by measuring the absorption at 280 nm.
2.4 Protein isolation
2.4.1 Prepartion of whole celllysate
Undifferentiated and differentiated cells were grown to confluency in 10 cm2
dishes. Media was aspirated from cultures and cells were washed once with TD. Cells
were lysed by adding 500 Ill of lxSDS lysis buffer (62.5mM Tris pH 6.8, 2% w/v SDS,
10% glycerol, 50mM DTT, 0.01% w/v bromophenol blue) directly onto the dish. The
26
cells were scraped off the plate with a spatula and the extract transferred to a
microcentrifuge tube. The samples were dispersed 10 times with a 26 Y2 gauge syringe to
shear genomic DNA and reduce sample viscosity while on ice. The desired amount of
sample to use was then heated for 5 minutes at 100 °C and cooled on ice.
2.4.2 Tissue Homogenisation
For heart samples the entire isolated ventricle was homogenized to completion in
1 ml of modified RIPA buffer (50mM Tris (pH7.4), 1% NP-40, 0.5% Na deoxycholate,
0.1% SDS, 150mM NaCl, complete protease inhibitors (Roche, Indianapolis IN), (lmM
Na vanadate, 1mM PMSF and 10mM Na metabisulfite). Homogenates were incubated on
ice for 2 hours then clarified by centifugation at 10,000 X g for 5 min at 4°C and used in
immunoblots without further manipulation.
2.5 Colorimetrie protein assays
2.5.1 Bio-Rad Protein Determination Assay
Total protein concentrations were determined usmg the Bio-Rad Protein
Determination Assay (BioRad, Hercules, CA) against a bovine serum albumin (BSA)
standard curve that serves as a reference to determine protein sample concentrations. Bio
Rad's protein assay is based on the color change of Coomassie Brilliant Blue G-250 dye
in response to various concentrations of protein. This procedure was followed to measure
total protein concentration obtained from tissue homogenisation.
The BSA samples and the protein samples were incubated with Bradford reagent
(1:5) (BioRad, Hercules, CA) and distilled water (dH20) (4:5) for 5 min at room
27
temperature. Optical density (OD) was read spectrophotometrically at 595 nm in
disposable cuvettes.
2.5.2 Sulforhodamine B (SRB) colorimetrie assay
The sulforhodamine B (SRB) assay is used for cell density determination, based
on the measurement of cellular protein content. At the end of the treatments, the media
was aspirated and cells were fixed to the plate of a 24 well plate with a solution
containing 10% trichloroacetic acid and 0.9% sodium chloride (NaCl) for 1 hour at 4°C.
Following incubation, fixing solution was removed and cells were washed 5 times with
distilled water to remove residual trichloroacetic acid. The plates were air dried. The
fixed cells were stained for 30 min with 0.4 % SRB dissolved in 1% acetic acid at room
temperature. SRB was then removed and wells were washed 5 times with 1% acetic acid
to wash off any unbound dye. The plates were air dried again. The bound SRB was eluted
in 2mls of 10 mM Tris base and the optical density was determined at that wavelength at
which the control cells result in an OD of about 1. That wavelength is usually situated
between 500-550 nm.
2.6 Immunoblot 1 Western Blot Analysis
Measurements of CSQ, CRT, SERCA2a, PLB, NFAT3, NAB and GAPDH
protein expression was performed by semiquantitative immunoblots using standard
methods. Protein (lOf-tl) from whole cell lysates was separated on sodium dodecyl
sulphate-po1yacrylamide gel (SDS-PAGE) by a one-dimensional electrophoresis method.
The samples were loaded in a stacking gel (4% acrylamide; 0.5M Tris-base, pH 6.8; 10%
28
SDS; 25% ammonium persulfate APS; Temed) and then migrated through a separating
gel (lü% acrylamide; 1.5M Tris-base, pH 8.8; 10%SDS; 25% APS; Temed) for
separation on the basis of the ir molecular size. Pro teins migrated at 1 OOV in lx running
buffer (25mM Tris-base; 192mM glycine; 0.1 %SDS) with a BioRad electrophoresis
apparatus. Following gel migration, the samples were electrophorically transferred to
Immobilon P membranes using transfer buffer (25mM Tris-base; 192mM glycine; 20%
methanol). Membranes were stained with Ponceau S (Sigma) to confirm equivalent
protein loading and transfer. Membranes were then blocked for 2 hours in 8% blocking
solution (20mM Tris pH 7.5; 150mM NaCl; 0.02% Tween 20; 3% skim milk powder) to
minimize the non-specifie protein-antibody interactions. Individual membranes were
placed in plastic bags and incubated with a specifie antibody diluted in blocking solution.
CSQ antibody was diluted 1:2500, SERCA2a and CRT 1:500, NFAT3 and PLB 1:200,
NAB 1:10 and GAPDH 1:10000 and incubated ovemight at 4°C. Following incubation,
the membranes were washed 3 times for 10 minutes in TBST (20mM Tris pH 7.5;
150mM NaCl; 0.02% Tween 20) and incubated for 2 hours at room temperature with an
appropriate horseradish-peroxidase-coupled secondary antibody, diluted 1:20000,
1:10000, 1:10000, 1:5000 and 1:40000, respectively in TBST+3% milk. The membranes
were then washed 3 times for lümin in TBST and treated with chemiluminescent
substrates according to the manufacturer' s instructions. Each series of immunoblots was
repeated at least three times from independent experiments.
29
2.7 Reciprocal co-immunoprecipitation and Western blots
Cardiac differentiated H9c2 cells were washed twice with TD (50mM Tris pH 7.4;
150mM NaCl) and 1ml/10cm2 dish of serum-free media containing 1% formaldehyde
added for 30 min. Media with formaldehyde was aspirated and cells were washed 3 times
with TD. Fixed cells were scraped by a spatula and collected in 1ml TD by brief
centrifugation (2500rpm/5min) and pellets lysed in 1ml SDS lysis buffer (1 %SDS, 10mM
EDTA, 50mM Tris pH 8.1). Cell lysate was diluted 10-fold with ChiP dilution buffer
(0.01% SDS, 1.1% Triton x-100, 1.2 mM EDTA, 16.7mM Tris pH 8.1, 167 mM NaCl).
Celllysate (lml) was then divided into 4 microcentrifuge tubes in which antibody (Egr-1
or NFAT3), or no antibody or normal serum control was added respectively. The samples
were then incubated at 4 oc for 6 hours on a rocking plate. Protein A was diluted in ChiP
dilution buffer to create 50% slurry, 50 !ll of which was added to each lysate and
incubated ovemight at 4 oc on a roc king plate. Prote in A Sepharose beads were washed
the next moming 5 times, 2x loading buffer added to them (62.5mM Tris-HCl pH 6.8;
10% glycerol; 2% SDS; 5% P-mercaptoethanol), boiled for 10 min and proteins collected
by centrifugation. The resulting IP lysate was subjected to standard western analysis as
described above.
2.8 In vitro chromatin immunoprecipitation (ChiP)
Cardiac differentiated H9c2 cells were washed twice with TD and fixed with
1ml/10cm2 dish of serum-free media containing 1% formaldehyde added for 30 min. The
formaldehyde was quenched with 125 mM glycine for 5 minutes at room temperature.
The cells were then scraped, collected by centrifugation (2500rpm for 5 min at 4 °C), then
30
washed twice with cold TD. Cells from one plate were lysed in lml IP buffer (150mM
NaCl; 50mM Tris-HCl pH 7.5; 5mM EDTA; l%v/v Triton x-100) supplemented with
protease inhibitors (1mM Na vanadate, 1mM PMSF and 10mM Na metabisulfite). The
nuclear pellet was collected by brief centrifugation (lmin) at high speed (13000rpm). To
shear the chromatin, the nuclear pellet was sonicated using 10 series of 30 second pulses
at a power output of 3. The supernatant was retained after centrifugation (13000rpm for
1 Omin at 4 °C). The IP reaction proceeded as above. Following washes of the Protein A
Sepharose pellet, 100 [!l of 10% (w/v) Chelex-100 was added and the Egr-l:DNA
formaldeh y de cross-linkages reversed by boiling for 10 min. The Ch el ex -100 preparation
was spun briefly (13000rpm for 1 min at 4 oc) and the DNA in the supernatant transferred
to a microcentrifuge tube. PCR was performed using DNA isolated prior to antibody
incubation (input DNA) or after immunoprecipitation (IP DNA). CSQ2 promoter-specific
primers sequences were as described in Table 2. Amplification used Taq DNA
polymerase and 36 cycles. Positive control reactions contained unmanipulated rat
genomic DNA, and negative controls contained ali reagents except DNA.
2.9 In vivo chromatin immunoprecipitation (ChiP)
Mouse hearts were rinsed free of blood and the atria removed. The ventricle was
chopped finely, placed in 4ml of DMEM containing 1% formaldehyde and placed on a
rocking plate for 30min at room temperature. The reaction was stopped by the addition of
0.6ml of lM glycine and further rocking for 15min. The pieces were collected by brief
spinning and then dounce homogenized with a loose pestle in buffer (lOmM Tris, pH8.0,
lOmM NaCl, 0.2% NP40 plus protease inhibitors as above). The pellet was collected by a
31
brief low speed spin and re-homogenized in the same buffer but with a tight pestle. The
nuclear pellet was collected by a low speed spin and resuspended in TE+ 1 %SDS.
Aliquots were then treated as described above for in vitro ChiP but primers specifie for
the mouse CSQ2 promoter were used (Table 1). The positive control reaction contained
unmanipulated mouse genomic DNA.
2.10 Polymerase Chain Reaction (PCR)
In the polymerase chain reaction (PCR), the DNA sequence lying between two
primers present at high concentration undergoes repeated doubling using thermal cycling
(alternatively heating and cooling the PCR sample following a specifie series of
temperature steps). To evaluate the amount of magnesium needed for the reaction, a
magnesium curve was performed. Subsequently, a master mix containing everything but
DNA was prepared. The mix was aliquoted into 0.6ml microcentrifuge tubes in equal
amounts. 1 f,tl DNA was added to each tube, followed by addition of 50 f.tl mineral oil to
prevent evaporation at high temperatures. Amplification of DNA was achieved using Taq
polymerase (homemade) and dNTPs (Fermentas). For the PCR, a programmable thermal
controller (MJ Research, Inc.) was used. A standard PCR program is for 36 cycles with
denaturation at 94 oc for 1 min, annealing at 55°C for 2 min, and extension at 72°C for 3
mm.
32
Table 1. mouseCSQ2 chromatin immunoprecipitation primer sequences
Region (bp) Forward primer Reverse primer bps -2107 to -1801 GCAAAGGACCCTGGCGTTAAGG TGCCAAGCCTGCAAGATTCCTC 306 -1634 to -1357 GAGCTTTCATGGCAGCAGAGGG TGCGCTGTGTGGCTTCTTGTTC 277 -1141 to-558 GGCAGAGTGGAGATTGCAGCTC CATTGTGTTGGTCGGTTCCAGG 583 -373to-100 CGCTGCATGGACAAATCCCTC GCTTTCACCTCCTTGGTGGTGC 273
Table 2. ratCSQ2 chromatin immunoprecipitation primer sequences
Region (bp) Forward primer Reverse primer bps -1864 to -1488 GCAGGCTTGGCAAGGACTATTG CGGTTCTCAATCAGCAGCTCCC 376 -1497 to -1269 TTGAGAACCGCACAGCCCAGAG TCACTGGAGTGGGCAGGACTTG 228 -1295 to -1070 TAACCCAAGTCCTGCCCACTCC AGCGCAGGCCAGAGTTGTGATC 225 -854 to -547 GGTGGAGAGAGGATGTTGGCAG TCTCTCCCTGGCTGCACTGTTC 307 -479 to -130 CCGTGTTCTTATTGGCACCGAC ATGCGCACAGAGCAAGAGCCAG 349 -145 to +72 CTTGCTCTGTGCGCATGTGTGC CCCACCACGAGCAGGTAAATCC 217
33
2.11 Bacterial Transformation
This procedure was followed in order to insert the pclneo-cardiac CSQ plasmid
into bacteria and amplify it. For this protocol the bacterial strain E.coli DH5a was used.
These chemically competent bacterial cells are generated by a physical cell wall
modification that facilitates DNA uptake. Plasmid DNA 5~--tl (1 :20 dilution) was added
directly into a 50[!1 aliquot of competent cells and mixed by gentle tapping. 5~--tl of
pUC 19 control DNA was added into 100 ~--tl competent cells and mixed as above. The two
vials were incubated on ice for 30 minutes. The vials were then heat-shocked for 45
seconds in a 37°C water bath. The vials were then placed on ice for 2 minutes and 200 [!l
of pre-warmed SOB medium were added to each vial. The vials were then placed in a
37°C shaking incubator for 1 hour at 225rpm. Two different volumes (50~--tl and 200~--tl)
from each transformation vial were plated on LB agar plates (bio-tryptone 10g/L; yeast
extract 5g/L; NaCl lOg/L; agar 15g/L). The plates were inverted and incubated at 37°C
overnight.
2.12 Small-scale (miniprep) preparation ofplasmid DNA
The following day, a single clone was inoculated in 5 ml LB medium (bio
tryptone lOg/L; yeast extract 5g/L; NaCl lOg/L) with appropriate antibiotic (ampicillin
100~--tg/ml) as a pre-culture overnight in 3]CC shaker. The bacterial culture was then
centrifuged at 13000rpm for 1 min. The pellet was resuspended in 500 [!l of Solution!
(50mM glucose; 25mM Tris pH 8.0; EDTA 10mM) and incubated at room temperature
for 5 minutes. Cells were then lysed by adding 1 ml of Solution2 (0.2N NaOH; 1% SDS)
and incubated on ice for 5 min. The lysed culture was precipitated by adding 750 ~--tl of
34
Solution3 (3M KOAc; 2M HOAc) and further incubated on ice for 5 mm. The
precipitated solution was centrifuged at 13000rpm for 5 minutes. The supernantant was
subjected to phenol/chloroform extraction. To precipitate the DNA, phenol-chloroform
extraction (1: 1 ratio) was performed twice followed by a single chloroform extraction.
Finally, the DNA was precipitated with 0.6 volumes of isopropanol, mixed thoroughly
and centrifuged at 13000rpm for 5 min. The DNA pellet was subsequently washed with
500 Ill of 70% cold ethanol, air-dried and dissolved in 100 Jll of TE.
2.13 Nucleic acid electrophoresis
2.13.1 Agarose gel electrophoresis of DNA
Agarose (lg) was added in 100 ml of lx TBE (Tris, Borate, EDTA) buffer and
boiled on a heating plate to dissolve the agarose. The agarose solution was cooled to
about 60°C before and poured into a horizontal gel chamber. The lx TBE buffer was used
also as electrophoresis running buffer in the gel chamber. The DNA samples were mixed
with 5x loading buffer and then loaded into the wells of the gel. The electrophoresis was
carried out at a steady voltage of 100 V. The size of the DNA fragments on agarose gels
was determined by extrapolating the size from a DNA size marker which was also loaded
along with the samples in a separate lane of the gel. After electrophoresis, the DNA in the
gel was stained in a plate containing water and ethydium bromide and photographed
using a UV gel documentation system.
35
2.13.2 Acrylamide gel electrophoresis of DNA
To examine the PCR products resulting from the ChiP procedure, which are
present in small amounts, an acrylamide gel (7.5% acrylamide; dH20; lx TBE; 25%
APS; Temed) specifie for DNA electrophoresis was used. This allows a sharper
visualization of the bands. To separate the nucleic acids, the same concept as with the
agarose gel is followed. The lx TBE buffer was used also as electrophoresis running
buffer in the gel chamber. From this point on, the PCR samples and gel were manipulated
as mentioned above for the agarose gel.
2.14 Fluorescence measurement of cytosolic free Ca2+ concentration
[Ca2+]i of ventricular myocytes was monitored by Naomi Kemeny (Dr. Komorova
laboratory) using microspectrofluorimetry (Komarova, Pereverzev et al. 2005). Cells
grown on 35 mm MatTek glass bottom dishes were loaded with 1.5 DM fura-2-AM
(Molecular Probes) for 40 min at room temperature in loading medium (DMEM
supplemented with 10% FBS and 10 mM HEPES). Fura-2 is a ratiometric dye. lts
excitation/emission spectrum changes depending on the free Ca2+ concentration. The Ca2
+
concentration is measured as the ratio between two fluorescence intensity values that are
taken at two different wavelengths(Rudolf, Mongillo et al. 2003).
In the end of the loading period, the media was replaced with physiological buffer
(130mM NaCl, 5mM KCl, lOmM glucose, lmM MgCh, lmM CaCh, 20mM HEPES, pH
7.4) and the dishes were mounted onto the stage of an inverted phase-contrast microscope
(Nikon, T -2000). The measurements were performed at room temperature. Changes in
fluorescent emission at 510 nm, following altemate excitation at 340 and 380 nm
36
(managed by high-speed wavelength-switching deviee, Lambda DG-4; Quorum
Technologies) were recorded using a cooled CCD camera (Hamamatsu), collected and
analyzed using image analysis software (Volocity, Improvision). Caffeine (0.5 mM), ATP
(0.1 mM) and were administered by bath application.
2.15 Densitometry and statistical analyses
X-ray films were scanned using an HP Scanjet 5100 C and HP Precision Scan
Softward (Hewlett-Packard, Palo Alto CA). The areas under the peaks were quantified
using Scionlmage Release Beta 3 Software (National Institutes of Health, Bethesday,
MD). Test protein expression was standardized to the signal from GAPDH measured on
the same blot. Values are expressed as the mean plus or minus the standard deviation.
Comparisons were made using the student's t-test. A p-value of <0.5 was considered
significant.
37
CHAPTERIII
RESULTS
3.1 Cell growth is not significant during the differentiation process
The isolation of Egr-1 overexpressing H9c2 cells was described previously
(Wang, Dostanic et al. 2005). Stable cells lines of H9c2 cells overexpressing the 533
amino acid (a.a.) wild type (wt)Egr-1, an I293F point mutation that ablates binding to the
Egr-1 repressor NAB (Swirnoff, Apel et al. 1998), or WT1-Egr-1, a fusion protein in
which the 1-307 a. a. of the Wilm's tumor protein was linked to the 337 -439a.a. of Egr-1
(Madden, Cook et al. 1991) were created. All cell lin es isolated overexpress Egr-1 to
approximately the same level. In order of transactivation activity, I293F >> wtEgr-1 >
WT 1-Egr-1, when assessed on known Egr-1-responsive genes. In order to examine
expression of the proteins involved in calcium homeostasis, the different cell lines
described above were differentiated to cardiomyocytes.
The differentiation process is necessary so that the cells mature and exhibit
enhanced cardiac Ca2+ channel expression while maintaining a cardiac phenotype
(Menard, Pupier et al. 1999). Meanwhile, myogenic transdifferentiation is inhibited
(Menard, Pupier et al. 1999). In order to evaluate the cell growth rate during this period,
cells were fixed and stained with sulforhodamine B dye at the end of each day in 24-well
dished in triplicates (Figure 3.1). Colorimetrie measurements of the bound dye provide an
estimate of the total protein mass that is related to cell number. The assay yielded similar
and not significant cell growth during differentiation.
39
• H9c2 • Egr-1
l293F )( WTEgr-1
5 -E 4 s:::: ....... cv 3 0 s:::: m 2 ..c .... 0 UJ 1 ..c
<( 0
1 2 3 4 5 Time(Days)
Figure 3.1-Cells do not grow significantly during the differentiation process
Graphical representation of SRB assay results.Cells were plated and cultured in differentiation media. Cells were fixed, dried and exposed to sulforhodamine B. Bound dye was eluted and absorbance measured. Cell growth is similar in ali celllines.
40
3.2 Egr-1 transactivation reduces CSQ expression
Our previous data found wtEgr-1 reduced sodium calcium exchanger-1
expression. To examine if proteins involved in SER calcium homeostasis were also
altered by Egr-1 we performed immunoblots to measure expression of calreticulin (CRT),
SERCA2a, phospholamban and p 16-phospholamban as well as calsequestrin (CSQ). To
determine if the expression was affected by cardiac differentiation we analysed cells
cultured in the absence or presence of differentiating media (Fig. 3.2). SERCA2a,
phospholamban and p 16-phospholamban were expressed to similar levels in all cells and
were significantly (p<0.05) increased with differentiation similarly in all cell lines (data
not shown). We conclude that Egr-1 does regulate their expression. CRT expression was
significantly (p<0.05) increased in cardiac differentiated compared with non
differentiated cells in all cell lines regardless of Egr-1 expression. A trend towards lower
leve1s in cardiac differentiated I293F and WT1-Egr-1 expressing cells compared with
cardiac differentiated H9c2 or wtEgr-1 overexpressing cells did not reach significance.
CSQ expression was increased significantly (p<0.05) with differentiation in all cell lines.
However, baseline CSQ expression was reduced in wtEgr-1 and greatly reduced in I293F
cells. Differentiation increased CSQ expression in the I293F cells, but this level of CSQ
expression did not approach the CSQ levels detected as the basal leve1 of expression in
the other cells lines. Thus, CSQ expression was downregulated in the I293F cell line
where Egr-1 transactivation is highest.
41
A
55k0a
55 kDa
43 kOa
B
.. .. .. E .. .5
3
~ 2 IL
H9c'
"' <!?.#'
+
CRT
5
= 4 " E .. .5 ~ 3 IL
2
1 +
I293F +
CSQ
CRT
CSQ
GAPDH
E - undrfferentiated
Ill + differentiate-d
Figure 3.2-CRT and CSQ expression in Egr-1 overexpressing H9c2 cells
(A).Western blot analysis of CRT and CSQ expression in undifferentiated versus differentiated cells. Protein from all celllines was separated on a SDS-PAGE, transferred to Immobilon P and stained with Ponceau C to confirm equal protein loading and transfer. Blots were incubated with antisera to CRT, CSQ or GAPDH as indicated on the right, showing migration of the 55 kDa CRT, 55kDa CSQ and 38kDa GAPDH. GAPDH confirmed relative! y equalloading of protein in each lane. (B). Bar graphs were produced to illustrate fold differences between undifferentiated and differentiated cells for CRT and CSQ protein. CRT and CSQ values from ail celllines were normalized to that of GAPDH and then compared to that of undifferentiated H9c2 expressed as 1. The mean, standard errors and significant p values (less than 0.05) are indicated on the graph. Calculations were based on three experiments.
42
3.3 Egr-1/NAB protein protein binding is not involved in CSQ regulation
The Egr family repressor protein, NAB2, binds to Egr-1 between a.a. 218-314 to
reduce Egr-1 transactivation. Egr-1 increases NAB2 expression. To determine if
differences in NAB2 expression could account for the variation in CASQ expression we
measured NAB2 levels in non-differentiated and cardiac differentiated cells (Fig.3.3).
Basal NAB expression was similar in ali cell lines. NAB expression increased
significantly (p<0.05) but to similar levels with differentiation in ali celllines. The 1293F
point mutation ablates NAB2 binding and the WT1-Egr-1 fusion protein bas the NAB
binding region of Egr-1 removed. Thus, Egr-1-mediated CSQ repression is independent
of NAB binding ability and independent of NAB expression levels.
3.4 Egr-1 protein binds to the CSQ2 promoter
To determine how Egr-1 regulates CSQ2 repression at the promoter, we
performed chromatin immunoprecipitation using anti-Egr-1 antibodies to collect Egr-
1 :DNA complexes from adult mouse wild type heart. We bad previously established that
the Egr-1 antibody recognized formaldehyde fixed and sonicated Egr-1:DNA complex.
We found CSQ2 promoter DNA was amplified in heart samples incubated with anti-Egr-
1 antibody. Four different sets of primers (Table 1) were used to examine Egr-1
localization to selected regions of the -2142 mCSQ2 promoter. Amplification was
detected only when using region 2-specific (R2) primers designed to amplify the -1637 to
-1389 region (Fig. 3.4), and DNA was not amplified when either more upstream, -2089 to
-1783, or downstream, -1001 to -540, or -355 to -82, primers sets were used. This
suggests that Egr-1 binds specifically to sites within or around -1801 to -1001 of the
CSQ2 promoter.
43
A
7:2 lilla
B
œ U'J Ill œ ... u
3
c:: 2 '0 0 1.1..
1
0
-
--:::::=- __o;oÎ ----;;:-
--=- = ~ ~ ~ ~ ~~ ~
-_ - ~
12:S:>F 1Nf1-Eg:r-1
NAB
GAP DB
lill - undifferentiated
11111 + clifferentiatecl
Figure 3.3-NAB expression as a function of differentiation in Egr-1 overexpressing cells. (A). Protein from all cell lines was separated on a SDS-PAGE, transferred to Immobilon P and stained with Ponceau C to confirm equal protein loading and transfer. Blats was incubated with anti-NAB antibody and anti-GAPDH antibody as indicated with the arrow on the right, showing migration of the 67kDa NAB and 38kDa GAPDH. GAPDH confirmed relatively equalloading of protein in each lane. (B). A bar graph was produced to illustrated fold difference between undifferentiated and differentiated cells for the NAB protein. NAB values from ali cells lines were normalized to those of corresponding GAPDH and then compared to that of undifferentiated H9c2 expressed as 1. The mean and standard errors are indicated on the graph. Calculations were based on three experiments.
44
Figure 3.4-Egr-1 binding to mouse CSQ2 promoter DNA
Chromatin Immunoprecipitation using anti-Egr-1 antibodies. (A). Schematic diagram illustrating regions of the promoter of the 5.2KB CSQ2 protein selected for amplification with specificaliy designed primers. (B). Cardiac H9c2 celis were differentiated and chromatin fixed. Chromatin from fixed H9c2 cells was previously sonicated and equal portions of DNA were incubated with no-antibody (-C) and 5f!l of anti-Egr-1 antibody. The DNA associated with Egr-1 was isolated and purified. Purified DNA, 5fll, was then amplified using CSQ2 promoter-specific primers representing ali 4 regions. Input represents DNA prior to antibody incubation. Input was purified and resuspended in TE. Negative controls included ali reagents except DNA. DNA markers are included on the left. The arrow points to the amplified CSQ2 DNA region. (C). Detailed representation of the CSQ2 promo ter R2 region. The characters in bold indicated ali possible NFA T sites within that region.
45
A
\:)~ ~' ~ï>.. ;':\ 14 h'b
,..., ~~ 'Î~ ;..~ b- f\....., ~'' ~,- r '\:. 'V ~ ~- ~·
-2160 ,v ' ,. ' '
RI R2 R3 R4
B
c TTC.A.TG!;CAG CAGAGGGCCT CllliGTCAGAC AGGACACTGG GATTAGCTTT TCCTTCTGGC CCCTGGGAAA GGTGCTGGTG GGATTTCTAG CACMAGAAG ATAAACCTTG GCCAGGCTCC CAAGCACCAC T}\TCTCCTCT GAAGAGCACG CAGACAGAAC CATCATCTGA CCl\GAAGAAA GTACCAAAGA GTCACCCGAG GGGTACTGGC AGGGGJ'I.TCTG CTGAACAliGA .AGCCACACAG
46
To determine if the same region was important in the rat, chromatin
immunoprecipitation was performed using the H9c2 cells and rat-specifie CSQ2 primers.
Six sets of primers (Table 2) were used to amplify homologous regions to the mouse
sequence in the -2031 rCSQ2 promoter DNA. Amplification was detected only with
primers amplifying the -1488 to -1295 region. Thus, Egr-1 binds to sites centered around
the rat -1488 to -1295 CSQ2 promoter region. This region is homologous to the
mou se region between about -1250 to -1000. Altogether these results suggest Egr-1
binding to the CSQ2 promoter at between -1650 and -1000 of the mouse genome.
3.5 Egr-1/NF AT3 interaction and CSQ2 regulation
Transfac analysis of the mCSQ2 and rCSQ2 promoters revealed the potential for
NFA T binding sites in the amplified region, but no consensus Egr-1 sites. Egr-1 was
shawn to dimerize with NFAT1 (Decker, Nehmann et al. 2003). We chose to study
NFAT3 as it is the most abundant NFAT family member found in heart (Bueno, van
Rooij et al. 2002). To examine for the possibility for Egr-1/NFA T3 interactions, we
performed reciprocal immunoprecipitation and Western blot assays using anti-Egr-1 and
anti-NFAT3 antibodies in differentiated H9c2, wtEgr-1, 1293F and WT1-Egr-1
overexpressing cells. We established that Egr-1 from ali the cell lines dimerized with
NFAT3 (Fig. 3.6). The WT1-Egr-1 fusion protein contains only amino acids 337-439 of
Egr-1 suggesting that NF AT3 binds to this domain.
To determine if Egr-1-mediated transcription 1s influenced by NFA T
trans activation we examined NF A T3 levels and the effect of cyclosporin A on CSQ
expression. Basal NFAT3 expression was similar and increased almost similarly with
47
differentiation in ali celllines (Fig. 3.5). Based on these results, we concluded that CSQ2
expression is independent of NFA T3 expression. NFA T localization to the nucleus for
transcription regulation depends on its dephosphorylation by calcineurin (phosphatase B).
We added 10uM cyclosporin A, an inhibitor of calcineurin (Molkentin, Lu et al. 1998), to
the cell culture media 48 hours prior to cell harvest and measured CSQ2 expression.
Cyclosporin A had no effect in H9c2 cells but reduced CSQ expression in Egr-1 and
1293F cells (Fig. 3.7). Although NFAT3 levels do not change with Egr-1 expression the
decrease in CSQ expression with cyclosporin A treatment of both Egr-1 and 1293F
overexpressing cells argues that a reduction in nuclear NFAT increases CSQ repression.
This suggests that whereas Egr-1 represses CSQ expression NFAT increases CSQ
expressiOn.
48
A
130kDa --
B
43kDa --
Q.l Il)
RI
l! u c "C 0
2
LI.. 1
0
NFAT3
GAPDH
til - undîffe rentiàted
Ill + different iaied
HSc2 Egr-1
Figure 3.5-NFAT involvement in CSQ regulation
(A). Protein from ali celi lines was separated on a SDS-PAGE, transferred to lmmobilon P and stained with Ponceau C to confirm equal protein loading and transfer. Blots were incubated with anti-NFAT3 antibody and anti-GAPDH antibody as indicated on the right, showing migration of the 150kDa NFAT3 and 38kDa GAPDH. GAPDH confirmed relatively equal loading of protein in each lane. A bar graph was produced to illustrated fold difference between undifferentiated and differentiated cells for the NF AT3 protein. NFAT3 values from ali celis lines were normalized to those of corresponding GAPDH and then compared to that of undifferentiated H9c2 expressed as 1. Standard errors are indicated on the graph. Calculations were based on three experiments.
49
IP: 95k:Da 72k:Da-
170kDa= l30kDa.··
95k:Da-
150kDa
H9c2 Egr '-'
I293F \VTI-Egr-1
Figure 3.6-Evaluating NFAT/Egr-1 interactions
\ft.lestern: . +- Egr-1
+-NFAT3
Western: - Egr-1
- NFAT3
Cardiac H9c2, Egr-1, 1293F and WT1-Egr-1 cells were differentiated and then fixed. Protein homogenates were then incubated with no-antibody, 5!!1 of anti-Egr-1 or 5!!1 of anti-NFAT3 antibody, the Egr-1/ antibody and NFAT3/ antibody complex collected by protein A- Sepharose and solubilised. Equal aliquots were electrophoresed though SDSPAGE and immunoblotted with anti Egr-1 and anti-NFAT3 sera as indicated on the right.
50
A
55 kDa --
43 kDa ___ _
B
u
1.6
1.4
1.2
"' .. "' f Hl
"' .5 l! û.fl 0 Il.
0.6
04
{).2
0.0
H9c2 +
Egr-1 +
\VTl-Egr-1 I293F
+ +
El - Cyclosporin
Ill + Cydosporin
CSQ
GAPDH
Figure 3.7-CSQ2 expression decreases with cyclosporin treatment
(A). Protein from all cell lines was separated on a SDS-PAGE, transferred to Immobilon P and stained with Ponceau C to confirm equal protein loading and transfer. Blots were incubated with anti-CSQ2 antibody and anti-GAPDH antibody as indicated with the arrow on the right, showing migration of the 55kDa CSQ2 and 38kDa GAPDH. GAPDH confirmed relative! y equalloading of protein in each lane. (B). A bar graph was produced to illustrated fold difference between undifferentiated and differentiated cells for the CSQ2 protein. CSQ2 values from all cells lines were normalized to those of corresponding GAPDH and then compared to that of undifferentiated H9c2 expressed as 1. Standard errors are indicated on the graph. Calculations were based on three experiments.
51
3.6 Microspectrofluorometry of control and Egr-1 overexpressing H9c2 cells
We performed microspectrofluorimetry to determine if Egr-1 transactivation
affected [Ca2+]i in vitro. Cardiac differentiated H9c2 cells as weil as cells overexpressing
wtEgr-1, 1293F and WT 1-Egr-1, were loaded with fura-2 and basal levels of calcium as
weil as changes in [Ca2+]i following bath application of caffeine (0.5 mM) or A TP (0.1
mM) were measured. Typical caffeine-induced [Ca2+]i changes are illustrated in the
micrographs (ER vs SER) of H9c2 cells following bath addition of caffeine at Os (Fig.
3.8). [Ca2+]i levels are indicated by pseudocolors with blue representing low levels of
[Ca2+]i and red representing high levels of [Ca2+]ï. Similar basal levels of [Ca2+]i were
observed in ali cell types (Fig. 3.8B). Almost half ( 44 ± 19%) of the H9c2 cells responded
to caffeine application with increases in [Ca2+L, which peaked and then declined slowly,
even in the continued presence of caffeine (Fig. 3.8A). No response was observed when
H9c2 cells were stimulated with vehicle. Caffeine did not elicit [Ca2+]i elevation in any of
the cells overexpressing Egr-1 or its mutants (Fig. 3.8C). Moreover, [Ca2+]i often
decreased in these cells following caffeine application.
To determine if the defects in calcium dynamics observed in cells overexpressing
wtEgr-1, 1293F and WTl-Egr-1, were restricted to the SER, we stimulated cardiac
differentiated H9c2 and 1293F overexpressing cells with ATP, which induces calcium
release from IP3 stores (Janowski, Cleemann et al. 2006) (Fig. 3.9). H9c2 cells responded
to ATP application with transient elevation of [Ca2+]i, which exhibited a slightly different
profile compared to the caffeine-induced [Ca2+]; elevations (Figure 3-9A). Similar to
control H9c2 cells, cells overexpressing 1293F also responded to A TP with transient
elevation of [Ca2+]i, although the amplitude of the responses was noticeably
52
Figure 3.8-Effect of Egr-1 modifications of the [ Ca2+]; dynamics.
Cells were loaded with fura-2, bathed in a physiological buffer and [Ca2+]i was monitored using fluorescence microscopy. (A) Micrographs demonstrate changes in [Ca2+]; with time following bath addition of 0.5 mM of caffeine at Os. Levels of [Ca2+]i are reflected by pseudocolor with blue representing low levels of and red-high levels of [Ca2+]i. Arrow indicates 2 cells responding to caffeine application with transient elevation of [Ca2+]i . Calibration bar applies to all images. (B) Modification of Egr-1 did not affect basallevels of [Ca2+]; . Data are means SD of basal [Ca2+]i measured in 8-12 different cells for each cell type from 3 independent experiments. (C) Caffeine induced a transient increase in [Ca2+]i in control H9c2 cells, but not in mutants with modified Egr-1. lllustrated are representative traces for 3 different cells for each cell type. Black bar indicates application of caffeine. Time scale applies for ali traces. 22-25 cells were tested in each of 3 independent experiments, 20-70% of control H9c2 cells responded to caffeine with transient elevation of [Ca2+]; .
53
A B 0.8
0 H9c2 Eg:r1 wt.Egr1 1293F
C 1.6 H9c2
0.4 '
-0
;.~ o ... al• tt {!y. 0.4
C) -t293F
54
A 2.0 H9c2 2.0 ....--, ,........, 0 0
:;:::1 1.5 :;:::1 1.5 œ œ - -~ 50s +'"'"""' + N 1.0 N 1.0 m (tl
fd. ü ..........
0.5 0.5
Caffeine ATP
B B 1.5 1293F 1.5 1293F .......... -0 0
:;:::; :;:::; ro ro ~ ..... - -,.....:.::; 1.0 50s ,....;.::; 1.0
+ + N N
(tl ttl ü ü ..._. .......
0.5 0.5
Caffeine ATP
Figure 3.9-1293F cells respond to ATP, but not caffeine with transient elevation of [Ca2+]i
Cells were loaded with fura-2, bathed in a physiological buffer and [Ca2+]i was monitored using fluorescence microscopy. (A) Representative traces of changes in [Ca2+]i in 7 of 25 H9c2 cells stimulated with caffeine (0.5mM, left) or ATP (O.lmM, right), indicated by the black bars below the traces. (B) Representative traces of changes in [Ca2+1ï in 7 of 25 1293F cells stimulated with caffeine (0.5mM, left) or ATP (O.lmM, right), indicated by the black bars below the traces. Time scale applies for all traces.
55
reduced. These results suggest that 1293F transactivation affects the SER calcium stores,
but not ER calcium stores.
3.7 CSQ2 rescue of 1293F calcium dynamics
CSQ2 expression was reduced in 1293F expressing cells and caffeine-induced
[Ca2+]i was also reduced. To determine if exogenously added CSQ could restore [Ca2+]i
dynamics we transfected differentiated 1293F cardiac cells with a CMV -driven CSQ2
expression plasmid (pclneo-\CSQ2). Microspectrofluorimetry was performed on the cells
48 hours following transfection. We found no change in [Ca2+]i dynamics in
untransfected or transfected cells, (data not shown). To examine transfection efficiency,
we used western blot analyses on the transfected cell lysates. We found increased CSQ
expression in the transfected versus non-transfected 1293F cells (Fig. 3.10). We conclude
that the addition of CSQ alone to 1293F overexpressing cells is insufficient to rescue
[Ca2+]i dynamics.
56
55kDa -
43kDa _
H9c2 I293F
+ CSQ Transfection
CSQ
GAPDH
Figure 3.10-CSQ expression increases in 1293F cells following transfection.
1293F cells were transfected with 2~g of pclneo-CSQ2 plasmid DNA for 48 hours before being harvested. Western analysis of the cell homogenates was performed. Protein from H9c2 (control) and 1293F (control and transfected) was separated on a SDS-PAGE, transferred to Immobilon P and stained with Ponceau C to confirm equal protein loading and transfer. Blots was incubated with anti-CSQ antibody and anti-GAPDH antibody showing migration of the 55kDa CSQ and 38kDa GAPDH. GAPDH confirmed relatively equalloading of protein in each lane.
57
A
1 NAB N-t~a,a~~llln'<: .!~t;M;: ;;;~•1\'!llîr,l:.;;m• ::::~111:«.181<
Zn fïugers
218 314 332 419
B
Egr-1 c
I293F c
R2
R2
NFAT3
x N
y
N
533 t-C
CSQ2 expressed
CSQ2 repressed
Figure 3.11-Proposed mechanism of CSQ2 expression regulation.
(A) Illustration of Egr-1 structure and binding sites for NAB and NFAT. (B) Schematic representation of CSQ expression regulation in Egr-1 and 1293F cells respectively. Following NF AT binding, an unknown prote in X binds to the promo ter promoting expression of CSQ. Following NFAT binding, an unknown protein Y binds to the CSQ promoter repressing CSQ expression.
58
CHAPTERIV
DISCUSSION
4. DISCUSSION
Maintaining CSQ2 expression is critically important for normal cardiac function
and may be particularly so with stress. In humans, mutations in CSQ2 resulting in either
truncated or missense CSQ2 protein are associated with catecholaminergic polymorphie
ventricular tachycardia, sudden cardiac death (Leenhardt, Lucet et al. 1995; Labat, Eldar
et al. 2001; Postma, Denjoy et al. 2002; Priori, Napolitano et al. 2002), and familial
hypertrophie cardiomyopathy (Chiu, Tebo et al. 2007). Deliberate CSQ2 deletion in mice
resulted in viable mice but the cardiac SR was increased in volume and the mice
developed arrhythmias (Knollmann, Chopra et al. 2006). A modest reduction (25%) in
CSQ2 expression in heterozygous deficient mice also had increased susceptibility to
ventricular arrhythmia (Chopra, Kannankeril et al. 2007). Thus, minor decreases in CSQ
expression have profound consequences with stress.
4.1 Cyclosporin A reduces CSQ2 expression
Our results using cardiac differentiated H9c2 cells show that CSQ expression is
reduced when Egr-1 transactivation is highest and that this leads to abnormal calcium
dynamics. The basal level of calcium was similar in all cell lines indicating adequate
calcium pre-stimulation. Expression of CRT is calcium dependent (Lynch, Chilibeck et
al. 2006). CRT expression was similar in all cells supporting the idea that there was no
difference in calcium content. Calcineurin, also known as phosphatase 2B, is calcium
calmodulin stimulated serine/threonine phosphatase. Cyclosporin A reduces calcineurin
activity and was shown to significantly reduce CSQ2 expression in I293F cells. We
60
conclude that calcineurin is involved in CSQ2 upregulation probably by interfering with
NF A T3 nuclear import.
4.2 Altered calcium dynamics in 1293F mutants
Replacement of the endogenous CSQ2 gene with mutations present in patients
caused compensatory increased CRT and RyR2 proteins, preserving viability and heart
function at rest (Song, Alcalai et al. 2007). The striking decrease in CSQ2 expression in
1293F expressing cells was not accompanied by increased expression of other SR proteins
such as CRT, SERCA2a or phospholarnban. Our results more closely resemble those of
Knollmann et al. who found no difference in CRT expression with CSQ2 genotype in a
different CSQ2 deficient mouse model (Knollmann, Chopra et al. 2006). Despite the
maintenance of control levels of CRT, functional calcium analyses indicated a defect in
SR function in vivo with stress when CSQ was reduced. In this regard, the in vivo and in
vitro data consistently show that when CSQ is reduced calcium dynamics are also
reduced. It is important to note that only the Ca2+ signalling pathway involving the RyR2
is affected. Calcium dynamics were normal when A TP was used as the stimulating agent.
ATP activates the IP3 receptors while caffeine activates the RyR2 receptors (Janowski,
Cleemann et al. 2006; Knollmann, Chopra et al. 2006). Thus, the reduction in calcium
dynamics is pathway-specific.
61
4.3 Other proteins are involved in CASQ2 repression in 1293F cells
We extended this analysis and show that SR rather than ER calcium dynamics are
reduced when CSQ2 is reduced and CRT is maintained even when basal calcium levels
are unaffected. The reduction in calcium dynamics may not solely be due to reduced
CSQ expression. Our attempts to rescue calcium function by replacing the CSQ protein
by transfection of CMV-CSQ into the 1293F cells were unsuccessful. We conclude that
other proteins or modifications of proteins may also be reduced or inactive in the 1293F
cells. In support of this idea, a decrease in CASQ expression was accompanied by a
decrease in triadin expression (data not shown).
4.4 Novel mechanism of CSQ2 repression in 1293F mutants
The mechanism of 1293F reduction of CSQ expression is novel. Previously, we
showed that 1293F and WTl-Egr-1 overexpressing cells had greatly increased NCX1
expression compared to a reduction when wtEgr-1 was ovexpressed (Wang, Dostanic et
al. 2005). This is consistent with a NAB-mediated repression of wtEgr-1 transactivation
establishing a negative feedback loop (Kumbrink, Gerlinger et al. 2005). The NAB
induced inhibition of NCX1 expression in wtEgr-1 overexpressing cells was relieved in
I293F by the point mutation and in WT1-Egr-1 cells because the NAB-binding site was
replaced by the WT1 protein domain. This model is not consistent with our results. In
contrast, the I293F ex pressing cells had grea tl y reduced CSQ2 expression and the WT 1-
Egr-1 cells had control levels of expression and stimulation with differentiation. There
was not a global defect in SR protein expression as other proteins in the SR, such as
SERCA2a, phospholamban and pSer16-phospholamban were unaffected. In other studies,
62
we found no difference in the growth rate or protein synthesis between the parental or
Egr-1 expressing cells arguing that 1293F cells grow similarly when compared with the
other cells. The similar increases in CRT, SERCA2a and phospholamban in ali the celis
after incubation with the differentiating media suggest that ali the celis responded equaliy
to the differentiating stimulation.
4.5 Egr-1-DNA/protein-protein interactions could be absent
A recent study identified sites within the first 180 bp of the human CSQ2
promoter containing an MEF-2, E-box and CArG box as sufficient and necessary for
cardiac expression and earmarked MEF-2 and SRF transcription factors as necessary for
cardiac specifie expression (Reyes-Juarez, Juarez-Rubi et al. 2007). Upstream regions of
the mouse CSQ2 gene contain muscle-specifie and non-muscle-specifie motifs (Frank,
Mesnard-Rouiller et al. 2001). Our chromatin immunoprecipitation data suggest that Egr-
1 binds within or around -1654 to -1000 of the mCASQ2 promoter and -1488 to -1295
rCASQ2 promoter region. Transfac analyses did not identify a consensus Egr-1 binding
site within this region but did identify NFAT sites.
NF AT is known to form dimers with neighbouring transcription factors on
promoter DNA (Tsytsykova, Tsitsikov et al. 1996) and recent data indicate that Egr-1 and
NFAT cooperate in gene activation (Alfonso-Jaume, Mahimkar et al. 2004; Schabbauer,
Schweighofer et al. 2007). A model of our mechanism for CSQ regulation is
schematically displayed in Figure 11. Our data are consistent with the idea that Egr-1
binds to NFAT at or near the Egr-1 DNA binding site through a.a. 337-439. This is the
sole Egr-1 region consistenly present in all 3 Egr-1 proteins we examined. At present we
63
cannat determine if both Egr-1 and NFAT3 or only one of the partners bind to DNA. If
Egr-1 does bind to DNA it could be at SPl sites. Egr-1 is known to bind to overlapping
SPl sites. Multiple SPI sites were not detected in the -1650 and -1000 bp region although
one was detected upstream between -1920 to -1846 bps. We hypothesize that Egr-1
binding to this upstream site is unlikely because we could not detect any amplification of
this region in the ChiP analyses using the more upstream primers. We suspect either that
Egr-1 does not bind DNA but rather complexes with NFAT-bound DNA or that Egr-1
binds to a non-consensus sequence.
4.6 Egr-l:NFAT3 binding is not repressive
We propose that Egr-1 and NFAT complexes together and binds neighbouring
sites on the CSQ2 promoter DNA (Fig. 3-11). wtEgr-1 and 1293F proteins bind to DNA
egually and we identified Egr-l:NFAT dimers in both wtEgr-1 and 1293F overexpressing
cells so our model shows both wtEgr-l:NFAT and 1293F:NFAT bound to DNA. We do
not know if NFAT binds DNA. Egr-l:NFAT3 binding is unlikely to be repressive
because WTl-Egr-1 protein binds NFAT3 and yet CSQ expression is maintained. These
results are consistent with the idea that a repressor protein binds particularly to Egr-1. The
single known difference between wtEgr-1 and 1283F is the inability of 1293F protein to
bind NAB proteins. Thus, our model proposes that a repressor protein binds to the 1-307
region of Egr-1 common in Egr-1 and 1293F but missing in WTl-Egr-1. Moreover, we
propose that in the absence of any NAB binding such as is the case with the I293F
mutation that 1293F:repressor binding is increased and repression is enhanced. The
reduction in CSQ expression with wild type Egr-1 expression also suggests that wtEgr-
64
1 :repressor protein binding must occur perhaps in Egr-1 proteins that are not bound by
NAB.
4.7 Cell-specific repression
Repressors, other than NAB1 and NAB2, have been show to bind to the 5'-region
of Egr family members. Egr-2, an Egr family member primarily expressed in neuronal
tissue and cells, when dimerized with Ddx20/DP103 reduced transcription from selected
promoters (Gillian and Svaren 2004). Egr-1 was also shawn to dimerize with
Ddx20/DP103, however, because Ddx20 expression is highest only in testes and neurons
(Ou, Mouillet et al. 2001) this mechanism is unlikely to be involved in the heart. In any
case, Egr-1-mediated activation and repression were shawn to be cell specifie. Egr-1
overexpression increased heparinase expression in prostate cells but reduced heparinase
expression in melanoma cells (de Mestre, Rao et al. 2005). Egr-1-mediated NAB2
induction in melanoma was higher and involved additional and more upstream NAB2
promoter regions than in colon carcinoma cells (Reyes-Juarez, Juarez-Rubi et al. 2007).
This suggests that interactions with cell specifie proteins determine the outcome, either
activation or repression, and can dictate the location of Egr-1 binding on the affected
promoter. It also suggests that mechanisms of regulation in non-cardiac cells may not be
pertinent to heart.
65
SUMMARY AND CONCLUSION
Heart failure is the major leading cause of death in the majority of the developing
countries in the world. The underlying cause of cardiac disorder is abnormal handling of
intracellular calcium. To maintain a low intracellular calcium concentration, many
transport and storage mechanism have been developed during evolution. Calsequestrin is
the major calcium storing protein in SR of muscle cells. Mutations in this protein are
associated with severe cardiac arrhythmias.
We observed that I293F cells, a mutant derived from the H9c2 cell line, which
overexpresses the Egr-1 transcription factor but lacks a NAB2 binding domain, expresses
unusually low levels of the CSQ2 protein. However, the other sarco-endoplasmic
reticulum proteins such as calreticulin and phospholamban were not affected. In addition,
NFAT3:Egr-l interaction is present in all cell lines under examination. Moreover, NAB
expression was similar in all cell lines suggesting that Egr-l:NAB activation is not
involved in CSQ2 repression. Microspectrofluorometry studies indicate that calcium
dynamics involving activation of RyR2 receptors were reduced in the I293F cellline.
Based on these observations, we conclude that the reduction of CSQ2 expression
of I293F follows a novel mechanism that might involve interaction with a novel
repression protein involved in CSQ/RyR sarcoplasmic reticulum calcium control.
Unveiling the details of such a mechanism will represent a promising therapeutic tool in
the field of cardiovascular physiology.
66
FUTURE PERSPECTIVES
In the future, we would like to examine the role of triadin in the regulation of
CSQ2 expression in H9c2 cells. Triadin is a protein associated to CSQ2 in the SR calcium
release complex. Recent studies indicate that triadin participates in regulation of cellular
Ca2+ cycling and contractility as stable expression of triadin was associated with cardiac
hypertrophy (Kirchhefer, Klimas et al. 2007).This might prove particularly challenging as
there are no good commercially available triadin antibodies that function in rat cardiac
cells.
In addition, we would like to compare expression of CSQ2 between the currently
established wtEgr-1 cells and wtEgr-1 cells expressing antisense Egr-1 transcription
factor. We expect to see an increase in CSQ2 expression in antisense clones.
The above project will allows us to better understand calsequestrin function in the
mammalian heart and lead to the development of therapeutic solutions.
67
REFERENCES
Alfonso-Jaume, M. A., R. Mahimkar, et al. (2004). "Co-operative interactions between NFAT (nuclear factor of activated T cells) cl and the zinc finger transcription factors Spl/Sp3 and Egr-1 regulate MTl-MMP (membrane type 1 matrix metalloproteinase) transcription by glomerular mesangial cells." Biochem J 380(Pt 3): 735-47.
Beard, N. A., D. R. Laver, et al. (2004). "Calsequestrin and the calcium release channel of skeletal and cardiac muscle." Prog Biophys Mol Biol85(1): 33-69.
Bers, D. M., S. M. Pogwizd, et al. (2002). "Upregulated Na/Ca exchange is involved in bath contractile dysfunction and arrhythmogenesis in heart failure." Basic Res Cardial 97 Suppl1: 136-42.
Bootman, M. D., T. J. Collins, et al. (2001). "Calcium signalling--an overview." Sernin Cell Dev Biol12(1): 3-10.
Bruneau, B. G., L. A. Piazza, et al. (1996). "Alpha 1-adrenergic stimulation of isolated rat atria results in discoordinate increases in natriuretic peptide secretion and gene expression and enhances Egr-1 and c-Myc expression." Endocrinology 137(1): 137-43.
Bueno, O. F., E. van Rooij, et al. (2002). "Calcineurin and hypertrophie heart disease: novel insights and remaining questions." Cardiovasc Res 53(4): 806-21.
Case, R. M., D. Eisner, et al. (2007). "Evolution of calcium homeostasis: from birth of the first cell to an omnipresent signalling system." Cell Calcium 42(4-5): 345-50.
Chiu, C., M. Tebo, et al. (2007). "Genetic screening of calcium regulation genes in familial hypertrophie cardiomyopathy." J Mol Cell Cardiol43(3): 337-43.
Chopra, N., P. J. Kannankeril, et al. (2007). "Modest reductions of cardiac calsequestrin increase sarcoplasmic reticulum Ca2+ leak independent of luminal Ca2+ and trigger ventricular arrhythmias in mice." Circ Res 101(6): 617-26.
de Belle, 1., D. Mercola, et al. (2000). "Method for cloning in vivo targets of the Egr-1 transcription factor." Biotechniques 29(1 ): 162-9.
de Mestre, A. M., S. Rao, et al. (2005). "Early growth response gene 1 (EGRl) regulates heparanase gene transcription in tumor cells." J Biol Chem 280(42): 35136-47.
Decker, E. L., N. Nehmann, et al. (2003). "Early growth response proteins (EGR) and nuclear factors of activated T cells (NFA T) form heterodimers and regulate proinflammatory cytokine gene expression." Nucleic Acids Res 31(3): 911-21.
Dibb, K. M., H. K. Graham, et al. (2007). "Analysis of cellular calcium fluxes in cardiac muscle to understand calcium homeostasis in the heart." Cell Calcium 42(4-5): 503-12.
Dostanic, S., N. Servant, et al. (2004). "Chronic beta-adrenoreceptor stimulation in vivo decreased Bcl-2 and increased Bax expression but did not activate apoptotic pathways in mouse heart." Can J Physiol Pharmacol82(3): 167-74.
Dullum, M. K. (2008). "Confusion in revascularization: are women different and why?" Cardial Rev 16(1): 30-5.
Frank, K. F., L. Mesnard-Rouiller, et al. (2001). "Structure and expression of the mouse cardiac calsequestrin gene." Basic Res Cardial 96(6): 636-44.
68
Gillian, A. L. and J. Svaren (2004). "The Ddx20/DP103 dead box protein represses transcriptional activation by Egr2/Krox-20." J Biol Chem 279(10): 9056-63.
Gyorke, S., B. M. Hagen, et al. (2007). "Chain-reaction Ca(2+) signaling in the heart." .J. Clin lnvest 117(7): 1758-62.
Gyorke, S. and D. Terentyev (2007). "Modulation of ryanodine receptor by luminal calcium and accessory proteins in health and cardiac disease." Cardiovasc Res.
Heon, S., M. Bernier, et al. (2003). "Dexrazoxane does not protect against doxorubicininduced damage in young rats." Am J Physiol Heart Circ Physiol 285(2): H499-506.
Houston, P., C. J. Campbell, et al. (2001). "The transcriptional corepressor NAB2 blocks Egr-1-mediated growth factor activation and angiogenesis." Biochem Biophys Res Commun 283(2): 480-6.
Imanaka-Yoshida, K., A. Amitani, et al. (1996). "Alterations of expression and distribution of the Ca(2+ )-storing pro teins in endo/sarcoplasmic reticulum during differentiation of rat cardiomyocytes." J Mol Cell Cardiol 28(3): 553-62.
Janowski, E., L. Cleemann, et al. (2006). "Diversity of Ca2+ signaling in developing cardiac cells." Ann N Y Acad Sei 1080: 154-64.
Kageyama, K., Y. lhara, et al. (2002). "Overexpression of calreticulin modulates protein kinase BI Akt signaling to promo te apoptosis during cardiac differentiation of cardiomyoblast H9c2 cells." J Biol Chem 277(22): 19255-64.
Khachigian, L. M. (2006). "Early growth response-1 in cardiovascular pathobiology." Circ Res 98(2): 186-91.
Kirchhefer, U., J. Klimas, et al. (2007). "Triadin is a critical determinant of cellular Ca cycling and contractility in the heart." Am J Physiol Heart Circ Physiol 293(5): H3165-74.
Knollmann, B. C., N. Chopra, et al. (2006). "Casq2 deletion causes sarcoplasmic reticulum volume increase, premature Ca2+ release, and catecholaminergic polymorphie ventricular tachycardia." J Clin Invest 116(9): 2510-20.
Komarova, S. V., A. Pereverzev, et al. (2005). "Convergent signaling by acidosis and receptor activator of NF-kappaB ligand (RANKL) on the calcium/calcineurin/NFAT pathway in osteoclasts." Proc Natl Acad Sei U S A 102(7): 2643-8.
Kumbrink, J., M. Gerlinger, et al. (2005). "Egr-1 induces the expression of its corepressor nab2 by activation of the nab2 promoter thereby establishing a negative feedback loop." J Biol Chem 280(52): 42785-93.
Lahat, H., M. Eldar, et al. (2001). "Autosomal recessive catecholamine- or exerciseinduced polymorphie ventricular tachycardia: clinical features and assignment of the disease gene to chromosome lpl3-21." Circulation 103(23): 2822-7.
Lakatta, E. G., V. A. Maltsev, et al. (2003). "Cyclic variation of intracellular calcium: a critical factor for cardiac pacemaker cell dominance." Circ Res 92(3): e45-50.
Lee, S. L., L. C. Tourtellotte, et al. (1995). "Growth and differentiation proceeds normally in cells deficient in the immediate early gene NGFI-A." J Biol Chem 270(17): 9971-7.
Leenhardt, A., V. Lucet, et al. (1995). "Catecholaminergic polymorphie ventricular tachycardia in children. A 7-year follow-up of 21 patients." Circulation 91(5): 1512-9.
69
Liu, N. and S. G. Priori (2007). "Disruption of calcium homeostasis and arrhythmogenesis induced by mutations in the cardiac ryanodine receptor and calsequestrin." Cardiovasc Res.
Lucerna, M., D. Mechtcheriakova, et al. (2003). "NAB2, a corepressor of EGR-1, inhibits vascular endothelial growth factor-mediated gene induction and angiogenic responses of endothelial cells." J Biol Chem 278(13): 11433-40.
Lynch, J. M., K. Chilibeck, et al. (2006). "Assembling pieces of the cardiac puzzle; calreticulin and calcium-dependent pathways in cardiac development, health, and disease." Trends Cardiovasc Med 16(3): 65-9.
Madden, S. L., D. M. Cook, et al. (1991). "Transcriptional repression mediated by the WT1 Wilms tumor gene product." Science 253(5027): 1550-3.
Matheny, C., M. L. Day, et al. (1994). "The nuclear localization signal of NGFI-A is located within the zinc finger DNA binding domain." J Biol Chem 269(11): 8176-81.
Menard, C., S. Pupier, et al. (1999). Modulation of L-type calcium channel expression during retinoic acid-induced differentiation of H9C2 cardiac cells. J Biol Chem. 274: 29063-70.
Mesaeli, N., K. Nakamura, et al. (1999). "Calreticulin is essential for cardiac development." J Cell Biol144(5): 857-68.
Miano, J. M. and B. C. Berk (1999). "NAB2: a transcriptional brak:e for activated gene expression in the vessel wall?" Am J Pathol155(4): 1009-12.
Michalak, M., L. Guo, et al. (2004). "Calreticulin in the heart." Mol Cell Biochem 263(1-2): 137-42.
Michalak, M., J. Lynch, et al. (2002). "Calreticulin in cardiac development and pathology." BiochimBiophys Acta 1600(1-2): 32-7.
Molkentin, J. D., J. R. Lu, et al. (1998). "A calcineurin-dependent transcriptional pathway for cardiac hypertrophy." Cell93(2): 215-28.
Ou, Q., J. F. Mouillet, et al. (2001). "The DEAD box protein DP103 is a regulator of steroidogenic factor-1." Mol Endocrinol15(1 ): 69-79.
Periasamy, M., P. Bhupathy, et al. (2007). "Regulation of sarcoplasmic reticulum Ca2+ ATPase pump expression and its relevance to cardiac muscle physiology and pathology." Cardiovasc Res.
Postma, A. V., 1. Denjoy, et al. (2002). "Absence of calsequestrin 2 causes severe forms of catecholarninergic polymorphie ventricular tachycardia." Circ Res 91(8): e21-6.
Priori, S. G., C. Napolitano, et al. (2002). "Clinical and molecular characterization of patients with catecholaminergic polymorphie ventricular tachycardia." Circulation 106(1): 69-74.
Reyes-Juarez, J. L., R. Juarez-Rubi, et al. (2007). "Transcriptional analysis of the human cardiac calsequestrin gene in cardiac and skeletal myocytes." J Biol Chem 282(49): 35554-63.
Rudolf, R., M. Mongillo, et al. (2003). Looking forward to seeing calcium. Nat Rev Mol Cell Biol. 4: 579-86.
Saadane, N., L. Alpert, et al. (1999). "Expression of immediate early genes, GATA-4, and Nkx-2.5 in adrenergic-induced cardiac hypertrophy and during regression in adult mice." Br J Pharmacol127(5): 1165-76.
70
Saadane, N., L. Alpert, et al. (2000). "Altered molecular response to adrenoreceptorinduced cardiac hypertrophy in Egr-1-deficient mi ce." Am J Physiol He art Circ Physiol 278(3): H796-805.
Saadane, N., P. Yue, et al. (2001). "Diminished molecular response to doxorubicin and loss of cardioprotective effect of dexrazoxane in Egr-1 deficient female mice." Can J Physiol Pharmacol 79(6): 533-44.
Schabbauer, G., B. Schweighofer, et al. (2007). "Nuclear factor of activated T cells and early growth response-1 cooperate to mediate tissue factor gene induction by vascular endothelial growth factor in endothelial cells." Thromb Haemost 97(6): 988-97.
Smith, G. (2007). "Matters of the heart: the physiology of cardiac function and failure." Exp Physiol 92(6): 973-86.
Song, L., R. Alcalai, et al. (2007). "Calsequestrin 2 (CASQ2) mutations increase expression of calreticulin and ryanodine receptors, causing catecholaminergic polymorphie ventricular tachycardia." J Clin Invest 117(7): 1814-23.
Srinivasan, R., G. M. Mager, et al. (2006). "NAB2 represses transcription by interacting with the CHD4 subunit of the nucleosome remodeling and deacetylase (NuRD) complex." J Biol Chem 281(22): 15129-37.
Sucharov, C. C., P. Mariner, et al. (2003). "Yin Yang 1 is increased in human heart failure and represses the activity of the human alpha-myosin heavy chain promoter." J Biol Chem 278(33): 31233-9.
Swirnoff, A. H., E. D. Apel, et al. (1998). "Nabl, a corepressor of NGFI-A (Egr-1), contains an active transcriptional repression domain." Mol Cell Biol 18(1): 512-24.
Thiel, G. and G. Cibelli (2002). "Regulation of life and death by the zinc finger transcription factor Egr-1." J Cell Physiol193(3): 287-92.
Tsytsykova, A. V., E. N. Tsitsikov, et al. (1996). "The CD40L promoter contains nuclear factor of activated T cells-binding motifs which require AP-l binding for activation of transcription." J Biol Chem 271(7): 3763-70.
van Rooij, E., P. A. Doevendans, et al. (2002). "Requirement of nuclear factor of activated T-cells in calcineurin-mediated cardiomyocyte hypertrophy." J Biol Chem 277(50): 48617-26.
Wang, C., S. Dostanic, et al. (2005). "Egr-1 negatively regulates expression of the sodium-calcium exchanger-1 in cardiomyocytes in vitro and in vivo." Cardiovasc Res 65(1): 187-94.
Yan, S. F., N. Mackman, et al. (1999). "Hypoxia/Hypoxemia-Induced activation of the procoagulant pathways and the pathogenesis of ischemia-associated thrombosis." Arterioscler Thromb Vase Bioll9(9): 2029-35.
Yu, J., V. Baron, et al. (2007). "A network of p73, p53 and Egrl is required for efficient apoptosis in tumor cells." Cell Death Differ 14(3): 436-46.
71