e. coli fluorescing red using cold temperature sensor prm + i12007. b0032 team: e cool i tina khoury...
DESCRIPTION
How to do it? Part 1 BBa_I12007 82Bp Promoter: modified lambda Prm Promoter (OR-3 obliterated) 2010 Kit Plate 2 Box 5 Well 11L, pSB2K3 gcaaccattatcaccgccagaggtaaaatagtcaacacgcacggtgttagata tttataaatagtggtgatagatttaacgtTRANSCRIPT
E. Coli Fluorescing Red Using Cold
Temperature Sensor
Prm +I12007
.B0032
Team: E Cool ITina Khoury
Jeremy GerbigKerwin DunhamDerek Blanchard
Goals Achieve
E. coli to fluoresce red at low temp (37°C) in presence of Cl or Cl (ts).
Find optimum temp where color change will be found. ~ 30-37°C
Find optimum concentration of Cl. Gene originally from coral.
Backup Plan Use high temp parts to make E. coli fluoresce at
high temp instead at low using a different gene. Expressing high (green) and low (red) temp.
genes in one sequence.
How to do it?
Part 1 BBa_I12007
82Bp Promoter: modified lambda Prm Promoter (OR-3 obliterated) 2010 Kit Plate 2 Box 5 Well 11L, pSB2K3
gcaaccattatcaccgccagaggtaaaatagtcaacacgcacggtgttagatatttataaatagtggtgatagatttaacgt
Part 2 & 3 Super Part BBa_I13503 Spring 2008 Distribution Source Plate 1002 1D pSB1A2 BBa_B0032
13Bp Ribosome Binding Site RSB.3 (medium)- derivative of BBa_0030 2010 Kit Plate 1 Well 2I, pSB1A2
tcacacaggaaag
Part 2 & 3 Super Part BBa_I13503 Spring 2008 Distribution Source Plate 1002 1D pSB1A2 3 BBa_E1010
681Bp Gene: highly engineered mutant of red fluorescent protein
from Discosoma striata (coral) 2010 Kit Plate 1 Well 18F, pSB2K3
atggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataa
Part 4 & 5 Super Part BBa_B0015 BBa_B0010 doubleT
129 Bp Stop, T1 from E. coli rrn B (Transcriptional Terminator) 2010 Kit Plate 1 Well 13D, pSB1A2
BBa_B0012 Stop, TE from coliophage T7 (Transcriptional Terminator) Source Plate 1000 Well 1B, pSB1A2
ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata
What’s new? The complete complex Biobricks
sequence that works! Combine 3 parts
BBa_I12007 - Promoter BBa_I13503 - RBS + Gene BBa_B0015 - Double Terminator
Promoter RBS + Gene Double Terminator
Protocol Isolate biobricks out of wells.
BBa_I12007 - Promoter BBa_I13503 - RBS + Gene BBa_B0015 - Double Terminator
Transform the bacteria.
Grow the transformed bacteria.
Isolate & check plasmids. Gel Electrophoresis
Protocol cont… Combining biobrick parts by digestion & ligation.
BBa_I12007 - Promoter BBa_I13503 - RBS + Gene BBa_B0015 - Double Terminator
S X & P X & P
Protocol cont…. Transform bacteria with new recombinant plasmid.
Observe results Color change dependent on
Temp between ~ 30-37°C Cl concentration ~ 1x – 10x
References Openwetware.org Partsregistry.org http://filebox.vt.edu/.../biol_4684/Methods/
genes.html http://www.fasebj.org/content/vol20/issue14/
images/large/z386120661480003.jpeg http://www.ncbi.nlm.nih.gov/bookshelf/br.fcgi?
book=mga&part=A1549 http://www.stat.berkeley.edu/users/terry/
Classes/s260.1998/Week8b/week8b/node3.html