dynamics of bcl-2 family of proteins in early ... phd...dynamics of bcl-2 family of proteins in...

This document is downloaded from DR‑NTU (https://dr.ntu.edu.sg)Nanyang Technological University, Singapore.

Dynamics of BCL‑2 family of proteins in earlypancreatic progenitors and β‑cells

Loo, Larry Sai Weng

2020

https://hdl.handle.net/10356/142359

https://doi.org/10.32657/10356/142359

This work is licensed under a Creative Commons Attribution‑NonCommercial 4.0International License (CC BY‑NC 4.0).

Downloaded on 22 Mar 2021 15:04:22 SGT

DYNAMICS OF BCL-2 FAMILY OF PROTEINS

IN EARLY PANCREATIC PROGENITORS

AND β-CELLS

LARRY LOO SAI WENG

SCHOOL OF BIOLOGICAL SCIENCES

2019

DYNAMICS OF BCL-2 FAMILY OF PROTEINS

IN EARLY PANCREATIC PROGENITORS

AND β-CELLS

LARRY LOO SAI WENG

SCHOOL OF BIOLOGICAL SCIENCES

A thesis submitted to the Nanyang Technological University in partial

fulfilment of the requirement for the degree of Doctor of Philosophy

2019

i

STATEMENT OF ORIGINALITY

I hereby certify that the work embodied in this thesis is the result of original research

done by me except where otherwise stated in this thesis. The thesis work has not been

submitted for a degree or professional qualification to any other university or

institution. I declare that this thesis is written by myself and is free of plagiarism and

of sufficient grammatical clarity to be examined. I confirm that the investigations were

conducted in accord with the ethics policies and integrity standards of Nanyang

Technological University and that the research data are presented honestly and without

prejudice.

21st Aug 2019

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

Date Larry Loo Sai Weng

ii

SUPERVISOR DECLARATION STATEMENT

I have reviewed the content and presentation style of this thesis and declare it of

sufficient grammatical clarity to be examined. To the best of my knowledge, the thesis

is free of plagiarism and the research and writing are those of the candidate’s except as

acknowledged in the Author Attribution Statement. I confirm that the investigations

were conducted in accord with the ethics policies and integrity standards of Nanyang

Technological University and that the research data are presented honestly and without

prejudice.

.

21st Aug 2019

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

Date Adrian Kee Keong Teo, Ph.D.

iii

AUTHORSHIP ATTRIBUTION STATEMENT

This thesis contains material from 1 paper published in the following peer-reviewed

review paper in which I am listed as first author.

Figure 1 is published as Loo et al., An arduous journey from human pluripotent stem

cells to functional pancreatic β-cells. Diabetes Obes Metab. 2018 Jan;20(1):3-13

The contributions of the co-authors are as follows:

L. S. W. L., H. H. L., J. B. J. and C. S. L. wrote and edited the manuscript. A. K. K. T.

conceptualized the contents, and wrote, edited and approved the manuscript.

Figure 2 is published as Giménez-Cassina A et al., Regulation of mitochondrial

nutrient and energy metabolism by BCL-2 family proteins. Trends Endocrinol

Metab. 2015 Apr;26(4):165-75.

Figure 4 is published as Ronit Sionov et al., Regulation of Bim in health and disease.

Oncotarget. 2015 Sep; 6(27): 23058–23134.

21st Aug 2019

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

Date Larry Loo Sai Weng

https://www.ncbi.nlm.nih.gov/pubmed/28474496

https://www.ncbi.nlm.nih.gov/pubmed/?term=Gim%C3%A9nez-Cassina%20A%5BAuthor%5D&cauthor=true&cauthor_uid=25748272



iv

ACKNOWLEDGEMENTS

The herculean effort expended in the completion of this thesis is not mine alone. I

would like to thank the many people behind this.

To Dr Adrian Teo, thank you for the wonderful opportunity to be one of the pioneer

members in your laboratory in IMCB. You are an excellent mentor with an undying

enthusiasm for science. You have given me much freedom for this project but despite

this, you were always there whenever I needed assistance in terms of experimental

troubleshooting and writing. I am very honoured to be the first PhD student to

graduate from AT Lab and I definitely look forward to the many generations of PhD

students successfully graduating from AT lab in the years to come. I firmly believe

that the Stem Cell and Diabetes Laboratory will be one of the leading laboratories

focusing on diabetes research in Singapore.

To Dr Xavier Roca, thank you for the time and effort in co-supervising me. I owe it to

you for the constant discussion on this project.

To Dr Su I-Hsin and Dr Yusuf Ali, thank you both for taking the time out to

participate in my qualifying exam and being part of my thesis advisory committee.

You have been most helpful in advising me during the entire PhD journey.

To Dr Shawn Hoon, Dr Choi Hyun Won, Dr Vidhya and Soumita, thank you all for

performing the RNA-Seq and bioinformatics analysis data presented in Figure 12A,

12B, 13A, 13B, 16A, 19A.

To members of the AT Lab, Hwee Hui/Shirley/Chek Mei for the logistics support.

Thanks to Alvin for performing the FACS experiments presented in Figure 14A. Also,

v

thanks to Natasha and Linh for critical evaluation of the manuscript. Also, thanks to

the rest of the lab members, Shabrina, Blaise and the numerous FYP students for

sharing their experiences and troubleshooting skills that made this thesis possible. And

finally, thanks to Joanita, Chang Siang and Hwee Hui for the effort to publish the

review paper (Loo et al., 2017).

To A*STAR Graduate Academy, thank you for awarding me the prestigious A*STAR

Graduate Scholarship which made it possible for me to pursue a PhD at A*STAR

Institute of Molecular and Cell Biology. I am very grateful for this. I look forward to

contributing to A*STAR in future.

To May Chong of Nanyang Technological University, School of Biological Sciences,

thank you for the amazing administrative support which you have given to the

graduate students.

vi

TABLE OF CONTENTS

Content page

Statement of Originality i

Supervisor Declaration Statement ii

Authorship Attribution Statement iii

Acknowledgements iv

Table of contents vi

Summary xiii

List of figures xvi

List of tables xx

List of abbreviations xxi

1 Introduction 1

1.1 Recapitulating pancreatic β-cells differentiation using human pluripotent

stem cells 1

1.1.1 Different hPSC lines used in pancreatic differentiation protocols 6

1.1.2 Variability between current protocols used to generate pancreatic

β-like cells 9

1.2 BCL-2 family 11

1.2.1 BCL-2 family proteins 11

1.2.2 Direct activation model 13

1.2.3 Displacement model 13

1.2.4 Embedded together model 14

1.2.5 Unified model 14

1.3 BCL-xL 16

vii

1.4 BIM (BCL2L11) 17

1.5 Role of splicing in BCL-2 family proteins 19

1.6 Role of members of the BCL-2 family in pancreatic development 21

1.7 Role of BCL-2 family in other cell lineages 24

1.8 The unfolded protein response and apoptotic pathways in mediating

pancreatic β-cell failure in diabetes 26

1.9 Hypothesis 30

1.10 Specific aims 30

2. Materials and Methods 32

2.1 Materials 32

2.1.1 Cell lines 32

2.1.2 Antibodies 32

2.1.3 Chemicals, peptides, media, reagents, assays and buffers 34

2.1.4 Softwares, instruments and algorithms 37

2.2 Mammalian cell cultures and differentiation 36

2.2.1 Mouse embryonic fibroblasts 38

2.2.2 hPSC and iAGb 38

2.2.3 17 Day differentiation protocol 38

2.2.4 35 Day differentiation protocol 39

2.2.5 HEK293FT cell culture 39

2.2.6 MIN6 cell culture 40

2.2.7 Human islets 40

2.3 Molecular biology techniques 40

2.3.1 RNA extraction and RT-PCR 40

2.3.2 Real-time Quantitative PCR (RT-QPCR) 41

viii

2.3.3 Protein BCA assay 42

2.3.4 SDS-PAGE and Western blot 42

2.3.5 Immunostaining 43

2.3.6 Fluorescence-activated cell sorting (FACS) 44

2.3.7 Subcloning of plasmids 45

2.3.8 Transfection/ Overexpression rescue studies 45

2.4 ER stressors, cytokines and inhibitor assays 46

2.4.1 ER stressors and cytokines 46

2.4.2 Chemical inhibitor 46

2.5 Lentiviral-mediated knockdown using shRNAs 46

2.6 Lentiviral-mediated overexpression of BIM isoforms 47

2.7 Seahorse metabolic flux assay 48

2.8 RNA-Seq and differential expression analysis 48

2.9 Quantification and statistical analysis 49

2.10 Data and software availability 49

3 Results 58

3.1 Differentiation of human pluripotent stem cells into pancreatic cells as a

model of human pancreatic development in vitro 58

3.1.1 Morphology and transcriptional profile of pancreatic genes during

17D differentiation 58

3.2 Decrease in apoptosis from D5 to D7 during 17D differentiation 61

3.3 Changes in BCL-2 family of transcripts during 17D differentiation 61

3.3.1 Transcriptional profile of BCL-2 family of genes during 17D8

differentiation 61

3.3.2 Protein profile of BCL-2 family of genes during 17D differentiation 63

ix

3.4 BCL-xL protects against apoptosis of pancreatic progenitor 66

3.4.1 Inhibition of BCL-xL at D7 using WEHI-539 decreases BCL-xL

expression and induces apoptosis in pancreatic progenitors 66

3.5 High-throughput RNA-Seq analysis identifies other possibles roles

of BCL-xL 70

3.5.1 Inhibition of BCL-xL decreases pancreatic progenitor transcripts 71

3.5.2 Inhibition of BCL-xL decreases pancreatic progenitor protein

expression 74

3.5.3 Overexpression of BCL-xL does not rescue the BCL-xL-inhibited

phenotype in pancreatic progenitors 76

3.6 Metabolic genes were perturbed in pancreatic progenitors upon BCL-xL

inhibition 77

3.6.1 Inhibition of BCL-xL using WEHI-539 on D7 decreases glycolytic

capacity and glycolytic reserve in pancreatic progenitors 78

3.6.2 Inhibition of BCL-xL using WEHI-539 on D7 decreases oxidative

phosphorylation in pancreatic progenitors 80

3.7 Role of Wnt and Secreted Frizzled Receptor Proteins (SFRPs) in pancreatic

lineage specification 83

3.7.1 Heatmap of Wnt and SFRPs showing differential gene expression after

BCL-xL inhibition 83

3.7.2 SFRP5 transcript expression is decreased upon WEHI-539

treatment on D7 84

3.7.3 Knockdown of SFRP5 does not decrease the expression of pancreatic

progenitor transcripts 86

3.8 Role of BCL-xL during pancreatic β-like cell differentiation 87

x

3.8.1 Dynamics of BCL-xL transcript in pancreatic β-like cell 87

3.8.2 Impact of BCL-xL inhibition on pancreatic β-like cell 89

4 Effects of ER stressors, Tunicamycin and Thapsigargin on MIN6 cells 91

4.1 Tunicamycin upregulates ER stress transcripts and selected Bcl-2 family

of transcripts in MIN6 cells 91

4.2 Thapsigargin upregulates ER stress transcripts and selected Bcl-2 family of

transcripts in MIN6 cells 93

4.3 Overexpression of BIM isoform transcripts in MIN6 cells 94

4.3.1 Overexpression of BIM isoform transcripts in the presence of

Tunicamycin/Thapsigargin treatment did not perturb ER stress

and Bcl-2 family of transcripts in MIN6 cells 94

4.4 Overexpression of BIM isoform transcripts in human islets 97

4.4.1 Overexpression of BIM isoform transcripts did not perturb ER

stress and BCL-2 family of transcripts in human islets 97

4.5 BIM isoforms can be overexpressed at the protein level in HEK293FT cells 98

4.6 BIML and BIMEL proteins are unable to be overexpressed at the protein level

in MIN6 cells 99

4.6.1 Overexpression of the BIM isoform proteins in MIN6 cells 99

4.6.2 Time-course overexpression of BIML, BIMEL and BIMγ in MIN6

cells 100

4.7 Overexpression of BIMγ was successful in Tunicamycin/Thapsigargin-treated

MIN6 cells 102

4.8 Overexpression of BIMγ was successful in MIN6 cells treated with cytokines 102

4.9 Overexpression of BIMγ in the presence of ER stressors or cytokines did not

confer protection against apoptosis in MIN6 cells 103

xi

4.9.1 Overexpression of BIMγ in the presence of ER stressors did not

perturb other repertoire of BCL-2 proteins except for BCL-xL 103

4.9.2 Overexpression of BIMγ in the presence of cytokines did not perturb

other repertoire of BCL-2 proteins except for BCL-xL 105

4.10 Cleaved caspase 3 was present in MIN6 cells overexpressed with BIMγ and

treated with ER stressors 107


treated with cytokines 108

5 Discussion (Part 1) 109

5.1 Decrease in apoptosis during differentiation of hPSC to

pancreatic progenitors 109

5.2 Changes in BCL-2 family of transcript expression levels during

differentiation of hPSC into pancreatic progenitors 110

5.3 BCL-xL and BAK play important roles in pancreatic specification 110

5.4 BCL-xL is critical for the survival of pancreatic progenitors 111

5.5 BCL-xL plays an indirect role in pancreatic specification 112

5.6 Overexpression of BCL-xL does not rescue the BCL-xL-inhibited

phenotype in pancreatic progenitors 114

5.7 BCL-xL is involved in maintaining the metabolic state of pancreatic

progenitors 115

5.8 Inhibition of BCL-xL perturbs Wnt signaling pathway in pancreatic

progenitors 117

5.9 A decrease in SFRP5 transcript expression is insufficient to decrease

pancreatic gene expression in vitro 118

5.10 Inhibition of BCL-xL indirectly leads to a loss of pancreatic β-like cell

xii

identity 120

6 Discussion (Part 2) 121

6.1 Tunicamycin and Thapsigargin induce ER stress and perturb the

expression of Bcl-2 family of transcripts in MIN6 cells 121

6.2 Overexpression of BIM isoforms did not perturb ER stress and BCL-2

family of transcripts in MIN6 cells and human islets 122

6.3 Inhibitory mechanisms prevent BIM protein from being overexpressed

in MIN6 cells 123

6.4 Overexpression of BIMγ induced upregulation of BCL-xL but did not protect

against apoptosis induced by ER stressors/cytokines 124

7 Conclusion 125

8 Future work 127

8.1 Future work for Chapter 3 127

8.2 Future work for Chapter 4 128

9 References 129

10 Author’s publications 149

11 Posters, awards, invited talk 150

12 Appendix – Western blot films 151

xiii

SUMMARY

Part 1: Role of BCL-xL in pancreatic specification (Chapter 3)

BCL-2 family proteins play an important role in the regulation of cell survival and

death. However, there are also certain members that exhibit tissue- and developmental

stage-specific expression and function. Here, I report a unique reciprocal relationship

between BCL-xL (not BCL2) and BAK during early human pancreatic differentiation.

The association of BCL-xL but not BCL2 with BAK has also been reported to keep

apoptosis in check, albeit not specifically during pancreatic development. This is

consistent with our findings that the compensatory increase in BCL2 protein

expression upon BCL-xL inhibition with WEHI-539 is insufficient to curb the BAK-

mediated increase in cleaved caspase 3 and the triggering of the caspase cascade.

I also found that the downregulation of BCL2L1/BCL-xL expression and function

resulted in a decrease in early pancreatic gene and protein expression. However, BCL-

xL is known to be dispensable during rodent beta cell development but rather is

important for protection against apoptotic stimuli in mature beta cells (Carrington et

al., 2009). Therefore, I propose that BCL-xL might be indirectly involved in human

pancreatic specification that is ultimately crucial for proper beta cell function.

Upon inhibition of BCL-xL function in D7 pancreatic progenitors, I found

perturbations in Wnt signalling molecules and a distinct downregulation of SFRP5

protein. Given the known role of Wnt signalling in pancreas development and the

importance of Sfrp5 in pancreatic organogenesis in both the Xenopus and zebrafish I

suggest that this could partly contribute to the effects of loss of BCL-xL/BCL2L1 gene

and protein function on the downregulation of pancreatic marker gene expression.

xiv

Interestingly, the inhibition of BCL-xL function affected metabolic processes during

early pancreatic specification. Since cellular metabolism can affect differentiation and

development, I posit that this perturbation at the mitochondrial level also partly

contributes to the mechanistic link between BCL-xL function and pancreatic

development. BCL-xL has been reported to be directly involved in mitochondrial

energetic capacity that is necessary for cell survival. Therefore, the loss of BCL-xL

function could indirectly result in a decrease in pancreatic differentiation fidelity as I

have observed.

Together, I report a previously unappreciated role for BCL-xL/BCL2L1 in possibly

suppressing BAK during human pancreatic development. Modulation of these BCL-2

family of proteins during human pancreatic specification from hPSC could possibly be

a means to improve differentiation efficiency.

Part 2: Role of BIM in MIN6 mouse β-cell and human islets (Chapter 4)

In this project, I evaluate the role of BIM in MIN6 (mouse β-cell line) and human

islets. I hypothesize that the increased BIM exon 3 to exon 4 ratio will decrease the

apoptosis of pancreatic β-cells. Hence, I overexpress the various BIM isoforms in

mouse β-cell and human islets treated with tunicamycin and thapsigargin;

BIML/BIMEL (promote apoptosis) and BIMγ (postulated to protect against apoptosis

based on increased BIM exon 3 to exon 4 ratio).

I reported that the BIM isoforms overexpression at the transcript level was insufficient

to perturb both ER stress and Bcl-2 family of transcripts in MIN6 cells and human

islets. Interestingly, although all three BIM isoforms, BIML, BIMEL and BIMγ were

successfully overexpressed in HEK293FT, only BIMγ was successfully overexpressed

xv

in MIN6 cells. This suggests a tight translational/posttranslational control of BIML

and BMEL proteins in MIN6 cells. I also report that the increased BIM exon 3 to exon

4 ratio through overexpression of BIMγ was able to indirectly upregulate BCL-xL

protein expression. However, this was insufficient to protect mouse β-cells against

apoptosis. Together, I report that the non-apoptotic form of BIMγ can regulate the

expression of BCL-xL in MIN6 cells.

xvi

List of figures

Figure 1 Diagram showing the stepwise differentiation from human pluripotent stem

cells to pancreatic β-like cells

Figure 2 Different classes of BCL-2 family of genes

Figure 3 Diagram showing the different activation models of BCL-2 family

Figure 4 The various isoforms of BIM

Figure 5 The three BIM isoforms used in this study

Figure 6 Pancreatic β-cells undergoing ER stress upregulate the BCL-2 family of

proteins

Figure 7 Morphology and characterisation of hPSC differentiating into pancreatic

progenitors using 17D differentiation protocol

Figure 8 Decrease in apoptosis from D5 to D7

Figure 9 Changes in BCL-2 family of transcripts during differentiation into

pancreatic progenitor using 17D differentiation protocol

Figure 10 Anti-apoptotic BCL-XL/BCL2L1 and pro-apoptotic BAK proteins exhibit

opposite trends during pancreatic specification from human pluripotent stem

cells

Figure 11 Effects of WEHI-539 treatment on D7 pancreatic progenitors

Figure 12 Inhibition of BCL-xL induces apoptosis in pancreatic progenitors.

Figure 13 RNA-Seq analysis showing groups of differentially expressed genes upon

WEHI-539 treatment

Figure 14 RNA-Seq analysis reveal that the inhibition of BCL-xL function decreases

the expression of pancreatic genes

Figure 15 Effects of BCL-xL knockdown on D7 pancreatic progenitors.

Figure 16 Inhibition of BCL-xL decreases pancreatic progenitor protein expression.

xvii

Figure 17 Overexpression of BCL-xL does not rescue the BCL-xL-inhibited

phenotype in pancreatic progenitors

Figure 18 Inhibition of BCL-xL perturbs metabolic genes in pancreatic progenitors

Figure 19 Inhibition of BCL-xL function decreases glycolytic functions in pancreatic

progenitors

Figure 20 Inhibition of BCL-xL function decreases the mitochondrial functions in

pancreatic progenitors

Figure 21 Inhibition of BCL-xL perturbs the expression of Wnt-associated genes

Figure 22 SFRP5 is involved in pancreatic specification

Figure 23 Effects of SFRP5 knockdown on pancreatic progenitor transcript

Figure 24 Dynamics of mature β-like cell markers and BCL-xL transcript during 35D

differentiation

Figure 25 Morphology and transcriptional profile of DMSO vs WEHI-539 treated cells

during differentiation into β-like cells

Figure 26 Effects of tunicamycin dose treatment on MIN6 cells

Figure 27 Effects of thapsigargin dose treatment on MIN6 cells

Figure 28 Transcripts of Bcl-2 family genes in BIM isoforms-overexpressing MIN6

cells under ER stress.

Figure 29 Overexpression of BIM isoforms in human islets

Figure 30 Overexpression of BIM isoforms at the protein level in HEK293FT cells

Figure 31 Overexpression of BIM isoforms at the protein level in MIN6 cells

Figure 32 Overexpression of the various BIM isoforms, BIML, BIMEL and BIMγ in

MIN6 cells

Figure 33 Overexpression of BIMγ was successful in MIN6 cells treated with

Tunicamycin/Thapsigargin

xviii

Figure 34 Overexpression of BIMγ was successful in MIN6 cells treated with

cytokines

Figure 35 Western blot analysis of BCL-2 family of proteins upon BIMγ

overexpression in MIN6 cells treated with ER stressors

Figure 36 Western blot analysis of BCL-2 family of proteins upon BIMγ

overexpression in MIN6 cells treated with cytokines

Figure 37 Cleaved caspase 3 was present in BIMγ overexpression in the presence of

ER stressors

Figure 38 Cleaved caspase 3 was present in BIMγ overexpression in the presence of

cytokines.

Figure 39 Full western blot films corresponding to Figure 10A.



Figure 42 Full western blot films corresponding to Figure 12A and 12B.

Figure 43 Full western blot films corresponding to Figure 12A and 12B.

Figure 44 Full western blot films corresponding to Figure 30.


Figure 46 Full western blot films corresponding to Figure 32A & 32B.



Figure 49 Full western blot films corresponding to Figure 35A, 35B and 35C.

xix

Figure 50 Full western blot films corresponding to Figure 36A, 36B and 36C



xx

List of Tables

Table 1 Types of hPSC used in the various pancreatic differentiation protocols

Table 2 List of antibodies used

Table 3 Chemicals, peptides, media, reagents, assays and buffers

Table 4 Softwares, instruments and algorithms

Table 5 List of human primers used for RT-QPCR

Table 6 List of human primers used for short hairpin (shRNA) cloning

Table 7 List of human primers used for cloning and overexpression

Table 8 List of mouse primers used for RT-QPCR

Table 9 Generation of pancreatic progenitors (17D protocol)

Table 10 Generation of pancreatic β-like cells (35D protocol)

Table 11 Molecular weight of BIM isoforms

xxi

List of Abbreviations

A1 B-cell lymphoma 2-related protein A1

ACT A Activin A

ADCY Adenylate Cyclase

ALDOC Aldolase C, fructose-biphosphate

ALK5ii TGF-β RI Kinase Inhibitor I

AMY Amylase

APAF1 Apoptotic protease activating factor 1

APC Adenomatous polyposis coli

ATF4 Activating transcription factor 4

ATF6 Activating transcription factor 6

ATP Adenosine Triphosphate

Axl Axl receptor tyrosine kinase

BAD BCL-2associated death promoter

BAX BCL-2-associated X protein

BAK BCL2 Antagonist/Killer 1

BBC3 BCL2 Binding Component 3

B cell B Lymphocyte

BCL2 B Cell Lymphoma 2

BCL-xL B Cell Lymphoma-Extra large

BCL-xS B Cell Lymphoma-Extra short

BCA Bicinchoninic acid assay

BCL-W BCL-2-like protein 2

BH3 BCL-2 Homology Domain 3

BH3-A BCL-2 Homology Domain 3 Activator

BH3-S BCL-2 Homology Domain 3 Sensitizer

BID BH3 interacting-domain death agonist

BIM BCL-2 Interacting Mediator of Death

BIML BCL-2 Interacting Mediator of Death Long

BIMEL BCL-2 Interacting Mediator of Death Extra Long

BIMS BCL-2 Interacting Mediator of Death Short

BIMγ BCL-2 Interacting Mediator Gamma

BIO 6-bromoin-dirubin-3-oxime

BLAST Basic Local Alignment Search Tool

BMF BCL-2 Modifying Factor

BMP4 Bone Morphogenetic Protein 4

BOK BCL-2 related ovarian killer

BOO BCL-2 Like 10

bp Basepair

Ca2+ Calcium

cDNA Complementary Deoxyribonucleic Acid

CD4 Cluster of Differentiation 4

CD8 Cluster of Differentiation 8

CED-9 Cell death abnormality gene 9

CHIR CHIR-99021

CHOP10 DNA damage-inducible transcript 3

xxii

CK19 Cytokeratin-19

CML Chronic Myeloid Leukemia

CMRL Connaught Medical Research Laboratories

CMV Cytomegalovirus

CO2 Carbon Dioxide

C/EBP CCAAT-enhancer-binding proteins

DAPI 4′,6-diamidino-2-phenylindole

DAPT Gamma-secretase inhibitor

DAVID Database for Annotation, Visualization and Integrated Discovery

DEX Dexamethasone

DMEM Dulbecco Modified Eagle Medium

DMSO Dimethyl sulfoxide

DNA Deoxyribonucleic Acid

dNTP deoxynucleotide triphosphate

DPAGT1 Dolichyl-Phosphate N-Acetylglucosaminephosphotransferase 1

DPBS Dulbecco's Phosphate Buffered Saline

dUTP Deoxyuridine-5'-triphosphate

ECAR Extracellular Acidification Rate

EGFR-

NSCLC

Epidermal Growth Factor-Receptor-Mutated Non-Small-Cell Lung

Cancer

EGL-1 EGg Laying defective

eIF2a Eukaryotic translation initiation factor 2A

ELISA Enzyme-Linked Immunosorbent Assay

ENO2 Enolase 2

ER Endoplasmic Reticulum

FACS Florescence-activated Cell Sorting

FAF-BSA Fatty Acid Free- Bovine Serum Albumin

FBS Foetal Bovine Serum

FDR False Discovery Rate

FGF2 Fibroblast Growth Factor 2



FW Forward

FZD1 Frizzled Class Receptor 1









FOXA1 Forkhead box protein A1

FOXA2 Forkhead box protein A2

GATA4 GATA binding protein 4

GATA6 GATA-binding factor 6

GCG Glucagon

xxiii

GDNA Genomic Deoxyribonucleic Acid

GEO Gene Expression Omnibus

GFP Green Fluorescence Protein

GHRL Ghrelin

GLIS1 Glis Family Zinc Finger 1

GLP-1 Glucagon-Like Peptide 1

GLUT2 Glucose Transporter 2

GSIS Glucose-stimulated insulin secretion

GSK3 Glycogen synthase kinase 3

G1 Gap 1 phase

HDAC Histone Deacetylases

HEK293FT Human Embryonic Kidney 293 Cells

hESCs Human Embryonic Stem Cells

HGF Hepatocyte Growth Factor

HH Hedgehog

HHEX Hematopoietically-expressed homeobox protein

HK2 Hexokinase 2

hIPSCs Human Induced Pluripotent Stem Cells

HLXB9 Homeobox HB9

HNF1A Hepatocyte nuclear factor 1 homeobox A

HNF1B Hepatocyte nuclear factor 1 homeobox B

HNF4A Hepatocyte nuclear factor 4 alpha

hPSC Human Pluripotent Stem Cells

HRK Harakiri

HRP Horse Radish Peroxidase

IAPP Islet Amyloid Polypeptide

IGF Insulin-Like Growth Factor

IFN-γ Interferon Gamma

IL-1β Interleukin 1 beta

INS Insulin

iPSCs Induced Pluripotent Stem Cells

IRE1-α Inositol-Requiring Enzyme 1 α

ITS-X Insulin-Transferrin-Selenium-Ethanolamine

JNK1 c-Jun N-Terminal Protein Kinase 1

KGF Keratinocyte growth factor

KLF4 Kruppel-like Factor 4

KOSR KnockOut™ serum replacement

LDN LDN193189

MAFA MAF bZIP transcription factor

MAPK/ERK mitogen-activated protein kinase

MCL-1 Myeloid cell Leukemia 1

MCL-1S Myeloid cell Leukemia 1 Short

MCL-1ES Myeloid cell Leukemia 1 Extra Short

MCL-1L Myeloid cell Leukemia 1 Long

MCS Multiple Cloning Site

MEF Mouse Embryonic Fibroblast

MET Mesenchymal-epithelial transition

MOI Multiplicity of Infection

xxiv

MOMP Mitochondrial Outer Membrane Permeabilization

MPER Mammalian Protein Extraction Reagent

mRNA Messenger RNA

MTD Matador

NaHCO3 Sodium bicarbonate

NANOG Nanog Homeobox

N-Bak Neuronal BCL2 Antagonist/Killer 1

NCBI National Center for Biotechnology Information

N-Cys N-acetylcysteine

NEAA Non-essential amino acid

NF-kB Nuclear Factor kappa-light-chain-enhancer of activated B cells

NGN3 Neurogenin-3

Nic Nicotinamide

NO Nitrous Oxide

NKX6.1 NKX6 Homeobox 1

NOXA Phorbol-12-myristate-13-acetate-induced protein 1

NRG-mice NOD/RAG1/2−/−IL2Rγ−/− mice

OCR Oxygen Consumption Rate

OCT4 Octamer-Binding Transcription Factor 4

OE Overexpression

PAX6 Paired Box Protein Pax-6

PARS Poly (ADP-Ribose) Synthetase

PBS Phosphate Buffer Saline

PBST Phosphate Buffer Saline Tween-20

PCA Principal Component Analysis

PDBu Phorbol 12,13-dibutyrate

PDX1 Pancreatic and duodenal homeobox 1

PERK Protein kinase R (PKR)-like endoplasmic reticulum kinase

PI3K Phosphoinositide 3-kinase

PKC Protein Kinase C

PTF1a Pancreas Associated Transcription Factor 1a

PTPN2 Protein Tyrosine Phosphatase Non-Receptor Type 2

PUMA p53 upregulated modulator of apoptosis

PYY Peptide YY

RA Retinoic Acid

RFX6 Regulatory factor X, 6

RNA Ribonucleic Acid

RNA-Seq Ribonucleic Acid Sequencing

ROCK Rho-Associated Protein Kinase

RPM Rounds Per Minute

RPMI-1640 Roswell Park Memorial Institute 1640 Medium

RT-QPCR Real-time Quantitative Polymerase Chain Reaction

RV Reverse

SANT1 Sonic Hedgehog Inhibitor.

SD Standard Deviation

SDS-PAGE Sodium dodecyl sulphate-polyacrylamide gel electrophoresis

SERCA Sarco/Endoplasmic Reticulum Ca2+-ATPase

SFRP1 Secreted Frizzled-Related Protein 1

https://en.wikipedia.org/wiki/Oligomer

https://en.wikipedia.org/wiki/Transcription_factor

xxv




shRNA Short Hairpin Ribonucleic Acid

siRNA Short Interfering Ribonucleic Acid

SOX2 Sex Determining Region Y-box 2

SOX9 Sex-Determining Region Y-box 9

SOX17 SRY-Box Transcription Factor 17

SST Somatostatin

sXBP1 Spliced X-box Binding Protein 1

TA Annealing Temperature

tBID Truncated BH3 interacting-domain death agonist

TBS Tris Buffer Saline

TBST Tris Buffer Saline Tween-20

Tm Melting Temperature

TNF-α Tumor Necrosis Factor Alpha

Treg Regulatory T cells

T1D Type 1 Diabetes

T2D Type 2 Diabetes

T3 Triiodothyronine

UPR Unfolded Protein Response

VDAC1 Voltage-dependent anion-selective channel 1

VEGF Vascular Endothelial Growth Factor

Vit C Vitamin C

WEHI-539 Walter and Eliza Hall Institute-539

Wg Wingless

WNT Wingless-related integration site

WNT2B Wingless-related integration site 2B

WNT5A Wingless-related integration site 5A




XBP1 X-box Binding Protein 1

XXi Gamma-Secretase Inhibitor

Y-27632 Rock Inhibitor

1

1 Introduction

1.1 Recapitulating pancreatic β-cell differentiation using human pluripotent

stem cells

Pluripotent “human embryonic stem cells” (hESCs) were initially discovered over two

decades ago (Thomson et al., 1998). hESCs possess the capability to undergo self-

renewal as well as the ability to differentiate into majority of human cell types. Using

hPSC as a model, many studies have been able to obtain pancreatic β-like cells from

hPSC (D'Amour et al., 2006, Kroon et al., 2008, Rezania et al., 2012, Pagliuca et al.,

2014). Discovered in 2006, induced pluripotent stem cells (iPSCs) can be produced

via reprogramming of somatic cells by expressing the pluripotency factors c-MYC,

OCT4, SOX2 and KLF4 (Takahashi and Yamanaka, 2006). Human iPSCs (hiPSCs)

can also be used to screen thousands of drugs in a high through-put manner on the

differentiated human cells (Takahashi and Yamanaka, 2013).

Many protocols have been established to produce pancreatic β-like cells in culture

(Loo et al., 2018). Novel breakthroughs in this field have facilitated the production of

β-like cells that possess the ability to secrete insulin in response to glucose challenge.

These protocols represent an avenue of cure for diabetes patients in terms of cell

replacement therapy. Using these protocols, scientists would be able to generate

pancreatic β-like cells and possibly utilize them for drug-screening libraries which

may prove to be valuable in enhancing secretion of insulin and regeneration of these

pancreatic β-like cells (Teo et al., 2015a, Teo et al., 2013).

Research on pancreatic ontogenesis in several animal models such as chicken, frog,

mouse and zebrafish (Zorn and Wells, 2007, Santosa et al., 2015) has identified many

signaling pathways that direct differentiation towards the pancreatic lineage. Many

2

growth factors and chemicals have been used to achieve this purpose and have been

summarized in Fig 1. To drive hPSC towards the pancreatic lineage, Activin A is used

during the first 2-4 days of differentiation to differentiate hPSC into definitive

endoderm (DE) (D'Amour et al., 2006, Jiang et al., 2007a, Basford et al., 2012,

Pagliuca et al., 2014, Nostro et al., 2011, D'Amour et al., 2005). To further induce DE

formation, BMP4 (Phillips et al., 2007, Xu et al., 2011, Teo et al., 2012), sodium

butyrate (Jiang et al., 2007a), WNT3A, BIO or CHIR99021 are utilized in conjunction

with Activin A (D'Amour et al., 2006, Teo et al., 2014). PI3K inhibitors such as

LY294002 (McLean et al., 2007) and Wortmannin (Zhang et al., 2009) are used as

PI3K signalling inhibits differentiation of DE. To characterize DE, high expression

levels of FOXA2, SOX17, CXCR4 are needed.

As DE progresses to pancreatic foregut, the morphology of the cells changes from a

2D to an epithelium layer that is largely cuboidal in structure. In the human embryonic

pancreatic mesenchyme, FGF such as FGF7 and FGF10 are highly expressed in order

to ensure proliferation of pancreatic epithelial cell (Ye et al., 2005) and FGF10 has

been shown to promote PDX1+ pancreatic progenitor proliferation (Hart et al., 2003).

FGF2 has also been shown in many studies to promote pancreatic progenitor

formation (Jiang et al., 2007a, Jiang et al., 2007b, Zhang et al., 2009, Teo et al., 2012,

Teo et al., 2014, Teo et al., 2015b). Vertebrate pancreatic development also requires

the aid of RA signaling. In vivo, the splanchnic lateral plate mesoderm produces RA

which induces Pdx1 expression in the dorsal foregut endoderm (Martin et al., 2005,

Molotkov et al., 2005). Thus, RA has been extensively utilized in pancreatic

development studies at an increasing concentration from 2 μM (D'Amour et al., 2006,

Zhang et al., 2009, Basford et al., 2012, Nostro et al., 2011) to 3 μM (Teo et al., 2012,

Teo et al., 2014, Teo et al., 2015b) and 10 μM (Jiang et al., 2007b, Shim et al., 2007).

3

In the ventral endoderm, BMP signaling is involved in liver lineage specification over

pancreas (Wandzioch and Zaret, 2009). Thus, to encourage pancreatic specification,

Noggin, a BMP antagonist is often used at doses of 50 ng/ml (Zhang et al., 2009,

Basford et al., 2012, Nostro et al., 2011), 100 ng/ml (Jiang et al., 2007a) and up to 150

ng/ml (Cho et al., 2012). Compounds such as LDN-193189 (Rezania et al., 2014,

Pagliuca et al., 2014) and dorsomorphin (Takeuchi et al., 2014) has also been shown to

inhibit BMP receptor. A disadvantage of adding BMP inhibitors during pancreatic

development ultimately results in premature endocrine differentiation (Pagliuca et al.,

2014, Rezania et al., 2013). The end-result of the insulin-producing cells are mostly

poly-hormonal. Since TGF-β signaling blocks specification of pancreatic

development, TGF-β receptor antagonist, SB431542 or ALK5 inhibitor II (ALK5ii)

has been utilized with Noggin, RA and FGF10 to initiate pancreatic specification and

at the same time inhibiting liver and gut expression markers (Cho et al., 2012, Inman

et al., 2002, Rezania et al., 2011).

The suppression of hedgehog signaling is necessary in pancreatic lineage specification

(D'Amour et al., 2006, Hebrok et al., 1998). Prior to Pdx1 expression, shh signaling is

impeded by notochord-derived signals in the foregut endoderm (Hebrok, 2003).

During pancreatic specification, DE cells are treated with 0.25 µM SANT1 (Rezania et

al., 2014, Pagliuca et al., 2014) and 0.25 µM cyclopamine (D'Amour et al., 2006,

Basford et al., 2012, Russ et al., 2015, Nostro et al., 2011, Mfopou et al., 2010) to

suppress hedgehog signaling and this serves to boost the generation of PDX1+ cells.

To further enhance pancreatic endocrine differentiation, additional components such

as Indolactam V and protein kinase C (PKC) agonists have been used (Chen et al.,

2009). Several studies have shown that PKC activators, TPB or PDBu, enhance

4

transcription factor expression such as NEUROD1, NGN3, NKX6.1 and PTF1A

(Rezania et al., 2014, Pagliuca et al., 2014).

To promote NGN3 expression and generation of various endocrine cell types,

suppression of NOTCH signaling is required (Jensen, 2004). Using γ-secretase

inhibitor DAPT that suppresses NOTCH signaling, it has been shown to enhance

generation of NGN3-expression cells (D'Amour et al., 2006). An alternative of γ-

secretase inhibitor XXI has also been used to augment the formation of

NKX6.1+INS+GLUC- cells from 25-50 % (Rezania et al., 2014).

In order to obtain mature pancreatic endocrine cells, nicotinamide, a poly (ADP-

ribose) synthetase inhibitor which enhances β-cell mass in human fetal pancreatic cells

in culture is also used (Otonkoski et al., 1993). In multiple studies, various

concentrations of Nicotinamide from 10 µM - 10 mM has been extensively utilized

(Segev et al., 2004, Jiang et al., 2007a, Zhang et al., 2009). Many years ago, the

generation of pancreatic β-like cells was only possible after maturation for three to six

months in vivo (Shim et al., 2007, Kroon et al., 2008, Rezania et al., 2012). However,

breakthroughs have been made in the past two years showing that functional

pancreatic β-like cells have been generated in vitro (Rezania et al., 2014, Pagliuca et

al., 2014, Russ et al., 2015). Despite the promising results of showing glycaemic

correction in animal diabetes models using these cells (Rezania et al., 2014, Vegas et

al., 2016, Bruin et al., 2015b), these immature cells are incomparable to mature human

β-cells. This is because they lack many important markers that are indicative of mature

β-cells. These β-like cells are incapable of responding in real-time to glucose challenge

and show incorrect insulin secretory kinetics and calcium dynamics (Bruin et al.,

2015a). Hence, there represents an ever-urgent demand to optimize the in vitro

protocols which will allow the generation of true mature human pancreatic β-cells.

5

Having discussed the numerous cellular signalling pathways being activated/repressed

upon pancreatic β-like cell differentiation, I also seek to identify new proteins that can

influence differentiation towards the pancreatic lineage. In this thesis, I am focused on

the BCL-2 family of proteins which have a canonical function in prosurvival and

death. But yet, they also have little-known functions in regulating cell lineage

differentiation.

Figure 1. Diagram showing the stepwise differentiation from human pluripotent stem cells to

pancreatic β-like cells. The various critical signaling pathways involved are listed in this diagram.

Green box indicates activation of the respective signalling pathways whereas red box indicates

inhibition of the respective signalling pathways. Blue box indicates small molecules or chemicals

used. Yellow box indicates the types of assays used to characterise the cells. Light blue box

indicates the RNA/Protein markers used to characterise the cells at each respective stage.

Taken from (Loo et al., 2018). An arduous journey from human pluripotent stem cells to functional

pancreatic β-cells. Diabetes Obes Metab. 20(1):3-13 (2018).

6

1.1.1 Different hPSC lines used in pancreatic differentiation protocols

Different hPSC lines can be differentiated into the three germ layers (Osafune et al.,

2008). Hence, different groups have tried using hPSC lines in order to assess if

differentiation protocols can be reproduced with minimal changes on the results (Table

1).

Most notably, H1(Rezania et al., 2012, Rezania et al., 2014) or H9 hESCs (WiCell) are

often the cell line of choice among the many research groups. The next most

frequently used cell lines are HES lines (ESI BIO) or the HUES lines from HSCI

(Harvard Stem Cell Institute). Pagliuca et al (Pagliuca et al., 2014) used HUES8 hESC

which is supposedly the best line for pancreatic differentiation (Osafune et al., 2008)

and also two hiPSC lines for their protocol (Pagliuca et al., 2014).

As shown in Table 1, many groups have experimented with different hPSC lines for

pancreatic differentiation and each of the line tends to exhibit differences in

differentiation potential (Pagliuca et al., 2014). As a result, it becomes difficult to

compare the reliability of each different protocols.

Despite the general consensus that pancreatic β-like cells can be reliably generated

with a wide variety of hPSC lines, optimization of each hPSC line may have to be

performed to achieve maximum differentiation potential to obtain pancreatic β-like

cells.

7

hESC line hiPSC

line

Summary Reference

H9 - Spontaneous differentiation of hESC into INS+ cells

in vitro.

(Assady et al., 2001)

H1, H9 - Spontaneous differentiation of hESC into mixed

population of INS+, GCG+, SST+, PYY+, IAPP+,

PDX1+, FOXA2+ and SOX17+ cells in vitro.

(Xu et al., 2006)

H9.2, H13, I6 - Growth factor-induced directed differentiation of

hESC into mixed population of INS+, GCG+, IAPP+,

PDX1+, NKX6.1+ and GLUT2+ cells in vitro.

(Segev et al., 2004)

SA002, AS034,

SA121, SA181

- Spontaneous differentiation of hESC into PDX1+,

FOXA2+ cells in vitro; followed by in vivo

maturation into mixed population of INS+, GCG+,

AMY+ and C-peptide+ cells.

(Brolen et al., 2005)

CyT203, CyT25,

CyT49, BG01,

BG02, BG03

- Growth factor-induced directed differentiation of

hESC into mixed populations of INS+, GCG+,

GHRL+, SST+, PPY+, C-peptide+, PDX1+, FOXA2+

and NKX6.1+ cells in vitro.

(D'Amour et al.,

2006)

HES1, HES2,

HES3, HES4,

HUES7, HUES9

- Growth factor-induced directed differentiation of

hESC into mixed populations of INS+, GCG+, SST+,

C-peptide+, PDX1+, NKX6.1+, GLUT2+ and CK19+

cells.

(Phillips et al., 2007)

H1, H7, H9 - Growth factor-induced directed differentiation of

hESC into mixed population of INS+, GCG+, AMY+,

C-peptide+, PDX1+, FOXA2+, NKX6.1+, GLUT2+

and PTF1a+ cells in vitro.

(Jiang et al., 2007a)

H1, H9 - Growth factor-induced directed differentiation of

hESC into mixed population of INS+, GCG+, AMY+,

SST+, C-peptide+, PDX1+, SOX17+ and GLUT2+

cells in vitro.

(Jiang et al., 2007b)

Miz-hES4, Miz-

hES6

- Growth factor-induced differentiation of hESC into

INS+, GCG+, C-peptide+, PDX1+, FOXA2+ and

SOX17+ co-expressing cells in vitro.

(Shim et al., 2007)

CyT49, CyT203 - Growth factor-induced differentiation of hESC into

PDX1+, NKX6.1+, FOXA2+ cells in vitro; followed

by in vivo maturation into INS+, GCG+, SST+, IAPP+,

GHR+ and MAFA+ cells.

(Kroon et al., 2008)

SNUhES3 - Growth factor-induced differentiation of hESC into

mixed population of GCG+, C-peptide+, PDX1+,

FOXA2+ and SOX17+ cells in vitro.

(Cho et al., 2008)

H9, H1 C1, C2,

C5

Growth factor-induced directed differentiation of

hESC and hiPSC into mixed population of INS+,

AMY+, SST+, C-peptide+, PDX1+, FOXA2+, SOX17+

and NKX6.1+ cells.

(Zhang et al., 2009)

HUES4, HUES8,

HUES9

- Chemically-induced directed differentiation of hESC

into PDX1+, FOXA2+ and SOX17+ cells.

(Borowiak et al.,

2009)

HUES2, HUES4, - Chemically and growth factor induction of hESC into (Chen et al., 2009)

Table 1: Different hPSC lines used in pancreatic differentiation protocols

Different hPSC/ hiPSC lines have been used in many different differentiation protocols over the

years and they are all listed in the table above.

Taken from (Loo et al., 2018). An arduous journey from human pluripotent stem cells to functional

pancreatic β-cells. Diabetes Obes Metab. 20(1):3-13 (2018).

8

HUES9 PDX1+ cells and further differentiation using growth

factors into mixed population of INS+, AMY+ and C-

peptide+ cells in vitro.

CyT49 - Reported the inconsistency in the results using

differentiation protocol described in Kroon et al.,

2008.

(Matveyenko et al.,

2010)

H1, H9, UC06 - Growth factor-induced differentiation of hESC into

INS+, AMY+, C-peptide+, PDX1+, NKX6.1+ and

FOXA2+ cells in vitro.

(Cai et al., 2010)

WA01, WA09 - Growth factor-induced differentiation of hESC into

INS+, GCG+, PDX1+, FOXA2+, SOX17+ and

NKX6.1+ cells in vitro.

(Xu et al., 2011)

H1, H9, HES3 38-2

from

GM013

90

Growth factor-induced differentiation of hESC and

hiPSC into INS+, C-peptide+, PDX1+ and FOXA2+

cells in vitro.

(Nostro et al., 2011)

INSGFP/w, HES2 - Growth factor-induced differentiation of hESC into

mixed population of INS+, GCG+, SST+ and GLUT2+

cells in vitro.

(Basford et al., 2012)

CyT49 - Growth factor-induced differentiation of hESC into

PDX1+, FOXA2+, NKX6.1+ and SOX17+ cells in

vitro; further maturation of progenitor cells into INS+,

GCG+ and SST+ cells in vivo.

(Schulz et al., 2012)

H1, ESI-

49

- Growth factor-induced differentiation of hESC into

INS+, GCG+, PDX1+, NKX6.1+ cells in vitro; further

maturation of progenitor cells into INS+, GCG+,

SST+, PPY+, PDX1+ and NKX6.1+ cells in vivo.

(Rezania et al., 2012)

VUB07 - Growth factor-induced differentiation of hESC into

PDX1+, FOXA2+, SOX9+ and CK19+ cells in vitro;

further maturation of progenitor cells into INS+ and

NKX6.1+ cells in vivo.

(Sui et al., 2013)

H1 - Growth factor-induced differentiation of hESC into

mixed population of INS+, GCG+ and NKX6.1+ cells

in vitro; further maturation of progenitor cells into

INS+, GCG+, SST+, C-peptide+, PDX1+ and NKX6.1+

in vivo.

(Bruin et al., 2013)

KhES-3 hiPSC

253G1


hiPSC into mixed population of INS+, GCG+, SST+,

C-peptide+, PDX1+, FOXA2+, NKX6.1+ and SOX17+

in vitro.

(Takeuchi et al.,

2014)

H1 hiPSC

#A189

45


hiPSC into mixed population of INS+, GCG+, PDX1+

and NKX6.1+ in vitro; further maturation of cells into

SST+ and C-peptide+ cells in vivo.

(Rezania et al., 2014)

HUES8 hiPSC1

,

hiPSC2


hiPSC into mixed population of INS+, GCG+, C-

peptide+, PDX1+ and NKX6.1+ cells in vitro.

(Pagliuca et al.,

2014)

H1 - Growth factor-induced differentiation of hESC into

mixed population of INS+, GCG+ and NKX6.1+ cells

in vitro; further maturation of progenitor cells into

INS+, GCG+, SST+, C-peptide+, PDX1+ and NKX6.1+

in vivo.

(Bruin et al., 2015b)

MEL1 - Growth factor-induced differentiation of hESC into

mixed population of INS+, GCG+, C-peptide+, PDX1+

and NKX6.1+ in vitro.

(Russ et al., 2015)

- ND1,

ND2,

hiPSCs


hiPSC into mixed population of INS+, GCG+, C-

peptide+, PDX1+ and NKX6.1+ cells in vitro.

(Millman et al.,

2016)

9

1.1.2 Variability between current protocols used to generate pancreatic β-like

cells.

2007 to present: maturation in vivo

In order to achieve insulin-producing cells, scientists have been transplanting

pancreatic progenitors into diabetic mice for in vivo maturation. PDX1+ pancreatic

endoderm cells were able to differentiate into insulin- and glucagon-producing cells

(Shim et al., 2007). As a result of this novel finding, more groups began to incorporate

in vivo maturation into their work (Basford et al., 2012, Kroon et al., 2008,

Matveyenko et al., 2010, Schulz et al., 2012).

Scientists from ViaCyte were able to generate pancreatic endoderm cell aggregates

and mature them in vivo for 3 to 6 months into glucose-responsive pancreatic

endocrine cells (Kroon et al., 2008). Interestingly, the C-peptide and insulin levels

secreted by the stem cell-derived beta-like cells were comparable to those secreted by

human islets. Next, the question of whether the site of transplantation would affect the

maturation efficiency began to surface. (Sui et al., 2013) reported that pancreatic

progenitors transplanted at the subcutaneous site were PDX1+ where barely any cells

remained post-transplantation in the fat pad. However, (Kroon et al., 2008) reported

transplantation of cells into the fat pad and these in vivo matured cells were capable of

restoring normoglycemia in streptozotocin-treated diabetic mice. This suggests that the

survival of transplanted pancreatic progenitors are strongly influenced by the in-vivo

microenvironment.

10

2014 to present: functional beta cells in vitro in a scalable system

Since 2014, scientists have been trying to generate functional beta-like cells in vitro in

a scalable system. To achieve a higher efficiency in generating beta-like cells, Insulin+

cells were generated from many different hPSC lines by culturing spheroids in media

containing nicotinamide, dexamethasone, and ALK5 inhibitor II (Takeuchi et al.,

2014).

A 7-stage protocol to differentiate hPSC into stage 7 (S7) cells was developed by

(Rezania et al., 2014) and the insulin secretion content of these S7 cells was

comparable to the amount secreted by human islets. Using this protocol, Rezania et al.

were able to reverse diabetes in mice in as short as 40 days compared to the normal 3

to 6 months.

In a breakthrough, (Pagliuca et al., 2014) came up with a protocol which could

generate billions of beta-like cells (SC-beta-cells) from hPSC in vitro. These cells

were able to reverse worsening hyperglycaemia in NRG-Akita mice. This essentially

solved the difficult problem of obtaining a sufficient amount of mature beta-like cells

from patient-specific hiPSCs. Furthermore, this protocol also provides a high-

throughput platform which can generate billions of patient-derived cells for drug-

screening purposes.

Using the same protocol, the SC beta-cells were encapsulated with alginate derivatives

which can maintain normal blood glucose levels without the need for

immunosuppressants for up to 174 days (Vegas et al., 2016).

11

1.2 BCL-2 family

1.2.1 BCL-2 family proteins

BCL-2 proteins control the activity of caspases and downstream cellular apoptosis.

(Adams and Cory, 1998, Gross et al., 1999). The proportion of anti-apoptotic to pro-

apoptotic BCL-2 proteins represents a critical effector of apoptosis. Anti-apoptotic

proteins are crucial in promoting cell survival. These proteins include A1, Bcl-2, Bcl-

xL, Bcl-w, Boo, Mcl-1 and C. elegans protein CED-9. The anti-apoptotic factors

contain three or four BH domains (BH1-4). In contrast, the pro-apoptotic factors are

classified into two major groups. The first group contains two or three BH domains

(Bax, Bak and Bok/Mtd) whereas the second group contains only the BH3 domain

(Bad, Bid, Bim/Bod, Bmf, Noxa, Puma/Bbc-3 and C. elegans Egl-1) (Huang and

Strasser, 2000) (Fig 2). These BH1-4 domains consist of short amino acid sequences

that play a part in categorizing these BCL-2 proteins into anti- and pro-apoptotic

proteins as well as defining them as multi-domain or BH3-only proteins.

BH3-only proteins are critical for initiating cellular apoptosis in mice (Bouillet et al.,

1999). In mammalian systems, there are at least eight BH3-only protein such as Bid,

Bim and Puma (Huang and Strasser, 2000). Each of the different BH3-only proteins

acts differently to avoid functional redundancy. The BH3 domain is comprised of an

amphipathic α-helix that is around 26 residues long that is capable of binding the

hydrophobic groove present in the anti-apoptotic BCL-2 proteins (Sattler et al., 1997).

In order to induce apoptosis, the BH3 domains of the pro-apoptotic proteins can

heterodimerize with the hydrophobic pockets formed by the BH1-3 domains of the

anti-apoptotic factors. The various BH3-only proteins are able to bind to many anti-

12

apoptotic proteins with a varying degree of binding affinity (Opferman et al., 2003,

Chen et al., 2005b, Kuwana et al., 2005b, Certo et al., 2006, Ku et al., 2011).

Apoptosis controlled by BCL-2 proteins is known as intrinsic apoptosis. BH3-only

proteins, including BIM, BID and PUMA, can bind BAX and BAK, permitting their

activation. This then facilitates their oligomerization which allows them to become

embedded into the mitochondrial membrane, resulting in “mitochondrial outer

membrane permeabilization” (MOMP). Once MOMP has taken place, cytochrome C

is released through the pores and interacts with apoptotic protease-activating factor 1

(APAF-1) to form the apoptosome. The cascade of events activate the initiator caspase

9 which then proceed to cleave and activate the various downstream executioner

caspases 3, 6 and 7, contributing to intrinsic apoptosis (Desagher et al., 1999, Kim et

al., 2006, Wei et al., 2000, Wei et al., 2001).

Figure 2. Different classes of BCL-2 family of genes. (1) Anti-apoptotic multidomain (BH1-4)

proteins, (2) Pro-apoptotic multidomain proteins (BH1-3) (3) BH3-only (BH3) domain proteins.

Adapted from Giménez-Cassina A et al. Regulation of mitochondrial nutrient and energy

metabolism by BCL-2 family proteins. Trends Endocrinol Metab. 2015 Apr;26(4):165-75.

https://www.ncbi.nlm.nih.gov/pubmed/?term=Gim%C3%A9nez-Cassina%20A%5BAuthor%5D&cauthor=true&cauthor_uid=25748272


13

Thus, I have presented several models here which show the behaviours of the various

BCL-2 proteins (Fig 3).

1.2.2 Direct activation model

In the “direct activation model”, pro-apoptotic BAX and BAK are bound by BH3

proteins and directly activated (Figure 3A). BH3 proteins can be subdivided into

“activators” and “sensitizers” depend upon their interaction affinities for BCL-2

proteins (Letai et al., 2002). Activator proteins, including BIM, tBID and PUMA, can

bind anti- and pro-apoptotic BCL-2 proteins (Kim et al., 2006). Sensitizers including

BAD and NOXA can bind anti-apoptotic proteins, resulting in liberation of activator

proteins, promoting MOMP (Letai et al., 2002, Kuwana et al., 2005a, Certo et al.,

2006). Anti-apoptotic proteins can interact with both activator and sensitizer proteins,

but cannot form a complex with BAX and BAK (Kim et al., 2006). Hence, to avoid

apoptosis, BH3 proteins must be sequestered by the anti-apoptotic factors to inhibit the

activity of BAX/BAK.

1.2.3 Displacement model

In the “displacement model”, BAX and BAK are proposed to be constitutively active,

with their inhibition requiring binding of anti-apoptotic proteins (Figure 3B). For

apoptosis to initiate, BAX and BAK must be released from their interaction with pro-

survival factors. In certain cells that express numerous anti-apoptotic BCL-2 proteins,

a combination of selectively binding BH3 proteins is needed to initiate apoptosis by

counteracting the protective ability of the anti-apoptotic members (Chen et al., 2005a).

For example, BAK heterodimerizing with BCL-xL and MCL-1 is commonly found in

proliferating cells. Introduction of NOXA can displace BAK-MCL-1 heterodimers.

14

This ultimately releases BAK, allowing the formation of NOXA-MCL complexes to

be formed. Hence, both BAD and NOXA are essential for antagonizing the influence

of BCL-xL and MCL-1 to successfully stimulate apoptosis (Willis et al., 2005).

1.2.4 Embedded together model

The “embedded together model” is a combination of the two previously discussed

models. It proposes that BAX and BAK bind to the cell membrane, inducing an

alteration to BCL-2 protein conformation (Figure 3C). This ultimately affects their

binding affinity for their respective partners (Garcia-Saez et al., 2009, Leber et al.,

2007). The sensitizer BH3 proteins can neutralize the activity of anti-apoptotic

proteins via displacement of both BAX and BAK from the membrane-embedded

complexes of anti-apoptotic factors (Billen et al., 2008, Lovell et al., 2008). As a

result, BAX and BAK bind membrane-embedded anti-apoptotic proteins and are then

released by sensitizer proteins to form oligomers and permeabilize membranes.

The activator proteins also play double role in which they can interact with pro-

survival factors and directly activate pro-apoptotic proteins. However, the interaction

between BH3 proteins and the anti-apoptotic/pro-apoptotic BCL-2 proteins is unstable.

This model of interaction has been shown in living cells (Aranovich et al., 2012).

1.2.5 Unified model

The “unified model” represents an expansion of the embedded together model, and

postulates that there are two modes via which BCL-2 proteins are able to block

MOMP (Llambi et al., 2011) (Figure 3D). In mode 1, activator BH3 proteins are

sequestered by the pro-survival BCL-2 proteins; whereas in mode 2, the effectors

15

themselves, active BAX and BAK, are bound and sequestered by anti-apoptotic BCL-

2 proteins. In this model, mode 1 is deemed inefficient as BH3 sensitizers can easily

overcome it, hence promoting MOMP. This model is also consistent with the known

roles of BAX and BAK in the division and fusion of mitochondria without initiating

MOMP. The unified model thus serves to link the regulation of MOMP and

mitochondrial dynamics.

Understanding the various models of BCL-2 protein interactions allows us to have a

structured summary of how BCL-2 proteins are known to act in concert to promote

MOMP. This is especially important in establishing the identity of various BCL-2

proteins during cellular development which I will explore next.

16

1.3 BCL-xL

Being a member of the BCL-2 gene family, BCL-xL maps to chromosome 20q11.21

(Boise et al., 1993). BCL-xL is able to undergo isoform splicing, leading to 2 different

proteins translated, the anti-apoptotic BCL-xL (233 residues) and the smaller residue

BCL-xS (170 residues) (Boise et al., 1993). BCL-xL consists of BH1-4 domains which

Figure 3. Diagram showing the different activation models of BCL-2 family. (A) Direct activation

model – BH3-Activators (BH3-A) bind to BAX/BAK. The BH3-Sensitisers (BH3-S) actively binds to the

anti-apoptotic proteins. BH3-A initiate activation BAK/BAX to induce mitochondrial outer membrane

permeabilization (MOMP). (B) Displacement model – BAX/BAK are constitutively expressed and they

promote MOMP by oligomerization. In this model, BAX/BAK are restrained by the anti-apoptotic

proteins. To induce MOMP through the freeing of BAX/BAK, the correct combination of BH3 proteins

must be bounded to the various anti-apoptotic proteins. (C) Embedded together model – The reversible

binding interactions between the BCL-2 proteins are regulated by local affinities and protein

concentrations. The membrane lipid bilayer plays a major role in this model. At different intracellular

membranes, the different concentrations of subsets of BCL-2 proteins change the binding dynamics to the

membrane bilayer and binding equilibria between the members. Both BH3-A and BH3-S can sequester

anti-apoptotic proteins and the anti-apoptotic proteins can sequester BH3 proteins and BAX/BAK at the

membrane or by preventing them to bind at the membrane level. (D). Unified model – In this model, anti-

apoptotic proteins has dual functions; sequester BH3-A (mode 1) and BAX/BAK (mode 2). However,

inhibition through mode 1 is considered less efficient.

17

are four distinct BCL-2 homology (BH) domains. An additional transmembrane region

allows it to localize to several cell compartments such as endoplasmic reticulum, outer

membrane and nuclear envelope. (Boise et al., 1993, Ng et al., 1997, Schmitt et al.,

2007). However, BCL-xS lacks the BH1 and BH2 domains (Boise et al., 1993, Fang et

al., 1994) and is mostly implicated in developmental apoptosis and pharmacological

cell death (Heermeier et al., 1996, Willimott et al., 2011).

Together with BCL-2, BCL-xL was originally involved in the capability to mediate

antioxidant effects (Hockenbery et al., 1993, Kane et al., 1993). However, the current

model favors both of them suppressing apoptosis by sequestering the pro-apoptotic

BAX and BAK in inhibitory interactions (Oltvai et al., 1993, Yang et al., 1995).

Hence, the rheostat model proposed in 1993 showed that apoptosis is largely

determined by the intrinsic equilibrium between anti- and pro-apoptotic BCL-2

proteins (Korsmeyer et al., 1993). An example of how BCL-xL exerts its pro-apoptotic

influence is seen when BCL-xL is able to inhibit the formation of pro-apoptotic

cystolic Ca2+ waves, ultimately decreasing the limit of ER Ca2+ stores. However, this

effect can be negated by BAK (Distelhorst and Bootman, 2011, Oakes et al., 2005,

Rong and Distelhorst, 2008). BCL-xL also regulates mitochondrial permeability

transition-dependent apoptosis by governing VDAC1 (Shimizu et al., 1995, Vander

Heiden et al., 2001, Vander Heiden et al., 1999).

1.4 BIM (BCL2L11)

Bim was first discovered in 1998 when researchers screened a bacteriophage lamda

cDNA expression library with recombinant Bcl-2 as a bait (O'Connor et al., 1998). In

lymphoid cells, BIM is highly expressed (O'Reilly et al., 2000). Bim-knockout mice

exhibit lymphoid hyperplasia which indicates that BIM is critical for the killing of

18

autoreactive thymocytes (Bouillet and Strasser, 2002) and B cells (Enders et al., 2003).

Also, these knockout mice exhibit a high titer of antibodies which eventually leads to

autoimmune kidney disease (Bouillet et al., 1999). Bim-knockout in hematopoietic cell

types showed resistance to cytotoxic conditions such as deprivation of cytokines and

exposure to glucocorticoids and taxol-induced killing (Bouillet et al., 1999). In a study

on patients with chronic myeloid leukemia, a deletion polymorphism in BIM was

observed and this changes the alternative splicing of the mRNA. This deletion

polymorphism with a 12.3 % minor allele frequency in East Asian individuals has

been shown to protect against apoptosis (King Pan Ng et al., 2012).

BIM can undergo differential splicing, resulting in three major isoforms (BIML,

BIMEL and BIMS). Among the three isoforms, BIMS is the most potent isoform and

is difficult to detect in vivo (O'Connor et al., 1998). Apart from these three isoforms,

other minor isoforms have also been cloned and characterized. In 2005, Adachi et al.

proposed a name standardization to the minor isoforms of BIM (Adachi et al., 2005).

As of current, there are 16 isoforms of BIM which are summarized in Figure 2 above.

BH3 domain is present in exon 8 (E8). In BIM intron 2, a 2903 bp deletion

polymorphism was found to favour splicing to exon 3 and this results in the

impairment of BIM’s role in apoptosis (Juan et al., 2014).

19

Figure 4. The various isoforms of BIM. Most common forms of BIM isoforms are BIML, BIMEL

and BIMS.

Adapted from Ronit Sionov et al. Regulation of Bim in health and disease. Oncotarget. 2015 Sep;

6(27): 23058–23134.

1.5 Role of splicing in BCL-2 family proteins

Several BCL-2 family members can undergo alternative splicing and hence, have their

activity modulated by post-transcriptional modifications. The anti-apoptotic BCL-2

can undergo alternative splicing to become BCL-2α and BCL-2β. BCL-2α is highly

expressed in B-cell lymphoma with t(14:18) translocation and this confers high level

of stress-resistance on the cells, improving their survival (Tsujimoto, 1989). BCL-2β

has a lower expression in healthy cells as compared to BCL-2α. However, it was

reported that there is an increased ratio of BCL-2β expression in both blood and bone

marrow of CML patients (Llambi et al., 2016). The anti-apoptotic BCL-xS is the pro-

apoptotic isoform of BCL-xL and its role mainly lies in inhibiting BCL-2, preventing

20

cell survival. It is generally expressing in cells with high turnover rate (Boise et al.,

1993) and can also sensitise cells to chemotherapy agents (Sumantran et al., 1995).

There are 3 isoforms of MCL-1; MCL-1L (MCL-1 Long), MCL-1S (MCL-1 Short)

and MCL-1ES (MCL-1 Extra Short). MCL-1L expression is increased when cells are

exposed to tumorigenic compounds, inducing cell survival (Belka and Budach, 2002,

Kozopas et al., 1993). MCL-1S is a pro-apoptotic isoform of MCL-1 which is encoded

by splicing out exon II in MCL-1 (Bae et al., 2000). The shortest isoform of MCL-1 is

known as the pro-apoptotic MCL-1ES and it interacts with MCL-1L to induce

mitochondrial cell death (Kim et al., 2009). Both pro-apoptotic MCL-1S and MCL-

1ES are lowly expressed in oral cancer tissues as compared to MCL-1 (Czabotar et al.,

2007).

As for the pro-apoptotic BCL-2 family members, there are multiple spliced variants in

Bax gene (Akgul et al., 2004, Oltvai et al., 1993). The inactive form of Baxα is

localised in the cytosol or embedded on the outer mitochondrial membranes in healthy

cells (Nechushtan et al., 1999). Upon stimuli by other pro-apoptotic members such as

Bim and tBid (Cartron et al., 2004, Marani et al., 2002), the N- and C-terminal region

of Baxα unfolds. This results in Baxα translocating from the cytosol to mitochondria,

ultimately leading to permeabilization of the outer mitochondrial membrane (Eskes et

al., 2000, Annis et al., 2005). The other isoform of Bax, Baxβ, exists in a constitutively

active conformation and is able to trigger cytochrome c release from the mitochondria.

Knockdown of Baxβ using shRNA desensitises Bax-dependent apoptosis signalling in

HCT116-Bax+/- cells. Taken together, therapeutic strategies could be designed by

targeting the spliced isoforms of Bax.

21

Another pro-apoptotic gene, Bak has a spliced variant N-Bak (Neuronal Bak) which is

only present in the neurons (Sun et al., 2001, Wong et al., 2005).

However, not much work is done on assessing the roles of the various members of

BCL-2 alternatively spliced isoforms on pancreatic progenitors and pancreatic β-cells.

In this project, I have cloned in the spliced isoforms BIMEL, BIML and BIMγ into the

pCDH-MSCV-MCS-EF1α-GFP vector. The expressed genes are already in their

spliced variants, hence, these isoforms will not be further spliced.

1.6 Role of members of the BCL-2 family in pancreatic development

Among the many members of the BCL-2 family of proteins, I am focusing on BCL-xL

and BIM. Understanding the functions of BCL-xL and BIM in pancreatic development

and β-cells would give us further insights into how BCL-2 family of proteins is used to

enhance generation of pancreatic progenitors and β-cells. There have been very limited

BCL-xL-related studies on pancreatic development of β-cells. One group has shown

that high expression of BCL-xL in β-cells is able to prevent cell death but ultimately,

the β-cells exhibit impairment of mitochondrial signal for insulin secretion (Zhou et

al., 2000). Mouse islets β-cells that lack BCL-xL develop normally and they are

especially hypersensitive to apoptotic stimuli (Carrington et al., 2009). Elevated

expression of BCL-xL, but not BCL-2, were also discovered in human islets post-

isolation, strongly highlighting the function of BCL-xL in regulating prosurvival in

human islets (Campbell et al., 2012). Both BCL-xL and BCL-2 have also been found

to repress glucose signaling in pancreatic β-cells (Luciani et al., 2013). To our

knowledge, there have been no reports on the roles of BCL-xL in pancreatic

development. This represents a huge research gap that I hope to fill through exploring

the role of BCL-xL using hPSC as a model to generate pancreatic progenitors. In

22

doing so, I seek to identify the non-canonical roles of BCL-xL in pancreatic

specification.

For BIM, I focused on BIML, BIMEL and BIMγ. The three BIM isoforms are depicted

in Fig 5. The BIML and BIMEL isoforms contain exon 8 in which reference (Ng et al.,

2012) refers to as exon 4. Therefore, exon 8 will be referred to as exon 4 from this

point onwards. The BH3 domain lies in the exon 4. However, exon 4 is absent in the

BIMγ isoform. In many studies, the BH3 domain has been shown to bind to anti-

apoptotic members and induce apoptosis (Huang and Strasser, 2000, Chen et al.,

2005a, Certo et al., 2006, Ku et al., 2011).

BIM transcript was shown to be upregulated in isolated human islets (Campbell et al.,

2012) and there have been very limited studies involving the modulation of BIM

expression in apoptosis in various cellular systems such as mouse and human

pancreatic β-cells (Nogueira et al., 2013, Santin et al., 2011, Colli et al., 2011a, Miani

et al., 2013b). BIML and BIMEL are expressed at an elevated level in the endocrine

cells as compared to the acinar cells (O'Reilly et al., 2000).

The modulation of BIM expression has also been observed to initiate apoptosis in

various cellular models, including mouse and human pancreatic β-cells. The

knockdown of GLIS1, a susceptibility gene for Type I diabetes (T1D) and Type II

diabetes (T2D), is able to activate apoptosis via modulation of BIM, favoring the

expression of BIMS which is the most potent splice variant of BIM (Nogueira et al.,

2013). PTPN2 upon inhibition was found to modulate pancreatic β-cell apoptosis

through JNK1-induced phosphorylation of BIM at Ser65. The phosphorylation at BIM

Ser65 in combination with exposure to IFN-γ leads to β-cells death (Santin et al.,

2011).

23

The inhibition of BIM by siRNAs in β-cells also prevented the activation of the

caspase cascade and cell death, when infected with the diabetogenic virus CVB5. This

implicates BIM in playing a role in apoptosis following viral invasion of β-cells (Colli

et al., 2011b). When β-cells were incubated with cyclopiazonic acid (CPA) + IL-1β, it

was found that the apoptotic rate was decreased when BIM was silenced. They

concluded that crosstalk between ER stress and IL-1β sensitizes β-cells to apoptosis

through an imbalance of anti-apoptotic A1 and pro-apoptotic BIM (Miani et al.,

2013a). These evidence suggest BIM has a critical function in governing β-cells death.

Other BCL-2 family of proteins are also implicated in pancreatic development.

Various cell death signals can induce high expression of Bax protein and is widely

considered a critical event in β-cell apoptosis (Grunnet et al., 2009, Tonnesen et al.,

2009). Using cytokines, Bax protein expression was also upregulated, resulting in a

high Bax/Bcl-2 ratio, favoring a cytokine-induced apoptotic fate for primary rat islets

(Mehmeti et al., 2011). Bax expression was also highly increased during islet isolation

procedure, suggesting that the physical stress of islet isolation also led to an apoptotic

fate in human islets (Thomas et al., 2002). Bax, rather than Bak, has been shown to

play a key role in pancreatic β-cell death upon Pdx-1 knockdown (Sun et al., 2016).

This suggests that Bax is important in regulating pancreatic β-cell apoptosis. Using a

high glucose concentrations as a long-term model of metabolic stress on β-cells, Bim,

Puma and Bax are upregulated and contributed to apoptosis in β-cells (McKenzie et

al., 2010).

Upon exposure to cytokines, Bcl-2, an anti-apoptotic factor, is decreased in mouse and

human pancreatic β-cells (Piro et al., 2001, Trincavelli et al., 2002, Van de Casteele et

al., 2002). Bcl-2 was also overexpressed in pancreatic β-cells and this led to protection

against cytokine-mediated apoptosis in these cells (Barbu et al., 2002, Rabinovitch et

24

al., 1999). Forced Bcl-2 expression also protects mouse islet against apoptosis but was

unable to inhibit autoimmune-induced apoptosis (Allison et al., 2000).

In response to cytokine-induced toxicity, Mcl-1 was implicated in protecting human

and rodent pancreatic β-cells against apoptosis (Meyerovich et al., 2017). However,

the ablation of Mcl-1 does not affect the development and functions of islets in mice.

A combination of cytokines, palmitate and ER stressors also decreased Mcl-1

expression in β-cells, resulting in apoptosis (Allagnat et al., 2011). This evidence

strongly highlights Mcl-1 as a possible drug target in diabetes treatment.

In order for BCL-2 family proteins to become activated for β-cell survival or

apoptosis, I looked at the ER which is crucial for folding and modification of proteins.

1.7 Role of BCL-2 family in other cell lineages

In the hepatocyte lineage, pro-apoptotic members such as Bak, Bad and Bax exhibit an

early decline in transcript levels during liver regeneration induced by partial

hepatectomy. On the other hand, Bcl-xl transcripts were increased, peaking at 12, 24

Figure 5. The three BIM isoforms used in this study. The gene structure of BIM-γ, BIML and

BIMEL containing different exons. BIM-γ is hypothesized to be the non-apoptotic version whereas

BIML and BIMEL are hypothesized to be the pro-apoptotic version as they contain the exon 8

domain. Exon 8 will therefore be referred to as Exon 4 in this thesis.

25

and 48 to 72 h, suggesting its role as a delayed early response gene during liver

regeneration (Tzung et al., 1997). Knockout of Bcl-w and Bfl-1/A1 in mice resulted in

the absence of liver (Hamasaki et al., 1998, Print et al., 1998, Rosse et al., 1998).

In the kidney cell lineage, mice which lacks Bcl-2 exhibit polycystic kidney disease

and eventually die around 4-16 weeks of age (Veis et al., 1993, Nakayama et al.,

1994). Bcl-2 knockout mice are born with normal hair colour but it rapidly turns to

grey coat colour (Veis et al., 1993, Nakayama et al., 1994, Kamada et al., 1995). This

gradual transit in colour change is attributed to the loss of melanocytes that produced

melanin (Yamamura et al., 1996). At the end of 5-6 weeks of the hair follicle cycle,

the melanin level in Bcl-2 knockout mice is comparable to that of albino mice

(Yamamura et al., 1996).

In the hematopoietic system, MCL-1 is shown to be critical for the survival of

common lymphocyte progenitor which gives rise to both B and T lymphocytes

(Opferman et al., 2005). Many other lymphocytes such as pro-B, pro-T cells, naïve,

effector, T-regulatory, memory B and T cells also require MCL-1 for survival

(Opferman et al., 2003, Dzhagalov et al., 2008, Vikstrom et al., 2010, Tripathi et al.,

2013, Pierson et al., 2013). Loss of anti-apoptotic BCL-xL in immature CD4+CD8+

thymocytes results in apoptosis and inhibits proper development of single-positive

thymocytes in chimeric animals (Ma et al., 1995). In Bcl-2 knockout mice, mature

lymphocytes undergo apoptosis due to the triggering of pro-apoptotic stimuli that

results in the expression of BIM (Bouillet et al., 2001). These studies point to the

importance of anti-apoptotic Bcl-2 family proteins in the survival of lymphocytes.

26

1.8 The unfolded protein response and apoptotic pathways in mediating

pancreatic β-cell failure in diabetes

The endoplasmic reticulum (ER) is a special cellular organelle involved in synthesis of

proteins and lipids. Proteins that are made in the ER may not be correctly folded,

forming aberrant structures. The accumulation of these incorrectly folded proteins may

result in aggregation in the ER lumen, resulting in ER stress and ultimately, UPR

activation (Pirot et al., 2007, Marciniak and Ron, 2006, Zhang and Kaufman, 2006).

The ER stress are able to induce UPR and this has been implicated in β-cell loss in

diabetes (type I and II) (Cnop et al., 2005). The three UPR pathways, PERK, IRE1α

and ATF6 gave crucial roles in the biosynthesis of proteins, and act to increase ER

capacity to buffer the stress load during increased protein synthesis (Elouil et al., 2007,

Lipson et al., 2006). However, prolonged stimulation of these pathways eventually

causes an impairment of β-cell function and apoptosis. Downstream of ER stress

pathways, CHOP (DNA-Damage-Inducible Transcript 3) belongs to the C/EBP

(CCAAT-enhancer-binding proteins) family (Oyadomari and Mori, 2004, Cao et al.,

1991) and its expression is increased under stress conditions.

There are several chemical inducers that can be used to bring about UPR. Examples

include tunicamycin and thapsigargin. Tunicamycin is commonly used in biological

studies to inhibit N-linked glycosylation, inducing UPR and arrest in G1 cell cycle

phase (Heifetz et al., 1979). Thapsigargin,is able to inhibit sarcoplasmic/endoplasmic

reticulum Ca2+-ATPase (SERCA) and it is also able to induce UPR and apoptosis in

β-cells (Cardozo et al., 2005, Zhou et al., 1998). The depletion of Ca2+ reduces the

quality of ER protein folding, leading to apoptosis via CHOP-10 upregulation

(Oyadomari et al., 2001).

27

As T1D is an autoimmune disease, the autoreactive T cells also play a key role in

mediating the destruction of beta cells in the body. In the asymptomatic phase of T1D,

T cell responses to autoantigens and autoantibody can be detected in suspected

patients (Ziegler et al., 2013). About 50-60% of genetic risk for T1D is derived from

HLA allele which encodes molecules which are implicated in the presentation of

antigen peptides to T cells (Noble et al., 2010). In T1D patients, autoreactive T cells

exhibit proinflammatory cytokine profiles (Chujo et al., 2013, van Lummel et al.,

2014). T1D patients also show dysregulation in peripheral tolerance including

impaired Treg function (Buckner, 2010, Ferraro et al., 2011) and effector T cell

resistance to Treg suppression (Schneider et al., 2008). Furthermore, the progression

of T1D can also be delayed by using immunosuppressive drugs which are targeted to

T cells (Bougneres et al., 1988).

Infiltrating immune cells release cytokines which are critical regulators of β-cell

apoptosis in T1D. The combination of TNF-α and/or IL-1β in combination with IFN-γ

induce production of nitrous oxide (NO) which in turn causes severe dysfunction and

death of β-cells (Eizirik and Mandrup-Poulsen, 2001, Southern et al., 1990, Welsh et

al., 1991, Eizirik et al., 1992). Apoptosis induced by the various cytokines is

modulated by several transcriptional cascades including genes such as NF-kB and

STAT-1 (Cardozo et al., 2001a, Cardozo et al., 2001b, Kutlu et al., 2003, Gysemans et

al., 2005, Eldor et al., 2006, Callewaert et al., 2007, Cnop et al., 2005). IL-1β and IFN-

γ are able to reduce SERCA expression in primary β cells and rat INS-1E cells,

thereby diminishing calcium ion stores in the ER (Cardozo et al., 2005). Certain

cytokines, including IL-1β and IFN-γ, can induce ER stress response by activating

IRE1α and eIF2a/ATF4/CHOP-10/BIM (Pirot et al., 2007, Cardozo et al., 2001b,

Kutlu et al., 2003, Cardozo et al., 2005). IFN-γ is able to decrease sXBP1 (spliced

28

XBP1) mRNA expression while augmenting CHOP-10 and ATF4 expression (Pirot et

al., 2006, Rasschaert et al., 2003). This results in a decrease of β-cell defense against

ER stress, favoring pro-apoptotic cues such as the expression of CHOP-10 and other

ATF4-dependent factors.

The BCL-2 family proteins are critical in downstream of ER stress pathways. Under

ER stress response, their expression increases rapidly and activates several

downstream genes; BIM, PUMA, NOXA and BCL-2. Several of them have been

observed to promote the demise of β-cells during ER stress (Reimertz et al., 2003,

Morishima et al., 2004, Mathai et al., 2005, Li et al., 2006). In the mitochondria, BAX

and BAK regulate outer mitochondria membrane permeability by undergoing

oligomerization when the cell is committed to apoptosis (Hsu et al., 1997, Gross et al.,

1998, Desagher et al., 1999, Griffiths et al., 1999, Wei et al., 2000, Makin et al., 2001).

Once the outer membrane is breached, cytochrome C is released and becomes bound

to procaspase 9 and APAF1, forming an apoptosome complex (Chinnaiyan, 1999, Hill

et al., 2004). This eventually activates the main activator, caspase 9 then further trigger

the activation of caspases 3 and 7 and through a series of downstream processes,

coordinate the destruction of the cell (also known as apoptosis) (Slee et al., 1999).

29

Figure 6. Pancreatic β-cells undergoing ER stress upregulate the BCL-2 family of proteins.

The 3 arms of the UPR (PERK, IRE1α, ATF6) are located in the ER membrane. They initiate

signaling events which serve to either increase or reduce protein load on the ER. PERK is able to

phosphorylate eIF2α which functions in shutting down global protein translation and increase

ATF4 expression. ATF4 induces transcription of selected genes whose function involves restoring

proteostasis. This creates a feedback mechanism leading to eIF2α dephosphorylation, reinitiating

protein translation. Activated cytosolic domains of IRE1α excise a 252bp intron from XBP1,

resulting in sXBP1. sXBP1 is able to upregulate UPR stress genes by binding directly to stress

promoters in the nucleus. ATF6 is exported to the golgi which is cleaved by protease to form

(ATF6 p50). ATF6 p50 acts as a transcription factor, inducing transcription of genes involved in

the UPR.

30

1.9 Hypotheses

I hypothesize that there are changes in the transcript and protein expression level of

the BCL-2 family of genes during differentiation of human embryonic stem cells into

the pancreatic lineage. The perturbation of certain members of BCL-xL through

chemical inhibition/ lentiviral-mediated knockdown will lead to a change in cell

lineage specification. I also hypothesize that modulation of BIM isoforms would

provide protective effects against apoptosis in mouse pancreatic β-cells and human

islets.

1.10 Specific aims

Aim 1: To determine the expression profile of BCL-2 family members during

pancreatic lineage differentiation and ascertain their role and function

Methodology 1: Differentiate human pluripotent stem cells (hPSC) into pancreatic

lineage and perform RT-QPCR/ western blot to assess the BCL-2 transcript and

protein levels at 8 different timepoints.

Aim 2: To perturb the expression level of BCL-xL during pancreatic differentiation to

study its role and function

Methodology 2: Inhibit BCL-xL using chemical inhibitors/ lentiviral-mediated

knockdown and perform RT-QPCR and western blot to assess specific pancreatic

markers level.

31

Aim 3: To understand the role of various BIM isoforms in pancreatic beta cells

Methodology 3: Overexpress various BIM isoforms in mouse pancreatic beta cells

and human islets and perform RT-QPCR and western blot to assess the protective

effects against apoptosis.

32

2 Materials and Methods

2.1 Materials

2.1.1 Cell lines

The cell samples were periodically sent for mycoplasma contamination checks.

H9 and iAGb were confirmed to have normal karyotype.

MIN6 cells were confirmed to be glucose-responsive by a fellow lab colleague, Miss

Shabrina.

Cell Lines Source Cat. No.

Mouse: CF-1 mouse

embryonic fibroblasts

MTI-GlobalStem GSC-6001G

Human ESC W09 (Female) WiCell Research Institute,

Inc

15-W0038

Human iPSCs iAGb (Male) Reprogrammed from

fibroblast AG16102,

Coriell Institute

N/A

HEK293FT Thermo Fisher Scientific R70007

MIN6 AddexBio C0018008

Human Islets Alberta Islet Distribution P

rogram

NA

2.1.2 Antibodies

All antibodies were from purchased Cell Signaling Technology (Danvers, MA, USA),

Santa Cruz Biotechnology (Santa Cruz, CA, USA), R&D Biosystems (Minneapolis,

MN, USA), Abcam (Cambridge, UK), Sigma-aldrich, Thermo Fisher Scientific

(Waltham, Massachusetts), Millipore (Burlington, MA).

Table 2: List of antibodies used

Antibodies Source Cat. No./ RRID

Anti-β-Actin (Mouse

monoclonal)

Sigma A5441;

RRID:AB_476744

https://www.google.com/search?q=Burlington,+Massachusetts&stick=H4sIAAAAAAAAAOPgE-LSz9U3MKoyLjMtUuIEsQ1zjXILtbSyk63084vSE_MyqxJLMvPzUDhWGamJKYWliUUlqUXFi1glnUqLcjLz0kvy83QUfBOLixOTM0qLU0tKigEHNoUTYQAAAA&sa=X&ved=2ahUKEwiiwdGoo9niAhUqCTQIHZCvCusQmxMoATAXegQIChAL

33

Anti-BAX [2D2] Mouse

monoclonal

Abcam Ab77566;

RRID:AB_1565901

Anti-BAX (Rabbit

polyclonal)

Cell Signaling Technology #2772S;

RRID: AB_10695870

Anti BAK [AT8B4] (Mouse

monoclonal)

Abcam Ab104124;

RRID:AB_10712355

Anti-BAK (Rabbit

polyclonal)


RRID: AB_2290287

Anti -BCL-xL [EPR16642]

(Rabbit monoclonal)

Abcam Ab178844;

RRID: NA

Anti-BCL-xL (Rabbit

polyclonal)


RRID: AB_10694844

Anti-BCL2 [EPR17509]

(Rabbit monoclonal)

Abcam Ab182858;

RRID: AB_2715467

Anti-BCL2 (Rabbit

polyclonal)

Cell Signaling Technology #2876;

RRID: AB_2064177

Anti-BIM (Rabbit

polyclonal)


RRID: AB_10692515

Anti-Caspase 3 (Rabbit

monoclonal)

Abcam Ab13847;

RRID:AB_443014

Anti-Caspase 3 (Rabbit

polyclonal)


RRID: AB_10694681

Anti-GATA4 [6H10] (Mouse

monoclonal)

Thermo Fisher Scientific MA5-15532;

RRID: AB_10989032

Anti-HNF1B (Goat

polyclonal)

Abcam Ab59118;

RRID:AB_945772

Anti- HNF4α (Rabbit

monoclonal)


RRID:AB_2295208

Anti-MCL1 (Rabbit

polyclonal)


RRID: AB_2281980

Anti-PAX6 [AD1.5] (Mouse

monoclonal)

Millipore Ab570718;

RRID:AB_570718

Anti-PDX1 (Goat

polyclonal)

R&D Systems Af2419;

RRID:AB_355257

Anti-PUMA (Rabbit

polyclonal)


RRID: AB_2064551

Anti-SFRP5 (Rabbit

polyclonal)

Abcam Ab230425;

RRID: NA

Donkey Anti-Mouse IgG

(H+L) Highly Cross-

Adsorbed secondary

antibody, Alexa Fluor Plus

647

Invitrogen Ab32787;

RRID: AB_2762830

Goat Anti-Mouse IgG HRP Santa Cruz sc-2005;

RRID: AB_631736

Donkey Anti-Rabbit IgG

(H+L) Alexa Fluor 488

Invitrogen A21206;

RRID:AB_2535792

Goat Anti-Rabbit IgG HRP Santa Cruz sc-2004;

RRID: AB_631746

34

Donkey Anti-Goat IgG

(H+L) Cross-Adsorbed, Alex

Fluor 488

Thermo Fisher Scientific A11055;

RRID: AB_2534102

Donkey Anti-Mouse (H+L)

Highly Cross-Adsorbed,

Alex Fluor 488

Thermo Fisher Scientific A21202;

RRID: AB_141607

2.1.3 Chemicals, peptides, media, reagents, assays and buffers

Table 3: Chemicals, peptides, media, reagents, assays and buffers

Chemical, peptides, media,

reagents, assays and buffers

Source Cat. No.

Activin A R&D system 338-AC-50

ALK5ill ENZO ALX-270-445-M001

Ascorbic acid Sigma A8960

Betacellulin Cell Signaling 5235SF

B-27™ Serum Minus

Vitamin A

Thermo Fisher Scientific #12587010

β-mercaptoethanol Thermo Fisher Scientific 21985-023

Calcium chloride Sigma C-5670

CHIR9021 Tocris 4423

CMRL 1066 Supplemented Mediatech Inc 99-603-CV

CMRL Medium 1066 Life Technologies 11530-037

Collagenase IV Life Technologies 17104019

Coverslips

18 x 18 mm

Marienfeld 0101030

DAKO mounting medium DAKO S3023

DAPI Sigma D9542

DAPT Abcam Ab120633

Dispase in DMEM/F12 STEMCELL Technologies 07923

D(+)-Glucose WAKO 049-31165

Donkey serum Merck S-30

DMEM F12 media Invitrogen 10565042

DMEM/High Glucose Media Hyclone SH30243.01

DMSO Sigma D2650

FAF-BSA Proliant 68700

FGF2 Miltenyi Biotec 130-093-838

FGF7 Mitenyi Biotec 130037178

Gelatin (Porcine) Sigma G1890

GlutamaxTM Supplement Invitrogen 35050038

HEPES Buffer 1M STEMCELL Technologies 07200

HyClone Phosphate Buffered

Saline solution

GE Healthcare Life

Sciences

SH30256.01

HycloneTM Foetal Bovine Hyclone SV30160.03

35

Serum (South America)

IFN-γ Biolegend 713906

IL-1β Biolegend 579406

ITS-X Life Technologies 51500056

KnockOut™ serum

replacement

Gibco 10828028

LDN193189 Sigma SML0559

L-Glutamine Sigma G8540

36

LipofectamineTM 2000

Transfection Reagent

Invitrogen 11668027

LY294002 LC labs L-7962

MCDB131 Life Technologies 10372019

MEM non-essential amino

acids (100X)

Life Technologies 11140-050

M-PER™ Mammalian

Protein Extraction Reagent

Thermo Fisher Scientific 78501

mTESRTM1 Basal Medium STEMCELL Technologies 85851

NaHCO3 Sigma S5761-500G

NheI New England Biolabs R3131

PDBu Tocris 4153

Penicillin-Streptomycin Thermo Fisher Scientific 15140122

Polybrene Millipore TR-1003-G

Retinoic Acid WAKO 186-01114

RPMI-1640 Gibco 11875093

SANT1 Santa Cruz Sc-203253

SuperFrost Plus™ Adhesion

slides


TeSRTM-E8TM Basal Medium STEMCELL Technologies 05990

TeSRTM-E8TM 25X

Supplement

STEMCELL Technologies 05992

Thapsigargin Cayman Chemical 10522-1

Tunicamycin Sigma T7765

TNF-α Biolegend 717904

TrypLE Express Life Technologies 12604021

Trypsin-EDTA (0.25 %) Life Technologies 25200056

T3 Millipore 642511

Vitamin B3 (Nicotinamide) Sigma N0636-100G

Vitamin C (L-Ascorbic acid) WAKO 012-04802

WEHI-539 ApexBio A3935

XhoI New England Biolabs R0146

XXI (Gamma-Secretase

Inhibitor)

Millipore 565790

Y-27632 STEMCELL Technologies 72302

Critical commercial assays Source Cat. No.

High Capacity cDNA

Reverse Transcription Kit

Applied Biosystems 4368813

iTaq™ Universal

SYBR® Green Supermix

Bio-Rad 1725124

Lenti-XTM p24 Rapid Titer

Kit

Clontech 632200

NucleoBondⓇ Xtra Midi Macherey-Nagel 740410.50

NucleospinⓇ Plasmid

EasyPure

Macherey-Nagel 740727.250

Phusion High-Fidelity DNA

Polymerase

Thermo Fisher Scientific F530S

37

PierceTM BCA Protein Assay

Kit


PureLinkTM Quick PCR

Purification Kit

Invitrogen K310002

RNA isolation NucleospinⓇ

RNA

Macherey-Nagel 740955.250

Seahorse XF Base Medium Agilent 102353-100-100

Seahorse XF Glycolysis

Stress Test Kit

Agilent 103020-100

Seahorse XF Mito Stress Kit Agilent 103015-100

SuperSignalTM West Dura

Extended Duration Substrate


2.1.4 Softwares, instruments and algorithms

Table 4: Softwares, instruments and algorithms

Softwares, instruments and

algorithms

Source Cat. No.

AxioVision LE Zeiss Version 4.8.2

Bio-Rad CFXTM Manager Bio-Rad Version 3.1

FlowJo 10 FlowJo Version 10

Seahorse XFe96 Analyzer Agilent S7800B

Seahorse Wave Desktop

Software

Agilent Version 2.6.1

Others

CFX384TM Real-Time

System

Bio-Rad 1855485

Coverslips

18 x 18 mm

Marienfeld 0101030

NanoDrop 1000

spectrophotometer

Thermo Fisher Scientific V 3.8

Nikon Eclipse Inverted Nikon TS-100

Olympus Fluoview 1000

Inverted Confocal

Olympus FV1000

Optima L-100 XP

Ultracentrifuge

Beckman Coulter L-100 XP

SuperFrost Plus™ Adhesion

slides

Thermo Fisher Scientific

10149870

SW28 Ti Swinging-Bucket

Aluminium Rotor

Beckman Coulter 342207

Ultra-Clear tubes Beckman Coulter 344058

https://www.nikon.com/products/microscope-solutions/support/download/brochures/pdf/2ce-mqlh-6.pdf

38

2.2 Mammalian cell cultures and differentiation

2.2.1 Mouse embryonic fibroblasts

Mouse embryonic fibroblasts were cultured in DMEM high glucose with GlutaMAX

supplement, 10 % foetal bovine serum (FBS) and 1 % Non-essential amino acid

(NEAA).

2.2.2 hPSC and iAGb

H9, a human embryonic stem cell line (WiCell Research Institute, Inc) and iAGb, a

human induced pluripotent stem cell line (Coriell Institute) were cultured in feeder-

free condition using TeSR™-E8™ basal medium and TeSR™-E8™ 25X Supplement

(STEMCELL Technologies). Media were changed daily and cells were passaged once

a week when confluent.

2.2.3 17 Day differentiation protocol

Undifferentiated human pluripotent stem cells (hPSC) were maintained in DMEM/F-

12 with 15 mM HEPES (STEMCELL Technologies), 20 % KnockOut™ serum

replacement (KOSR), L-Glutamine, NEAA (Life Technologies) and supplemented

with 10 ng/ml FGF2 (Miltenyi Biotec) in 5 % CO2 and 100 % humidity. hPSC media

were replaced every 24 h. hPSC were manually split and seeded on irradiated CF-1

mouse embryonic fibroblasts once a week. At D-2, the cells were washed with PBS

and incubated with Dispase (STEMCELL Technologies) and Collagenase IV (Life

Technologies) for 5 min. The cells were then washed with sterile PBS, scored and

passed through 70 μM cell strainer. For each 10 cm plate, 6 ml hPSC medium was

used to flush the plate and cell suspension collected. The cell suspension was then

dispensed into a 6 well plate and left to incubate for 48 h at 5 % CO2 and 100 %

39

humidity. Cells were differentiated 2 days later in RPMI-1640/2 % B-27 (no vitamin

A; serum-free chemically defined medium (Gibco) supplemented with 1 % GlutaMAX

Supplement (Invitrogen), 1 % MEM non-essential amino acids NEAA (Invitrogen),

0.1 % β-mercaptoethanol (Gibco). The cells were differentiated using the 17D

differentiation protocol listed in Table 8. At the end of the 17D differentiation

protocol, the cells were then harvested at each respective time-point for RNA and

protein analysis. The protocol has been used to generate early pancreatic progenitors

and is based on the following papers as described in (Teo et al., 2016, Teo et al.,

2015b, Teo et al., 2014).

2.2.4 35 Day differentiation protocol

At D-2, confluent hPSC in 10cm dish were washed with sterile PBS and incubated

with 3 ml of TrypLE (Life Technologies) for 3 min. The cells were then washed with

sterile PBS. 5 ml of DMEM/F12 media were then dispensed into the dish to flush the

cells and the cell solution was filtered through 70 μM filter. The cells were centrifuged

at 1200 rpm for 5 min and seeded at 1 million cells/ml in a non-coated plate and left to

incubate for 48 h at 5 % CO2 and 100 % humidity in a shaker at 80 rpm. The cells

were differentiated using the 35D differentiation protocol listed in Table 9. At the end

of the 35D differentiation protocol, the cells were then harvested at each respective

time-point for RNA analysis. The protocol has been used to generate pancreatic β-like

cells and is based on the following papers as described in (Pagliuca et al., 2014).

2.2.5 HEK293FT cell culture

HEK293FT cells were cultured in DMEM High glucose (Life Technologies)

supplemented with 10 % Foetal bovine serum (South America Hyclone) and 1 % Non-

essential amino acid NEAA (Invitrogen).

40

2.2.6 MIN6 cell culture

Mouse β-cell line MIN6 (P24-P37) was cultured in MIN6 media composed of DMEM

high glucose, 15 % FBS, 1 % sodium pyruvate and 55 µM β-mercaptoethanol.

2.2.7 Human islets

Human islets were obtained from the University of Alberta, Canada and cultured in

Miami media overnight before use. For RT-QPCR study, I used 200 islets for each

condition.

2.3 Molecular biology techniques

2.3.1 RNA extraction and RT-PCR

RNA was extracted from the cells using RNA isolation Nucleospin® RNA (Macherey-

Nagel). 350 μl of RA1 buffer was added to each well of a 12-well plate. Cell

homogenates were transferred to spin columns and processed as according to the

manufacturer’s instructions. Purified RNA was quantified using the NanoDrop 1000

spectrophotometer (Thermo Fisher Scientific). A total of 1 μg of RNA was converted

to cDNA using High capacity cDNA Reverse Transcription Kit (Applied Biosystems).

For 1 reaction, the following were mixed, 2 μl 10X RT buffer, 0.8 μl 25X dNTP mix

(100 mM), 2 μl 10X RT random primers, 1 μl MultiscribeTM reverse transcriptase. The

mixture was topped up with respective amount of nuclease-free water to 20 μl. The

protocol is as follows: 25 °C for 10 min, 37 °C for 120 min, 85 °C for 5 min and 4 °C

forever.

41

2.3.2 Quantitative real-time PCR (RT-QPCR)

RT-QPCR was performed on the CFX384 Touch™ Real-Time PCR Detection System

with iTaq™ Universal SYBR® Green Supermix (Bio-Rad). For one RT-QPCR

reaction, the following reagents were mixed, 5 μl SYBR Green Supermix, 300 nM FW

primer, 300 nM RV primer, 1.9 μl nuclease-free water, 2.5 μl cDNA (2.5 ng/μl) to a

final volume of 10 μl. The samples were loaded in duplicate on a 384-well plate

(Applied Biosystems). The thermal cycling condition was as follows: 95 °C for 3 min,

9 °C for 5 s, 60 °C for 30 s, repeated for 40 cycles and then 65 °C for 30 s, 65 °C for 5

s and 4 °C forever. Fold changes were normalized to β-actin gene expression and are

based on relative expression values calculated using the 2-ΔΔC(T) method. RT-QPCR

primers were designed to span exon-exon junction, wherever possible, using Primer-

BLAST (NCBI). Sequences of primers are listed in Tables 4 and 7.

This is the list of steps to design the primers for RT-QPCR.

1. Obtain accession number for gene of interest from NCBI website

2. US database: http://www.ncbi.nlm.nih.gov/

3. Search for ‘species name’ + ‘gene of interest’

4. Accession number starting with NM, look for those with mRNA

5. Go to Primer-Blast (http://www.ncbi.nlm.nih.gov/tools/primer-blast/)

6. Enter accession number

7. qPCR product size: 100-200 bp (minimum 75 bp; maximum ~300 bp)

Tm: 64 °C (min); 65 °C (opt); 66 °C (max)

[*this is to ensure that the Tm of the 2 primers is not too far apart]

Default Tm difference is 2 °C

TA: ~60 °C for universal RT-QPCR reactions

8. For ‘Exon junction span’, choose ‘Primer must span an exon-exon

junction’.

9. Select intron inclusion.

10. Extension time of 30 s should be insufficient to amplify 1000 bp intronic

sequence

11. If result shows no suitable primers, remove the two criteria from the search

12. Enter the correct species (Depends on type of cells)

Get Primers

http://www.ncbi.nlm.nih.gov/

http://www.ncbi.nlm.nih.gov/tools/primer-blast/

42

13. From the result list of the primers, choose 1 pair of primer, take note of the

following:

Product length

14. Exon junction

Check ‘Products on intended target’ to make sure the primers amplify the

gene of interest

15. Ensure that there is NO other different target genes under ‘Products on

potentially unintended templates’

gDNA contains both exons and introns. As for our qPCR experiments, we extracted

the mRNA and converted it to cDNA. Hence, the cDNA only contains the exons

(coding region). No gDNA was detected as gDNA was degraded using on-column

DNAse I.

2.3.3 Protein BCA assay

Cells were washed with PBS and treated with Trypsin for 5 min at 37 °C. Dislodged

cells were neutralized with MEF media and centrifuged at 1500 rpm for 5 min to

obtain the cell pellet. Cell pellet was washed with PBS and centrifuged at 1500 rpm.

The cell pellet was lysed in M-PER mammalian protein extraction reagent (Thermo

Fisher Scientific) in the presence of protease and phosphatase inhibitors (Sigma).

Protein lysates were then quantified using BCA assay kit (Thermo Fisher Scientific).

2.3.4 SDS-PAGE and Western blot

Sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE) was

performed using the Mini-PROTEAN Tetra Cell system (Bio-Rad) at 150 V for 1 h.

40 µg of proteins were then transferred to PVDF membranes (Bio-Rad) at 100 V for 1

h. The blots were then blocked for 1 h in 5 % milk (Anlene non-fat milk) and probed

with the respective primary antibodies and secondary antibodies. Primary antibodies

used in this study: Mouse monoclonal anti-β-actin (1:10000 Sigma, A5541), Rabbit

polyclonal anti-BAX (1:1000, Cell Signaling Technologies, #2772S), Rabbit

43

polyclonal anti-BAK (1:1000, Cell Signaling Technology, #3814S), Rabbit polyclonal

anti-BCL-xL (1:1000, Cell Signaling Technology #2762S), Rabbit polyclonal anti-

BCL2 (1:1000, Cell Signaling Technology #2876), Rabbit polyclonal anti-BIM

(1:1000, Cell Signaling Technology #2819S), Rabbit polyclonal anti-Caspase 3

(1:1000, Cell Signaling Technology, #9662S), Rabbit polyclonal anti-MCL1 (1:1000,

Cell Signaling Technology, #4572), Rabbit polyclonal anti-PUMA (1:1000, Cell

Signaling Technology #4976). Secondary used in this study: Goat anti-rabbit IgG HRP

(1:10000, Santa Cruz, sc-2004), Goat anti-mouse IgG HRP (1:10000, Santa Cruz, sc-

2005). Chemiluminescent signals were detected using Super SignalTM West Dura

Extended Duration substrate (Thermo Fisher Scientific). More information on

antibodies used are in Table 1.

2.3.5 Immunostaining

At the end of each differentiation time-point, cells on coverslips (Marienfeld) were

washed with DPBS and fixed with 4 % paraformaldehyde for 20 min at room

temperature. Cells were blocked with DPBS containing 5 % donkey serum and 0.1 %

Triton X-100 at 4 °C for 1 h before overnight incubation with primary antibodies at 4

°C. Primary antibodies used in this study: Rabbit monoclonal anti-BCL-xL (1:1000,

Abcam, Ab178844), Rabbit monoclonal anti-BCL2 (1:150, Abcam, Ab182858),

Mouse monoclonal anti-BAK (1:1000, Abcam, Ab104124), Mouse monoclonal anti-

GATA4 (1:1000, Thermo Fisher Scientific, MA5-15532), Goat polyclonal anti-

HNF1B (1:100, Abcam, Ab59118), Rabbit monoclonal anti-HNF4α (1:1000, Cell

Signaling Technology #3113), Goat polyclonal anti-PDX1 (1:20, R&D Systems,

Af2419), Rabbit polyclonal anti-Caspase 3 (1:200, Abcam, Ab13847), Cells were

incubated in the dark with secondary antibodies diluted in DPBS containing 0.1 %

Triton X-100 for 1 h at 4 °C before staining with DAPI (Sigma) for 20 min at 4 °C.

44

Secondary antibodies used in this study: Alex Fluor Plus 647 Donkey Anti-Mouse IgG

(H+L) (1:500, Invitrogen, Ab32787), Alexa Fluor 488 Donkey Anti-Rabbit IgG (H+L)

(1:500, Invitrogen, A21206), Alexa Fluor 488 Donkey Anti-Goat IgG (H+L) (1:500,

Thermo Fisher Scientific, A11055), Alex Fluor 488 Donkey Anti-Mouse (H+L)

(1:500, Thermo Fisher Scientific, A21202). The coverslips were mounted onto

SuperFrost Plus™ Adhesion slides (Thermo Fisher Scientific) using DAKO mounting

medium (DAKO). Confocal images were acquired with the Olympus FV1000 inverted

confocal microscope using the Olympus Fluoview v3.1 software. Brightfield images

were acquired with the Axiovert 200M inverted microscope using the Axiovision LE

software version 4.8.2. More information on antibodies used are in Table 1.

2.3.6 Fluorescence-activated cell sorting (FACS)

Differentiated cells were harvested using a cell scraper and dissociated into single cells

following incubation with Trypsin/EDTA at 37 °C. Single cells were collected by

passing the suspension through a 40 µm cell strainer. Cells were pelleted by

centrifugation at 1200 rpm for 5 minutes. Supernatant was aspirated and cells were

washed with DPBS, followed by fixation with 4 % paraformaldehyde on ice for 1 h.

Fixed cells were washed with DPBS before blocking in FACS buffer (5 % FBS in

DPBS) containing 0.1 % Triton X-100 on ice for 1 h. Cells were incubated with

primary antibodies for 1 h at 4 °C and washed with FACS buffer containing 0.1 %

Triton X-100 prior to addition of secondary antibodies. Cells were incubated with

secondary antibodies in the dark for 1 h at 4 °C. After washing, cells were resuspended

in FACS buffer before analysis using the BDTM LSR II Flow Cytometer. Data analysis

was performed using the FlowJo 7.0 software.

45

2.3.7 Subcloning of plasmids

Plasmids containing the various BIM gene isoforms (BIML, BIMEL and BIMγ) were

kind gifts from our collaborator Dr Ong Sin Tiong at Duke-NUS. Forward and reverse

primers containing NheI (GCTAGC) and XhoI (CTCGAG) restriction sites were

designed. PCR was performed using Phusion High-Fidelity DNA Polymerase. The

relevant bands were excised from the gels and subcloned into pCDH-CMV-MCS-

EF1a lentiviral vector.

For subcloning of BCL-xL and SFRP5, forward and reverse primers containing NheI

(GCTAGC) and XhoI (CTCGAG) restriction sites were designed. BCL-xL and SFRP5

were amplified through PCR using Phusion High-Fidelity DNA Polymerase. BCL-xL

and SFRP5 band were excised from the gel and subcloned into pCDH-CMV-MCS-

EF1a lentiviral vector.

2.3.8 Transfection/ Overexpression rescue studies

HEK293FT/MIN6 cells were seeded onto 6 cm plates and rested overnight. For each

reaction, two tubes were prepared, one tube containing 8 µg of plasmid DNA, 500 μl

of Opti-MEM were mixed together and the other tube containing 20 μl of

Lipofectamine 2000 and 500 μl of Opti-MEM. The reaction was incubated for 20 min

and then added drop-wise onto the cells. The cells were incubated for 48 h and

harvested for protein analysis by SDS-page/Western blot.

hPSC were differentiated to D6 using the 17D protocol and trypsinized into single

cells. The cell solution was neutralized with 5 ml of MEF medium and centrifuged at

1500 rpm for 5 min to obtain the cell pellet. The cell pellet was resuspended in D5

media and 400,000 cells were seeded onto a 12-well plate and incubated overnight. On

46

D7, cells were transduced with shRNA targeting BCL-xL into each well at MOI 200.

The cells were then transfected with 1.6 µg of BCL-xL and incubated for 48 h and

harvested for RT-QPCR analysis.

2.4 ER stressors, cytokines and inhibitor assays

2.4.1 ER stressors and cytokines

All of the human cytokines (IFN-γ, TNF-α, IL-1β) were obtained from

Genomax/Biolegend. They were reconstituted in RNAse-free water and diluted to 1

mg/ml and stored at -80 °C. They were all used at 50 ng/ml in the experiments.

2.4.2 Chemical inhibitor

H9 cells were differentiated using 17D differentiation protocol to D7 and treated with

10 μM of WEHI-539 (ApexBio), inhibitor of BCL-xL. On D8, the cells were

harvested for RT-QPCR, protein analysis and immunostaining.

2.5 Lentiviral-mediated knockdown using shRNAs

shRNAs targeting BCL-xL (Sigma Construct: shRNA TRCN0000033500 and

TRCN0000033501) and SFPR5 (Sigma Construct: shRNA TRCN0000014495 and

TRCN0000429117) were cloned into pLKO.1 vector. Plasmids were extracted using

NucleoBond® Xtra Midi (Macherey-Nagel). The plasmids were packaged into virus

using HEK293FT cells. Media was changed after 24 h after transfection and left to

incubate. Media was collected at 48 and 72 h and pooled. The lentivirus in the

collected media was concentrated using ultra-clear tubes (Beckman Coulter) and

placed in SW28 Ti swinging-bucket aluminium rotor (Beckman Coulter). The SW28

47

swinging-bucket rotor was loaded in Optima L-100 XP ultracentrifuge (Beckman

Coulter) and centrifuged at 23,000 rpm for 1.5 h at 4 °C. 500 µl of DMEM media was

used to resuspend the pellet and the suspension was frozen at -80 °C. hPSC were

differentiated to D6, trypsinized into single cells and re-plated at 400,000 cells per

well in a 12-well plate. On D7, the single cells were transduced with the lentivirus

with a MOI of 200 in 5 μg/ml polybrene (Millipore) for 24 h. The medium were then

changed to normal differentiation media and left to grow for an additional 48 h.

2.6 Lentiviral-mediated overexpression of BIM isoforms

pCDH-CMV-MCS-EF1a vector was obtained from System Biosciences and modified

to include FLAG and V5 tag. The respective BIM isoforms (L, EL, γ) were then

cloned into the vector using NheI and XhoI (New England Biolabs). The constructs

were transfected with viral packing plasmids (pHDM-tat, pRC/CMV-rev, pHDM-

HIVgpm, pHDM-G) into HEK293FT cells using calcium chloride transfection

method.

Media was changed after 24 h after transfection and left to incubate. Media was

collected at 48 and 72 h and pooled. The lentivirus in the collected media was

concentrated using ultra-clear tubes (Beckman Coulter) and placed in SW28 Ti

swinging-bucket aluminium rotor (Beckman Coulter). The SW28 swinging-bucket

rotor was loaded in Optima L-100 XP ultracentrifuge (Beckman Coulter) at

centrifuged at 23,000 rpm for 1.5 h at 4 °C. 500 µl of DMEM media was used to

resuspend the pellet and the suspension was frozen at -80 °C. The lentiviruses were

titer and used at MOI 200 on human islets.

48

2.7 Seahorse metabolic flux assay

hPSC were differentiated to D7 using the 17D differentiation protocol and treated with

DMSO or WEHI-539 (Apexbio) for 24 h. D8 cells were then trypsinized and 150,000

cells plated per well on Seahorse XF96 cell culture microplates (Agilent). Growth

media was changed to Seahorse XF Base Medium (Agilent) supplemented with L-

Glutamine (Sigma) and placed in a non-CO2 incubator 1 h prior to assay. Glycolysis

was measured via the Seahorse XF Glycolysis Stress Test Kit (Agilent) with a

Seahorse XF 96 analyzer (Agilent) following the manufacturer’s protocol. Using the

same setup, oxidative phosphorylation was measured using Seahorse XF Mito Stress

Kit (Agilent).

2.8 RNA-Seq and differential expression analysis

Poly-A mRNA was enriched from 1 µg of total RNA with oligo-dT beads

(Invitrogen). Up to 100 ng of poly-A mRNA recovered was used to construct

multiplexed strand-specific RNA-seq libraries as per manufacturer’s instruction

(NEXTflexTM Rapid Directional RNA-SEQ Kit, dUTP-Based, v2). Individual library

quality was assessed with an Agilent 2100 Bioanalyzer and quantified with a QuBit

2.0 fluorometer before pooling for sequencing on a HiSeq 2000 (1 x 101 bp read). The

pooled libraries were quantified using the KAPA quantification kit (KAPA

Biosystems) prior to cluster formation. Adapter sequences and low quality bases in

Fastq read sequences were trimmed using Trimmomatic (v.0.33) (parameters:

LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:36). The quality

filtered Fastq sequence reads were then aligned to the human genome (hg19) using

Tophat (v.2.0.14) (parameters: --no-coverage-search --library-type=fr-firststrand) and

annotated with Ensembl gene IDs. The resulting bam files were used to generate

49

feature read counts using the Python package-based htseq-count of HTSeq (v.0.6.1p1)

(parameters: default union-counting mode, --stranded=reverse). The read count matrix

output from HTSeq was used to perform differential expression analysis using the

edgeR package (available in R (v.3.1.3)) in both ‘classic’ and generalized linear model

(glm) modes to contrast patient versus control. Procedures described in edgeR

documentation were followed to calculate P-values, FDR adjusted p-values (q-values)

and fold-changes. A false discovery rate (FDR) cutoff of 0.05 was used to filter

significantly differentially expressed genes. These genes with Ensembl IDs were

mapped to gene symbols. The RNA-Seq and differential expression analysis were

performed in collaborations with Dr Shawn Hoon and Dr Vidhya (IMCB Molecular

Engineering laboratory), Dr Choi Hyun Won, and Soumita (IMCB Computational and

Statistical Systems Biology laboratory).

2.9 Quantification and statistical analysis

All assays were repeated at least twice. Statistical parameters for each experiment,

including values of replicates and statistical significance, can be found in the figure

legends. All statistical analyses were performed using Student’s t-test (2-sided; equal

variance). P values of less than 0.05 were considered significant.

2.10 Data and software availability

The accession number for RNA-Seq data reported in this paper is GEO: GSE136064

50

Primers for cloning, RT-QPCR and knockdown studies

All primers were ordered from IDT Technologies at a concentration of 100 µM.

Table 5: List of human primers used for RT-QPCR

Gene

Usage Accession

Number Sequence

ALDOC RT-

QPCR

NM_005165.2 FW 5’ ACCCGAGCTGTGCTTGTGGC 3’

RV 5’ TTGGCCATGCTGCCTACAGACTC

3’

ATF4 RT-

QPCR

NM_00195.4 FW 5’ CGACCAGTCGGGTTTGGGGG 3’

RV 5’ CGGAGAAGGCATCCTCCTTGCT

3’

ATF6 RT-

QPCR

NM_007348.4 FW 5’

TCTTCAGGGTGCTCTGGAACAGG 3’

RV 5’ CTCCCCTTCTGCGGATGGCT 3’

β-ACTIN RT-

QPCR

NM_001101.5 FW 5’ TTGCCGATCCGCCGCCCGTC 3’

RV 5’

CCCATGCCCACCATCACGCCCTGG 3’

BAD RT-

QPCR

NM_004322.3 FW 5’ CGAGATCGGGCTTGGGGTGAG

3’

RV 5’ CTGGGCCCTCATCTGTCTGCC 3’

BAK RT-

QPCR

NM_001188.4 FW 5’ GATCCCGGCAGGCTGATCCC 3’

RV 5’ TCCTGTTCCTGCTGATGGCGG 3’

BAX RT-

QPCR

NM_00129142

8.1

FW 5’ GCCGGGTTGTCGCCCTTTTC 3’

RV 5’ GCAGCCCCCAACCACCCTG 3’

BCL-xL RT-

QPCR

NM_00131791

9.1

FW 5’ GGAGAACGGCGGCTGGGATA 3’

RV 5’ GGCCACAGTCATGCCCGTCA 3’

BCL2 RT-

QPCR

NM_000633.2 FW 5’ AGGCTGGGATGCCTTTGTGGAA

3’

RV 5’ CAAGCTCCCACCAGGGCCAAA

3’

BID RT-

QPCR

NM_197966.2 FW 5’ GGGTAGTCGACCGTGTCCGC 3’

RV 5’

GCTGGAACCGTTGTTGACCTCAC 3’

BIM RT-

QPCR

NM_138621.5 FW 5’ GCAATGGCTTCCATGAGGCAGG

3’

RV 5’ GTGGGTGGTCTTCGGCTGCT 3’

CHOP10

(DDIT3)

RT-

QPCR

NM_00119505

3.1

FW 5’ AGCACCTCCCAGAGCCCTCA 3’

RV 5’ CATGCGCTGCTTTCCAGCCC 3’

ENO2 RT-

QPCR

NM_001975.3 FW 5’ CATTGCTCAGCTGGCCGGGA 3’

RV 5’ GCTTGCACGCTTGGATGGCTT 3’

FOXA1 RT-

QPCR

NM_004496.4 FW 5’

AGCTACTACGCAGACACGCAGG 3’

https://www.ncbi.nlm.nih.gov/nuccore/NM_005165.2

https://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&id=1519243098

51

RV 5’ TGTTGCCGCTCGTAGTCATGGT

3’

GATA4 RT-

QPCR

NM_00130809

3.1

FW 5’

GCAGAGAGTGTGTCAACTGTGGGG 3’

RV 5’ TGGGGACCCCGTGGAGCTT 3’

GATA6 RT-

QPCR

NM_005257.5 FW 5’ GCCCCTCATCAAGCCGCAGA 3’

RV 5’ CAAGTGGTCTGGGCACCCCAT 3’

HHEX RT-

QPCR

NM_002729.5 FW 5’ ACACGCACGCCCTGCTCCGC 3’

RV 5’

TGGCCAGACGCTTCCTCTCGGGC 3’

HK2 RT-

QPCR

NM_000189.4 FW 5’ GGCACCCAGCTGTTTGACCAC 3’

RV 5’ AGCCACAACGTCTCTGCCTTCC

3’

HLXB9 RT-

QPCR

NM_005515.4 FW 5’ GCGTCCACCGCGGGCATGATCC

3’

RV 5’ AAGCGCTTGGGCCGCGACAGG

3’

HNF1A RT-

QPCR

NM_00130617

9.1

FW 5’

CTTCTGCAGGAGGACCCGTGGCGT 3’

RV 5’ GGCGGCCCGCTTCTGCGTCT 3’

HNF1B RT-

QPCR

NM_000458.4 FW 5’ GGGGCCCGCGTCCCAGCAAA 3’

RV 5’ GGCCGTGGGCTTTGGAGGGGG

3’

HNF4A RT-

QPCR

NM_178849.2 FW 5’

GGACGACCAGGTGGCCCTGCTCAGA

3’

RV 5’ GCTCCGGGCAGTGCCGAGGGA

3’

IRE1A RT-

QPCR

NM_001433.5 FW 5’ CCATGCCGCCGAGATGTCCT 3’

RV 5’

GTTGGTGGTTCACGACGAATCTGC 3’

MCL1 RT-

QPCR

NM_021960.5 FW 5’ AGGGCGACTTTTGGCCACCG 3’

RV 5’ TGCCTTGGAAGGCCGTCTCG 3’

NANOG RT-

QPCR

NM_024865.4 FW 5’ GACCTGGTGCACCCAATCCT 3’

RV 5’ TCCAAGGCAGCCTCCAAGTC 3’

NOXA RT-

QPCR

NM_021127.2 FW 5’

CCAGCAGAGCTGGAAGTCGAGTG 3’

RV 5’

TGCAGTCAGGTTCCTGAGCAGAAG 3’

OCT4 RT-

QPCR

NM_002701.6 FW 5’ CCCCGGAGCCCTGCACCGTCA

3’

RV 5’

CCCCCAGGGTGAGCCCCACATCG 3’

PAX6 RT-

QPCR

NM_000280.4 FW 5’ CCCACCACACCGGTTTCCTCC 3’

RV 5’ GGTGGGCAGCATGCAGGAGT 3’

PDX1 RT-

QPCR

NM_000209.4 FW 5’ CCTTCCCGGAGGGAGCCGAGCC

3’

RV 5’ GTAGGCCGTGCGCGTCCGCT 3’






52

PERK RT-

QPCR

NM_004836.6 FW 5’ GACCGCGCGGCAGGTCATTA 3’

RV 5’ TCCCACTGGAAGAGGGCTCCA

3’

PUMA RT-

QPCR

NM_00112724

0.2

FW 5’ CCAGATTTGTGGTCCTCAGCCCT

3’

RV 5’ TTGAGGTCGTCCGCCATCCG 3’

RFX6 RT-

QPCR

NM_173560.4 FW 5’ GCGGCTTGGAACAAGAGGCCA

3’

RV

5‘ACGAGTGAAGCCACCCTCATTCTTT

3’

SFRP1 RT-

QPCR

NM_003012.5 FW 5’ GACCGGCCCATCTACCCGTG 3’

RV 5’ CACACCGTTGTGCCTTGGGG 3’

SFRP2 RT-

QPCR

NM_003013.3 FW 5’ CAGCCACCGAGGAAGCTCCA 3’

RV 5’ TCGGACACACCGTTCAGCTTGT

3’

SFRP4 RT-

QPCR

NM_003014.4 FW 5’ GCCATCGTCACGGACCTCCC 3’

RV 5’ CACCGATCGGGGCTTAGGCG 3’

SFRP5 RT-

QPCR

NM_003015.3 FW 5’

CGCCTCCAGTGACCAAGATCTGC 3’

RV 5’ GTGTCCTTGCGCTTCAGGGGG 3’

SOX2 RT-

QPCR

NM_003106.4 FW 5’ GACGGAGCTGAAGCCGCCGGG

3’

RV 5’ CGCTGCCCGCGGGACCACAC 3’

SOX9 RT-

QPCR

NM_000346.4 FW 5’ ACCAGCCGCGGCGGAGGAAGT

3’

RV 5’ GGGATTGCCCCGAGTGCTCGCC

3’

SOX17 RT-

QPCR

NM_022454.4 FW 5’ GGCGAGGCGCCGGCGAACAG 3’

RV 5’

TCAGCGCCTTCCACGACTTGCCCAG 3’

SXBP1 RT-

QPCR

NM_00107953

9.1

FW 5’

AGTGAGCTGGAACAGCAAGTGGT 3’

RV 5’ TCATTCCCCTTGGCTTCCGCC 3’

WNT2B RT-

QPCR

NM_024494.2 FW 5’ ATGCTGAGACCGGGTGGTGC 3’

RV 5’

AATGTACCACCAGGACGTGTCTACG 3’

WNT5A RT-

QPCR

NM_003392.4 FW 5’ GCTCGCTCGGGTGGCGA 3’

RV 5’

CCTAGCGACCACCAAGAATTGGCT 3’

WNT5B RT-

QPCR

NM_032642.2 FW 5’ CTGGAGCCTGATGGACGGGTG

3’

RV 5’

AGCTAATGACCACCAGGAGTTGGC 3’

WNT7B RT-

QPCR

NM_058238.2 FW 5’ ACGTGAAGCTCGGAGCACTGT

3’

RV 5’ AGCGTCCGAAGCGGAACTGG 3’




53

WNT8B RT-

QPCR

NM_003393.3 FW 5’ GCTTCGCAGTGCCAATCGGG 3’

RV 5’ TTGCCCGTTGCGGGAGTCAT 3’

XBP1 RT-

QPCR

NM_005080.3 FW 5’



Table 6: List of human primers used for short hairpin (shRNA) cloning

Gene

Usage Accession

Number Sequence

shBCL-

xL-1

RNAi NA FW 5’

CCGGGTGGAACTCTATGGGAACAAT

CTCGAGATTGTTCCCATAGAGTTCCA

CTTTTTG 3’

RV 5’

AATTCAAAAAGTGGAACTCTATGGG

AACAATCTCGAGATTGTTCCCATAGA

GTTCCAC 3’

shBCL-

xL-2

RNAi NA FW 5’

CCGGGCTCACTCTTCAGTCGGAAATC

TCGAGATTTCCGACTGAAGAGTGAGC

TTTTTG 3’

RV 5’

AATTCAAAAAGCTCACTCTTCAGTCG

GAAATCTCGAGATTTCCGACTGAAGA

GTGAGC 3’

shSFRP5

-1

RNAi NA FW 5’

CCGGCCACTCGGATACGCAGGTCTTC

TCGAGAAGACCTGCGTATCCGAGTG

GTTTTT 3’

RV 5’

AATTAAAAACCACTCGGATACGCAG

GTCTTCTCGAGAAGACCTGCGTATCC

GAGTGG 3’

shSFRP5

-2

RNAi NA FW 5’

CCGGTGCTCCCTCTACTACCCTTTCCT

CGAGGAAAGGGTAGTAGAGGGAGCA

TTTTTTG 3’

RV 5’

AATTCAAAAAATGCTCCCTCTACTAC

CCTTTCCTCGAGGAAAGGGTAGTAGA

GGGAGCA 3’


54

Table 7: List of human primers used for cloning and overexpression

Gene

Usage Accession

Number Sequence

BCL-xL OE NM_138578.3 FW 5’

GCGGCGGCTAGCATGTCTCAGAGCAA

CCGGGAG 3’

RV 5’ CGCCGCCTCGAGTCATT

TCCGACTGAAGAGTGAGCCC 3’

BIML OE NM_006538.5 FW 5’ GCG

GCGGCTAGCATGGCAAAGCAACCTTC

TGATG 3’

RV 5’

CGCCGCCTCGAGTCAATGCATTCTCC

ACACCAGG 3’

BIMEL OE NM_138621.5 FW 5’ GCG

GCGGCTAGCATGGCAAAGCAACCTTC

TGATG 3’

RV 5’ CGC CGCCTC

GAGTCAATGCATTCTCCACACCAGG 3’

BIMγ OE NM_207002.3 FW 5’ GCG

GCGGCTAGCTAGTCATCCTAGAGGAT

ATAGGT 3’

RV 5’

CGCCGCCTCGAGTGAGAAATCCTTGT

GGTTGAGTT 3’

Table 8: List of mouse primers used for RT-QPCR

Gene

Usage Accession

Number Sequence

Bim RT-

QPCR

NM_207680.

2

FW 5’

CAGTGCAATGGCTTCCATACGACAG 3’

RV 5’ GAGGGTGGTCTTCAGCCTCGC 3’

Bax RT-

QPCR

NM_007527.

3

FW 5’ GATCCAAGACCAGGGTGGCTGG

3’

RV 5’ TGAGCGAGGCGGTGAGGACT 3’

Bak RT-

QPCR

NM_007523.

3

FW 5’ CACGGCTGAGCCATCCCACA 3’

RV 5’ TGCTGTTCAGAAGGGGACGGG

3’

Bad RT-

QPCR

NM_007522.

3

FW 5’

ACCAGCAGCCCAGAGTATGTTCCA 3’

RV 5’ GTCCCCGCTGGGTACGAACTG 3’









55

Puma RT-

QPCR

NM_133234.

2

FW 5’ CCCTCCAGAAGGCAACCGCC 3’

RV 5’ TCGCGGGCTAGACCCTCTACG 3’

Noxa RT-

QPCR

NM_021451.

2

FW 5’ CACGTGGAGTGCACCGGACA 3’

RV 5’ CCTTCAAGTCTGCTGGCACCCG

3’

Bid RT-

QPCR

NM_007544.

4

FW 5’ TGGTTGTAGAGCACAGCTGCCA

3’

RV 5’ GGCTCGTGCTGACGATCCCA 3’

Bcl2 RT-

QPCR

NM_009741.

5

FW 5’ TGGGGTGAACTGGGGGAGGAT

3’

RV 5’ GTTCCACAAAGGCATCCCAGCC

3’

Mcl1 RT-

QPCR

NM_008562.

3

FW 5’ AGGCTGGGATGGGTTTGTGGAG

3’

RV 5’

GTCCCCTATTGCACTCACAAGGCT 3’

Bcl-xl RT-

QPCR

NM_001289

716.1

FW 5’ ACGGCGGCTGGGACACTTTT 3’

RV 5’ ATGCCCGTCAGGAACCAGCG 3’

Perk RT-

QPCR

NM_010121.

3

FW 5’ CAGGCAGCGGAAGGAGTCTGAA

3’

RV 5’ CTCCCGTGCCAACTCCCTGTT 3’

Atf4 RT-

QPCR

NM_009716.

3

FW 5’ TCTGCTTGCTGTCTGCCGGTT 3’

RV 5’ CGTGAAGAGCGCCATGGCTTAG

3’

Atf6 RT-

QPCR

NM_001081

304.1

FW 5’

TCTCCAGGGTGCTCTGGAACAGG 3’

RV 5’

ACACTTGCAGCTCACTCCCAGAAT 3’

Ire1a

(Ern1)

RT-

QPCR

NM_023913.

2

FW 5’ GGCCTCCCCATGCCGAAGTT 3’

RV 5’

GGTGATGGTGTATTCTGTCCGTCCA 3’

Chop-

10

(Ddit3)

RT-

QPCR

NM_007837.

4

FW 5’

CCGGAACCTGAGGAGAGAGAACCT 3’

RV 5’

AGGTGCCCCCAATTTCATCTGAGG 3’

sxbp1 RT-

QPCR

NM_005080.

3

FW 5’















56

Table 9: Generation of pancreatic progenitors (17D protocol)

D0 Activin A 100 ng/ml + CHIR 3 μM + LY 10 μM

D3 Activin A 50 ng/ml

D5 FGF2 50 ng/ml + RA 3 μM + Nic 10 mM

D7 FGF2 50 ng/ml + RA 3 μM + Nic 10 mM

D10 FGF2 50 ng/ml + RA 3 μM + Nic 10 mM + DAPT 20 μM

D12 FGF2 50 ng/ml + RA 3 μM + Nic 10 mM + DAPT 20 μM

D14 FGF2 50 ng/ml + Nic 10 mM + DAPT 20 μM

D17 Harvest

Table 10: Generation of pancreatic β-like cells (35D protocol)

D-2 Split cells

D0 Activin 100 ng/ml + CHIR 3 μM hPSC

Harvest

D1 Activin 100 ng/ml

D3 FGF7 50 ng/ml DE

D5 FGF7 50 ng/ml

D6 FGF7 50 ng/ml + RA 2 μM + Sant1 0.25 μM + PDBu 500

nM + LDN 200 nM PGT

D7 FGF7 50 ng/ml + RA 2 μM + Sant1 0.25 μM + PDBu 500

nM

D8 FGF7 50 ng/ml + RA 100 nM + Sant1 0.25 μM PP1

D10 FGF7 50 ng/ml + RA 100 nM + Sant1 0.25 μM

D12 FGF7 50 ng/ml + RA 100 nM + Sant1 0.25 μM

D13 RA 100 nM + Sant1 0.25 μM + XXI 1 µM + Alk5iII 10 μM

+ T3 1 μM + Betacellulin 20 ng/ml

PP2

Harvest

57

D15 RA 100 nM + Sant1 0.25 μM + XXI 1 μM + Alk5iII 10 μM

+ T3 1 μM + Betacellulin 20 ng/ml

D17 RA 25 nM + XXI 1 μM + Alk5iII 10 μM + T3 1 μM +

Betacellulin 20 ng/ml

D19 RA 25 nM + XXI 1 μM + Alk5iII 10 μM + T3 1 μM +

Betacellulin 20 ng/ml

D20 Alk5iII 10 μM + T3 1 μM EN

Harvest

D22 Alk5iII 10 μM + T3 1 μM


D28 Alk5iII 10 μM + T3 1 μM SC-β

Harvest




D35 SC-β Harvest

Table 11: Molecular weight of BIM isoforms

Name Native isoforms V5 + 3X Flag Overexpressed

isoforms

BIMEL 23 kDa 3 kDa 26 kDa

BIML 15 kDa 3 kDa 18 kDa

BIMγ NA 3 kDa 16 kDa

58

3 Results

3.1 Differentiation of human pluripotent stem cells into pancreatic cells as a

model of human pancreatic development in vitro

In this project, I am investigating the dynamics of pro- and anti-apoptotic proteins

during pancreatic lineage differentiation. I am specifically interested in the Bcl-2

family members which have been shown to be able to contribute to apoptosis in

various cell types (Adams and Cory, 1998, Huang and Strasser, 2000, Gross et al.,

1999, Youle and Strasser, 2008). Through understanding the identity of the BCL-2

members, I hope to make modifications to the in-vitro differentiation protocol which

could possibly lead to higher efficiency of generation of pancreatic progenitors.

3.1.1 Morphology and transcriptional profile of pancreatic genes during 17D

differentiation

I am using a 17 day (17D) protocol that allows us to generate early pancreatic

progenitors from hPSC (Teo et al., 2015b) (Fig 7A). I harvested the cells at different

time-points D0, 3, 5, 7, 10, 12, 14 and 17 and evaluated the different pancreatic

progenitor transcripts by using RT-QPCR. The rationale of this experimental approach

is to give us a deeper insight into the transcript expression dynamics of pancreatic

genes during the differentiation from hPSC to pancreatic progenitors. The spherical

morphology of the hPSC was observed at D0. As differentiation proceeded, the hPSC

started to lose its spherical morphology. As definitive endoderm starts to form, I

observed a monolayer and cobblestone morphology with extensive cell migration out

of the colonies. Towards the end of the differentiation at D17, I observed patches of

cells with pancreatic progenitor morphology at 4X and 125X magnification (Fig 7B).

59

The transcription expression level of OCT4, SOX2 and NANOG were high and sharply

decreased as the differentiation towards pancreatic progenitors began (Fig 7C).

At D0, the expression level of SOX17 and FOXA2 is low but is increased on D3 when

definitive endoderm cells are formed (Fig 7D). At D5, the expression of FOXA2 is

decreased but subsequently increases again from D7 when gut tube derivatives are

being formed. From D10 onwards, SOX17 expression began to decrease until D17.

From D5 to D10, the definitive endoderm differentiates into the posterior foregut and

this is marked by increased expression in several genes such as FOXA1, GATA4,

GATA6 and HNF4A (Fig 7E).

From D10 to D17, the posterior foregut differentiates into early pancreatic progenitors

which are marked by an increased expression of HNF1B, HB9, PAX6, PDX1 and

RFX6 transcripts (Fig 7E). Except for PDX1, all the other transcription factors show a

decrease at D17 due to them having developmental stage-specific expression. Taken

together, these results suggest that I can obtain early pancreatic progenitors in vitro

using this 17D differentiation protocol (Teo et al., 2015b, Teo et al., 2016).

60

A

Figure 7. Morphology and characterisation of hPSC differentiating into pancreatic progenitors

using 17D differentiation protocol. (A) Illustration of the 17D protocol utilising various growth factors

and chemicals to induce hPSC differentiation towards pancreatic progenitor lineage. (B) Morphological

changes of the differentiated cells at each respective time-point. Images were taken at 4X and also

magnified 125X. Scale bar represent 200 µM. (C) Expression profile of pluripotent marker transcripts

during 17D differentiation (D) Expression profile of definitive endoderm transcripts during 17D

differentiation. (E) Expression profile of pancreatic progenitor transcripts during 17D differentiation. A

representative of at least two independent experiments is shown. All error bars indicate SD of three

replicates in an independent experiment.

C D

E

B

61

3.2 Decrease in apoptosis from D5 to D7 during 17D differentiation

As differentiation progresses from D5 to D7, I observed a decrease in the amount of

cell death (Fig 8). This observation was also reported in our subsequent usage of 35D

protocol (Fig 23A) and also in other studies (Wang et al., 2015). However, no further

insights into this decreased cell death were reported. Since the BCL-2 family of genes

are also involved in prosurvival and apoptosis, I hypothesized that the percentage

change in cell death from D5 to D7 is inextricably linked to the BCL-2 family of

genes.

3.3 Changes in BCL-2 family of transcripts during 17D differentiation

3.3.1 Transcriptional profile of BCL-2 family of genes during 17D differentiation

The BCL-2 family is implicated in prosurvival and apoptosis and to our knowledge,

their expression dynamics are relatively unexplored in the field of early pancreas

differentiation. Understanding the expression dynamics of the BCL-2 family allows us

to determine the identity of the various BCL-2 genes which are critical in early

Figure 8. Decrease in apoptosis from D5 to D7. Trypan blue cell count data comparing 8

different timepoints during the 17D differentiation protocol. A representative of at least two

independent experiments is shown. Asterisk (*) indicates P < 0.05 compared to D5 control. All

error bars indicate SD of three replicates in an independent experiment.

62

pancreas differentiation. In doing so, new molecular pathways involving the BCL-2

family could possibly be elucidated, contributing to a deeper understanding of

pancreas development. Hence, I asked the question if there are changes in the BCL-2

family of transcripts during early pancreas differentiation. To determine this, I

differentiated hPSC using the 17D protocol and harvested the cells at each respective

time-point and evaluated several anti-apoptotic and pro-apoptotic transcripts using

RT-QPCR. This gave us an insight into the expression dynamics of the anti-apoptotic

and pro-apoptotic genes during differentiation of hPSC towards the pancreatic lineage.

For pro-apoptotic transcripts, I focused on BAD, BAK, BAX, BID, BIM, NOXA,

PUMA. BAX, BAK, BIM and PUMA showed significant upregulation of at least 2-fold

from D5 to D7 (P < 0.05) (Fig 9A & 9B). Interestingly, anti-apoptotic transcripts BCL-

2, BCL-XL and MCL-1 were also upregulated from D5-D7 (P < 0.05) (Fig 9C). Some

of the transcripts such as BAX and BCL-xL exhibited a decrease between D14 and

D17 whereas BCL2 and BAD did not. This could suggest stage-specific transcript

expression. BID is a BH3 domain only pro-apoptotic member of the BCL2 family. The

active proapoptotic potential of BID is only induced upon its truncation by Casp8 into

tBID. Hence, there might not be any changes in BID transcript expression level.

However, BCL-2 family functions at the protein level, hence, the protein expression

would reflect more accurately on the BCL-2 family members which are involved.

Our results lead us to speculate that the earlier observations of changes in cell death

are linked to the changes in the BCL-2 family of transcripts.

63

3.3.2 Protein profile of BCL-2 family of genes during 17D differentiation

I then evaluated the level of BCL-2 family proteins expression during the 17D

differentiation. I harvested the cells at each respective time-point and examined the

BCL-2 family of protein profile using western blotting.

BIM, MCL-1, PUMA did not show any substantial changes in the protein expression

level during the 17D differentiation (Fig 10A & 10B). BAX is expressed at a low level

Figure 9. Changes in BCL-2 family of transcripts during differentiation into pancreatic

progenitor using 17D differentiation protocol. (A) Expression profile of pro-apoptotic BH3-only

domain BIM and PUMA transcripts during 17D differentiation. (B) Expression profile of

multidomain BAX and BAK transcripts during 17D differentiation. (C) Expression profile of anti-

apoptotic multidomain BCL-xL, BCL2 and MCL1 during 17D differentiation. A representative of at

least three independent experiments is shown. Asterisk (*) indicates P < 0.05 compared to D5

control. All error bars indicate SD of three replicates in an independent experiment.

C A

B

64

on D0 and there is no change in expression level throughout (Fig 10A & 10B).

Interestingly, BCL-xL and BAK showed a highly contrasting trend in terms of protein

expression (Fig 10A & 10B). From D0 to D5, BCL-xL protein is expressed at a low

level. However, as the cells differentiate towards pancreatic progenitors, I detected an

increase in BCL-xL protein expression from D7 onwards to D17. In contrast, BAK

was highly expressed from D0 to D5, but from D7 onwards, BAK protein expression

was downregulated. This contrast in protein expression of BCL-xL and BAK strongly

suggests that they contribute to pancreatic lineage specification.

During apoptosis, BAX and BAK activate and combine into oligomers that result in

MOMP (Korsmeyer et al., 2000, Wei et al., 2000). This allows cytochrome C to

escape into the cytoplasm, instigating the activation of the caspase cascade, ultimately

resulting in cell death (Adams, 2003, Danial and Korsmeyer, 2004, Green and

Kroemer, 2004).

I then evaluated the expression of the final effector cleaved caspase 3. From D5

onwards, the cleaved caspase 3 protein expression was reduced (Fig 10A). This could

be a result of the suppression of BAK by BCL-XL, disabling the BAK apoptotic

mechanism, thereby leading to cell survival. The close association of BAK with BCL-

xL has also been observed in other studies (Willis et al., 2005, Sattler et al., 1997). I

also validated the protein immunoblot data obtained using immunofluorescence

staining. I observed an increased expression of BCL-xL from D3 to D12 whereas

BAK was decreased from D3 to D12 (Fig 10C). Taken together, the evidence propose

that up-regulated BCL-xL and reduced BAK from D7 to D17 may contribute to

reduced cleavage of caspase 3.

65

Figure 10. Anti-apoptotic BCL-XL/BCL2L1 and pro-apoptotic BAK proteins exhibit opposite

trends during pancreatic specification from human pluripotent stem cells. (A) Protein profile of

BCL-2 family of proteins and cleaved caspase 3 during 17D differentiation. (B) Quantification of

the western blot presented in Figure 10A. (C) Immunofluorescence staining showing BCL-xL, BAK

and Cleaved caspase 3 staining on D3 and D12. Scale bars represent 50 μm. A representative of at

least three independent experiments is shown.

B

C

A

66

3.4 BCL-xL protects against apoptosis of pancreatic progenitor

3.4.1 Inhibition of BCL-xL at D7 using WEHI-539 decreases BCL-xL

expression and induces apoptosis in pancreatic progenitors

Next, I asked the question if BCL-xL protects pancreatic progenitors against apoptosis.

To determine if this is the case, I utilized WEHI-539, a highly specific chemical

inhibitor of BCL-xL (Figure 11A). WEHI-539 can inhibit BCL-xL specifically in

many cell types by binding to the hydrophobic groove of BCL-xL (Park et al., 2017,

Pecot et al., 2016, Tan et al., 2018). In this experiment, I differentiated the cells to D7

when the expression of BCL-xL is high and then inhibited BCL-xL using the WEHI-

539 at 10 µM (Fig 11B, 11C).

67

Upon successful inhibition of BCL-xL, I would be able to determine its importance for

pancreatic progenitors’ survival and apoptosis. At the protein level, I observed that

BCL-xL protein was decreased using 1 µM and 10 µM of WEHI-539 (Fig 12A, 12B,

12C, 12D). The decreased BCL-xL protein expression could be an indirect

consequence of WEHI-539 blocking BCL-xL function. I also observed that BCL-2

Figure 11. Effects of WEHI-539 treatment on D7 pancreatic progenitors. (A) Schematics of

experimental layout. For shBCL-xL experiments, please refer to Fig 15B. (B) Morphology of D8

pancreatic progenitors after treatment with 1 μM, 5 μM, 10 μM, 100 μM WEHI-539 for 24 h. Images

were taken at 4X and also magnified 125X. Scale bar represents 200 μm. (C) BCL-2 family of

transcripts expression profile after treatment with WEHI-539 for 24 h.

A

C

B

68

protein expression was increased upon BCL-xL inhibition (Fig 12A & 12B). The

upregulation of BCL-2 suggests that it may be a compensatory mechanism by the cells

to protect against apoptosis. Despite the upregulation of BCL-2 protein, the presence

of cleaved caspase 3 band suggests that BCL-2 protein is unable to protect the cells

against apoptosis (Fig 12A). Hence, our data established that BCL-xL, rather than

BCL-2, plays a more dominant role in maintaining the survival of pancreatic

progenitors.

69

Figure 12. Inhibition of BCL-xL induces apoptosis in pancreatic progenitors. (A) BCL-2 family

of proteins expression profile after treatment with WEHI-539 for 24 h. (B) Repeat of BCL-2 family of

proteins expression profile after treatment with WEHI-539 for 24 h. (C) Quantification of BCL-2

family proteins in Figure 11D. (D) Quantification of second repeat BCL-2 family proteins. A

representative of at least two independent experiments is shown. Asterisk (*) indicates P < 0.05

compared to DMSO control. All error bars indicate SD of three replicates in an independent

experiment.

A

B

C

D

70

3.5 High-throughput RNA-Seq analysis identifies other possible roles

of BCL-xL

Next, I asked the question if there are any molecular phenotype if BCL-xL is inhibited

during pancreatic differentiation. I differentiated the cells to D7 and inhibited BCL-xL

with WEHI-539. I then extracted the RNA and performed RNA-sequencing on the

DMSO control and WEHI-539-treated samples. The global RNA sequencing results

gave us an insight into the differentially expressed genes between DMSO control vs

WEHI-539-treated samples. This would provide us with the important clues of BCL-

xL-inhibition effects in pancreatic progenitors. I showed the PCA plot illustrating the

DMSO-treated samples and WEHI-treated samples localizing in different clusters (Fig

13A), suggesting the dissimilarity between the two populations of samples.

I also found that upon BCL-xL inhibition, certain clusters of genes were differentially

expressed in the global RNA-seq heatmap (Fig 13B), notably the pancreatic and

metabolic genes. These data indicate that apart from its prosurvival role, BCL-xL also

has non-canonical roles such as metabolic regulation in pancreatic progenitors which I

will explore in the subsequent sections in this thesis.

71

3.5.1 Inhibition of BCL-xL decreases pancreatic progenitor transcripts

To further elucidate the other roles of BCL-xL, I generated a volcano plot showing the

differentially expressed genes upon inhibition of BCL-xL (Fig 14A). I then analyzed

the RNA-seq data and generated the heatmap illustrating differential pancreatic gene

expression using a 1.5 fold cutoff in terms of decreased fold change expression (P <

0.05). The heatmap results would subsequently give us an insight into the effects of

BCL-xL inhibition on the pancreatic genes. Upon WEHI-539 treatment on D7, I

observed many pancreatic genes such as RFX6, HHEX, GATA6 and GATA4 that are

downregulated (Fig 14B). I then used RT-QPCR to validate the RNA-seq data. The

majority of the pancreatic genes such as HNF1B, FOXA1, GATA4, GATA6, HNF4A,

HHEX, PDX1 and RFX6 exhibited a decrease in transcript expression when the cells

were treated with 10 µM WEHI-539 (P < 0.05) (Fig 14C). One interesting observation

is that PAX6 showed an increase in transcript expression when BCL-xL was inhibited.

B

A

Figure 13. RNA-Seq analysis showing groups of differentially expressed genes upon WEHI-

539 treatment. (A) Principal Component Analysis (PCA) plot showing the clustering of the

DMSO vs WEHI-539 treated samples. (B) Global heatmap showing the differential heatmap

expression when D7 pancreatic progenitors were treated with WEHI-539. Two prominent

differentially expressed groups of genes shown are the pancreatic and metabolic genes.

72

The following genes HLXB9, SOX9 and HNF1A were not affected by the inhibition of

BCL-xL. This suggests that the inhibition of BCL-xL function did not have a global

impact on pancreatic gene expression as evidenced by the increase in PAX6 gene

expression and a lack of change in HLXB9, SOX9 or HNF1A.

Figure 14. RNA-Seq analysis reveal that the inhibition of BCL-xL function decreases the

expression of pancreatic genes. (A) Volcano plot representation of differentially expressed genes

between DMSO vs WEHI-539 treated samples. (B) Hierarchical clustering heatmap analysis of

pancreatic genes that were downregulated in WEHI-539-treated D7 cells. (C) RT-QPCR validation

of pancreatic progenitor transcripts in WEHI-539-treated D7 cells. The RNA-Seq was performed

with the assistance of Dr Shawn Hoon, Dr Choi Hyun Won, Dr Vidhya and Soumita.

C

A B

73

To complement this data, I also cloned two pairs of shRNAs targeting BCL-xL with

scrambled shRNA as control. After transduction for 72 h, I observed that the shBCL-

xL transduced cells failed to exhibit a mesenchymal-epithelial transition (MET) that

typically occurred for wild-type cells (Fig 15A). I was able to knockdown BCL-xL

transcripts by 80 % (P < 0.05). Upon knockdown of BCL-xL, the expression of all the

pancreatic progenitor transcripts were decreased except for SOX9 (Fig 15B). Overall,

the evidence propose that BCL-xL may be indirectly involved in maintaining the

pancreatic progenitor transcript level, hence, contributing to the pancreatic progenitor

identity.

74

3.5.2 Inhibition of BCL-xL decreases pancreatic progenitor protein expression

Next, I asked if the inhibition of BCL-xL would decrease the protein expression of

pancreatic progenitor genes and thus, I performed FACS on the WEHI-539 treated

cells. The rationale of this experiment is to allow us to assess the repercussions of

BCL-xL inhibition on the pancreatic progenitors at the protein level. I found that there

was a decrease from 92.7 % to 72.7 % BCL-xL+ cells upon inhibition using WEHI-

B

Figure 15. Effects of BCL-xL knockdown on D7 pancreatic progenitors. (A) Morphology of

pancreatic progenitors after shBCL-xL transduction. Scale bar represent 200 µm. (B) RT-QPCR

validation of pancreatic progenitor transcripts after knockdown of BCL-xL in D7 cells. A


compared to shSCR control. All error bars indicate SD of three replicates in an independent

experiment.

A

b

75

539. I further observed a decrease from 83.5 % to 44.7 % (PDX1+), 95.3 % to 78.2 %

(GATA4+), 88.3 % to 67.3 % (HNF4A+), 91.3 % to 67.4 % (HNF1B+) cells (Fig

16A). I then validated the data using immunofluorescence. From the

immunofluorescence data, I observed a decrease in the intensity of HNF4A, PDX1,

HNF1B and GATA4 staining (Fig 16B). Since these genes are important pancreatic

markers, our data propose that apart from the function of BCL-xL in prosurvival

effects, BCL-xL may also indirectly contribute to maintaining the pancreatic

progenitor identity of the cells.

A

Figure 16. Inhibition of BCL-xL decreases pancreatic progenitor protein expression. (A)

FACS was performed on DMSO vs WEHI-539 treated D7 pancreatic progenitors. The percentage

of BCL-xL+, PDX1+, GATA4+, HNF4A+ and HNFβ+ cells upon WEHI-539 treatment. (B)

Immunostaining showing HNF4A, PDX1, HNF1B and GATA4 intensity on WEHI-539 treated

pancreatic progenitors. Scale bar represent 50 μm. FACS and immunostaining were done with the

assistance of Alvin and Hwee Hui.

B

76

3.5.3 Overexpression of BCL-xL does not rescue the BCL-xL-inhibited


Since BCL-xL inhibition resulted in a decreased expression level of pancreatic

progenitor transcripts, I asked the question if the overexpression of BCL-xL rescues

the Bcl-xL-inhibited phenotype after WEHI-539 treatment in pancreatic progenitors.

Thus, I inhibited BCL-xL on D7 using WEHI-539 for 24 h and then transfected

exogenous BCL-xL for 48 h. Our results indicate that BCL-xL overexpression was

successful even in the WEHI-treated sample (Fig 17A). However, I did not observe

any increase in the pancreatic progenitor transcripts such as HNF1B, GATA4, RFX6,

HHEX, HNF4A or PDX1 (Fig 17B). The results suggest that WEHI-539 effects may

not be restricted to BCL-xL.

A

Figure 17. Overexpression of BCL-xL does not rescue the BCL-xL-inhibited phenotype in

pancreatic progenitors. (A) Overexpression of BCL-xL for 24 h after WEHI-539 treatment on D7.

(B) Overexpression rescue of BCL-xL in pancreatic progenitors treated with WEHI-539. All error

bars indicate SD of three replicates in an independent experiment. Asterisk (*) indicates P < 0.05

compared to DMSO + GFP control.

B

77

3.6 Metabolic genes were perturbed in pancreatic progenitors upon BCL-xL

inhibition

To examine the effects of BCL-xL inhibition on the various groups of genes, I used

DAVID 6.8 online software. The top 15 categories of downregulated genes were as

shown in Fig 18A. The results suggest that certain metabolic pathways were perturbed

when BCL-xL is inhibited in pancreatic progenitors. To uncover these pathways, I re-

looked at the RNA-seq data and observed perturbations in many groups of metabolic

genes. Out of the many metabolic genes, I curated a list of glycolysis genes that were

shown to be downregulated upon BCL-xL inhibition (Fig 18B). I validated three of

these genes, HK2, ALDH2 and ENO2 through RT-QPCR and confirmed that these

genes were downregulated in mRNA expression (Fig 18C).

78

3.6.1 Inhibition of BCL-xL using WEHI-539 on D7 decreases glycolytic capacity

and glycolytic reserve in pancreatic progenitors

The previous results suggested a perturbation in glycolysis genes when BCL-xL was

inhibited. Hence, I asked the question if the inhibition of BCL-xL would lead to

defects in glycolytic functions in pancreatic progenitors. To answer this question, I

differentiated hESCs to D7 and treated the cells with WEHI-539 for 24 h. I then

utilized the Seahorse XFe96 analyzer to measure extracellular acidification rate

(ECAR) which corresponds to glycolysis rate.

Figure 18. Inhibition of BCL-xL perturbs metabolic genes in pancreatic progenitors. (A) Gene

ontology analysis of WEHI-539 treated D7 cells. (B) Heatmap of glycolysis genes upon WEHI-539

treatment (C) RT-QPCR validation of glycolysis genes upon WEHI-539 treatment. A

representative of at least two independent experiments is shown. All error bars indicate SD of three

replicates in an independent experiment. Asterisk (*) indicates P < 0.05 compared to DMSO

control.

A B

C

79

I observed that the WEHI-539 treated cells exhibited a lower ECAR in the glycolysis

stress test as shown in Fig 19A. From the individual graph, I observed that the WEHI-

treated cells exhibited a decrease from 39.2 mpH/min to 29.7 mpH/min (glycolysis)

(Fig 19B), 57.2 mpH/min to 39.9 mpH/min (glycolytic capacity) (Fig 19B), 18.0

mpH/min to 10.2 mpH/min (glycolytic reserve) (Fig 19C) and 15.6 mpH/min to 8.4

mpH/min (non-glycolytic acidification) (Fig 19D). Overall, the evidence suggest that

BCL-xL could be indirectly involved in maintaining glycolytic functions in pancreatic

progenitors.

80

3.6.2 Inhibition of BCL-xL using WEHI-539 on D7 decreases oxidative

phosphorylation in pancreatic progenitors

Since BCL-xL is localized on the mitochondria of the cell, I asked if there is any

substantial impact of BCL-xL inhibition on pancreatic progenitor mitochondrial

Figure 19. Inhibition of BCL-xL function decreases glycolytic functions in pancreatic

progenitors. (A) ECAR comparing DMSO vs WEHI-539 treated pancreatic progenitors. (B)

Individual component graphs of glycolysis, glycolytic capacity, glycolytic reserve and non-

glycolytic acidification. (C) Second repeat of ECAR comparing DMSO vs WEHI-539 treated

pancreatic progenitors. (D) Second repeat of individual component graphs of glycolysis, glycolytic

capacity, glycolytic reserve and non-glycolytic acidification. A representative of at least two

independent experiments is shown. All error bars indicate SD of 8 samples in an independent

experiment. Asterisk (*) indicates P < 0.05 compared to DMSO control.

B

D

A

C

81

functions. To answer this question, I differentiated hESCs to D7 and treated the cells

with WEHI-539 for 24 h. I then utilized the Seahorse XF Cell Mito Stress Test to

evaluate if there are any perturbations in mitochondrial functions in pancreatic

progenitors. The rationale for this approach was as follows. Since BCL-xL impacts

mitochondrial physiology by regulating the pH of the intermembrane space, the

inhibition of BCL-xL would lead to decreased mitochondrial functions. This

experimental approach would give us an insight into the mitochondrial functions upon

BCL-xL inhibition. I observed that the oxygen consumption rate (OCR) is generally

decreased upon inhibition of BCL-xL (Fig 20A). I also showed in Fig 20B that basal

mitochondrial respiration is decreased from 118.1 pmol/min to 70.4 pmol/min whereas

ATP production is decreased from 99.2 pmol/min to 57.1 pmol/min. I also measured

the maximal respiration which is decreased from 250.9 pmol/min to 148.9 pmol/min

and the spare respiratory capacity also decreased from 132.7 pmol/min to 78.5

pmol/min (Fig 20B). Overall, the evidence propose that BCL-xL might be indirectly

involved in maintaining the oxidative phosphorylation process in pancreatic

progenitors.

82

Figure 20. Inhibition of BCL-xL function decreases the mitochondrial functions in pancreatic

progenitors. (A) Mitochondrial respiration comparing DMSO vs WEHI-539 treated pancreatic

progenitors. (B) Individual component graphs of basal mitochondrial respiration, ATP production,

maximal respiration and spare respiratory capacity. (C) Repeat of mitochondrial respiration

comparing DMSO vs WEHI-539 treated pancreatic progenitors. (D) Repeat of individual

component graphs of basal mitochondrial respiration, ATP production, maximal respiration and

spare respiratory capacity. A representative of at least two independent experiments is shown. All

error bars indicate SD of 8 samples in an independent experiment. Asterisk (*) indicates P < 0.05

compared to DMSO control.

D

D

A

C

B

83

3.7 Role of Wnt and Secreted Frizzled Receptor Proteins (SFRPs) in pancreatic

lineage specification

3.7.1 Heatmap of Wnt and SFRPs showing differential gene expression after

BCL-xL inhibition

Wnt signaling has been observed to regulate the development of mouse and human

pancreas (Sharon et al., 2019, Papadopoulou and Edlund, 2005). To understand the

impact of BCL-xL inhibition on Wnt and SFRPs genes, I re-assessed the RNA-seq

data and generated a heatmap consisting of the various Wnts and SFRPs genes using a

1.5 fold cutoff in terms of decreased fold change expression, (P < 0.05). From the

heatmap, I observed that Wnt molecules such as WNT5B, WNT7B, WNT2B, WNT8B,

WNT5A were upregulated (Fig 21A). Frizzled (fz) receptors that act as receptors in the

Wnt signaling pathway were decreased (FZD8, FZD6, FZD4, FZD7, FZF5, FZD2)

and increased (FZD10, FZD1, FZD3) (Fig 19A). I validated several Wnt genes

through RT-QPCR, showing an increase in transcript expression of WNT2B (Fig 21B).

A decrease in WNT5A and WNT5B transcripts expression was also observed (Fig 21C).

Of interest to us are the Secreted Frizzed-like Receptor Proteins (SFRPs) which share

structural similarity with the Wnt-binding domain on the fz receptors. As a result, they

are often classified as an antagonist of the Wnt signaling pathway. Our RNA-Seq data

suggest that SFRP5 was strongly downregulated while the others (SFRP1, SFRP2,

SFRP4) are upregulated (Fig 21A).

84

3.7.2 SFRP5 transcript expression is decreased upon WEHI-539 treatment on D7

Since the various SFRPs were perturbed upon BCL-xL inhibition in pancreatic

progenitors, I then validated the RNA-seq data by RT-QPCR analysis of the various

SFRPs. I observed that SFRP5 is drastically downregulated upon BCL-xL inhibition

(Fig 22A). I also evaluated SFRP5 protein expression via immunofluorescence upon

WEHI-539 treatment on D7. SFRP5 protein expression was shown to be decreased on

A

Figure 21. Inhibition of BCL-xL perturbs the expression of Wnt-associated genes. (A) Heatmap

analysis revealed perturbation of WNT-associated genes. (B) Perturbed transcript expression in WNT2B,

upon BCL-xL inhibition. (C) Perturbed transcript expression in WNT5A and WNT5B upon BCL-xL

inhibition. A representative of at least two independent experiments is shown. Asterisk (*) indicates P <

0.05 compared to DMSO control. All error bars indicate SD of three replicates in an independent

experiment.

C

B

85

D8 (Fig 22B). Next, I sought to assess the dynamics of SFRP5 transcripts expression

during the 17D differentiation. The rationale is to evaluate the importance of SFRP5 in

pancreatic specification. From the results, I observed that SFRP5 expression was

increased drastically from D7 (Fig 22C). The increase in SFRP5 transcript expression

continued until D14 before decreasing at D17. Taken in all, the results suggest that

SFRP5 is strongly downregulated after BCL-xL inhibition and that BCL-xL could act

in concert with SFRP5 to regulate pancreatic specification.

Figure 22. SFRP5 is involved in pancreatic specification. (A) Inhibition of BCL-xL perturbs

SFRP5 transcript expression. (B) SFRP5 protein expression after BCL-xL inhibition. Scale bar

represents 100 μm. (C) SFRP5 transcript expression trend during 17D differentiation. A



experiment.

B C

A

86

3.7.3 Knockdown of SFRP5 does not decrease the expression of pancreatic

progenitor transcripts

Since I hypothesized that SFRP5 plays an important role in pancreatic specification, I

cloned two pairs of shRNAs targeting SFRP5 and transduced them in D7 pancreatic

progenitors for 72 h. The rationale of this experimental approach is that if SFRP5 is

indeed critical for pancreatic progenitor generation, the knockdown of SFRP5 would

decrease the pancreatic progenitor transcripts expression level. After 72 h, I observed

that there was an increased cell death as indicated by the missing patches of cells

shown (Fig 23A). I also observed SFRP5 transcripts levels decreased after lentiviral

mediated knockdown (Fig 21B). However, I observed that the knockdown of SFRP5

did not decrease pancreatic progenitor transcripts (Fig 23B), suggesting that SFRP5 is

not involved in pancreatic specification.

Figure 23. Effects of SFRP5 knockdown on pancreatic progenitor transcript. (A) Morphology of

cells after SFRP5 knockdown. Scale bar represents 200 μm. (B) GATA4, HNF1B and PDX1

transcript expression after SFRP5 knockdown. Asterisk (*) indicates P < 0.05 compared to shSCR


B

A

87

3.8 Role of BCL-xL during pancreatic β-like cell differentiation

3.8.1 Dynamics of BCL-xL transcript in pancreatic β-like cell

I have shown in the previous section that BCL-xL is critical in the formation of early

pancreatic progenitors. BCL-xL has been shown to be important for insulin secretion

in β-cells (Zhou et al., 2000) and regulating prosurvival in human islets (Campbell et

al., 2012). In this section, I evaluated the dynamics of BCL-xL transcript during

differentiation into pancreatic β-like cells. The rationale of the experiment is to

determine if BCL-xL is important in pancreatic β-like cells using hPSC as a model.

Here, I used a 35D protocol to generate pancreatic β-like cells (Pagliuca et al., 2014)

(Fig 24A). I observed changes in morphological structure as hPSC differentiate into β-

like cells during the 35D differentiation (Fig 24B). Similar to using the 17D protocol, I

also observed increased apoptosis of the cells during the first 5 days of differentiation

(data not shown). As the single cells were incubated on a low attachment 6-well plate

on a rotating shaker, I observed the gradual increase in cell cluster size as

differentiation progressed from D1 onwards (Fig 24B). The differentiation continued

to D35 with the addition of the respective growth factors. At D35, I harvested the cells

and evaluated the transcript expression of several mature β-like cell markers. I was

able to generate INS+ cells as shown from the increased INS transcripts on D35 (Fig

24C). I also observed an increase in transcript expression of several mature β-cell

markers such as PDX1 and MAFA (Fig 24C). Importantly, I also observed an increased

BCL-xL transcript expression from D8 onwards (Fig 24C), suggesting that BCL-xL is

also involved in β-like cell generation.

88

B

C

Figure 24. Dynamics of mature β-like cell markers and BCL-xL transcript during 35D

differentiation. (A) Schematics of 35D protocol used for generating pancreatic β-like cells. (B)

Morphology of the differentiating clumps at various stages during 35D differentiation. Scale bar

represents 500 μm. (C) D35 cells showing increase of INS, PDX1, MAFA and BCL-xL transcript

expression. A representative of at least two independent experiment is shown. Asterisk (*)

indicates P < 0.05 compared to D0 control. All error bars indicate SD of three replicates in an

independent experiment.

A

89

3.8.2 Impact of BCL-xL inhibition on pancreatic β-like cell

In the previous section, I have shown that BCL-xL transcript expression is increased

from D8 onwards. To further elucidate its role in regulating the formation of β-like

cells, I used the 35D differentiation protocol to differentiate hPSC towards pancreatic

β-like cells (Pagliuca et al., 2014). I differentiated the hPSC to D8 and treated the cells

with DMSO and WEHI-539 for 24 h. The DMSO and WEHI-539-treated cells were

harvested at the respective time-points (Fig 25A). I observed a decrease in PDX1, INS

and MAFA transcripts expression on D35 upon WEHI-539 treatment, suggesting that

these β-like cells also lose their identity upon inhibition of BCL-xL (Fig 25B & 25C).

90

Figure 25. Morphology and transcriptional profile of DMSO vs WEHI-539 treated cells during

differentiation into β-like cells. (A) Morphology of DMSO vs WEHI-539 treated cells during 35D

differentiation. (B) Transcriptional profile of DMSO vs WEHI-539 treated cells during 35D. (C)

Second repeat of transcriptional profile of DMSO vs WEHI-539 treated cells during 35D. A

representative of at least two independent experiment is shown. Asterisk (*) indicates P < 0.05


experiment.

B

C

A

91

4 Effects of ER stressors, Tunicamycin and Thapsigargin on MIN6 cells

4.1 Tunicamycin upregulates ER stress transcripts and selected Bcl-2 family

of transcripts in MIN6 cells

In the previous section, I evaluated the role of BCL-xL in pancreatic progenitors. In

this chapter, I will evaluate the role of BIM in MIN6 (mouse β-cell line) and human

islets. The hypothesis is that increased BIM exon 3 to exon 4 ratio will decrease the

apoptosis of pancreatic β-cells. To test this hypothesis, I intended to overexpress the

various BIM isoforms by transducing pCDH- BIML, pCDH-BIMEL and pCDH-

BIMγ-containing lentiviruses into MIN6 and human islets. Since the transfected cells

are overexpressing BIML/BIMEL (promote apoptosis) and BIMγ (postulated to

protect against apoptosis based on increased BIM exon 3 to exon 4 ratios as per Ng et

al (Ng et al., 2012), I hypothesized that there are discrepancies in the expression level

of ER stress/Bcl-2 transcripts when the MIN6 cells are treated with

tunicamycin/thapsigargin.

Extended ER stress has been shown to promote apoptosis (Kim et al., 2008) and

pathogenesis of certain diseases such as diabetes and neurodegeneration (Ron and

Walter, 2007). The UPR is a defense response designed to restore equilibrium and to

alleviate ER stress. Hence, I sought to determine the tunicamycin-induced UPR in

MIN6 and to investigate if Bcl-2 family of proteins play a role in ER stress-promoted

apoptosis. MIN6 cells were incubated with an increasing amount of tunicamycin (0,

2.5, 5, 10 µM) for 24 h. Several ER stress-related genes such as Perk, Atf4, Atf6,

Sxbp1, Ire1a and Chop-10 were upregulated (Fig 26A). The results suggest that the

UPR is triggered in MIN6 cells. The unresolved effects of UPR would lead to

perturbation in the Bcl-2 family of genes. I then evaluated the expression of various

92

Bcl-2 family of transcripts in (Fig 26B). I observed that tunicamycin was able to

induce an upregulation of Bim, Bax, Puma, Noxa and Bcl-2 transcripts even at a low

dose of 2.5 µM. Upregulation of these pro-apoptotic transcripts indicate that the MIN6

cells are possibly undergoing apoptosis. I also observed an increasing number of

apoptotic MIN6 cells after incubation with tunicamycin (Fig 26C).

B

C

Figure 26. Effects of tunicamycin dose treatment on MIN6 cells. (A) Effects of increasing

dosage of tunicamycin on ER stress transcripts in MIN6 cells. (B) Effects of increasing dosage of

tunicamycin on Bcl-2 family of transcripts in MIN6 cells. (C) Morphology of increasing dosage of

tunicamycin in MIN6 cells. Images were taken at 4X and also magnified 125X. Scale bar

represents 200 µM. Asterisk (*) indicates P < 0.05 compared to untreated control. All error bars

indicate SD of three replicates in an independent experiment.

A

93

4.2 Thapsigargin upregulates ER stress transcripts and selected Bcl-2 family of

transcripts in MIN6 cells

Next, I asked if thapsigargin was also able to activate the UPR in MIN6 cells after 24

h of incubation. All of the ER stress-related genes such as Perk, Atf4, Atf6, Sxbp1,

Ire1a and Chop-10 were found to be upregulated even at a low dose of 2.5 µM (Fig

27A). Pro-apoptotic transcripts such as Bim, Bax, Bak, Bad, Puma, Noxa were also

upregulated (Fig 27B). The anti-apoptotic transcripts are also upregulated. Similar to

tunicamycin treatment, MIN6 cells treated with thapsigargin also showed an increase

of rounded apoptotic cells floating (Fig. 27C).

Figure 27. Effects of thapsigargin dose treatment on MIN6 cells. (A) Effects of increasing dosage

of thapsigargin on ER stress transcripts in MIN6 cells. (B) Effects of increasing dosage of

thapsigargin on the Bcl-2 family of transcripts in MIN6 cells. (C) Morphology of increasing dosage

of thapsigargin in MIN6 cells. Images were taken at 4X and also magnified 125X. Scale bar

represents 200 µM. (*) indicates P < 0.05 compared to untreated control. All error bars indicate SD

of three replicates in an independent experiment.

B

A

C

A

94

4.3 Overexpression of BIM isoform transcripts in MIN6 cells

4.3.1 Overexpression of BIM isoform transcripts in the presence of

Tunicamycin/Thapsigargin did not perturb ER stress and Bcl-2 family of

transcripts in MIN6 cells

Hence, I sought to assess if the overexpression of the BIM isoforms will perturb the

ER stress/Bcl-2 family of transcripts. I transfected MIN6 cells with the various BIM

isoforms for 48 h and treated them with tunicamycin and thapsigargin at 2.5 µM for 24

h respectively. I processed both experiments in parallel. GFP is fused to all Bim

constructs; BIML, BIMEL, BIMγ in the pCDH vector. The pCDH vector was obtained

from a collaborator and we have thoroughly sequenced and confirmed the vector

before using it. In order to detect the specific BIM isoform, Bim primers were

designed flanking the entire Bim region. However, I also designed the primers that

flank the various BIM isoform regions; BIMEL, BIML and BIMγ. Hence, I could only

detect the specific Bim exons and not the entire Bim transcript. In Fig 28A, exon 2A is

shared by all three BIM isoforms but I found it to be more highly expressed in BIMγ

than BIML and BIMEL. BIMγ is the only isoform that contains exon 3. BIML/BIMEL

contain exon 4 that encodes the BH3 domain and is highly upregulated in both of

BIML/BIMEL-transfected MIN6 cells. This evidence proposes that the overexpression

of the BIM isoforms in MIN6 cells was successful at the transcript level.

Since the trigger of ER stress can potentially lead to pancreatic β-cell death in T1D, I

asked if the overexpression of BIM isoforms with tunicamycin/thapsigargin could lead

to perturbations in the ER stress transcripts. I investigated the expression of Perk, Atf4,

Atf, Sxbp1, Ire1a and Chop-10 (Fig 28B and 28D). In the BIMγ plus

95

tunicamycin/thapsigargin-treated MIN6 cells, there was a non-statistically significant

decrease (P > 0.05) in Perk and Atf4 transcripts levels. The other arms of the ER stress

response such as Atf6 and Ire1α did not show any perturbation at the transcript levels.

Next, I investigated the transcript expression of Bim, Bax, Bak, Bad, Bid, Puma and

Noxa (Fig 28C and 28E). A higher expression level (non-statistically significant; P >

0.05) of pro-apoptotic Bak, Bid and Noxa with BIMγ overexpression in the presence of

tunicamycin in MIN6 cells was observed, although I hypothesized BIMγ to be

protective against apoptosis. In the BIMγ overexpression plus thapsigargin-treated

MIN6 cells, a non-statistically significant (P > 0.05) trend of increase in Bax transcript

level was observed. The treatment of BIML/BIMEL-overexpressed MIN6 cells with

tunicamycin/thapsigargin is expected to lead to a higher rate of apoptosis characterised

by a higher expression level of the pro-apoptotic genes and a lower expression level of

the anti-apoptotic genes. However, this was not observed, suggesting that

overexpression of the BIM isoforms in conjunction with tunicamycin/thapsigargin did

not lead to perturbation of both ER stress and Bcl-2 family of transcripts.

96

D

A

Figure 28. Transcripts of Bcl-2 family genes in BIM isoform-overexpressing MIN6 cells under

ER stress. (A) Overexpression of BIM isoform transcripts in MIN6 cells. (B) Overexpression of BIM

isoform transcripts in the presence of tunicamycin effects on the ER stress transcripts in MIN6 cells.

(C) Overexpression of BIM isoform transcripts in the presence of tunicamycin effects on the Bcl-2

family of transcripts in MIN6 cells. (D) Overexpression of BIM isoform transcripts in the presence of

thapsigargin effects on the Bcl-2 family of transcripts in MIN6 cells. (E) Overexpression of BIM

isoform transcripts in the presence of thapsigargin effects on the Bcl-2 family of transcripts in MIN6

cells. Asterisk (*) indicates P < 0.05 compared to untransfected control. All error bars indicate SD of

three replicates in an independent experiment.

C

E

B

97

4.4 Overexpression of BIM isoform transcripts in human islets

4.4.1 Overexpression of BIM isoform transcripts did not perturb ER stress and

BCL-2 family of transcripts in human islets

Next, I also performed overexpression of BIM isoform transcripts in human islets. All

of the three BIM isoforms contain exon 2A and it is clear that the overexpression of

exon 2a was higher as compared to the GFP control. Exon 3 was overexpressed up to

7-fold in the BIMγ sample as compared to the other samples, indicating that the

overexpression of BIMγ in human islets was working (Fig 29A). BIM exon 4 was

overexpressed in BIML and BIMEL >2.5 fold as compared to other samples. This

indicated that the overexpression of BIML and BIMEL was also working as they are

the exon 4-containing BIM isoforms (Fig 29A). Following the successful

overexpression of BIM isoforms in human islets, I also investigated if the BIM isoform

overexpression would perturb the ER stress transcripts in human islets (Fig 29B).

However, our results indicated that there were no perturbations in any of the ER stress

transcripts (PERK, XBP1, ATF4, ATF6 and CHOP-10). Next, I investigated if the

overexpression of the various BIM isoforms can lead to perturbations in the BCL-2

family of transcripts in human islets. BIM transcripts were overexpressed in both

BIML and BIMEL samples but not the BIMγ samples (Fig. 29C). Dismally, no

differences were observed for BAK, BID, PUMA, NOXA, BAD, BCL-XL, MCL1 and

BCL-2, when comparing the overexpressed samples to the GFP control (Fig 29C).

Overall, the evidence indicated that the overexpression of BIM isoforms did not

perturbed the ER stress and BCL-2 family of transcripts in the human islets.

98

4.5 BIM isoforms can be overexpressed at the protein level in HEK293FT cells

In the previous section, experiments were performed to assess the perturbation of the

ER stress/BCL-2 family of transcripts at the RNA level. However, minimal

transcriptional changes were observed. To unequivocally confirm that our various

BIM isoform plasmids were indeed able to lead to an overexpression of BIM protein, I

Figure 29. Overexpression of BIM isoforms in human islets. (A) Overexpression of BIM isoform

transcripts in human islets. (B) Overexpression of BIM isoform transcripts effects on the ER stress

transcripts in human islets. (C) Overexpression of BIM isoform transcripts effects on the BCL-2

family of transcripts in human islets. Asterisk (*) indicates P < 0.05 compared to untransfected


C

A

B

99

performed confirmatory overexpression studies in HEK293FT cells after transfection

for 48 h. In GFP-transfected control, very little endogenous BIM protein was detected.

In the BIML-transfected lane, there was an 18 kDa band detected that corresponds to

the predicted molecular weight for BIML (Fig 30A). Two bands were observed for

BIMEL, one at 26 kDa and the other 18 kDa. The 26 kDa band likely corresponds to

BIMEL while the 18 kDa band corresponds to BIML (Fig 30A). In BIMγ-transfected

lane, a band at 16 kDa was observed (Fig 30A). Thus, the observed band most likely

corresponds to BIMγ. Here, I quantified the bands and confirmed that our plasmids are

indeed able to overexpress the various BIM isoforms at the protein level (Fig 30B)

Figure 30. Overexpression of BIM isoforms at the protein level in HEK293FT cells. (A) Western

blot analysis showing all three BIM isoforms, BIMEL (26 kDa), BIML (18 kDa) and BIMγ (16 kDa) in

HEK293FT cells. (B) Quantification of the overexpressed BIMEL, BIML and BIMγ bands.

4.6 BIML and BIMEL proteins are unable to be overexpressed at the protein

level in MIN6 cells

4.6.1 Overexpression of the BIM isoform proteins in MIN6 cells

Although the various BIM isoforms were overexpressed in MIN6 cells using the same

method as per HEK293FT cells, I was only able to detect the overexpression of BIMγ

A B

100

protein 48 h post-transfection (Fig 31A & 31B). This was quite puzzling as all three

BIM isoforms can be overexpressed at the transcript level. Possible explanations could

be the tight translational control over BIML and BIMEL transcripts, or that the protein

could be degraded by 48 h post-transfection.

4.6.2 Time-course overexpression of BIML, BIMEL and BIMγ in MIN6 cells

Next, I asked if BIML/BIMEL protein might be overexpressed at earlier time-point. I

transfected MIN6 cells with the various BIM isoforms and harvested at several time-

points (6, 12, 24 and 48 h). However, no overexpression was detected for BIML and

BIMEL protein across the various time-points (Fig 32A). This suggests a tight

translational control over BIML and BIMEL transcripts. BIMγ was clearly

overexpressed as early as 12 h post-transfection (Fig 32B & 32C). I also validated the

overexpression of the BIM isoforms using immunofluorescence (Fig 32D). I was

unable to detect the overexpression of BIML and BIMEL even after 48 h of

overexpression whereas BIMγ was able to be overexpressed. Since BIMγ was the only

isoform that can be overexpressed, I proceeded to test the hypothesis that

A B

Figure 31. Overexpression of BIM isoforms at the protein level in MIN6 cells. (A) Western blot

analysis showing BIMγ overexpression at the protein level in MIN6. (B) Quantification of

overexpressed BIMEL, BIML and BIMγ bands.

101

overexpression of BIMγ (increased BIM exon 3 to exon 4 ratios) can protect pancreatic

β-cells against apoptosis.

Figure 32. Overexpression of the various BIM isoforms, BIML, BIMEL and BIMγ in MIN6

cells. (A) Overexpression of BIML and BIMEL at 6, 12, 24 and 48 h. (B) Overexpression of BIMγ at

6, 12, 24 and 48 h. (C) Quantification of overexpressed BIMγ bands at 6, 12, 24 and 48 h. (D)

Immunofluorescence staining showing overexpression of all the BIM isoforms. Images were taken at

4X and also magnified 125X. Scale bar represents 200 µM.

A

B

D

C

102

4.7 Overexpression of BIMγ was successful in Tunicamycin/Thapsigargin-treated

MIN6 cells.

To assess if BIMγ can protect against ER stressor-induced apoptosis, BIMγ was

overexpressed in MIN6 cells for 48 h and incubated with tunicamycin/thapsigargin at

2.5 µM for 24 h. The negative controls consisted of samples that were non-treated or

treated with tunicamycin/thapsigargin respectively. A GFP control which was non-

treated or treated with tunicamycin/thapsigargin respectively was also included. For

the BIMγ overexpression samples, I observed that the BIMγ protein was

overexpressed (Fig 33A & 33B). However, I also observed that upon Tunicamycin and

Thapsigargin treatment, BIMγ protein expression was reduced.

4.8 Overexpression of BIMγ was successful in MIN6 cells treated with cytokines

BIMγ was also overexpressed in MIN6 for 48 h followed by treatment with various

T1D-related cytokines to ascertain pathophysiological relevance. The negative

controls consisted of samples that were non-treated or treated with cytokines for

another 24 h. GFP controls were also included and were either non-treated or treated

A B

Figure 33. Overexpression of BIMγ was successful in MIN6 cells treated with

Tunicamycin/Thapsigargin. (A) MIN6 cells were overexpressed with BIMγ for 48 h and

treated with 2.5 µM of respective ER stressors for 24 h. (B) Quantification of the overexpressed

BIMγ bands.

103

with cytokines. BIMγ was successfully overexpressed at the protein level (Fig 34A &

34B).

4.9 Overexpression of BIMγ in the presence of ER stressors or cytokines did not

confer protection against apoptosis in MIN6 cells

4.9.1 Overexpression of BIMγ in the presence of ER stressors did not perturb

other repertoire of BCL-2 proteins except for Bcl-xl

I next asked if the overexpression of BIMγ could perturb the repertoire of other BCL-2

proteins at the protein level. In the BIMγ overexpression samples, I did not observe

any changes in BAX, BAK and PUMA proteins. (Fig 35A, 35B, 35C). However, in

the in the BIMγ overexpression samples, I observed that BCL-2 was consistent but

interestingly BCL-xL showed increased protein expression (Fig 35C & 35D). This

.

.

B A

Figure 34. Overexpression of BIMγ was successful in MIN6 cells treated with cytokines. (A)

MIN6 cells were overexpressed with BIMγ for 48 h.and treated with 50 ng/ml of respective

cytokines for 24 h. (B) Quantification of the overexpressed BIMγ bands.

104

suggests that BIMγ overexpression could possibly result in an increase in BCL-xL to

counter apoptosis.

Figure 35. Western blot analysis of BCL-2 family of proteins upon BIMγ overexpression in

MIN6 cells treated with ER stressors. (A) Western blot analysis of BAX expression in MIN6

cells after BIMγ overexpression for 48 h and subsequent 24 h of ER stressor treatment.

(B) Western blot analysis of BAK expression in MIN6 cells after BIMγ overexpression for 48 h

and subsequent 24 h of ER stressor treatment. (C) Western blot analysis of PUMA, BCL-xL and

BCL-2 expression in MIN6 cells after BIMγ overexpression for 48 h and subsequent 24 h of ER

stressor treatment. (D) Quantification of the BAX, BAK, PUMA, BCL-xL, and BCL-2 bands.

A

B

D

C

A

105

4.9.2 Overexpression of BIMγ in the presence of cytokines did not perturb other

repertoire of BCL-2 proteins except for BCL-xL

BAX, BAK and PUMA protein expression levels were not significantly altered in the

presence of BIMγ overexpression and/or cytokines (Fig 36A & 36B). However, BCL-

2 and BCL-xL protein expression showed an upregulation in the GFP control and

BIMγ overexpression samples (Fig 36C & 36D). This could possibly indicate that

there might be a partial protection against apoptosis by upregulating BCL-xL.

106

Figure 36. Western blot analysis of BCL-2 family of proteins upon BIMγ overexpression in

MIN6 cells treated with cytokines. (A) Western blot analysis of BAK expression in MIN6 cells

after BIMγ overexpression for 48 h and subsequent 24 h of cytokine treatment. (B) Western blot

analysis of BAX and PUMA expression in MIN6 cells after BIMγ overexpression for 48 h and

subsequent 24 h of cytokine treatment. (C) Western blot analysis of BCL-xL and BCL-2

expression. in MIN6 cells after BIMγ overexpression for 48 h and subsequent 24 h of cytokine

treatment. (D) Quantification of BAX, BAK, PUMA, BCL-xL and BCL-2 bands.

C

D

B A

107


treated with ER stressors

Since the hypothesis was that the overexpression of BIMγ protects β-cells from ER

stress-induced cell death, I then evaluated cleaved caspase 3 expression which is the

final gateway in the apoptotic cascade. Results from the previous section showed that

BCL-xL was upregulated upon BIMγ overexpression, suggesting protection against

apoptosis in MIN6. Here, I showed that full-length caspase 3 was consistent

throughout the samples while the cleaved caspase 3 band was only observed in the

lanes treated with tunicamycin and thapsigargin (Fig 37A & 37B). Cleaved caspase 3

was detected BIMγ-overexpressed samples, indicating that the overexpression of

BIMγ and the upregulated BCL-xL was insufficient to protect MIN6 cells against ER

stress-induced cell death.

Figure 37. Cleaved caspase 3 was present in BIMγ overexpression in the presence of ER

stressors. (A) MIN6 cells were overexpressed with BIMγ for 48 h and treated with 2.5 µM of

respective ER stressors. (B) Quantification of the FL casp3 and Ccasp3 bands.

A

B

108


treated with cytokines

Here, I showed that the full-length caspase 3 band was equal throughout the samples

while cleaved caspase 3 band was detected in all the samples (Fig 38A & 38B). The

original assumption was that the cytokines treatment would only lead to caspase 3

activation but in this case, it is unknown why apoptosis was also detected in the non-

treated samples. Overall, the evidence suggests that overexpression of BIMγ, in spite

of upregulation of BCL-xL, was unable to protect MIN6 against apoptosis.

Figure 38. Cleaved caspase 3 was present in BIMγ overexpression in the presence of

cytokines. (A) MIN6 cells were overexpressed with BIMγ for 48 h and treated with 50 ng/ml of

respective cytokines. (B) Quantification of the FL casp3 and Ccasp3 bands.

A

B

109

5 Discussion (Part 1)

5.1 Decrease in apoptosis during differentiation of hPSC to pancreatic

progenitors

In this study, I observed increased cell death during the first five days of

differentiation and cell death drastically decreased thereafter on D7 (Fig 8). On D0 and

D3, I used 100 ng/ml Activin A, 3 µM CHIR9021 and 10 µM LY294002 to

differentiate the hPSC respectively. Usage of Activin A during the first few days has

been widely used in generating definitive endoderm cells from hPSC (D'Amour et al.,

2006, Jiang et al., 2007a, Basford et al., 2012, Pagliuca et al., 2014, D'Amour et al.,

2005, Nostro et al., 2011). The observation of increased cell death during the

generation of definitive endoderm coincides with many previous results from various

investigators (Wang et al., 2015, Qu et al., 2017). The usage of Activin A has also

been shown to cause cell death (Nishihara et al., 1993) in hybridoma and myeloma cell

lines. However, Activin A-induced apoptosis is repressed by BCL-2 in B cell

hybridoma cell lines (Koseki et al., 1995). Usage of LY294002, a PI3K inhibitor, has

been observed to induce cell death in many cell types in vitro (Fujiwara et al., 2008,

Jiang et al., 2010). Although these studies did not implicate the direct involvement of

BCL-2 family, it is well-understood that they play important roles in cell death and

survival.

110

5.2 Changes in BCL-2 family of transcript expression levels during differentiation

of hPSC into pancreatic progenitors

BCL-2 family of genes are involved in cell survival and apoptosis (Adams and Cory,

1998, Gross et al., 1999). I reasoned that decreased apoptosis phenotype observed

during pancreatic progenitor differentiation is related to the changes in the BCL-2

levels of transcripts. Here, I reported that there were indeed changes in the BCL-2

family of transcripts expression levels during 17D differentiation. For pro-apoptotic

transcripts, I observed an increase of BIM, PUMA, BAD transcript expression from D5

to D7 (Fig 9A). For anti-apoptotic transcripts, I also observed an increase of BCL-xL

and BCL-2 transcripts expression from D5 to D7 (Fig 9C). To the best of our

knowledge, this is the first report of changes in BCL-2 gene expression during

pancreatic specification using hPSC as a model. Overall, the evidence suggest that

BCL-2 family of genes are involved during pancreatic differentiation and may be

critical for pancreatic lineage specification.

5.3 BCL-xL and BAK play important roles in pancreatic specification

I then found that BCL-xL protein is highly expressed on D7 onwards, possibly to

suppress the pro-apoptotic effects of BAK (Fig 10A). BCL-xL has also been found to

restraint BAK, a pro-apoptotic protein that is responsible for cellular apoptosis (Sattler

et al., 1997, Lee et al., 2016, Willis et al., 2005, Kodama et al., 2012). Surprisingly,

BAK protein expression is decreased from D7 onwards, suggesting an inverse

correlated relationship between BCL-xL and BAK. Although BAX can form

heterodimers with BAK during apoptosis (Dewson et al., 2012), I did not observe any

changes in BAX expression level (Fig 10A), suggesting that there is a decrease in the

111

amount of heterodimers for inducing MOMP. Alternatively, BAK alone can induce

apoptosis by oligomerization through inserting exposed BH3 domain into the groove

of another BAK monomer (Dewson et al., 2009), suggesting that BAK alone can

induce apoptosis of pancreatic progenitors. Several of the proteins such as BIMEL,

BIML, PUMA and BCL-2 did not show any changes in expression throughout the 17D

differentiation, suggesting that they do not play a role in pancreatic lineage

differentiation. BIMS showed a decrease in expression from D7 onwards which

correlates to a similar expression to BAK. However, a paper reported that the BIMS

expression is not likely to be associated with BCL-xL as it does not interact with BCL-

xL in epithelial cells (Weber et al., 2007).

Since BCL-xL shows only an increase in protein expression from D7 onwards, I

postulate that there could be an unknown BH3-only protein that is temporarily holding

BCL-xL in check from D0 to D7. At the same time, BAX and BAK are constitutively

active, leading to a large amount of cell death observed. From D7 onwards, this

unknown BH3-only protein expression decreases and is no longer able to keep BCL-

xL in check any further. Hence, BCL-xL protein expression increase and this may

serve to suppress the proapoptotic BAK, leading to a decrease in apoptosis. This

finding fits the displacement model in the BCL-2 activation model.

5.4 BCL-xL is critical for the survival of pancreatic progenitors

In this part, I showed that BCL-xL is critical for pancreatic progenitor survival. To

study this, I inhibited BCL-xL at D7 using a specific inhibitor, WEHI-539 and I

observed that there was increased cleaved caspase 3 protein expression level in the

western blot (Fig 12A & 12B). The presence of cleaved caspase 3 upon WEHI-539

112

suggests that BCL-xL is critical for prosurvival in pancreatic progenitors. This finding

confirms the separate observation of previous investigators that BCL-xL is critical for

prosurvival in human islets (Campbell et al., 2012) and mouse β-cells (Carrington et

al., 2009, Zhou et al., 2000). However, it is well-established that BCL-xL is not only

critical for pancreatic progenitor survival, but it is critical in a prosurvival role in many

different cell types (Yang et al., 2003, Nakamura et al., 2016, Bai et al., 2012). In the

area of embryonic development, the loss of BCL-xL has been shown to lead to

embryonic lethality by E13.5 in which a large amount of apoptosis was observed in the

developing hematopoietic and nervous systems (Motoyama et al., 1995). Furthermore,

BCL-xL is also vital in ensuring the neuron survival in the developing brain and spinal

cord. A conditional knock-out of Bcl2l1 in CNS neurons resulted in the mice having

lower numbers of catecholaminergic neurons (Savitt et al., 2005). These mice

eventually developed a decrease in striatal dopamine production and had a lower brain

mass. Another report highlights the importance of BCL-xL in maintaining the survival

of differentiated neuronal cortex that controls complex behavior (Nakamura et al.,

2016). Despite this evidence, not much is known on the role of BCL-xL during

pancreatic development. Taken together, our findings suggest the importance of BCL-

xL in prosurvival during pancreatic development.

5.5 BCL-xL plays an indirect role in pancreatic specification

I sought to identify other potential roles of BCL-xL in pancreatic progenitors. A

surprising finding was that inhibition of BCL-xL indirectly decreased pancreatic gene

expression during pancreatic differentiation. The volcano plot showed that pancreatic

genes were downregulated in expression level (Fig 14A). Further validation of the

pancreatic genes such as HNF1B. GATA4, HNF4A, PDX1 and many others, through

113

RT-QPCR, showed downregulation in mRNA expression upon inhibition of BCL-xL

(Fig 14C). To our knowledge, BCL-xL has never been shown to direct pancreatic cell

lineage and this is the first report of BCL-xL indirectly influencing differentiation

towards pancreatic lineage. This could possibly suggest the indirect effects of BCL-xL

inhibition on pancreatic gene expression. Furthermore, I also complemented the data

by using shRNA targeting BCL-xL on D7 cells. Here, I observed that the majority of

pancreatic gene transcript expression such as HNF1B, GATA4, HNF4A, PDX1 were

also downregulated (Fig 15B). The decrease in BCL-xL protein expression has also

led to the decrease in PDX1+, GATA4+, HNF4A+ and HNF1B+ cells (Fig 16A). In

terms of influencing cell lineage decision, many other studies have shown that BCL-

xL can direct hematopoietic stem cells differentiation into myeloid and erythroid

lineage (Haughn et al., 2003), as well as direct the lineage of embryonic cortical

precursor cells (Chang et al., 2007). Through the use of hPSC modeling of pancreatic

lineage, our novel findings strongly suggest that BCL-xL could indeed influence hPSC

differentiation towards pancreatic lineage. This evidence highlights BCL-xL playing

an indirect role in influencing cell lineage specification.

However, a conflicting report showed that pancreas-specific Bcl-xl–knockout mice do

not show any phenotype in terms of the pancreas/body weight ratio when compared to

wildtype littermates (Ikezawa et al., 2017). While the authors did not report any gross

phenotype, they did not evaluate pancreatic gene expression or diabetes phenotypes.

Hence, they were unable to determine if there are deficiency of functions in Bcl-xl-

knockout mice islets.

Apparent discrepancies between the RT-QPCR results using WEHI-539 and shRNA

targeting BCL-xL is the expression of several genes such as PAX6, HLXB9 and

HNF1A. Due to the fact that pancreatic gene expression is dynamic, it suggests that

114

there could be a delay in differentiation into pancreatic progenitors when BCL-xL is

reduced. Hence, I reasoned that this could be due to the difference in the treatment

time between WEHI-539 and shRNA targeting BCL-xL. WEHI-539 treatment was

incubated for 24 h (D7-D8) whereas shRNA transduction was incubated for 72 h (D7-

D10) to enhance knockdown efficiency. An alternative to resolve this issue is to

perform knockdown of BCL-xL at D5 and analyse the data at D8/D9. The second

alternative is to treat the cells with WEHI-539 on D8 and analyse the data on D9. This

will resolve the differences in treatment time between using WEHI-539 and shBCL-

xL. Furthermore, a previous study also showcased the differences between chemical

inhibitors and shRNAs, suggesting that in certain cases, the readout may generally be

the same but there could also be some differences due to off-target effects of the

chemical inhibitors (Weiss et al., 2007).

Another alternative involves the speculation that more differentiated pancreatic

progenitors are more dependent on BCL-xL for survival. When the populations of

cells are treated with WEHI-539 or shBCL-xL, the loss of BCL-xL could have led to a

loss of these more differentiated pancreatic progenitors, leaving behind the less

differentiated cells that account for the decreased pancreatic gene expression.

5.6 Overexpression of BCL-xL does not rescue the BCL-xL-inhibited


The results presented here showed that overexpression of BCL-xL on D8 after WEHI-

539 treatment was unable to rescue the BCL-xL-inhibited phenotype in pancreatic

progenitors. Evidence that the rescue experiment failed is that even though

overexpression of BCL-xL transcript was successful (Fig 17A), however, I did not

115

observe any increase in the expression level of the various pancreatic genes in the

WEHI-539 + BCL-xL samples as compared to the WEHI-539 + GFP samples (Fig

17B). More work would need to be done on determining if the overexpression of BCL-

xL was successful at the protein level. This is because the structure of the

overexpressed BCL-xL protein might not fold properly and this could result in the

inability of exogenous BCL-xL to function. The data suggest that overexpression of

BCL-xL may be insufficient to rescue the BCL-xL-inhibited phenotype in pancreatic

progenitors and perhaps, additional factors are likely needed to be important in

pancreatic lineage specification. In addition, WEHI-539 may not specifically target

BCL-xL, hence the non-specific inhibition of other unknown genes may play a role in

preventing the downstream overexpression of exogenous BCL-xL. However, a report

mentioned that rescue effects of WEHI-539 treatment in human colon carcinoma cells

(RKO) was possible by having Tet-BCL-xL integrated. This stable RKO line

harbouring the tetracycline-inducible GFP-tagged Bcl-xL was able to induce BCL-xL

overexpression via induction of tetracycline (Bennett et al., 2016). This is in contrast

with my current method of exogenous BCL-xL overexpression via transfection.

5.7 BCL-xL is involved in maintaining the metabolic state of pancreatic

progenitors

In this report, I also uncovered a novel function of BCL-xL in regulating the metabolic

state of pancreatic progenitors. From the RNA-Seq data, I observed that glycolysis

gene transcripts were downregulated (Fig 18B). RT-QPCR validation confirmed that

certain glycolysis transcripts such as ENO2, HK2 and ALDOC expression were

downregulated (Fig 18C). In this study, I have shown that inhibition of BCL-xL in

pancreatic progenitors led to an overall decrease in glycolysis, including glycolytic

116

capacity and glycolytic reserve (Fig 19B & 19D). I also observed that inhibition of

BCL-xL in pancreatic progenitors led to a decrease in basal mitochondrial respiration,

ATP production and maximal respiration (Fig 20B & 20D). I also noted a decrease in

the spare respiratory capacity, non-mitochondrial oxygen consumption and proton leak

(Fig 20B & 20D). This evidence agrees with several previous studies of BCL-xL being

involved in mitochondrial metabolic studies. In another study, it reported that BCL-xL

acts as a mediator between apoptosis and protein N-alpha-acetylation (Yi et al., 2011).

Through overexpression of BCL-xL in MEFs, the levels of protein N-acetylation and

Acetyl-CoA was reduced, contributing to apoptotic resistance in MEFs. Hence, it was

concluded that BCL-xL regulates Acetyl-CoA, a signaling molecule which in turn

regulates protein N-acetylation, conferring apoptotic sensitivity to metabolism in

MEFs. In another study, BCL-xL-deficient neurons exhibited a defect in control of

mitochondrial membrane potential, resulting in a leaky inner mitochondrial membrane

(Chen et al., 2011). Unable to maintain a normal membrane potential, the bcl-x-

deficient cells eventually depolarize and die off. Through interacting with the

mitochondrial F1F0 ATP synthase, BCL-xL was also shown to regulate the metabolic

efficiency of neurons (Alavian et al., 2011). These studies highlight the importance of

BCL-xL in the regulation of metabolism in different cell types. To our knowledge,

there are no reports of BCL-xL in regulating metabolism in pancreatic progenitors and

this novel finding provides a first insight on the importance of BCL-xL in regulating

both glycolysis and oxidative phosphorylation in D7 pancreatic progenitors.

117

5.8 Inhibition of BCL-xL perturbs Wnt signaling pathway in pancreatic

progenitors

Wnt proteins are a group of cysteine-rich glycoproteins that are primarily defined by a

pattern of 22-24 conserved cysteine residues. Wnt signaling plays an important part in

developmental biology by contributing to tissue patterning, cell lineage determination,

polarity and proliferation (Cadigan and Nusse, 1997, Uren et al., 2000). In the human

genome, there are a total of 19 Wnt proteins. Wnt ligands can bind to receptors of the

Frizzled family, leading to the activation of downstream Wnt signaling through three

pathways: canonical Wnt-β-catenin signalling, the Wnt/Ca2+ pathway, and the planar

cell polarity pathway (Kuhl et al., 2000).

Importantly, Wnt signaling has been observed to be a key pathway in pancreas

development. Research has implicated that Wnt2b, Wnt4, Wnt5a and Wnt7b in the

development of the pancreas in mice (Heller et al., 2002, Papadopoulou and Edlund,

2005). Interestingly, none of the Wnt gene mutants showed any developmental defects

except for Wnt5/Wnt5a (Heller et al., 2002). The activation of β-catenin during

pancreas development resulted in complete pancreatic agenesis (Heiser et al., 2006).

Stimulation of β-catenin activity also promoted the redirection of intestine lineage into

liver and pancreas, implying that Wnt signaling is important specifying hindgut

lineage in the endoderm (McLin et al., 2007). Knocking down of β-catenin inhibitor,

Apc also resulted in the complete abolishment of pancreatic development in zebrafish

(Nadauld et al., 2004).

In another study, use of the Wnt inhibitor APC in vitro, promoted an increase in the

amount of differentiated endocrine cells, suggesting that suppression of Wnt signalling

is crucial for normal mice pancreas development (Sharon et al., 2019). These results

118

propose that pancreatic development is tightly regulated via Wnt signaling. Further

studies on Wnt signaling functions could lead to deeper insights into pancreatic

development.

I showed that certain genes involved in Wnt signaling are perturbed, in particular,

upregulation of WNT2B. (Fig 21B). This finding has also been confirmed in the

previous investigation that Wnt2b, Wnt5a and Wnt7b are strongly implicated in mouse

pancreas development (Heller et al., 2002, Papadopoulou and Edlund, 2005), albeit in

rodents and not human pancreatic development. I also showed inhibition of BCL-xL

decreases WNT5A and WNT5B transcripts (Fig 21C). However, in a contrasting study

(Heller et al., 2002), the investigators reported that overexpression of Wnt5a resulted

in a decrease pancreas size, implying that pancreatic bud formation was incomplete,

thus, limiting the growth of the pancreas. This is in direct contrast with our

observation that a decrease in WNT5A transcripts disrupts pancreatic progenitor

specification. However, in another study that supports our results, the authors utilized

morpholinos (MOs), a sequence-specific translational inhibitor to inhibit Wnt5a in

both zebrafish and mouse (Kim et al., 2005). They reported that Wnt5/Fz2 plays an

important role in islet formation. One possible suggestion to resolve this contradiction

is that Wnt5a needs to be in the correct dosage as well as at the right developmental

stage for normal pancreas organogenesis.

5.9 A decrease in SFRP5 transcript expression is insufficient to decrease

pancreatic gene expression in vitro

There are five Secreted Frizzled Receptor Proteins (SFRP) members in humans,

mainly SFRP1, SFRP2, SFRP3, SFRP4 and SFRP5. Being the first group of proteins

to be identified as Wnt antagonists, they are made up of 300 amino acids containing a

119

signal sequence, a small hydrophilic C-terminal domain and a Frizzled-like cysteine-

rich domain (CRD) (Rattner et al., 1997). As the name implies, SFRPs exhibited

similarity to Frizzled’s extracellular domain, suggesting that SFRPs would be able to

bind Wnt and inhibit Wnt signaling. Each member has highly specific and temporal

expression patterns, suggesting that they are critical for developmental processes

(Rattner et al., 1997, Leimeister et al., 1998). For instance, the deletion of a specific

sequence in the Frizzled CRD domain in SFRP3 is required to bind and inhibit Wnt-1

signaling (Lin et al., 1997). In another study, SFRP1 was shown to bind to Wingless

(Wg) in both co-precipitation and ELISA assays (Uren et al., 2000). However, the

deletion of a certain sequence in CRD did not affect SFRP1’s ability to bind to Wg

suggesting that other sites are involved in Wg binding.

SFRP5 exhibited an increasing expression trend during 17D differentiation (Fig 22C),

suggesting its importance in pancreatic progenitor differentiation. I also showed that

among the many SFRPs, only SFRP5 transcripts and protein is drastically reduced

upon BCL-xL inhibition (Fig 22A) and thus, I postulated that SFRP5 is important in

pancreatic specification. I was able to knockdown SFRP5 transcripts (Fig 23B) and I

observed a large amount of cell death (Fig 23A). I also showed that knockdown of

SFRP5 did not decrease pancreatic progenitor transcripts HNF1B, GATA4 and PDX1

(Fig 23B).

Based on the previous finding, Sfrp5 has been shown to inhibit Wnt11 and the deletion

of Sfrp5 failed to maintain pancreatic foregut identity in a Xenopus model (Li et al.,

2008). I reasoned that knockdown of SFRP5 transcript via lentivirus-mediated

transduction was insufficient to observe a decrease in the expression of pancreatic

progenitor transcripts. For future work, I will evaluate the knockdown of SFRP5

protein and confirm high efficiency of knockdown in all the pancreatic cells. Another

120

solution is to ensure complete depletion of SFRP5, a feasible strategy is to have to

generate a SFRP5-knockout line and repeat the experiments to observe for any

phenotypes.

5.10 Inhibition of BCL-xL indirectly leads to a loss of pancreatic β-like cell

identity

Here, I reported that BCL-xL also showed increased transcript expression during 35D

generation protocol (β-like cells), suggesting that it is also indirectly involved in the

generation of pancreatic β-like cells (Fig 24C). Evidence that BCL-xL could be

indirectly important for the generation of pancreatic β-like cells is that PDX1, MAFA

and INS transcript expression were downregulated on D35 upon inhibition of BCL-xL

on D8 (Fig 25B & 25C). These results thus lend further credence to our earlier results

of decreased pancreatic progenitor transcript expression using the 17D differentiation

protocol (Fig 14C).

Many previous studies have link BCL-xL to cellular lineage specification and

functions in the areas of hematopoietic differentiation (Haughn et al., 2003) and

neurons differentiation (Nakamura et al., 2016). Taken together, this suggest that

BCL-xL contributes to many types of cell lineage development and functions.

121

6 Discussion (Part 2)

6.1 Tunicamycin and Thapsigargin induce ER stress and perturb the

expression of Bcl-2 family of transcripts in MIN6 cells

The results presented here show that ER stressors including tunicamycin and

thapsigargin were able to induce the UPR in MIN6 cells by upregulating IRE1a, Perk

and Atf6. Tunicamycin is able to inhibit N-linked glycosylation of proteins by

DPAGT1 in the ER, inducing ER stress (Heifetz et al., 1979, Keller et al., 1979)

whereas thapsigargin inhibits sarcoplasmic and endoplasmic reticulum Ca2+-ATPase

(SERCA), eventually leading to depletion of calcium in the ER and increased cytosolic

calcium concentrations (Foufelle and Fromenty, 2016). However, the results suggest

that despite the difference in the mode of ER stress activation, all three ER stress

pathways are being activated as shown by an increase in Perk, Atf4, Atf6, Sxbp1, Ire1a

and Chop10 transcripts. (Fig 26A, 27A), consistent with a similarity in outcome.

Activation of Perk can stimulate apoptosis through increasing the expression of Atf4

and Chop10 (Ma et al., 2002, Jiang et al., 2004). Chop10 is an important mediator that

performs a key function in apoptosis (Oyadomari and Mori, 2004). As such, the

upregulation of Chop10 is linked to several pro-apoptotic effects downstream of ER

stress (Benavides et al., 2005, Tajiri et al., 2006, Oyadomari and Mori, 2004). It

includes the translocation of Bax from the cytosolic compartment to mitochondria

(Gotoh et al., 2004) and downregulation of Bcl-2, resulting in decrease of cellular

glutathione (McCullough et al., 2001) and subsequently exposing the cells to oxidative

stress (Ciccaglione et al., 2007). Bcl-2 family proteins are generally thought of as the

governors of apoptosis, both through the mitochondrial pathway and through ER stress

(Newmeyer and Ferguson-Miller, 2003) and also cell death regulated by ER stress. In

122

this case, I also showed that tunicamycin/thapsigargin can also upregulate Bim, Bax,

Puma, Noxa and Bcl-2 (Fig 26B, 27B). This finding has also been reported earlier

(Oakes et al., 2006). This indicates that treatment with these ER stressors for 24 h was

able to induce ER stress and Bcl-2 family of genes expression. These findings were

confirmed independently by other groups who reported activation of the UPR

pathways using ER stressors albeit, in mouse β-cells (Rulifson et al., 2007, Grunnet et

al., 2009). Although the mode of ER stress activation by tunicamycin is different from

that of thapsigargin, the results suggest a similarity in the outcome. Both tunicamycin

and thapsigargin were able to induce similar outcome in ER stress activation such as

increase in Perk, Atf4, Atf6, Sxbp1, Ire1a and Chop10.

6.2 Overexpression of BIM isoforms did not perturb ER stress and BCL-2

family of transcripts in MIN6 cells and human islets

I reported that I was able to overexpress the various BIM isoforms, BIML, BIMEL

and BIMγ in MIN6 in the presence of Tunicamycin and Thapsigargin (Fig 28A).

However, even though overexpression was successful in both MIN6 and human islets,

I did not observe any perturbations in ER stress and Bcl-2 family of transcripts in both

MIN6 in Tunicamycin (Fig 28B, 28C) and Thapsigargin-treated samples (Fig 28D,

28E). I was also able to overexpress BIM isoforms in human islets (Fig 29A) but also

did not managed to observe perturbation in both ER stress (Fig 29B) and BCL-2

family of transcripts (Fig 29C). I reasoned that the BIM isoforms interactions take

place at the protein level and overexpression at the transcript level was insufficient to

perturb both ER stress and BCL-2 family of transcripts. It was also noted that BIML

and BIMEL are unable to be overexpressed at the protein level and this could possibly

account for the result shown.

123

6.3 Inhibitory mechanisms prevent BIM protein from being overexpressed in

MIN6 cells

I was able to overexpress all of the BIM isoforms at the protein level in HEK293FT

(Fig 30A). but not MIN6 β-cells. However, I was only able to overexpress BIMγ in

MIN6 (Fig 31A). I did not observe any presence of GFP in MIN6 overexpressed with

BIML/BIMEL even after 48 h (Fig 32D). Moreover, western blot analysis also showed

no exogenous BIML and BIMEL proteins being overexpressed (Fig 32A). On the

other hand, BIMγ was successfully overexpressed at 48 h (Fig 32B). This suggests that

the BIML/BIMEL proteins were not translated at all in MIN6 cells. This strongly

suggests that there might be a difference in the regulation of BIM expression between

cancer cells and β-cell lines. Moreover, BIML and BIMEL were not overexpressed in

MIN6 cell line despite accumulating at RNA levels, possibly hinting a tight

translational/posttranslational control (Fig 32A). There have been explanations about

the repression of BIM in many cell types such as lymphocytes (Dijkers et al., 2000)

and fibroblasts (Weston et al., 2003). However, its repression in pancreatic β-cells is

still unknown. There might be cell-type specific differences in which BIML/BIMEL

are unable to be overexpressed in MIN6 cells. This could be due to BIML and BIMEL

proteins being rapidly degraded upon translation as Bim was found to be degraded by

the ubiquitin-proteasome system due to phosphorylation of Bim by p42/p44 MAPK

(Ley et al., 2003, Luciano et al., 2003). In other systems, Bim protein was also shown

in neurons (Meller et al., 2006) to be rapidly degraded after the cells experienced

physiological stimuli. The rapid degradation of the pro-apoptotic Bim protein using an

ubiquitin-proteasome system protects the cells from further damage, ensuring cell

survival. Such an ubiquitin-proteasome system could also possibly exist in the MIN6

mouse β-cell, thus degrading the exogenous BIML and BIMEL. Hence, I propose

124

using MG132, a proteasome inhibitor that could possibly block BIML and BIMEL

protein degradation in MIN6 cells. Using this approach, I might be able to overexpress

BIML and BIMEL at the protein level and further evaluate if BIML and BIMEL can

perturb ER stress and Bcl-2 family of transcripts.

6.4 Overexpression of BIMγ induced upregulation of BCL-xL but did not protect

against apoptosis induced by ER stressors/cytokines

Here, I showed that the treatment of MIN6 cells with Tunicamycin and Thapsigargin

appeared to decrease the amount of BIMγ protein overexpression (Figure 33A). This

suggests that there may be some unknown mechanism of ER stressors which is able to

inhibit BIMγ overexpression. I also showed that the overexpression of BIMγ (an

increase in BIM exon 3 to exon 4) in the presence of ER stressors/cytokines was able

to upregulate BCL-xL protein expression in MIN6 (Fig 35C, 36C). However, despite

the presence of BCL-xL protein upregulation induced by BIMγ overexpression,

cleaved caspase 3 band was detected (Fig 37A & 38A). This implies that BIMγ-

induced increased expression of BCL-xL is insufficient to protect against apoptosis in

MIN6 cells.

I hypothesized that the increased ratio of exon 3 to exon 4 would protect the pancreatic

β-cells against ER stressors/cytokines-induced apoptosis. This theory was corroborated

by previously published evidence suggesting that the increase in BIM exon 3 to exon 4

ratio conferred intrinsic tyrosine kinase inhibitor-mediated resistance apoptosis in

chronic myeloid leukemia and epidermal growth factor receptor NSCLC cell lines (Ng

et al., 2012). However, this TKI-mediated resistance could be reversed by BH3-

mimetic drugs.

125

In this case, even though I showed BCL-xL protein were upregulated upon BIMγ

overexpression (increased BIM exon 3 to exon 4 ratio), it was insufficient to protect

against apoptosis in MIN6 cells, possibly suggesting that other prosurvival or pro-

apoptotic factors may be required.

7 Conclusion

Here, I conclude that BCL-xL is a key anti-apoptotic protein that is important in the

survival of pancreatic progenitors. Apart from that, BCL-xL also played a role in

influencing differentiation of hPSC towards pancreatic lineage as high levels of BCL-

xL protein were observed from D7 onwards. I also found that BAK was decreased on

D7 onwards during pancreatic differentiation, suggesting that low levels of BAK

protein were necessary for pancreatic specification. Furthermore, the loss of BCL-xL

function also led to a decrease in glycolysis functions and oxidative phosphorylation in

pancreatic progenitors. This evidence highlights BCL-xL critical role in pancreatic

progenitors. I also conclude that the loss of BCL-xL led to perturbations in Wnt genes

such as WNT2B, WNT5A and WNT5B. Most importantly, it also led to a decrease in

SFRP5 transcript and protein expression. Even though SFRP5 was shown to maintain

pancreatic foregut identity in a Xenopus model, I did not observe perturbation in

pancreatic gene expression after SFRP5 knockdown, suggesting that there could be

some contradictions on the role of SFRP5 in maintaining pancreatic lineage in-vitro. I

also showed that BCL-xL plays an important role in maintaining the identity of β-like

cells generated from hPSC.

I also conclude that Tunicamycin and Thapsigargin were able to induce ER stress and

perturb the Bcl-2 family of transcripts. Further observations revealed that all three

126

BIM isoforms, BIML, BIMEL and BIMγ were successfully overexpressed in

HEK293FT. However, only BIMγ was successfully overexpressed in MIN6 cells,

suggesting a tight translational/posttranslational control of BIML and BMEL proteins

in MIN6 cells. I also showed that the increased BIM exon 3 to exon 4 ratio through

overexpression of BIMγ was able to indirectly upregulate BCL-xL protein expression.

However, this was insufficient to protect mouse β-cells against apoptosis. Thus, I

reasoned that the reduction of BIM exon 4 is the key to confer protection against β-

cells apoptosis.

Collectively, I provided the possible involvement of BCL-xL in human pancreatic

progenitors/human β-like cells and BIM in terminally-differentiated mouse β-

cells/human islets.

127

8 Future work

8.1 Future work for Chapter 3

To our knowledge, I am the first to show that BCL-xL might be indirectly involved

during hPSC differentiation towards the pancreatic lineage. Hence, further work would

need to be done as described below.

I also intend to perform co-immunoprecipitation studies to confirm the interaction

between BAK and BCL-xL during differentiation to pancreatic progenitors.

I intend to address the failure of BCL-xL overexpression to rescue the BCL-xL-

inhibited phenotype in pancreatic progenitors. I suggest using western blot and

immunofluorescence to establish the overexpression of BCL-xL at the protein level in

pancreatic progenitors. I also reasoned that there might be additional cofactors that are

needed for the rescue to work.

I performed knockdown of SFRP5 and assumed that it did not decrease pancreatic

gene transcripts. I intend to use western blot and confirm that SFRP5 is successfully

knockdown at the protein level before making this assumption.

For long term work, it may be possible to investigate the functions of BCL-xL further

through a conditional deletion of Bcl-xl in mouse pancreas. Using this system, it

would be possible to study the effects of Bcl-xl knockout in mouse pancreas

development in-vivo using RT-QPCR, immunofluorescence and western blot to probe

for mouse β-cell markers. In addition, it is also possible to evaluate the functional

impact of Bcl-xl knockout mouse β-cells using glucose-stimulated insulin secretion

(GSIS). Another work to be done in the long term would be to generate a BCL-xL

knockout hPSC model and subject the cells to both 17D and 35D differentiation.

Using RT-QPCR and western blot to probe for β-cell markers, I would be able to

128

evaluate the effects of complete BCL-xL knockout on pancreatic progenitors and β-

like cells. On the other hand, it may be possible to generate a SFRP5-knockout hPSC

line to ensure complete depletion of SFRP5 and repeat the experiments to observe for

any phenotypes.

8.2 Future work for Chapter 4

Since I evaluated that the increase in BIM exon 3 to exon 4 ratio does not decrease the

ability of ER stressors to initiate apoptosis in β-cells, I propose using lentiviral-

mediated knockdown approach to target BIM exon 4. This will allow us to determine if

the decreased exon 4 levels can protect against apoptosis in pancreatic β-cells. I would

also perform the experiments in EndoC-BH2, an immortalized human β-cell line to

show its significance in human studies. Our results also suggested that BIML and

BIMEL were not able to be overexpressed at the protein level in MIN6 cells. One

possible solution is to use MG132, a proteasome inhibitor. If BIML and BIMEL are

indeed degraded at the protein level, the usage of MG132 could block the degradation

process. I might be able to overexpress BIML and BIMEL at the protein level

successfully. Using this approach, I can then evaluate the overexpression of the pro-

apoptotic isoforms of BIML and BIMEL effects on ER stress and Bcl-2 family of

transcripts.

129

9 References

Adachi, M., Zhao, X. & Imai, K. 2005. Nomenclature of dynein light chain-linked

BH3-only protein Bim isoforms. Cell Death Differ, 12, 192-3.

Adams, J. M. 2003. Ways of dying: multiple pathways to apoptosis. Genes Dev, 17,

2481-95.

Adams, J. M. & Cory, S. 1998. The Bcl-2 protein family: arbiters of cell survival.

Science, 281, 1322-6.

Akgul, C., Moulding, D. A. & Edwards, S. W. 2004. Alternative splicing of Bcl-2-

related genes: functional consequences and potential therapeutic applications.

Cellular and molecular life sciences : CMLS, 61, 2189-99.

Alavian, K. N., Li, H., Collis, L., Bonanni, L., Zeng, L., Sacchetti, S., Lazrove, E.,

Nabili, P., Flaherty, B., Graham, M., Chen, Y., Messerli, S. M., Mariggio, M.

A., Rahner, C., Mcnay, E., Shore, G. C., Smith, P. J., Hardwick, J. M. & Jonas,

E. A. 2011. Bcl-xL regulates metabolic efficiency of neurons through

interaction with the mitochondrial F1FO ATP synthase. Nat Cell Biol, 13,

1224-33.

Allagnat, F., Cunha, D., Moore, F., Vanderwinden, J. M., Eizirik, D. L. & Cardozo, A.

K. 2011. Mcl-1 downregulation by pro-inflammatory cytokines and palmitate

is an early event contributing to beta-cell apoptosis. Cell death and

differentiation, 18, 328-37.

Allison, J., Thomas, H., Beck, D., Brady, J. L., Lew, A. M., Elefanty, A., Kosaka, H.,

Kay, T. W., Huang, D. C. & Strasser, A. 2000. Transgenic overexpression of

human Bcl-2 in islet beta cells inhibits apoptosis but does not prevent

autoimmune destruction. International immunology, 12, 9-17.

Annis, M. G., Soucie, E. L., Dlugosz, P. J., Cruz-Aguado, J. A., Penn, L. Z., Leber, B.

& Andrews, D. W. 2005. Bax forms multispanning monomers that oligomerize

to permeabilize membranes during apoptosis. EMBO J, 24, 2096-103.

Aranovich, A., Liu, Q., Collins, T., Geng, F., Dixit, S., Leber, B. & Andrews, D. W.

2012. Differences in the mechanisms of proapoptotic BH3 proteins binding to

Bcl-XL and Bcl-2 quantified in live MCF-7 cells. Mol Cell, 45, 754-63.

Assady, S., Maor, G., Amit, M., Itskovitz-Eldor, J., Skorecki, K. L. & Tzukerman, M.

2001. Insulin production by human embryonic stem cells. Diabetes, 50, 1691-

7.

Bae, J., Leo, C. P., Hsu, S. Y. & Hsueh, A. J. 2000. MCL-1S, a splicing variant of the

antiapoptotic BCL-2 family member MCL-1, encodes a proapoptotic protein

possessing only the BH3 domain. J Biol Chem, 275, 25255-61.

Bai, H., Chen, K., Gao, Y. X., Arzigian, M., Xie, Y. L., Malcosky, C., Yang, Y. G.,

Wu, W. S. & Wang, Z. Z. 2012. Bcl-xL enhances single-cell survival and

expansion of human embryonic stem cells without affecting self-renewal. Stem

Cell Res, 8, 26-37.

Barbu, A., Welsh, N. & Saldeen, J. 2002. Cytokine-induced apoptosis and necrosis are

preceded by disruption of the mitochondrial membrane potential (Deltapsi(m))

in pancreatic RINm5F cells: prevention by Bcl-2. Molecular and cellular

endocrinology, 190, 75-82.

Basford, C. L., Prentice, K. J., Hardy, A. B., Sarangi, F., Micallef, S. J., Li, X., Guo,

Q., Elefanty, A. G., Stanley, E. G., Keller, G., Allister, E. M., Nostro, M. C. &

Wheeler, M. B. 2012. The functional and molecular characterisation of human

130

embryonic stem cell-derived insulin-positive cells compared with adult

pancreatic beta cells. Diabetologia, 55, 358-71.

Belka, C. & Budach, W. 2002. Anti-apoptotic Bcl-2 proteins: structure, function and

relevance for radiation biology. Int J Radiat Biol, 78, 643-58.

Benavides, A., Pastor, D., Santos, P., Tranque, P. & Calvo, S. 2005. CHOP plays a

pivotal role in the astrocyte death induced by oxygen and glucose deprivation.

Glia, 52, 261-75.

Bennett, A., Sloss, O., Topham, C., Nelson, L., Tighe, A. & Taylor, S. S. 2016.

Inhibition of Bcl-xL sensitizes cells to mitotic blockers, but not mitotic drivers.

Open Biol, 6.

Billen, L. P., Kokoski, C. L., Lovell, J. F., Leber, B. & Andrews, D. W. 2008. Bcl-XL

inhibits membrane permeabilization by competing with Bax. PLoS Biol, 6,

e147.

Boise, L. H., Gonzalez-Garcia, M., Postema, C. E., Ding, L., Lindsten, T., Turka, L.

A., Mao, X., Nunez, G. & Thompson, C. B. 1993. bcl-x, a bcl-2-related gene

that functions as a dominant regulator of apoptotic cell death. Cell, 74, 597-

608.

Borowiak, M., Maehr, R., Chen, S., Chen, A. E., Tang, W., Fox, J. L., Schreiber, S. L.

& Melton, D. A. 2009. Small molecules efficiently direct endodermal

differentiation of mouse and human embryonic stem cells. Cell stem cell, 4,

348-58.

Bougneres, P. F., Carel, J. C., Castano, L., Boitard, C., Gardin, J. P., Landais, P., Hors,

J., Mihatsch, M. J., Paillard, M., Chaussain, J. L. & Et Al. 1988. Factors

associated with early remission of type I diabetes in children treated with

cyclosporine. N Engl J Med, 318, 663-70.

Bouillet, P., Cory, S., Zhang, L. C., Strasser, A. & Adams, J. M. 2001. Degenerative

disorders caused by Bcl-2 deficiency prevented by loss of its BH3-only

antagonist Bim. Dev Cell, 1, 645-53.

Bouillet, P., Metcalf, D., Huang, D. C., Tarlinton, D. M., Kay, T. W., Kontgen, F.,

Adams, J. M. & Strasser, A. 1999. Proapoptotic Bcl-2 relative Bim required for

certain apoptotic responses, leukocyte homeostasis, and to preclude

autoimmunity. Science, 286, 1735-8.

Bouillet, P. & Strasser, A. 2002. BH3-only proteins - evolutionarily conserved

proapoptotic Bcl-2 family members essential for initiating programmed cell

death. J Cell Sci, 115, 1567-74.

Brolen, G. K., Heins, N., Edsbagge, J. & Semb, H. 2005. Signals from the embryonic

mouse pancreas induce differentiation of human embryonic stem cells into

insulin-producing beta-cell-like cells. Diabetes, 54, 2867-74.

Bruin, J. E., Rezania, A. & Kieffer, T. J. 2015a. Replacing and safeguarding pancreatic

beta cells for diabetes. Sci Transl Med, 7, 316ps23.

Bruin, J. E., Rezania, A., Xu, J., Narayan, K., Fox, J. K., O'neil, J. J. & Kieffer, T. J.

2013. Maturation and function of human embryonic stem cell-derived

pancreatic progenitors in macroencapsulation devices following transplant into

mice. Diabetologia, 56, 1987-98.

Bruin, J. E., Saber, N., Braun, N., Fox, J. K., Mojibian, M., Asadi, A., Drohan, C.,

O'dwyer, S., Rosman-Balzer, D. S., Swiss, V. A., Rezania, A. & Kieffer, T. J.

2015b. Treating diet-induced diabetes and obesity with human embryonic stem

cell-derived pancreatic progenitor cells and antidiabetic drugs. Stem cell

reports, 4, 605-20.

131

Buckner, J. H. 2010. Mechanisms of impaired regulation by

CD4(+)CD25(+)FOXP3(+) regulatory T cells in human autoimmune diseases.

Nat Rev Immunol, 10, 849-59.

Cadigan, K. M. & Nusse, R. 1997. Wnt signaling: a common theme in animal

development. Genes Dev, 11, 3286-305.

Cai, J., Yu, C., Liu, Y., Chen, S., Guo, Y., Yong, J., Lu, W., Ding, M. & Deng, H.

2010. Generation of homogeneous PDX1(+) pancreatic progenitors from

human ES cell-derived endoderm cells. Journal of molecular cell biology, 2,

50-60.

Callewaert, H. I., Gysemans, C. A., Ladriere, L., D'hertog, W., Hagenbrock, J.,

Overbergh, L., Eizirik, D. L. & Mathieu, C. 2007. Deletion of STAT-1

pancreatic islets protects against streptozotocin-induced diabetes and early

graft failure but not against late rejection. Diabetes, 56, 2169-73.

Campbell, P. D., Weinberg, A., Chee, J., Mariana, L., Ayala, R., Hawthorne, W. J.,

O'connell, P. J., Loudovaris, T., Cowley, M. J., Kay, T. W., Grey, S. T. &

Thomas, H. E. 2012. Expression of pro- and antiapoptotic molecules of the

Bcl-2 family in human islets postisolation. Cell transplantation, 21, 49-60.

Cao, Z., Umek, R. M. & Mcknight, S. L. 1991. Regulated expression of three C/EBP

isoforms during adipose conversion of 3T3-L1 cells. Genes & development, 5,

1538-52.

Cardozo, A. K., Heimberg, H., Heremans, Y., Leeman, R., Kutlu, B., Kruhoffer, M.,

Orntoft, T. & Eizirik, D. L. 2001a. A comprehensive analysis of cytokine-

induced and nuclear factor-kappa B-dependent genes in primary rat pancreatic

beta-cells. The Journal of biological chemistry, 276, 48879-86.

Cardozo, A. K., Kruhoffer, M., Leeman, R., Orntoft, T. & Eizirik, D. L. 2001b.

Identification of novel cytokine-induced genes in pancreatic beta-cells by high-

density oligonucleotide arrays. Diabetes, 50, 909-20.

Cardozo, A. K., Ortis, F., Storling, J., Feng, Y. M., Rasschaert, J., Tonnesen, M., Van

Eylen, F., Mandrup-Poulsen, T., Herchuelz, A. & Eizirik, D. L. 2005.

Cytokines downregulate the sarcoendoplasmic reticulum pump Ca2+ ATPase

2b and deplete endoplasmic reticulum Ca2+, leading to induction of

endoplasmic reticulum stress in pancreatic beta-cells. Diabetes, 54, 452-61.

Carrington, E. M., Mckenzie, M. D., Jansen, E., Myers, M., Fynch, S., Kos, C.,

Strasser, A., Kay, T. W., Scott, C. L. & Allison, J. 2009. Islet beta-cells

deficient in Bcl-xL develop but are abnormally sensitive to apoptotic stimuli.

Diabetes, 58, 2316-23.

Cartron, P. F., Gallenne, T., Bougras, G., Gautier, F., Manero, F., Vusio, P., Meflah,

K., Vallette, F. M. & Juin, P. 2004. The first alpha helix of Bax plays a

necessary role in its ligand-induced activation by the BH3-only proteins Bid

and PUMA. Mol Cell, 16, 807-18.

Certo, M., Del Gaizo Moore, V., Nishino, M., Wei, G., Korsmeyer, S., Armstrong, S.

A. & Letai, A. 2006. Mitochondria primed by death signals determine cellular

addiction to antiapoptotic BCL-2 family members. Cancer cell, 9, 351-65.

Chang, M. Y., Sun, W., Ochiai, W., Nakashima, K., Kim, S. Y., Park, C. H., Kang, J.

S., Shim, J. W., Jo, A. Y., Kang, C. S., Lee, Y. S., Kim, J. S. & Lee, S. H.

2007. Bcl-XL/Bax proteins direct the fate of embryonic cortical precursor

cells. Mol Cell Biol, 27, 4293-305.

Chen, L., Willis, S. N., Wei, A., Smith, B. J., Fletcher, J. I., Hinds, M. G., Colman, P.

M., Day, C. L., Adams, J. M. & Huang, D. C. 2005a. Differential targeting of

132

prosurvival Bcl-2 proteins by their BH3-only ligands allows complementary

apoptotic function. Molecular cell, 17, 393-403.

Chen, L., Willis, S. N., Wei, A., Smith, B. J., Fletcher, J. I., Hinds, M. G., Colman, P.

M., Day, C. L., Adams, J. M. & Huang, D. C. 2005b. Differential targeting of

prosurvival Bcl-2 proteins by their BH3-only ligands allows complementary

apoptotic function. Mol Cell, 17, 393-403.

Chen, S., Borowiak, M., Fox, J. L., Maehr, R., Osafune, K., Davidow, L., Lam, K.,

Peng, L. F., Schreiber, S. L., Rubin, L. L. & Melton, D. 2009. A small

molecule that directs differentiation of human ESCs into the pancreatic lineage.

Nature chemical biology, 5, 258-65.

Chen, Y. B., Aon, M. A., Hsu, Y. T., Soane, L., Teng, X., Mccaffery, J. M., Cheng, W.

C., Qi, B., Li, H., Alavian, K. N., Dayhoff-Brannigan, M., Zou, S., Pineda, F.

J., O'rourke, B., Ko, Y. H., Pedersen, P. L., Kaczmarek, L. K., Jonas, E. A. &

Hardwick, J. M. 2011. Bcl-xL regulates mitochondrial energetics by stabilizing

the inner membrane potential. J Cell Biol, 195, 263-76.

Chinnaiyan, A. M. 1999. The apoptosome: heart and soul of the cell death machine.

Neoplasia, 1, 5-15.

Cho, C. H., Hannan, N. R., Docherty, F. M., Docherty, H. M., Joao Lima, M., Trotter,

M. W., Docherty, K. & Vallier, L. 2012. Inhibition of activin/nodal signalling

is necessary for pancreatic differentiation of human pluripotent stem cells.

Diabetologia, 55, 3284-95.

Cho, Y. M., Lim, J. M., Yoo, D. H., Kim, J. H., Chung, S. S., Park, S. G., Kim, T. H.,

Oh, S. K., Choi, Y. M., Moon, S. Y., Park, K. S. & Lee, H. K. 2008.

Betacellulin and nicotinamide sustain PDX1 expression and induce pancreatic

beta-cell differentiation in human embryonic stem cells. Biochemical and

biophysical research communications, 366, 129-34.

Chujo, D., Foucat, E., Nguyen, T. S., Chaussabel, D., Banchereau, J. & Ueno, H.

2013. ZnT8-Specific CD4+ T cells display distinct cytokine expression profiles

between type 1 diabetes patients and healthy adults. PLoS One, 8, e55595.

Ciccaglione, A. R., Marcantonio, C., Tritarelli, E., Equestre, M., Vendittelli, F.,

Costantino, A., Geraci, A. & Rapicetta, M. 2007. Activation of the ER stress

gene gadd153 by hepatitis C virus sensitizes cells to oxidant injury. Virus

research, 126, 128-38.

Cnop, M., Welsh, N., Jonas, J. C., Jorns, A., Lenzen, S. & Eizirik, D. L. 2005.

Mechanisms of pancreatic beta-cell death in type 1 and type 2 diabetes: many

differences, few similarities. Diabetes, 54 Suppl 2, S97-107.

Colli, M. L., Nogueira, T. C., Allagnat, F., Cunha, D. A., Gurzov, E. N., Cardozo, A.

K., Roivainen, M., Op De Beeck, A. & Eizirik, D. L. 2011a. Exposure to the

viral by-product dsRNA or Coxsackievirus B5 triggers pancreatic beta cell

apoptosis via a Bim / Mcl-1 imbalance. PLoS pathogens, 7, e1002267.

Colli, M. L., Nogueira, T. C., Allagnat, F., Cunha, D. A., Gurzov, E. N., Cardozo, A.

K., Roivainen, M., Op De Beeck, A. & Eizirik, D. L. 2011b. Exposure to the

viral by-product dsRNA or Coxsackievirus B5 triggers pancreatic beta cell

apoptosis via a Bim / Mcl-1 imbalance. PLoS Pathog, 7, e1002267.

Czabotar, P. E., Lee, E. F., Van Delft, M. F., Day, C. L., Smith, B. J., Huang, D. C.,

Fairlie, W. D., Hinds, M. G. & Colman, P. M. 2007. Structural insights into the

degradation of Mcl-1 induced by BH3 domains. Proc Natl Acad Sci U S A,

104, 6217-22.

133

D'amour, K. A., Agulnick, A. D., Eliazer, S., Kelly, O. G., Kroon, E. & Baetge, E. E.

2005. Efficient differentiation of human embryonic stem cells to definitive

endoderm. Nature biotechnology, 23, 1534-41.

D'amour, K. A., Bang, A. G., Eliazer, S., Kelly, O. G., Agulnick, A. D., Smart, N. G.,

Moorman, M. A., Kroon, E., Carpenter, M. K. & Baetge, E. E. 2006.

Production of pancreatic hormone-expressing endocrine cells from human

embryonic stem cells. Nature biotechnology, 24, 1392-401.

Danial, N. N. & Korsmeyer, S. J. 2004. Cell death: critical control points. Cell, 116,

205-19.

Desagher, S., Osen-Sand, A., Nichols, A., Eskes, R., Montessuit, S., Lauper, S.,

Maundrell, K., Antonsson, B. & Martinou, J. C. 1999. Bid-induced

conformational change of Bax is responsible for mitochondrial cytochrome c

release during apoptosis. The Journal of cell biology, 144, 891-901.

Dewson, G., Kratina, T., Czabotar, P., Day, C. L., Adams, J. M. & Kluck, R. M. 2009.

Bak activation for apoptosis involves oligomerization of dimers via their

alpha6 helices. Mol Cell, 36, 696-703.

Dewson, G., Ma, S., Frederick, P., Hockings, C., Tan, I., Kratina, T. & Kluck, R. M.

2012. Bax dimerizes via a symmetric BH3:groove interface during apoptosis.

Cell Death Differ, 19, 661-70.

Dijkers, P. F., Medema, R. H., Lammers, J. W., Koenderman, L. & Coffer, P. J. 2000.

Expression of the pro-apoptotic Bcl-2 family member Bim is regulated by the

forkhead transcription factor FKHR-L1. Current biology : CB, 10, 1201-4.

Distelhorst, C. W. & Bootman, M. D. 2011. Bcl-2 interaction with the inositol 1,4,5-

trisphosphate receptor: role in Ca(2+) signaling and disease. Cell calcium, 50,

234-41.

Dzhagalov, I., Dunkle, A. & He, Y. W. 2008. The anti-apoptotic Bcl-2 family member

Mcl-1 promotes T lymphocyte survival at multiple stages. J Immunol, 181,

521-8.

Eizirik, D. L., Cagliero, E., Bjorklund, A. & Welsh, N. 1992. Interleukin-1 beta

induces the expression of an isoform of nitric oxide synthase in insulin-

producing cells, which is similar to that observed in activated macrophages.

FEBS letters, 308, 249-52.

Eizirik, D. L. & Mandrup-Poulsen, T. 2001. A choice of death--the signal-transduction

of immune-mediated beta-cell apoptosis. Diabetologia, 44, 2115-33.

Eldor, R., Yeffet, A., Baum, K., Doviner, V., Amar, D., Ben-Neriah, Y., Christofori,

G., Peled, A., Carel, J. C., Boitard, C., Klein, T., Serup, P., Eizirik, D. L. &

Melloul, D. 2006. Conditional and specific NF-kappaB blockade protects

pancreatic beta cells from diabetogenic agents. Proceedings of the National

Academy of Sciences of the United States of America, 103, 5072-7.

Elouil, H., Bensellam, M., Guiot, Y., Vander Mierde, D., Pascal, S. M., Schuit, F. C.

& Jonas, J. C. 2007. Acute nutrient regulation of the unfolded protein response

and integrated stress response in cultured rat pancreatic islets. Diabetologia,

50, 1442-52.

Enders, A., Bouillet, P., Puthalakath, H., Xu, Y., Tarlinton, D. M. & Strasser, A. 2003.

Loss of the pro-apoptotic BH3-only Bcl-2 family member Bim inhibits BCR

stimulation-induced apoptosis and deletion of autoreactive B cells. J Exp Med,

198, 1119-26.

Eskes, R., Desagher, S., Antonsson, B. & Martinou, J. C. 2000. Bid induces the

oligomerization and insertion of Bax into the outer mitochondrial membrane.

Mol Cell Biol, 20, 929-35.

134

Fang, W., Rivard, J. J., Mueller, D. L. & Behrens, T. W. 1994. Cloning and molecular

characterization of mouse bcl-x in B and T lymphocytes. Journal of

immunology, 153, 4388-98.

Ferraro, A., Socci, C., Stabilini, A., Valle, A., Monti, P., Piemonti, L., Nano, R., Olek,

S., Maffi, P., Scavini, M., Secchi, A., Staudacher, C., Bonifacio, E. &

Battaglia, M. 2011. Expansion of Th17 cells and functional defects in T

regulatory cells are key features of the pancreatic lymph nodes in patients with

type 1 diabetes. Diabetes, 60, 2903-13.

Foufelle, F. & Fromenty, B. 2016. Role of endoplasmic reticulum stress in drug-

induced toxicity. Pharmacol Res Perspect, 4, e00211.

Fujiwara, M., Izuishi, K., Sano, T., Hossain, M. A., Kimura, S., Masaki, T. & Suzuki,

Y. 2008. Modulating effect of the PI3-kinase inhibitor LY294002 on cisplatin

in human pancreatic cancer cells. J Exp Clin Cancer Res, 27, 76.

Garcia-Saez, A. J., Ries, J., Orzaez, M., Perez-Paya, E. & Schwille, P. 2009.

Membrane promotes tBID interaction with BCL(XL). Nat Struct Mol Biol, 16,

1178-85.

Gotoh, T., Terada, K., Oyadomari, S. & Mori, M. 2004. hsp70-DnaJ chaperone pair

prevents nitric oxide- and CHOP-induced apoptosis by inhibiting translocation

of Bax to mitochondria. Cell death and differentiation, 11, 390-402.

Green, D. R. & Kroemer, G. 2004. The pathophysiology of mitochondrial cell death.

Science, 305, 626-9.

Griffiths, G. J., Dubrez, L., Morgan, C. P., Jones, N. A., Whitehouse, J., Corfe, B. M.,

Dive, C. & Hickman, J. A. 1999. Cell damage-induced conformational changes

of the pro-apoptotic protein Bak in vivo precede the onset of apoptosis. The

Journal of cell biology, 144, 903-14.

Gross, A., Jockel, J., Wei, M. C. & Korsmeyer, S. J. 1998. Enforced dimerization of

BAX results in its translocation, mitochondrial dysfunction and apoptosis. The

EMBO journal, 17, 3878-85.

Gross, A., Mcdonnell, J. M. & Korsmeyer, S. J. 1999. BCL-2 family members and the

mitochondria in apoptosis. Genes & development, 13, 1899-911.

Grunnet, L. G., Aikin, R., Tonnesen, M. F., Paraskevas, S., Blaabjerg, L., Storling, J.,

Rosenberg, L., Billestrup, N., Maysinger, D. & Mandrup-Poulsen, T. 2009.

Proinflammatory cytokines activate the intrinsic apoptotic pathway in beta-

cells. Diabetes, 58, 1807-15.

Gysemans, C. A., Ladriere, L., Callewaert, H., Rasschaert, J., Flamez, D., Levy, D. E.,

Matthys, P., Eizirik, D. L. & Mathieu, C. 2005. Disruption of the gamma-

interferon signaling pathway at the level of signal transducer and activator of

transcription-1 prevents immune destruction of beta-cells. Diabetes, 54, 2396-

403.

Hamasaki, A., Sendo, F., Nakayama, K., Ishida, N., Negishi, I., Nakayama, K. &

Hatakeyama, S. 1998. Accelerated neutrophil apoptosis in mice lacking A1-a, a

subtype of the bcl-2-related A1 gene. J Exp Med, 188, 1985-92.

Hart, A., Papadopoulou, S. & Edlund, H. 2003. Fgf10 maintains notch activation,

stimulates proliferation, and blocks differentiation of pancreatic epithelial cells.

Developmental dynamics : an official publication of the American Association

of Anatomists, 228, 185-93.

Haughn, L., Hawley, R. G., Morrison, D. K., Von Boehmer, H. & Hockenbery, D. M.

2003. BCL-2 and BCL-XL restrict lineage choice during hematopoietic

differentiation. J Biol Chem, 278, 25158-65.

135

Hebrok, M. 2003. Hedgehog signaling in pancreas development. Mechanisms of

development, 120, 45-57.

Hebrok, M., Kim, S. K. & Melton, D. A. 1998. Notochord repression of endodermal

Sonic hedgehog permits pancreas development. Genes & development, 12,

1705-13.

Heermeier, K., Benedict, M., Li, M., Furth, P., Nunez, G. & Hennighausen, L. 1996.

Bax and Bcl-xs are induced at the onset of apoptosis in involuting mammary

epithelial cells. Mechanisms of development, 56, 197-207.

Heifetz, A., Keenan, R. W. & Elbein, A. D. 1979. Mechanism of action of

tunicamycin on the UDP-GlcNAc:dolichyl-phosphate Glc-NAc-1-phosphate

transferase. Biochemistry, 18, 2186-92.

Heiser, P. W., Lau, J., Taketo, M. M., Herrera, P. L. & Hebrok, M. 2006. Stabilization

of beta-catenin impacts pancreas growth. Development, 133, 2023-32.

Heller, R. S., Dichmann, D. S., Jensen, J., Miller, C., Wong, G., Madsen, O. D. &

Serup, P. 2002. Expression patterns of Wnts, Frizzleds, sFRPs, and

misexpression in transgenic mice suggesting a role for Wnts in pancreas and

foregut pattern formation. Dev Dyn, 225, 260-70.

Hill, M. M., Adrain, C., Duriez, P. J., Creagh, E. M. & Martin, S. J. 2004. Analysis of

the composition, assembly kinetics and activity of native Apaf-1 apoptosomes.

The EMBO journal, 23, 2134-45.

Hockenbery, D. M., Oltvai, Z. N., Yin, X. M., Milliman, C. L. & Korsmeyer, S. J.

1993. Bcl-2 functions in an antioxidant pathway to prevent apoptosis. Cell, 75,

241-51.

Hsu, Y. T., Wolter, K. G. & Youle, R. J. 1997. Cytosol-to-membrane redistribution of

Bax and Bcl-X(L) during apoptosis. Proceedings of the National Academy of

Sciences of the United States of America, 94, 3668-72.

Huang, D. C. & Strasser, A. 2000. BH3-Only proteins-essential initiators of apoptotic

cell death. Cell, 103, 839-42.

Ikezawa, K., Hikita, H., Shigekawa, M., Iwahashi, K., Eguchi, H., Sakamori, R.,

Tatsumi, T. & Takehara, T. 2017. Increased Bcl-xL Expression in Pancreatic

Neoplasia Promotes Carcinogenesis by Inhibiting Senescence and Apoptosis.

Cell Mol Gastroenterol Hepatol, 4, 185-200 e1.

Inman, G. J., Nicolas, F. J., Callahan, J. F., Harling, J. D., Gaster, L. M., Reith, A. D.,

Laping, N. J. & Hill, C. S. 2002. SB-431542 is a potent and specific inhibitor

of transforming growth factor-beta superfamily type I activin receptor-like

kinase (ALK) receptors ALK4, ALK5, and ALK7. Molecular pharmacology,

62, 65-74.

Jensen, J. 2004. Gene regulatory factors in pancreatic development. Developmental

dynamics : an official publication of the American Association of Anatomists,

229, 176-200.

Jiang, H., Fan, D., Zhou, G., Li, X. & Deng, H. 2010. Phosphatidylinositol 3-kinase

inhibitor(LY294002) induces apoptosis of human nasopharyngeal carcinoma in

vitro and in vivo. J Exp Clin Cancer Res, 29, 34.

Jiang, H. Y., Wek, S. A., Mcgrath, B. C., Lu, D., Hai, T., Harding, H. P., Wang, X.,

Ron, D., Cavener, D. R. & Wek, R. C. 2004. Activating transcription factor 3

is integral to the eukaryotic initiation factor 2 kinase stress response. Molecular

and cellular biology, 24, 1365-77.

Jiang, J., Au, M., Lu, K., Eshpeter, A., Korbutt, G., Fisk, G. & Majumdar, A. S. 2007a.

Generation of insulin-producing islet-like clusters from human embryonic stem

cells. Stem cells, 25, 1940-53.

136

Jiang, W., Shi, Y., Zhao, D., Chen, S., Yong, J., Zhang, J., Qing, T., Sun, X., Zhang,

P., Ding, M., Li, D. & Deng, H. 2007b. In vitro derivation of functional

insulin-producing cells from human embryonic stem cells. Cell research, 17,

333-44.

Juan, W. C., Roca, X. & Ong, S. T. 2014. Identification of cis-acting elements and

splicing factors involved in the regulation of BIM Pre-mRNA splicing. PloS

one, 9, e95210.

Kamada, S., Shimono, A., Shinto, Y., Tsujimura, T., Takahashi, T., Noda, T.,

Kitamura, Y., Kondoh, H. & Tsujimoto, Y. 1995. bcl-2 deficiency in mice

leads to pleiotropic abnormalities: accelerated lymphoid cell death in thymus

and spleen, polycystic kidney, hair hypopigmentation, and distorted small

intestine. Cancer Res, 55, 354-9.

Kane, D. J., Sarafian, T. A., Anton, R., Hahn, H., Gralla, E. B., Valentine, J. S., Ord,

T. & Bredesen, D. E. 1993. Bcl-2 inhibition of neural death: decreased

generation of reactive oxygen species. Science, 262, 1274-7.

Keller, R. K., Boon, D. Y. & Crum, F. C. 1979. N-Acetylglucosamine- 1 -phosphate

transferase from hen oviduct: solubilization, characterization, and inhibition by

tunicamycin. Biochemistry, 18, 3946-52.

Kim, H., Rafiuddin-Shah, M., Tu, H. C., Jeffers, J. R., Zambetti, G. P., Hsieh, J. J. &

Cheng, E. H. 2006. Hierarchical regulation of mitochondrion-dependent

apoptosis by BCL-2 subfamilies. Nature cell biology, 8, 1348-58.

Kim, H. J., Schleiffarth, J. R., Jessurun, J., Sumanas, S., Petryk, A., Lin, S. & Ekker,

S. C. 2005. Wnt5 signaling in vertebrate pancreas development. BMC Biol, 3,

23.

Kim, I., Xu, W. & Reed, J. C. 2008. Cell death and endoplasmic reticulum stress:

disease relevance and therapeutic opportunities. Nature reviews. Drug

discovery, 7, 1013-30.

Kim, J. H., Sim, S. H., Ha, H. J., Ko, J. J., Lee, K. & Bae, J. 2009. MCL-1ES, a novel

variant of MCL-1, associates with MCL-1L and induces mitochondrial cell

death. FEBS Lett, 583, 2758-64.

King Pan Ng, Axel M Hillmer, Charles T H Chuah, Wen Chun Juan, Tun Kiat Ko,

Audrey S M Teo, Pramila N Ariyaratne, Naoto Takahashi, Kenichi Sawada,

Yao Fei, Sheila Soh, Wah Heng Lee, John W J Huang, John C Allen Jr, Xing

Yi Woo, Niranjan Nagarajan, Vikrant Kumar, Anbupalam Thalamuthu, Wan

Ting Poh, Ai Leen Ang, Hae Tha Mya, Gee Fung How, Li Yi Yang, Liang Piu

Koh, Balram Chowbay, Chia-Tien Chang, Veera S Nadarajan, Wee Joo Chng,

Hein Than, Lay Cheng Lim, Yeow Tee Goh, Shenli Zhang, Dianne Poh,

Patrick Tan, Ju-Ee Seet, Mei-Kim Ang, Noan-Minh Chau, Quan-Sing Ng,

Daniel S W Tan, Manabu Soda, Kazutoshi Isobe, Markus M Nöthen, Tien Y

Wong, Atif Shahab, Xiaoan Ruan, Valère Cacheux-Rataboul, Wing-Kin Sung,

Eng Huat Tan, Yasushi Yatabe, Hiroyuki Mano, Ross a Soo, Tan Min Chin,

Wan-Teck Lim, Ruan, Y. & Ong, S. T. 2012. A common BIM deletion

polymorphism mediates intrinsic resistance and inferior responses to tyrosine

kinase inhibitors in cancer. Nature Medicine, 18, 521-528.

Kodama, T., Hikita, H., Kawaguchi, T., Shigekawa, M., Shimizu, S., Hayashi, Y., Li,

W., Miyagi, T., Hosui, A., Tatsumi, T., Kanto, T., Hiramatsu, N., Kiyomizu,

K., Tadokoro, S., Tomiyama, Y., Hayashi, N. & Takehara, T. 2012. Mcl-1 and

Bcl-xL regulate Bak/Bax-dependent apoptosis of the megakaryocytic lineage at

multistages. Cell Death Differ, 19, 1856-69.

137

Korsmeyer, S. J., Shutter, J. R., Veis, D. J., Merry, D. E. & Oltvai, Z. N. 1993. Bcl-

2/Bax: a rheostat that regulates an anti-oxidant pathway and cell death.

Seminars in cancer biology, 4, 327-32.

Korsmeyer, S. J., Wei, M. C., Saito, M., Weiler, S., Oh, K. J. & Schlesinger, P. H.

2000. Pro-apoptotic cascade activates BID, which oligomerizes BAK or BAX

into pores that result in the release of cytochrome c. Cell Death Differ, 7, 1166-

73.

Koseki, T., Yamato, K., Krajewski, S., Reed, J. C., Tsujimoto, Y. & Nishihara, T.

1995. Activin A-induced apoptosis is suppressed by BCL-2. FEBS Lett, 376,

247-50.

Kozopas, K. M., Yang, T., Buchan, H. L., Zhou, P. & Craig, R. W. 1993. MCL1, a

gene expressed in programmed myeloid cell differentiation, has sequence

similarity to BCL2. Proc Natl Acad Sci U S A, 90, 3516-20.

Kroon, E., Martinson, L. A., Kadoya, K., Bang, A. G., Kelly, O. G., Eliazer, S.,

Young, H., Richardson, M., Smart, N. G., Cunningham, J., Agulnick, A. D.,

D'amour, K. A., Carpenter, M. K. & Baetge, E. E. 2008. Pancreatic endoderm

derived from human embryonic stem cells generates glucose-responsive

insulin-secreting cells in vivo. Nature biotechnology, 26, 443-52.

Ku, B., Liang, C., Jung, J. U. & Oh, B. H. 2011. Evidence that inhibition of BAX

activation by BCL-2 involves its tight and preferential interaction with the BH3

domain of BAX. Cell research, 21, 627-41.

Kuhl, M., Sheldahl, L. C., Park, M., Miller, J. R. & Moon, R. T. 2000. The Wnt/Ca2+

pathway: a new vertebrate Wnt signaling pathway takes shape. Trends Genet,

16, 279-83.

Kutlu, B., Cardozo, A. K., Darville, M. I., Kruhoffer, M., Magnusson, N., Orntoft, T.

& Eizirik, D. L. 2003. Discovery of gene networks regulating cytokine-induced

dysfunction and apoptosis in insulin-producing INS-1 cells. Diabetes, 52,

2701-19.

Kuwana, T., Bouchier-Hayes, L., Chipuk, J. E., Bonzon, C., Sullivan, B. A., Green, D.

R. & Newmeyer, D. D. 2005a. BH3 domains of BH3-only proteins

differentially regulate Bax-mediated mitochondrial membrane permeabilization

both directly and indirectly. Molecular cell, 17, 525-35.

Kuwana, T., Bouchier-Hayes, L., Chipuk, J. E., Bonzon, C., Sullivan, B. A., Green, D.

R. & Newmeyer, D. D. 2005b. BH3 domains of BH3-only proteins

differentially regulate Bax-mediated mitochondrial membrane permeabilization

both directly and indirectly. Mol Cell, 17, 525-35.

Leber, B., Lin, J. & Andrews, D. W. 2007. Embedded together: the life and death

consequences of interaction of the Bcl-2 family with membranes. Apoptosis,

12, 897-911.

Lee, E. F., Grabow, S., Chappaz, S., Dewson, G., Hockings, C., Kluck, R. M.,

Debrincat, M. A., Gray, D. H., Witkowski, M. T., Evangelista, M.,

Pettikiriarachchi, A., Bouillet, P., Lane, R. M., Czabotar, P. E., Colman, P. M.,

Smith, B. J., Kile, B. T. & Fairlie, W. D. 2016. Physiological restraint of Bak

by Bcl-xL is essential for cell survival. Genes Dev, 30, 1240-50.

Leimeister, C., Bach, A. & Gessler, M. 1998. Developmental expression patterns of

mouse sFRP genes encoding members of the secreted frizzled related protein

family. Mech Dev, 75, 29-42.

Letai, A., Bassik, M. C., Walensky, L. D., Sorcinelli, M. D., Weiler, S. & Korsmeyer,

S. J. 2002. Distinct BH3 domains either sensitize or activate mitochondrial

apoptosis, serving as prototype cancer therapeutics. Cancer cell, 2, 183-92.

138

Ley, R., Balmanno, K., Hadfield, K., Weston, C. & Cook, S. J. 2003. Activation of the

ERK1/2 signaling pathway promotes phosphorylation and proteasome-

dependent degradation of the BH3-only protein, Bim. The Journal of

biological chemistry, 278, 18811-6.

Li, J., Lee, B. & Lee, A. S. 2006. Endoplasmic reticulum stress-induced apoptosis:

multiple pathways and activation of p53-up-regulated modulator of apoptosis

(PUMA) and NOXA by p53. The Journal of biological chemistry, 281, 7260-

70.

Li, Y., Rankin, S. A., Sinner, D., Kenny, A. P., Krieg, P. A. & Zorn, A. M. 2008.

Sfrp5 coordinates foregut specification and morphogenesis by antagonizing

both canonical and noncanonical Wnt11 signaling. Genes Dev, 22, 3050-63.

Lin, K., Wang, S., Julius, M. A., Kitajewski, J., Moos, M., Jr. & Luyten, F. P. 1997.

The cysteine-rich frizzled domain of Frzb-1 is required and sufficient for

modulation of Wnt signaling. Proc Natl Acad Sci U S A, 94, 11196-200.

Lipson, K. L., Fonseca, S. G., Ishigaki, S., Nguyen, L. X., Foss, E., Bortell, R.,

Rossini, A. A. & Urano, F. 2006. Regulation of insulin biosynthesis in

pancreatic beta cells by an endoplasmic reticulum-resident protein kinase

IRE1. Cell metabolism, 4, 245-54.

Llambi, F., Moldoveanu, T., Tait, S. W., Bouchier-Hayes, L., Temirov, J., Mccormick,

L. L., Dillon, C. P. & Green, D. R. 2011. A unified model of mammalian BCL-

2 protein family interactions at the mitochondria. Mol Cell, 44, 517-31.

Llambi, F., Wang, Y. M., Victor, B., Yang, M., Schneider, D. M., Gingras, S.,

Parsons, M. J., Zheng, J. H., Brown, S. A., Pelletier, S., Moldoveanu, T., Chen,

T. & Green, D. R. 2016. BOK Is a Non-canonical BCL-2 Family Effector of

Apoptosis Regulated by ER-Associated Degradation. Cell, 165, 421-33.

Loo, L. S. W., Lau, H. H., Jasmen, J. B., Lim, C. S. & Teo, A. K. K. 2018. An arduous

journey from human pluripotent stem cells to functional pancreatic beta cells.

Diabetes Obes Metab, 20, 3-13.

Lovell, J. F., Billen, L. P., Bindner, S., Shamas-Din, A., Fradin, C., Leber, B. &

Andrews, D. W. 2008. Membrane binding by tBid initiates an ordered series of

events culminating in membrane permeabilization by Bax. Cell, 135, 1074-84.

Luciani, D. S., White, S. A., Widenmaier, S. B., Saran, V. V., Taghizadeh, F., Hu, X.,

Allard, M. F. & Johnson, J. D. 2013. Bcl-2 and Bcl-xL suppress glucose

signaling in pancreatic beta-cells. Diabetes, 62, 170-82.

Luciano, F., Jacquel, A., Colosetti, P., Herrant, M., Cagnol, S., Pages, G. & Auberger,

P. 2003. Phosphorylation of Bim-EL by Erk1/2 on serine 69 promotes its

degradation via the proteasome pathway and regulates its proapoptotic

function. Oncogene, 22, 6785-93.

Ma, A., Pena, J. C., Chang, B., Margosian, E., Davidson, L., Alt, F. W. & Thompson,

C. B. 1995. Bclx regulates the survival of double-positive thymocytes. Proc

Natl Acad Sci U S A, 92, 4763-7.

Ma, Y., Brewer, J. W., Diehl, J. A. & Hendershot, L. M. 2002. Two distinct stress

signaling pathways converge upon the CHOP promoter during the mammalian

unfolded protein response. Journal of molecular biology, 318, 1351-65.

Makin, G. W., Corfe, B. M., Griffiths, G. J., Thistlethwaite, A., Hickman, J. A. &

Dive, C. 2001. Damage-induced Bax N-terminal change, translocation to

mitochondria and formation of Bax dimers/complexes occur regardless of cell

fate. The EMBO journal, 20, 6306-15.

139

Marani, M., Tenev, T., Hancock, D., Downward, J. & Lemoine, N. R. 2002.

Identification of novel isoforms of the BH3 domain protein Bim which directly

activate Bax to trigger apoptosis. Mol Cell Biol, 22, 3577-89.

Marciniak, S. J. & Ron, D. 2006. Endoplasmic reticulum stress signaling in disease.

Physiological reviews, 86, 1133-49.

Martin, M., Gallego-Llamas, J., Ribes, V., Kedinger, M., Niederreither, K., Chambon,

P., Dolle, P. & Gradwohl, G. 2005. Dorsal pancreas agenesis in retinoic acid-

deficient Raldh2 mutant mice. Developmental biology, 284, 399-411.

Mathai, J. P., Germain, M. & Shore, G. C. 2005. BH3-only BIK regulates BAX,BAK-

dependent release of Ca2+ from endoplasmic reticulum stores and

mitochondrial apoptosis during stress-induced cell death. The Journal of

biological chemistry, 280, 23829-36.

Matveyenko, A. V., Georgia, S., Bhushan, A. & Butler, P. C. 2010. Inconsistent

formation and nonfunction of insulin-positive cells from pancreatic endoderm

derived from human embryonic stem cells in athymic nude rats. American

journal of physiology. Endocrinology and metabolism, 299, E713-20.

Mccullough, K. D., Martindale, J. L., Klotz, L. O., Aw, T. Y. & Holbrook, N. J. 2001.

Gadd153 sensitizes cells to endoplasmic reticulum stress by down-regulating

Bcl2 and perturbing the cellular redox state. Molecular and cellular biology,

21, 1249-59.

Mckenzie, M. D., Jamieson, E., Jansen, E. S., Scott, C. L., Huang, D. C., Bouillet, P.,

Allison, J., Kay, T. W., Strasser, A. & Thomas, H. E. 2010. Glucose induces

pancreatic islet cell apoptosis that requires the BH3-only proteins Bim and

Puma and multi-BH domain protein Bax. Diabetes, 59, 644-52.

Mclean, A. B., D'amour, K. A., Jones, K. L., Krishnamoorthy, M., Kulik, M. J.,

Reynolds, D. M., Sheppard, A. M., Liu, H., Xu, Y., Baetge, E. E. & Dalton, S.

2007. Activin a efficiently specifies definitive endoderm from human

embryonic stem cells only when phosphatidylinositol 3-kinase signaling is

suppressed. Stem cells, 25, 29-38.

Mclin, V. A., Rankin, S. A. & Zorn, A. M. 2007. Repression of Wnt/beta-catenin

signaling in the anterior endoderm is essential for liver and pancreas

development. Development, 134, 2207-17.

Mehmeti, I., Lenzen, S. & Lortz, S. 2011. Modulation of Bcl-2-related protein

expression in pancreatic beta cells by pro-inflammatory cytokines and its

dependence on the antioxidative defense status. Molecular and cellular

endocrinology, 332, 88-96.

Meller, R., Cameron, J. A., Torrey, D. J., Clayton, C. E., Ordonez, A. N., Henshall, D.

C., Minami, M., Schindler, C. K., Saugstad, J. A. & Simon, R. P. 2006. Rapid

degradation of Bim by the ubiquitin-proteasome pathway mediates short-term

ischemic tolerance in cultured neurons. J Biol Chem, 281, 7429-36.

Meyerovich, K., Violato, N. M., Fukaya, M., Dirix, V., Pachera, N., Marselli, L.,

Marchetti, P., Strasser, A., Eizirik, D. L. & Cardozo, A. K. 2017. MCL-1 Is a

Key Antiapoptotic Protein in Human and Rodent Pancreatic beta-Cells.

Diabetes, 66, 2446-2458.

Mfopou, J. K., Chen, B., Sui, L., Sermon, K. & Bouwens, L. 2010. Recent advances

and prospects in the differentiation of pancreatic cells from human embryonic

stem cells. Diabetes, 59, 2094-101.

Miani, M., Barthson, J., Colli, M. L., Brozzi, F., Cnop, M. & Eizirik, D. L. 2013a.

Endoplasmic reticulum stress sensitizes pancreatic beta cells to interleukin-

1beta-induced apoptosis via Bim/A1 imbalance. Cell Death Dis, 4, e701.

140

Miani, M., Barthson, J., Colli, M. L., Brozzi, F., Cnop, M. & Eizirik, D. L. 2013b.

Endoplasmic reticulum stress sensitizes pancreatic beta cells to interleukin-

1beta-induced apoptosis via Bim/A1 imbalance. Cell death & disease, 4, e701.

Millman, J. R., Xie, C., Van Dervort, A., Gurtler, M., Pagliuca, F. W. & Melton, D. A.

2016. Generation of stem cell-derived beta-cells from patients with type 1

diabetes. Nature communications, 7, 11463.

Molotkov, A., Molotkova, N. & Duester, G. 2005. Retinoic acid generated by Raldh2

in mesoderm is required for mouse dorsal endodermal pancreas development.

Developmental dynamics : an official publication of the American Association

of Anatomists, 232, 950-7.

Morishima, N., Nakanishi, K., Tsuchiya, K., Shibata, T. & Seiwa, E. 2004.

Translocation of Bim to the endoplasmic reticulum (ER) mediates ER stress

signaling for activation of caspase-12 during ER stress-induced apoptosis. The

Journal of biological chemistry, 279, 50375-81.

Motoyama, N., Wang, F., Roth, K. A., Sawa, H., Nakayama, K., Nakayama, K.,

Negishi, I., Senju, S., Zhang, Q., Fujii, S. & Et Al. 1995. Massive cell death of

immature hematopoietic cells and neurons in Bcl-x-deficient mice. Science,

267, 1506-10.

Nadauld, L. D., Sandoval, I. T., Chidester, S., Yost, H. J. & Jones, D. A. 2004.

Adenomatous polyposis coli control of retinoic acid biosynthesis is critical for

zebrafish intestinal development and differentiation. J Biol Chem, 279, 51581-

9.

Nakamura, A., Swahari, V., Plestant, C., Smith, I., Mccoy, E., Smith, S., Moy, S. S.,

Anton, E. S. & Deshmukh, M. 2016. Bcl-xL Is Essential for the Survival and

Function of Differentiated Neurons in the Cortex That Control Complex

Behaviors. J Neurosci, 36, 5448-61.

Nakayama, K., Nakayama, K., Negishi, I., Kuida, K., Sawa, H. & Loh, D. Y. 1994.

Targeted disruption of Bcl-2 alpha beta in mice: occurrence of gray hair,

polycystic kidney disease, and lymphocytopenia. Proc Natl Acad Sci U S A,

91, 3700-4.

Nechushtan, A., Smith, C. L., Hsu, Y. T. & Youle, R. J. 1999. Conformation of the

Bax C-terminus regulates subcellular location and cell death. EMBO J, 18,

2330-41.

Newmeyer, D. D. & Ferguson-Miller, S. 2003. Mitochondria: releasing power for life

and unleashing the machineries of death. Cell, 112, 481-90.

Ng, F. W., Nguyen, M., Kwan, T., Branton, P. E., Nicholson, D. W., Cromlish, J. A. &

Shore, G. C. 1997. p28 Bap31, a Bcl-2/Bcl-XL- and procaspase-8-associated

protein in the endoplasmic reticulum. J Cell Biol, 139, 327-38.

Ng, K. P., Hillmer, A. M., Chuah, C. T., Juan, W. C., Ko, T. K., Teo, A. S.,

Ariyaratne, P. N., Takahashi, N., Sawada, K., Fei, Y., Soh, S., Lee, W. H.,

Huang, J. W., Allen, J. C., Jr., Woo, X. Y., Nagarajan, N., Kumar, V.,

Thalamuthu, A., Poh, W. T., Ang, A. L., Mya, H. T., How, G. F., Yang, L. Y.,

Koh, L. P., Chowbay, B., Chang, C. T., Nadarajan, V. S., Chng, W. J., Than,

H., Lim, L. C., Goh, Y. T., Zhang, S., Poh, D., Tan, P., Seet, J. E., Ang, M. K.,

Chau, N. M., Ng, Q. S., Tan, D. S., Soda, M., Isobe, K., Nothen, M. M., Wong,

T. Y., Shahab, A., Ruan, X., Cacheux-Rataboul, V., Sung, W. K., Tan, E. H.,

Yatabe, Y., Mano, H., Soo, R. A., Chin, T. M., Lim, W. T., Ruan, Y. & Ong, S.

T. 2012. A common BIM deletion polymorphism mediates intrinsic resistance

and inferior responses to tyrosine kinase inhibitors in cancer. Nature medicine,

18, 521-8.

141

Nishihara, T., Okahashi, N. & Ueda, N. 1993. Activin A induces apoptotic cell death.

Biochem Biophys Res Commun, 197, 985-91.

Noble, J. A., Valdes, A. M., Varney, M. D., Carlson, J. A., Moonsamy, P., Fear, A. L.,

Lane, J. A., Lavant, E., Rappner, R., Louey, A., Concannon, P., Mychaleckyj,

J. C., Erlich, H. A. & Type 1 Diabetes Genetics, C. 2010. HLA class I and

genetic susceptibility to type 1 diabetes: results from the Type 1 Diabetes

Genetics Consortium. Diabetes, 59, 2972-9.

Nogueira, T. C., Paula, F. M., Villate, O., Colli, M. L., Moura, R. F., Cunha, D. A.,

Marselli, L., Marchetti, P., Cnop, M., Julier, C. & Eizirik, D. L. 2013. GLIS3, a

susceptibility gene for type 1 and type 2 diabetes, modulates pancreatic beta

cell apoptosis via regulation of a splice variant of the BH3-only protein Bim.

PLoS genetics, 9, e1003532.

Nostro, M. C., Sarangi, F., Ogawa, S., Holtzinger, A., Corneo, B., Li, X., Micallef, S.

J., Park, I. H., Basford, C., Wheeler, M. B., Daley, G. Q., Elefanty, A. G.,

Stanley, E. G. & Keller, G. 2011. Stage-specific signaling through TGFbeta

family members and WNT regulates patterning and pancreatic specification of

human pluripotent stem cells. Development, 138, 861-71.

O'connor, L., Strasser, A., O'reilly, L. A., Hausmann, G., Adams, J. M., Cory, S. &

Huang, D. C. 1998. Bim: a novel member of the Bcl-2 family that promotes

apoptosis. The EMBO journal, 17, 384-95.

O'reilly, L. A., Cullen, L., Visvader, J., Lindeman, G. J., Print, C., Bath, M. L., Huang,

D. C. & Strasser, A. 2000. The proapoptotic BH3-only protein bim is

expressed in hematopoietic, epithelial, neuronal, and germ cells. The American

journal of pathology, 157, 449-61.

Oakes, S. A., Lin, S. S. & Bassik, M. C. 2006. The control of endoplasmic reticulum-

initiated apoptosis by the BCL-2 family of proteins. Current molecular

medicine, 6, 99-109.

Oakes, S. A., Scorrano, L., Opferman, J. T., Bassik, M. C., Nishino, M., Pozzan, T. &

Korsmeyer, S. J. 2005. Proapoptotic BAX and BAK regulate the type 1 inositol

trisphosphate receptor and calcium leak from the endoplasmic reticulum.

Proceedings of the National Academy of Sciences of the United States of

America, 102, 105-10.

Oltvai, Z. N., Milliman, C. L. & Korsmeyer, S. J. 1993. Bcl-2 heterodimerizes in vivo

with a conserved homolog, Bax, that accelerates programmed cell death. Cell,

74, 609-19.

Opferman, J. T., Iwasaki, H., Ong, C. C., Suh, H., Mizuno, S., Akashi, K. &

Korsmeyer, S. J. 2005. Obligate role of anti-apoptotic MCL-1 in the survival of

hematopoietic stem cells. Science, 307, 1101-4.

Opferman, J. T., Letai, A., Beard, C., Sorcinelli, M. D., Ong, C. C. & Korsmeyer, S. J.

2003. Development and maintenance of B and T lymphocytes requires

antiapoptotic MCL-1. Nature, 426, 671-6.

Osafune, K., Caron, L., Borowiak, M., Martinez, R. J., Fitz-Gerald, C. S., Sato, Y.,

Cowan, C. A., Chien, K. R. & Melton, D. A. 2008. Marked differences in

differentiation propensity among human embryonic stem cell lines. Nature

biotechnology, 26, 313-5.

Otonkoski, T., Beattie, G. M., Mally, M. I., Ricordi, C. & Hayek, A. 1993.

Nicotinamide is a potent inducer of endocrine differentiation in cultured human

fetal pancreatic cells. The Journal of clinical investigation, 92, 1459-66.

Oyadomari, S. & Mori, M. 2004. Roles of CHOP/GADD153 in endoplasmic reticulum

stress. Cell death and differentiation, 11, 381-9.

142

Oyadomari, S., Takeda, K., Takiguchi, M., Gotoh, T., Matsumoto, M., Wada, I.,

Akira, S., Araki, E. & Mori, M. 2001. Nitric oxide-induced apoptosis in

pancreatic beta cells is mediated by the endoplasmic reticulum stress pathway.

Proceedings of the National Academy of Sciences of the United States of

America, 98, 10845-50.

Pagliuca, F. W., Millman, J. R., Gurtler, M., Segel, M., Van Dervort, A., Ryu, J. H.,

Peterson, Q. P., Greiner, D. & Melton, D. A. 2014. Generation of functional

human pancreatic beta cells in vitro. Cell, 159, 428-39.

Papadopoulou, S. & Edlund, H. 2005. Attenuated Wnt signaling perturbs pancreatic

growth but not pancreatic function. Diabetes, 54, 2844-51.

Park, H. A., Licznerski, P., Mnatsakanyan, N., Niu, Y., Sacchetti, S., Wu, J., Polster,

B. M., Alavian, K. N. & Jonas, E. A. 2017. Inhibition of Bcl-xL prevents pro-

death actions of DeltaN-Bcl-xL at the mitochondrial inner membrane during

glutamate excitotoxicity. Cell Death Differ, 24, 1963-1974.

Pecot, J., Maillet, L., Le Pen, J., Vuillier, C., Trecesson, S. C., Fetiveau, A., Sarosiek,

K. A., Bock, F. J., Braun, F., Letai, A., Tait, S. W. G., Gautier, F. & Juin, P. P.

2016. Tight Sequestration of BH3 Proteins by BCL-xL at Subcellular

Membranes Contributes to Apoptotic Resistance. Cell Rep, 17, 3347-3358.

Phillips, B. W., Hentze, H., Rust, W. L., Chen, Q. P., Chipperfield, H., Tan, E. K.,

Abraham, S., Sadasivam, A., Soong, P. L., Wang, S. T., Lim, R., Sun, W.,

Colman, A. & Dunn, N. R. 2007. Directed differentiation of human embryonic

stem cells into the pancreatic endocrine lineage. Stem cells and development,

16, 561-78.

Pierson, W., Cauwe, B., Policheni, A., Schlenner, S. M., Franckaert, D., Berges, J.,

Humblet-Baron, S., Schonefeldt, S., Herold, M. J., Hildeman, D., Strasser, A.,

Bouillet, P., Lu, L. F., Matthys, P., Freitas, A. A., Luther, R. J., Weaver, C. T.,

Dooley, J., Gray, D. H. & Liston, A. 2013. Antiapoptotic Mcl-1 is critical for

the survival and niche-filling capacity of Foxp3(+) regulatory T cells. Nat

Immunol, 14, 959-65.

Piro, S., Lupi, R., Dotta, F., Patane, G., Rabuazzo, M. A., Marselli, L., Santangelo, C.,

Realacci, M., Del Guerra, S., Purrello, F. & Marchetti, P. 2001. Bovine islets

are less susceptible than human islets to damage by human cytokines.

Transplantation, 71, 21-6.

Pirot, P., Eizirik, D. L. & Cardozo, A. K. 2006. Interferon-gamma potentiates

endoplasmic reticulum stress-induced death by reducing pancreatic beta cell

defence mechanisms. Diabetologia, 49, 1229-36.

Pirot, P., Ortis, F., Cnop, M., Ma, Y., Hendershot, L. M., Eizirik, D. L. & Cardozo, A.

K. 2007. Transcriptional regulation of the endoplasmic reticulum stress gene

chop in pancreatic insulin-producing cells. Diabetes, 56, 1069-77.

Print, C. G., Loveland, K. L., Gibson, L., Meehan, T., Stylianou, A., Wreford, N., De

Kretser, D., Metcalf, D., Kontgen, F., Adams, J. M. & Cory, S. 1998.

Apoptosis regulator bcl-w is essential for spermatogenesis but appears

otherwise redundant. Proc Natl Acad Sci U S A, 95, 12424-31.

Qu, S., Yan, L., Fang, B., Ye, S., Li, P., Ge, S., Wu, J., Qu, D. & Song, H. 2017.

Generation of enhanced definitive endoderm from human embryonic stem cells

under an albumin/insulin-free and chemically defined condition. Life Sci, 175,

37-46.

Rabinovitch, A., Suarez-Pinzon, W., Strynadka, K., Ju, Q., Edelstein, D., Brownlee,

M., Korbutt, G. S. & Rajotte, R. V. 1999. Transfection of human pancreatic

143

islets with an anti-apoptotic gene (bcl-2) protects beta-cells from cytokine-

induced destruction. Diabetes, 48, 1223-9.

Rasschaert, J., Liu, D., Kutlu, B., Cardozo, A. K., Kruhoffer, M., Tf, O. R. & Eizirik,

D. L. 2003. Global profiling of double stranded RNA- and IFN-gamma-

induced genes in rat pancreatic beta cells. Diabetologia, 46, 1641-57.

Rattner, A., Hsieh, J. C., Smallwood, P. M., Gilbert, D. J., Copeland, N. G., Jenkins,

N. A. & Nathans, J. 1997. A family of secreted proteins contains homology to

the cysteine-rich ligand-binding domain of frizzled receptors. Proc Natl Acad

Sci U S A, 94, 2859-63.

Reimertz, C., Kogel, D., Rami, A., Chittenden, T. & Prehn, J. H. 2003. Gene

expression during ER stress-induced apoptosis in neurons: induction of the

BH3-only protein Bbc3/PUMA and activation of the mitochondrial apoptosis

pathway. The Journal of cell biology, 162, 587-97.

Rezania, A., Bruin, J. E., Arora, P., Rubin, A., Batushansky, I., Asadi, A., O'dwyer, S.,

Quiskamp, N., Mojibian, M., Albrecht, T., Yang, Y. H., Johnson, J. D. &

Kieffer, T. J. 2014. Reversal of diabetes with insulin-producing cells derived in

vitro from human pluripotent stem cells. Nature biotechnology, 32, 1121-33.

Rezania, A., Bruin, J. E., Riedel, M. J., Mojibian, M., Asadi, A., Xu, J., Gauvin, R.,

Narayan, K., Karanu, F., O'neil, J. J., Ao, Z., Warnock, G. L. & Kieffer, T. J.

2012. Maturation of human embryonic stem cell-derived pancreatic progenitors

into functional islets capable of treating pre-existing diabetes in mice.

Diabetes, 61, 2016-29.

Rezania, A., Bruin, J. E., Xu, J., Narayan, K., Fox, J. K., O'neil, J. J. & Kieffer, T. J.

2013. Enrichment of human embryonic stem cell-derived NKX6.1-expressing

pancreatic progenitor cells accelerates the maturation of insulin-secreting cells

in vivo. Stem Cells, 31, 2432-42.

Rezania, A., Riedel, M. J., Wideman, R. D., Karanu, F., Ao, Z., Warnock, G. L. &

Kieffer, T. J. 2011. Production of functional glucagon-secreting alpha-cells

from human embryonic stem cells. Diabetes, 60, 239-47.

Ron, D. & Walter, P. 2007. Signal integration in the endoplasmic reticulum unfolded

protein response. Nature reviews. Molecular cell biology, 8, 519-29.

Rong, Y. & Distelhorst, C. W. 2008. Bcl-2 protein family members: versatile

regulators of calcium signaling in cell survival and apoptosis. Annual review of

physiology, 70, 73-91.

Rosse, T., Olivier, R., Monney, L., Rager, M., Conus, S., Fellay, I., Jansen, B. &

Borner, C. 1998. Bcl-2 prolongs cell survival after Bax-induced release of

cytochrome c. Nature, 391, 496-9.

Rulifson, I. C., Karnik, S. K., Heiser, P. W., Ten Berge, D., Chen, H., Gu, X., Taketo,

M. M., Nusse, R., Hebrok, M. & Kim, S. K. 2007. Wnt signaling regulates

pancreatic beta cell proliferation. Proceedings of the National Academy of

Sciences of the United States of America, 104, 6247-52.

Russ, H. A., Parent, A. V., Ringler, J. J., Hennings, T. G., Nair, G. G., Shveygert, M.,

Guo, T., Puri, S., Haataja, L., Cirulli, V., Blelloch, R., Szot, G. L., Arvan, P. &

Hebrok, M. 2015. Controlled induction of human pancreatic progenitors

produces functional beta-like cells in vitro. EMBO J, 34, 1759-72.

Santin, I., Moore, F., Colli, M. L., Gurzov, E. N., Marselli, L., Marchetti, P. & Eizirik,

D. L. 2011. PTPN2, a candidate gene for type 1 diabetes, modulates pancreatic

beta-cell apoptosis via regulation of the BH3-only protein Bim. Diabetes, 60,

3279-88.

144

Santosa, M. M., Low, B. S., Pek, N. M. & Teo, A. K. 2015. Knowledge Gaps in

Rodent Pancreas Biology: Taking Human Pluripotent Stem Cell-Derived

Pancreatic Beta Cells into Our Own Hands. Front Endocrinol (Lausanne), 6,

194.

Sattler, M., Liang, H., Nettesheim, D., Meadows, R. P., Harlan, J. E., Eberstadt, M.,

Yoon, H. S., Shuker, S. B., Chang, B. S., Minn, A. J., Thompson, C. B. &

Fesik, S. W. 1997. Structure of Bcl-xL-Bak peptide complex: recognition

between regulators of apoptosis. Science, 275, 983-6.

Savitt, J. M., Jang, S. S., Mu, W., Dawson, V. L. & Dawson, T. M. 2005. Bcl-x is

required for proper development of the mouse substantia nigra. J Neurosci, 25,

6721-8.

Schmitt, E., Beauchemin, M. & Bertrand, R. 2007. Nuclear colocalization and

interaction between bcl-xL and cdk1(cdc2) during G2/M cell-cycle checkpoint.

Oncogene, 26, 5851-65.

Schneider, A., Rieck, M., Sanda, S., Pihoker, C., Greenbaum, C. & Buckner, J. H.

2008. The effector T cells of diabetic subjects are resistant to regulation via

CD4+ FOXP3+ regulatory T cells. J Immunol, 181, 7350-5.

Schulz, T. C., Young, H. Y., Agulnick, A. D., Babin, M. J., Baetge, E. E., Bang, A. G.,

Bhoumik, A., Cepa, I., Cesario, R. M., Haakmeester, C., Kadoya, K., Kelly, J.

R., Kerr, J., Martinson, L. A., Mclean, A. B., Moorman, M. A., Payne, J. K.,

Richardson, M., Ross, K. G., Sherrer, E. S., Song, X., Wilson, A. Z., Brandon,

E. P., Green, C. E., Kroon, E. J., Kelly, O. G., D'amour, K. A. & Robins, A. J.

2012. A scalable system for production of functional pancreatic progenitors

from human embryonic stem cells. PloS one, 7, e37004.

Segev, H., Fishman, B., Ziskind, A., Shulman, M. & Itskovitz-Eldor, J. 2004.

Differentiation of human embryonic stem cells into insulin-producing clusters.

Stem cells, 22, 265-74.

Sharon, N., Vanderhooft, J., Straubhaar, J., Mueller, J., Chawla, R., Zhou, Q.,

Engquist, E. N., Trapnell, C., Gifford, D. K. & Melton, D. A. 2019. Wnt

Signaling Separates the Progenitor and Endocrine Compartments during

Pancreas Development. Cell Rep, 27, 2281-2291 e5.

Shim, J. H., Kim, S. E., Woo, D. H., Kim, S. K., Oh, C. H., Mckay, R. & Kim, J. H.

2007. Directed differentiation of human embryonic stem cells towards a

pancreatic cell fate. Diabetologia, 50, 1228-38.

Shimizu, S., Eguchi, Y., Kosaka, H., Kamiike, W., Matsuda, H. & Tsujimoto, Y. 1995.

Prevention of hypoxia-induced cell death by Bcl-2 and Bcl-xL. Nature, 374,

811-3.

Slee, E. A., Harte, M. T., Kluck, R. M., Wolf, B. B., Casiano, C. A., Newmeyer, D. D.,

Wang, H. G., Reed, J. C., Nicholson, D. W., Alnemri, E. S., Green, D. R. &

Martin, S. J. 1999. Ordering the cytochrome c-initiated caspase cascade:

hierarchical activation of caspases-2, -3, -6, -7, -8, and -10 in a caspase-9-

dependent manner. The Journal of cell biology, 144, 281-92.

Southern, C., Schulster, D. & Green, I. C. 1990. Inhibition of insulin secretion by

interleukin-1 beta and tumour necrosis factor-alpha via an L-arginine-

dependent nitric oxide generating mechanism. FEBS letters, 276, 42-4.

Sui, L., Mfopou, J. K., Chen, B., Sermon, K. & Bouwens, L. 2013. Transplantation of

human embryonic stem cell-derived pancreatic endoderm reveals a site-

specific survival, growth, and differentiation. Cell transplantation, 22, 821-30.

145

Sumantran, V. N., Ealovega, M. W., Nunez, G., Clarke, M. F. & Wicha, M. S. 1995.

Overexpression of Bcl-XS sensitizes MCF-7 cells to chemotherapy-induced

apoptosis. Cancer Res, 55, 2507-10.

Sun, J., Mao, L. Q., Polonsky, K. S. & Ren, D. C. 2016. Pancreatic beta-Cell Death

due to Pdx-1 Deficiency Requires Multi-BH Domain Protein Bax but Not Bak.

The Journal of biological chemistry, 291, 13529-34.

Sun, Y. F., Yu, L. Y., Saarma, M., Timmusk, T. & Arumae, U. 2001. Neuron-specific

Bcl-2 homology 3 domain-only splice variant of Bak is anti-apoptotic in

neurons, but pro-apoptotic in non-neuronal cells. J Biol Chem, 276, 16240-7.

Tajiri, S., Yano, S., Morioka, M., Kuratsu, J., Mori, M. & Gotoh, T. 2006. CHOP is

involved in neuronal apoptosis induced by neurotrophic factor deprivation.

FEBS letters, 580, 3462-8.

Takahashi, K. & Yamanaka, S. 2006. Induction of pluripotent stem cells from mouse

embryonic and adult fibroblast cultures by defined factors. Cell, 126, 663-76.

Takahashi, K. & Yamanaka, S. 2013. Induced pluripotent stem cells in medicine and

biology. Development, 140, 2457-61.

Takeuchi, H., Nakatsuji, N. & Suemori, H. 2014. Endodermal differentiation of human

pluripotent stem cells to insulin-producing cells in 3D culture. Scientific

reports, 4, 4488.

Tan, Y., Lin, Y., Li, K., Xiao, X., Liang, J., Cai, J., Guo, L., Li, C., Zhu, W., Xing, F.,

Mai, J., Gu, J., Tan, X., Yin, W., Lu, B., Qiu, P., Su, X., Gao, M., Hu, J., He,

S., Lu, L., Gong, S., Yan, G. & Zhang, H. 2018. Selective Antagonism of Bcl-

xL Potentiates M1 Oncolysis by Enhancing Mitochondrial Apoptosis. Hum

Gene Ther, 29, 950-961.

Teo, A. K., Ali, Y., Wong, K. Y., Chipperfield, H., Sadasivam, A., Poobalan, Y., Tan,

E. K., Wang, S. T., Abraham, S., Tsuneyoshi, N., Stanton, L. W. & Dunn, N.

R. 2012. Activin and BMP4 synergistically promote formation of definitive

endoderm in human embryonic stem cells. Stem cells, 30, 631-42.

Teo, A. K., Gupta, M. K., Doria, A. & Kulkarni, R. N. 2015a. Dissecting

diabetes/metabolic disease mechanisms using pluripotent stem cells and

genome editing tools. Molecular metabolism, 4, 593-604.

Teo, A. K., Lau, H. H., Valdez, I. A., Dirice, E., Tjora, E., Raeder, H. & Kulkarni, R.

N. 2016. Early Developmental Perturbations in a Human Stem Cell Model of

MODY5/HNF1B Pancreatic Hypoplasia. Stem cell reports, 6, 357-67.

Teo, A. K., Tsuneyoshi, N., Hoon, S., Tan, E. K., Stanton, L. W., Wright, C. V. &

Dunn, N. R. 2015b. PDX1 binds and represses hepatic genes to ensure robust

pancreatic commitment in differentiating human embryonic stem cells. Stem

cell reports, 4, 578-90.

Teo, A. K., Valdez, I. A., Dirice, E. & Kulkarni, R. N. 2014. Comparable generation

of activin-induced definitive endoderm via additive Wnt or BMP signaling in

absence of serum. Stem cell reports, 3, 5-14.

Teo, A. K., Wagers, A. J. & Kulkarni, R. N. 2013. New opportunities: harnessing

induced pluripotency for discovery in diabetes and metabolism. Cell

metabolism, 18, 775-91.

Thomas, D., Yang, H., Boffa, D. J., Ding, R., Sharma, V. K., Lagman, M., Li, B.,

Hering, B., Mohanakumar, T., Lakey, J., Kapur, S., Hancock, W. W. &

Suthanthiran, M. 2002. Proapoptotic Bax is hyperexpressed in isolated human

islets compared with antiapoptotic Bcl-2. Transplantation, 74, 1489-96.

146

Thomson, J. A., Itskovitz-Eldor, J., Shapiro, S. S., Waknitz, M. A., Swiergiel, J. J.,

Marshall, V. S. & Jones, J. M. 1998. Embryonic stem cell lines derived from

human blastocysts. Science, 282, 1145-7.

Tonnesen, M. F., Grunnet, L. G., Friberg, J., Cardozo, A. K., Billestrup, N., Eizirik, D.

L., Storling, J. & Mandrup-Poulsen, T. 2009. Inhibition of nuclear factor-

kappaB or Bax prevents endoplasmic reticulum stress- but not nitric oxide-

mediated apoptosis in INS-1E cells. Endocrinology, 150, 4094-103.

Trincavelli, M. L., Marselli, L., Falleni, A., Gremigni, V., Ragge, E., Dotta, F.,

Santangelo, C., Marchetti, P., Lucacchini, A. & Martini, C. 2002. Upregulation

of mitochondrial peripheral benzodiazepine receptor expression by cytokine-

induced damage of human pancreatic islets. Journal of cellular biochemistry,

84, 636-44.

Tripathi, P., Koss, B., Opferman, J. T. & Hildeman, D. A. 2013. Mcl-1 antagonizes

Bax/Bak to promote effector CD4(+) and CD8(+) T-cell responses. Cell Death

Differ, 20, 998-1007.

Tsujimoto, Y. 1989. Overexpression of the human BCL-2 gene product results in

growth enhancement of Epstein-Barr virus-immortalized B cells. Proc Natl

Acad Sci U S A, 86, 1958-62.

Tzung, S. P., Fausto, N. & Hockenbery, D. M. 1997. Expression of Bcl-2 family

during liver regeneration and identification of Bcl-x as a delayed early

response gene. Am J Pathol, 150, 1985-95.

Uren, A., Reichsman, F., Anest, V., Taylor, W. G., Muraiso, K., Bottaro, D. P.,

Cumberledge, S. & Rubin, J. S. 2000. Secreted frizzled-related protein-1 binds

directly to Wingless and is a biphasic modulator of Wnt signaling. J Biol

Chem, 275, 4374-82.

Van De Casteele, M., Kefas, B. A., Ling, Z., Heimberg, H. & Pipeleers, D. G. 2002.

Specific expression of Bax-omega in pancreatic beta-cells is down-regulated

by cytokines before the onset of apoptosis. Endocrinology, 143, 320-6.

Van Lummel, M., Duinkerken, G., Van Veelen, P. A., De Ru, A., Cordfunke, R.,

Zaldumbide, A., Gomez-Tourino, I., Arif, S., Peakman, M., Drijfhout, J. W. &

Roep, B. O. 2014. Posttranslational modification of HLA-DQ binding islet

autoantigens in type 1 diabetes. Diabetes, 63, 237-47.

Vander Heiden, M. G., Chandel, N. S., Schumacker, P. T. & Thompson, C. B. 1999.

Bcl-xL prevents cell death following growth factor withdrawal by facilitating

mitochondrial ATP/ADP exchange. Molecular cell, 3, 159-67.

Vander Heiden, M. G., Li, X. X., Gottleib, E., Hill, R. B., Thompson, C. B. &

Colombini, M. 2001. Bcl-xL promotes the open configuration of the voltage-

dependent anion channel and metabolite passage through the outer

mitochondrial membrane. The Journal of biological chemistry, 276, 19414-9.

Vegas, A. J., Veiseh, O., Gurtler, M., Millman, J. R., Pagliuca, F. W., Bader, A. R.,

Doloff, J. C., Li, J., Chen, M., Olejnik, K., Tam, H. H., Jhunjhunwala, S.,

Langan, E., Aresta-Dasilva, S., Gandham, S., Mcgarrigle, J. J., Bochenek, M.

A., Hollister-Lock, J., Oberholzer, J., Greiner, D. L., Weir, G. C., Melton, D.

A., Langer, R. & Anderson, D. G. 2016. Long-term glycemic control using

polymer-encapsulated human stem cell-derived beta cells in immune-

competent mice. Nat Med, 22, 306-11.

Veis, D. J., Sorenson, C. M., Shutter, J. R. & Korsmeyer, S. J. 1993. Bcl-2-deficient

mice demonstrate fulminant lymphoid apoptosis, polycystic kidneys, and

hypopigmented hair. Cell, 75, 229-40.

147

Vikstrom, I., Carotta, S., Luthje, K., Peperzak, V., Jost, P. J., Glaser, S., Busslinger,

M., Bouillet, P., Strasser, A., Nutt, S. L. & Tarlinton, D. M. 2010. Mcl-1 is

essential for germinal center formation and B cell memory. Science, 330, 1095-

9.

Wandzioch, E. & Zaret, K. S. 2009. Dynamic signaling network for the specification

of embryonic pancreas and liver progenitors. Science, 324, 1707-10.

Wang, H., Luo, X., Yao, L., Lehman, D. M. & Wang, P. 2015. Improvement of Cell

Survival During Human Pluripotent Stem Cell Definitive Endoderm

Differentiation. Stem Cells Dev, 24, 2536-46.

Weber, A., Paschen, S. A., Heger, K., Wilfling, F., Frankenberg, T., Bauerschmitt, H.,

Seiffert, B. M., Kirschnek, S., Wagner, H. & Hacker, G. 2007. BimS-induced

apoptosis requires mitochondrial localization but not interaction with anti-

apoptotic Bcl-2 proteins. The Journal of cell biology, 177, 625-36.

Wei, M. C., Lindsten, T., Mootha, V. K., Weiler, S., Gross, A., Ashiya, M.,

Thompson, C. B. & Korsmeyer, S. J. 2000. tBID, a membrane-targeted death

ligand, oligomerizes BAK to release cytochrome c. Genes & development, 14,

2060-71.

Wei, M. C., Zong, W. X., Cheng, E. H., Lindsten, T., Panoutsakopoulou, V., Ross, A.

J., Roth, K. A., Macgregor, G. R., Thompson, C. B. & Korsmeyer, S. J. 2001.

Proapoptotic BAX and BAK: a requisite gateway to mitochondrial dysfunction

and death. Science, 292, 727-30.

Weiss, W. A., Taylor, S. S. & Shokat, K. M. 2007. Recognizing and exploiting

differences between RNAi and small-molecule inhibitors. Nat Chem Biol, 3,

739-44.

Welsh, N., Eizirik, D. L., Bendtzen, K. & Sandler, S. 1991. Interleukin-1 beta-induced

nitric oxide production in isolated rat pancreatic islets requires gene

transcription and may lead to inhibition of the Krebs cycle enzyme aconitase.

Endocrinology, 129, 3167-73.

Weston, C. R., Balmanno, K., Chalmers, C., Hadfield, K., Molton, S. A., Ley, R.,

Wagner, E. F. & Cook, S. J. 2003. Activation of ERK1/2 by deltaRaf-1:ER*

represses Bim expression independently of the JNK or PI3K pathways.

Oncogene, 22, 1281-93.

Willimott, S., Merriam, T. & Wagner, S. D. 2011. Apoptosis induces Bcl-XS and

cleaved Bcl-XL in chronic lymphocytic leukaemia. Biochemical and

biophysical research communications, 405, 480-5.

Willis, S. N., Chen, L., Dewson, G., Wei, A., Naik, E., Fletcher, J. I., Adams, J. M. &

Huang, D. C. 2005. Proapoptotic Bak is sequestered by Mcl-1 and Bcl-xL, but

not Bcl-2, until displaced by BH3-only proteins. Genes & development, 19,

1294-305.

Wong, L. F., Ralph, G. S., Walmsley, L. E., Bienemann, A. S., Parham, S., Kingsman,

S. M., Uney, J. B. & Mazarakis, N. D. 2005. Lentiviral-mediated delivery of

Bcl-2 or GDNF protects against excitotoxicity in the rat hippocampus. Mol

Ther, 11, 89-95.

Xu, X., Browning, V. L. & Odorico, J. S. 2011. Activin, BMP and FGF pathways

cooperate to promote endoderm and pancreatic lineage cell differentiation from

human embryonic stem cells. Mechanisms of development, 128, 412-27.

Xu, X., Kahan, B., Forgianni, A., Jing, P., Jacobson, L., Browning, V., Treff, N. &

Odorico, J. 2006. Endoderm and pancreatic islet lineage differentiation from

human embryonic stem cells. Cloning and stem cells, 8, 96-107.

148

Yamamura, K., Kamada, S., Ito, S., Nakagawa, K., Ichihashi, M. & Tsujimoto, Y.

1996. Accelerated disappearance of melanocytes in bcl-2-deficient mice.

Cancer Res, 56, 3546-50.

Yang, C. C., Lin, H. P., Chen, C. S., Yang, Y. T., Tseng, P. H., Rangnekar, V. M. &

Chen, C. S. 2003. Bcl-xL mediates a survival mechanism independent of the

phosphoinositide 3-kinase/Akt pathway in prostate cancer cells. J Biol Chem,

278, 25872-8.

Yang, E., Zha, J., Jockel, J., Boise, L. H., Thompson, C. B. & Korsmeyer, S. J. 1995.

Bad, a heterodimeric partner for Bcl-XL and Bcl-2, displaces Bax and

promotes cell death. Cell, 80, 285-91.

Ye, F., Duvillie, B. & Scharfmann, R. 2005. Fibroblast growth factors 7 and 10 are

expressed in the human embryonic pancreatic mesenchyme and promote the

proliferation of embryonic pancreatic epithelial cells. Diabetologia, 48, 277-

81.

Yi, C. H., Pan, H., Seebacher, J., Jang, I. H., Hyberts, S. G., Heffron, G. J., Vander

Heiden, M. G., Yang, R., Li, F., Locasale, J. W., Sharfi, H., Zhai, B.,

Rodriguez-Mias, R., Luithardt, H., Cantley, L. C., Daley, G. Q., Asara, J. M.,

Gygi, S. P., Wagner, G., Liu, C. F. & Yuan, J. 2011. Metabolic regulation of

protein N-alpha-acetylation by Bcl-xL promotes cell survival. Cell, 146, 607-

20.

Youle, R. J. & Strasser, A. 2008. The BCL-2 protein family: opposing activities that

mediate cell death. Nat Rev Mol Cell Biol, 9, 47-59.

Zhang, D., Jiang, W., Liu, M., Sui, X., Yin, X., Chen, S., Shi, Y. & Deng, H. 2009.

Highly efficient differentiation of human ES cells and iPS cells into mature

pancreatic insulin-producing cells. Cell research, 19, 429-38.

Zhang, K. & Kaufman, R. J. 2006. Protein folding in the endoplasmic reticulum and

the unfolded protein response. Handbook of experimental pharmacology, 69-

91.

Zhou, Y. P., Pena, J. C., Roe, M. W., Mittal, A., Levisetti, M., Baldwin, A. C., Pugh,

W., Ostrega, D., Ahmed, N., Bindokas, V. P., Philipson, L. H., Hanahan, D.,

Thompson, C. B. & Polonsky, K. S. 2000. Overexpression of Bcl-x(L) in beta-

cells prevents cell death but impairs mitochondrial signal for insulin secretion.

Am J Physiol Endocrinol Metab, 278, E340-51.

Zhou, Y. P., Teng, D., Dralyuk, F., Ostrega, D., Roe, M. W., Philipson, L. &

Polonsky, K. S. 1998. Apoptosis in insulin-secreting cells. Evidence for the

role of intracellular Ca2+ stores and arachidonic acid metabolism. The Journal

of clinical investigation, 101, 1623-32.

Ziegler, A. G., Rewers, M., Simell, O., Simell, T., Lempainen, J., Steck, A., Winkler,

C., Ilonen, J., Veijola, R., Knip, M., Bonifacio, E. & Eisenbarth, G. S. 2013.

Seroconversion to multiple islet autoantibodies and risk of progression to

diabetes in children. JAMA, 309, 2473-9.

Zorn, A. M. & Wells, J. M. 2007. Molecular basis of vertebrate endoderm

development. International review of cytology, 259, 49-111.

149

10 Author’s publications

1. Loo, S.W.L., Lau, H.H., Jasmen, J., Lim, C.S., and Teo, K.K.A. (2017). An

arduous journey from human pluripotent stem cells to functional pancreatic β-

cells. Diabetes, Obesity and Metabolism, in press

2. Loo S.W.L., Vethe. H., Paulo J,A., Jasmen J., Jackson N., Bjørlykke Y.,

Valdez I.A., Vaudel M., Barsnes H., Gygi S.P, Teo K.K.A., Ræder H., &

Kulkarni R.N. (2019). Dynamic proteome profiling of human pluripotent stem

cell-derived pancreatic progenitors. (Stem Cells).

3. Loo S.W.L., Soetedjo A.A.P., H.H Lau., Linh N.L., Vidhya G.K., S Ghosh, H.

Choi, Roca X., Hoon S., and Teo K.K.A. BCL-xL/BCL2L1 is a critical anti-

apoptotic protein that suppresses BAK to promote pancreatic specification

from human pluripotent stem cells. (In revision).

4. Lau H.H., Ng N.H.J., Loo S.W.L., Jasmen J, Teo K.K.A. (2017). The

molecular functions of hepatocyte nuclear factors in and beyond the liver. J

Hepatol, S0168-8278(17)32451-0

5. Lau, H.H, Nur S.A, Loo, S.W.L., Vidhya G.K., Hoon S. and Teo, K.K.A

(2018). ERK1/2 signaling is indispensable for definitive endoderm formation

(In revision)

150

11 Posters, awards, invited talk

Posters

1. Islet Biology: From cell birth to death, Keystone conference, Colorado

2. 79th Scientific sessions American Diabetes Association, San Francisco

Awards

1. Most Original Idea prize - A*STAR-P&G 1st Singapore Biotechnology Young

Entrepreneur Scheme (YES) Competition 2016

2. 1st Prize - NTU-Quintiles Challenge 2016 – Predicting Patients’ quality risk

3. Selected as one of the 100 leaders of tomorrow (LoT) from around the world to

participate in the Global Biotech Revolution GapSummit 2017 held in

Washington D.C.

4. International Society for Stem Cell Research Travel award 2017

5. Finalist at 2018 Falling Walls Labs Singapore

151

12. Appendix – Western blot films

Figure 39. Full western blot films corresponding to Figure 10A. Full western blot films of

BIM, PUMA and BAX.

152


BAK, BCL-xL and MCL-1.

153


Cleaved CASP3, FL CASP3 and β-ACTIN.

154

Figure 42. Full western blot films corresponding to Figure 12A and 12B. Full western blot

films of BIM, PUMA, BAX, BAK, BCL-xL and BCL-2.

155

Figure 43. Full western blot films corresponding to Figure 12A and 12B. Full western blot

films of MCL-1, Cleaved CASP3, FL CASP3 and β-ACTIN.

Figure 44. Full western blot films corresponding to Figure 30. Full western blot films of BIM

and β-ACTIN.

156


BIMγ and β-ACTIN.

Figure 46. Full western blot films corresponding to Figure 32A & 32B. Full western blot films

of BIML, BIMEL, BIMγ and β-ACTIN.

157


BIMγ and β-ACTIN.


BIMγ and β-ACTIN.

158

Figure 49. Full western blot films corresponding to Figure 35A, 35B and 35C Full western

blot films of BAX, PUMA, BCL-2, BCL-xL and β-ACTIN

Figure 50. Full western blot films corresponding to Figure 36A, 36B and 36C Full western

blot films of BAK, BAX, BCL-xL, PUMA, BCL-2 and β-ACTIN

159


Cleaved CASP3 and FL CASP3


Cleaved CASP3 and FL CASP3

dynamics of bcl-2 family of proteins in early ... phd...dynamics of bcl-2 family of proteins in...

Documents