PROTEIN EXPRESSION AND CHARACTERIZATION OF THE MAJOR

AUTOANTIGEN (TITIN DOMAIN) ASSOCIATED WITH AUTOIMMUNE

RIPPLING MUSCLE DISEASE

A dissertation submitted

to Kent State University in partial

fulfillment of the requirements for the

degree Doctor of Philosophy

by

Lisa M. Zelinka

May, 2015

Dissertation written by

Lisa M. Zelinka

B.S., Youngstown State University, 1995

M.S., Youngstown State University, 2002

Ph.D., Kent State University, 2015

Approved by

Dr. Gary R. Walker, Chair, Doctoral Dissertation Committee

Dr. Fayez Safadi, Doctoral Dissertation Committee

Dr. Eric M. Mintz, Doctoral Dissertation Committee

Dr. Wen- Hai Chou, Doctoral Dissertation Committee

Dr. Robert Clements, Graduate Faculty Representative

Accepted by

Dr. Eric M. Mintz, Director, School of Biomedical Sciences

Dr. James L. Blank, Dean, College of Arts and Science

iii

TABLE OF CONTENTS

TABLE OF CONTENTS ................................................................................................ iii

LIST OF FIGURES ........................................................................................................ vi

LIST OF DIAGRAMS ................................................................................................... vii

LIST OF TABLES ........................................................................................................ viii

ACKNOWLEDGEMENTS ............................................................................................ ix

I. INTRODUCTION ................................................................................................1

Anatomy and Physiology of Skeletal Muscle .......................................................1

Regulation of Muscle Contraction ........................................................................5

Rippling Muscle Disease (Genetic) ....................................................................10

Autoimmune Rippling Muscle Disease (Acquired) ............................................19

Skeletal Muscle Connectin/Titin.........................................................................27

Gene Cloning and Regulation .............................................................................37

Aims and Scope of Dissertation Research ..........................................................40

II. MATERIALS AND METHODS ........................................................................42

Strains .................................................................................................................42

RMMG#6 pBluescript II KS/SK(+)........................................................43

Cloning and Transformation ...............................................................................44

RMMG#6 DNA Insert Cloning ..............................................................44

pGEX and RMMG#6 Ligation ...............................................................46

iv

Transformation ........................................................................................48

Plasmid Preparation ................................................................................ 50

DNA Sequencing .................................................................................... 50

Protein Expression .................................................................................. 51

Glutathione-S-transferase affinity chromatography purification ............ 52

SDS PAGE .............................................................................................. 53

Western Blot ........................................................................................... 53

Olmsted Affinity Purification of Antibodies .......................................... 54

Immunofluorescent Microscopy ............................................................. 55

Titin Gels ................................................................................................ 56

Two Dimensional Gel Electrophoresis (2DGE) ..................................... 57

Protein Excision and Analysis ............................................................................61

In Gel Digestion ......................................................................................61

MASS Spectrophotometer ......................................................................62

III. RESULTS ...........................................................................................................65

Specimen Integrity ..............................................................................................65

Cloning and Transformation ...............................................................................66

Ligation ...............................................................................................................67

Confirmation of Ligation ....................................................................................67

Plasmid Construction ..........................................................................................75

Protein Expression and Purification....................................................................78

Polyacrylamide Gel Electrophoresis ...................................................................81

v

Confirmation of Antibody Reactivity .................................................................83

Cellular Localization ...........................................................................................85

Blast X Search.....................................................................................................87

MS/MS Protein Sequence Analysis ....................................................................99

IV. DISCUSSION .....................................................................................................90

REFERENCES .............................................................................................................110

APPENDICES ..............................................................................................................126

A. List of Abbreviations ..................................................................................127

B. List of Solutions and Reagents ...................................................................128

C. Muscle Protein Reference Table .................................................................132

D. Miscellaneous Solutions .............................................................................134

E. Vertical Agarose Gel Electrophoresis .........................................................137

F. Vertical Agarose Titin Gel Electrophoresis Gel Casting ............................138

vi

LIST OF FIGURES

Figure Page

1. PCR DNA Gel of pBluescript RMMG#677 .......................................................69

2. DNA Gel of pCR®4-TOPO RMMG#678 ..........................................................70

3. DNA Gel of pGEX and pCR®-TOPO RMMG#679 ..........................................71

4. DNA Gel of pGEX3RMMG#6 ...........................................................................72

5. DNA Sequence of ARMD Immune-Reactive Titin N2-A ..................................73

6. PCR and Restriction Endonuclease Analysis of pGEX Titin N2-A ...................74

7. Virtual Amino Acid Sequence Analysis .............................................................76

8. pG3RMMG6 Map ...............................................................................................77

9. SDS-PAGE of Expression and Purification ........................................................80

10. Vertical Agarose Gel Electrophoresis of Glutathione Affinity Purified

GST-titin N2-A Domain Fusion Protein .............................................................82

11. Western Blot .......................................................................................................84

12. Olmsted Affinity Purified Autoantibody from ARMD Antisera ........................86

13. Sequence Alignment of EU428487 ....................................................................87

14. Nano LC/MS/MS Analysis of gst-RMMG6 Fusion Protein...............................89

vii

LIST OF DIAGRAMS

Diagram Page

1. Sarcomere ..........................................................................................................2

2. Molecular Structures of the Sarcomere..............................................................9

3. Immunogenic Domains of Titin .......................................................................21

4. Domain structure of Titin Isoforms in Human ................................................29

5. Ion Channels of Skeletal Muscle Triad ............................................................36

6. Diagram of the Position of ARMD Autoantibody Binding on

Skeletal Muscle Titin .....................................................................................108

viii

LIST OF TABLES

Table Page

1. Events of Normal Skeletal Muscle Contraction..................................................10

2. Proteins Subject to Autoantibody Attack ............................................................20

ix

ACKNOWLEDGMENTS

I would have never been able to fulfill the requirements of my dissertation

without the constant guidance of my advisor, committee members, family, and friends.

My deepest gratitude goes to my advisor, Dr. Gary Walker. Dr. Walker generously

shared his expertise, patience, concern, care, and his passion for science and life. Dr.

Walker also provided me with an excellent research atmosphere where he was not only

my advisor but my colleague. His excellent guidance extended even to the point of

understanding that I needed to learn on my own, but he also had experience enough to

know to throw me a lifeline when I was in over my head. (This is something you

cannot comprehend until you have students of your own). Perhaps the most valuable

lesson that Dr. Walker taught me is that even negative data yields positive results in

terms of contributing to knowledge and understanding. I would also like to thank Dr.

Asch and Dr. Dorman for suggesting new ideas to resolve my experimental issues. Dr.

Asch always found time to answer my endless questions. I would like to thank Dr.

Cagiut, Dr. Cooper, Dr. Lorimer, and Dr. Fagan for their constant kindness,

consideration, compassion, support, and knowledge and also for the use of their

laboratories and reagents.

I would never have been able to make it through these days without my YSU

family. I want to thank Sumedha Sethi, who was an excellent friend (and cook!). She

was always eager to listen and willing to help with her best suggestions, not only in

terms of research, but also in the realm of encouragement and emotional support. I

would also like to thank Tom Watkins, an excellent friend, who answered my

x

innumerable questions and provided me with research suggestions as well as

encouragement and emotional support. I want to express special gratitude to my

student, Robert Giles, whose contagious enthusiasm inspired me during days where

enthusiasm was in short supply. He was my right hand, and without his continual thirst

for scientific knowledge and his eager preparation of my experiments, I never would

have stayed the course. It would have been a lonely lab without these people. Many

thanks to Julie, Heather, Stephanie, Angela, Dan, and Christine.

I would like to thank all the people at Sharon Regional Health System for all of

their encouragement, support and schedule changes.

I also learned throughout my journey that the secretary of the department knows

where everything is located and how to do things so I would like to thank Pat and Judy

for being so awesome at their jobs and keeping in check with my timeline.

Finally, I would like to thank my fiancé, Scott Suchora. He was on call for

cheering me up and he unfalteringly stood by me through the good, the bad, and the

ugly. He was my emotional support, my sounding-board, and my personal complaint

committee. I also want to thank my children, Alexandria Ann and Victoria Elizabeth,

for inspiring me not only to love and to laugh, but for reminding me that the influence

of a vital person vitalizes, and that girls need good female role models, especially in the

fields of math and science.

A simple thank you just does not seem adequate compensation for all of you!

1

CHAPTER I

INTRODUCTION

Anatomy and Physiology of Skeletal Muscle

The ultra structure of a skeletal muscle sarcomere is composed of distinct

contractile components to stabilize and control the sarcomeric structure and function

during contraction and relaxation. One muscle fiber is composed of thousands of long,

cylindrical cells. The sarcoplasm has light and dark bands or cross-striations.

Skeletal muscle has a striated appearance due to discontinuous position of the

A-band and then the I-band. The A-band is darker and denser then the I-band which is

lighter. The darker regions are called anisotropic or more commonly, A-band and the

light bands are named isotropic or more commonly, I-band. Contractile elements in the

skeletal muscle are named myofibrils. Diagram 1 is a one dimension schematic

representation of a muscle cell showing the cellular components.

2

Diagram 1: This is a schematic representation of the sarcomere.

This picture shows where the sarcomere cellular components are located

within the sarcomere. The titin molecule is red and located in the in the

Z-line of the I-band to the myosin of the A-band. Source: Kravitz L.

Web page. [Internet]. Albuquerque (NM): University of New Mexico;

[date unknown]. One screen from listing of media pages. Available

from: http://www.unm.edu/~lkravitz/MEDIA2/Sarcomere.jpg.

Myofibrils consist of three different myofilaments referred to as thick, thin, and

elastic filaments. A sarcomere is a uniquely specialized arrangement of myofilaments

in the myofibril. The I-band consists of actin thin filaments and the A-band consists of

myosin thick filaments. The I-band is directly attached to the Z-disk or Z-line. The Z-

disks are plate shaped areas containing the greatest density of sarcomeric proteins to

separate each sarcomere. It functions as a scaffold to support the contractile apparatus

3

formed by actin and myosin as well as their associated proteins (Sanger et al., 2008).

The A-bands in the sarcomere stretch the entire length of the thick filament and are

vicariously linked to the Z-disk by connectin or titin. Elastic filaments consist of the

large protein referred to as connectin or titin. Connectin or titin functions to stabilize

the thick filaments to the Z-disks. Not only does titin/ connectin have elastic properties

it also has regulatory properties (Barinaga 1995) as well. Titin will be discussed later

in detail due to its essential role in the sarcomere. Z-disks are located in the middle of

the I-bands and the H-zones are located in the middle of the A-bands. The H-zones

only contain thick filaments and are separated by the M-line. The function of the H-

zone is to attach the myosin thick filaments to the middle of the M-line.

Myosin is a contractile protein. The tail of the myosin points towards the M-

line which is located in the center of the sarcomere. Thick filaments contain the

myosin head or another name for them is cross bridges. The thin filaments contain

actin. Actin is a contractile protein. Actin’s purpose is to serve as the myosin binding

site. Each actin molecule on the thin filament holds a myosin binding site to adhere to

the myosin head of the thick filament.

Thin filaments are comprised of troponin and tropomyosin. These constituents

are regulatory proteins. The key role of tropomyosin is to sequester the myosin binding

sites on the actin molecule to facilitate relaxation of the muscle fiber. The muscle is

activated to contract by release of free calcium. Free calcium is released from the free

calcium release channels in the sarcoplasmic reticulum. Then the free calcium couples

to the troponin on the thin filament. This results in a conformational alteration of

4

tropomyosin to reveal the myosin-binding site on the actin molecules. Actin, located

on the thin filaments, couples to the myosin head located on the thick filaments

allowing the thick filament to slide over the thin filament by the activation of the

ATPase cycle leading to a decrease in sarcomere length. When the contraction is

finished, the membrane potential returns to a resting potential, which triggers the

calcium release channels in the sarcoplasmic reticulum to seal. Free calcium is pumped

from the sarcoplasm back to the sarcoplasmic reticulum by active transport from an

ATP powered calcium pump. This allows the troponin-tropomyosin complex to return

to normal and conceal the myosin binding sites on the actin. Now the muscle is in a

relaxed state.

In addition to thin and thick filaments, there are three more very large,

filamentous proteins that have essential support roles in muscle contraction. These

giant filamentous muscle proteins are titin, nebulin, and obscurin. Obscurin is a

multidomain, linear protein consisting of adhesion modules and signaling domains. It

is not included in the sarcomere proper; however, it exists on the peripheries. Nebulin

binds actin in striated muscle. Nebulin produces muscle contraction by associating

with the alpha-actin that makes the I-band, and nebulin. It extends along with actin,

with its N-terminus aligned with the ends of the titin filaments, and its C-terminus is

anchored to the Z-disk. Of course, titin is the most abundant of these three, and the

third most common protein in the muscle, behind only myosin and actin. Titin is the

largest sarcomeric protein; it spans half the muscle length. The N-terminus is attached

to the Z-disk and the C- terminus in the M-band. Due to this arrangement titin is

5

considered as the sarcomere’s third filamentous system, along with myosin and actin

(Kontrogianni- Konstantopoulos et al. 2009).

Regulation of Muscle Contraction

Muscle contraction occurs in conjunction with motor neurons. In 1954 Hanson

and Huxley proposed the sliding filament model describing contractile filaments and

properties of the sarcomere and motor neurons during contraction. An elaborate

sequence of events must occur for a normal skeletal muscle fiber to contract. The very

first event that must occur is a nerve impulse received at the axon terminal end of the

motor neuron. It is in fact the nerve impulse that activates the release of acetylcholine

into the synaptic cleft. When the acetylcholine (ACh) is released from the motor

neuron it complexes to the alpha subunits of the acetylcholine receptor (AChR) on the

motor end plate of the muscle sarcolemma located at the neuromuscular junction. The

coupling of acetylcholine (ACh) to the acetylcholine receptor (AChR) causes a

conformational alteration, responsible for releasing the free sodium ions to flow in the

sarcomere. The sodium release creates an action potential across the sarcolemma

surface and into the middle of the sarcomere via the T-tubule invagination.

It is actually the sarcolemma depolarization that distributes over the entire

sarcolemma into the T-tubule that stimulates the opening of the L-type voltage-gated

calcium channel located in the T-tubule to release free calcium ions (Bers et al. 1998;

Tanabe et al. 1990). This voltage dependent calcium channel positioned in the T-tubule

6

membrane of the sarcolemma is referred to as the dihydropyridine receptor (DHPR)

(Tortora et al. 1993).

The dihydropyridine receptor (DHPR) consists of multimeric proteins weighing

170, 150, 52, and 32 KDa with a grand total of 404 Kda (Mygland et al. 1994). DHPR

activates the calcium channel in the sarcoplasmic reticulum called the ryanodine

receptor to open and release free calcium into the sarcomere (Tanabe et al. 1990;

Mygland et al. 1992; Bers et al. 1998; Mouton et al. 2001; Lamb et al. 2000) at the I-

band. The ryanodine receptor (RyR) is a large muscle protein calcium release channel

located in the sarcoplasmic reticulum. RyR is a transmembrane ion channel protein

weighing 305 KDa residing in close contact to the T-tubular sarcolemma invaginations.

The exact mechanism for linking the excitation-contraction (E-C) coupling

between DHPR and RyR is not completely understood it is speculated that it is

electromechanical (Marx et al. 1998). DHPR/RyR channels are so closely associated to

each other in vivo that they have been coimmunoprecipitated in experiments (Marty et

al. 1994). Calcium passage is coordinated by DHPR and RyR in an orthograde

direction which DHPR activates the opening of the RyR and in a retrograde direction

which the RyR quells the closing of the DHPR (Nakai et al. 1996). It has been

demonstrated that the II-III loop domains of the DHPR are implicated in the association

between the RyR and the DHPR (Grabner et al. 1998).

The contraction is triggered by the influx of free calcium ions released from the

RyR, into the sarcoplasm. The calcium ions couple to the troponin C (TnC) molecule.

This results in a conformational alteration in the tropomyosin. This confirmational

7

change exposes myosin-binding sites attached to the actin thin filaments positioned in

the I-band. Next the myosin binds to ATP and hydrolyzes the ATP into ADP+ Pi

allowing the myosin to become “cocked.” When the myosin releases Pi it synthesizes a

“power stroke” that will eject the ADP molecule. The power stroke allows the myosin

molecules to pull the Z-disks to the M-line. Then the calcium is driven out of the

sarcomere back into the sarcoplasmic reticulum via the calcium ATPase pump. Myosin

complexes ATP and the actin filaments are released (Tortora and Grabowski 1995).

The skeletal muscle triad is an essential contributor to excitation-contraction.

The skeletal muscle triad (SMT) is composed of three membranous areas; two cisternae

of the sarcoplasmic reticulum and the indentation of the sarcolemma named the

transverse tubule or T-tubule. The skeletal muscle triad (SMT) is located over the Z-

disk right in the middle of the I-band. An important function of the skeletal muscle

triad (SMT) is the opening of the acetylcholine receptor’s sodium channel to begin the

propagation of E-C by stimulating DHPR to open the RyR to release the calcium at the

I-band. It has been demonstrated that a protein called triadin affects E-C coupling

between DHPR and RyR (Brandt et al., 1992). According to Brandt, triadin is a 95 kDa

protein of the sarcoplasmic reticulum and an essential component of the triad junction

involved in the functional coupling between DHPR and RyR or the juctional foot

protein of the SR (Brandt et al. 1990; Kim et al. 1990). This study confirmed that

depolarization-induced calcium release from the SR is regulated by the anchored T-

tubule membrane (Ikemoto et al. 1984) as previously postulated.

8

Another skeletal muscle protein, dystrophin, is thought to have a role in

associating DHPR and RyR with the cytoskeleton (Brown 1993) due to its cellular

localization adjacent to SMT (Watkins 1998; Hoffman 1987) it is near DHPR and RyR

(Hoffman 1987). It is suggested that the depolarization of the DHPR T-tubular

membrane activates the release of calcium ions from the RyR into the sarcoplasm

resulting in the rippling phenomena (Mygland et al. 1994). Diagram 2 is a picture of

the sarcomere molecular structure including the cellular location of the skeletal muscle

triad. Table 1 is a summary of the sequence of events required to synthesize a normal

skeletal muscle contraction.

9

Diagram 2: Picture of the molecular structures of the skeletal muscle sarcomere.

The orientation of the actin thin filaments and the myosin thick filaments

is overlaid on top of the Z-disk and the M-line. The triad is also shown in

a box illustrating its position over the I-band. A second box illustrates the

molecular structures of the regulatory proteins tropomyosin and troponin.

The titin molecule is also illustrated showing that it spans half of the

sarcomere and anchors the thick filaments to the Z-disk. Reprinted from:

Barinaga M. Titanic protein gives muscles structure and bounce. Science.

1995; 270(5234): 23.

10

Table 1: Sequence of events coordinating normal skeletal muscle contraction

Events of Skeletal Muscle Contraction

1. Acetylcholine (ACh) release from motor neuron

2. ACh binds -subunits of acetylcholine receptor (AChR)

3. The AChR opens to Na+

flow

4. Depolarization spreads over the muscle cell into T-tubule

5. Depolarization opens the L-type voltage gated Ca 2+

channel

dihydropyridine receptor (DHPR)

6. DHPR channel opening electromechanically opens the ryanodine

receptor (RyR) Ca 2+

channel of the SR

7. Ca 2+

entry into the sarcomere binds TnC leading to a

conformational change in tropomyosin, exposing the myosin

binding sites on the actin thin filaments

8. Myosin binds ATP

9. Myosin hydrolyzes ATP to ADP+ Pi and becomes “cocked”

10. Myosin releases Pi and generates a power stroke, later ejecting

ADP

11. Ca 2+

is pumped back out of the sarcomere into the SR by the Ca 2+

ATPase

12. Myosin binds ATP and releases the actin filaments

Rippling Muscle Disease (Genetic)

This rippling phenomenon was first described by Torbergsen in 1975 as a

genetic skeletal muscle disorder. Rippling muscle disease (RMD) is a rare, usually

11

benign, myotonia-like myopathy presenting with rapid rolling contractions and

percussion-induced contractions. This abnormal myotonia-like myopathy is electrically

silent during electromyographic analysis. Electrical silence during the

electromyography testing confirms that action potentials are not required for the rolling,

wave-like contractions to occur (Jusic 1989; Torbergsen 2002: Ricker et al. 1989).

Electrically silent muscle rippling seems to be exclusive to RMD (Yuen et al. 2001).

Due to this evidence, the muscular abnormality occurs in the contractile apparatus and

the contractions are not activated by depolarization of the sarcolemma (Torbergsen,

2002). As a matter of fact, a concentric needle electrode analysis demonstrated

ordinary motor unit potentials with a normal interference blueprint without myotonic

discharges (Torbergsen 2002; Yuen et al. 2001). Myotonia is a characteristic type of

spontaneous muscle electrical activity.

Since electrophysiological evidence supports that these contractions occur with

no motor unit action potentials (MUAPs) or electrically silent (Jusic 1989; Ricker et al.

1989; So et al. 2001) where does the muscle contraction originate? Many theories exist

about where these muscle contractions originate. One theory was proposed by Bretag

in 1988. His research suggested that the continuation of the electrically silent

contractions may possibly occur due to a conceivable role for stretch activated calcium

channels (Bretag 1988; Graham 2005). Stretch activated channels (SACs) or

mechanosensitive calcium channels (MSCs) play a role by the rippling muscle fibers

displaying calcium dependent, membrane depolarization-independent muscle

contractions (Bretag et al. 1988; Burns et al. 1994; Graham 2005).

12

The signs and symptoms of rippling muscle disease (RMD) encompass muscle

stiffness, muscle hypertrophy (Roberts et al. 2006), muscular hyperexcitability

(Torbergsen 2002) and after rest slowness in muscle movement. RMD patients often

report symptoms get worse with inactivity. Many RMD patients have to walk on their

toes upon awakening in the morning for about five minutes (Yuen et al. 2001). The

symptoms seemed to improve after exercise or simple stretching (Yeun et al. 2001).

The clinical hallmark symptom of RMD is the exclusive irritability of the

muscle to mechanical stimulation involuntarily producing rapid rolling muscle

contractions that revolve diagonally from one end of the muscle to the other end of the

muscle when provoked by mechanical stimuli like tapping and stretching of the muscle

(Torbergsen 2002; Ricker et al. 1989; Yuen et al. 2001). These self-propagating waves

are stimulated by mechanical stretch (Ricker et al. 1989). The contractions can be

induced voluntarily by a forceful muscle contraction pursued by sudden stretch (Ricker

et al. 1989; Burns et al. 1994). The spread of the contraction seems to be ten times

slower verses a normal muscle fiber action potential. The contractions extend not only

along the entire length of the muscle, but also progress to laterally adjacent muscle

fibers. Ricker found that the local contraction of a small number of sarcomeres could

stimulate the contraction of surrounding sarcomeres (Ricker et al. 1989).

Other symptoms often reported in RMD patients are myoedema and muscle

cramps, usually occurring in the proximal muscles of the lower extremities like the

quadriceps or the pectoralis and during forced physical activity muscle stiffness and

myalgia (Torbergsen 1975; Ricker et al. 1989; Torbergsen 2002). Myoedema is

13

percussion induced local mounding of muscles with duration of several seconds. The

myoedema experienced by RMD patients is painful (Torbergsen 2002; Lamb 2005). If

a RMD patient voluntarily contracts the muscle after a local mounding of muscle a

serration stays at the origin of the percussion site (Ricker et al. 1989). A percussion

induced rapid muscle contraction (PIRC) initiated by tapping the muscle with a reflex

hammer can also stimulate transitory local mounding or myoedema (Vorgerd et al.

1999; Torbergsen 2002) or sometimes it is referred to as percussion contracture (Yuen

et al. 2001). Percussion contracture is a percussion-initiated contraction that is

electrically silent. Also RMD patients have relatively normal laboratory findings

except for the creatine kinase (CK) levels. The CK levels in these patient’s sera is

moderately elevated.

RMD is an inherited heterogeneous autosomal dominant skeletal muscle

disorder associated with several genetic loci (Lamb 2005; Stephan et al. 1999; Stephan

et al. 1994; Yeun et al. 2001). A family in Oregon with RMD displayed genomic

mapping to a localized defect on the distal end of the long arm on chromosome one

location 1q41-1q42 (Stephan et al. 1999) as well as a second locus on chromosome 3

location 3p25 (Betz et al. 2001; Vorgerd et al. 2001). On the other hand, this 1q41-

1q42 locus was nonexistent in three Northern European families with RMD (So et al.

2001). A unique interest with location 3p25 is that this location is the identical location

for the caveolin-3 gene (Minetti et al., 1998). Caveolin-3 (CAV3) may participate in

muscle hyperexcitability in families with RMD from Germany and Scandinavia

(Vorgerd et al. 2001).

14

Caveolin-3 (CAV3) is an integral membrane protein that interacts with the

dystrophin-glycoprotein and is localized at the sarcolemma as well as the T-tubular

system in skeletal muscle (Nishino et al. 2002). It is responsible for the formation of

caveolae (Minetti et al. 2002; Galbiati et al. 2001; Woodman et al. 2004). Caveolae are

small invaginations of the sarcolemma. CAV3 has an essential function in the

formation of the T-tubule system (Parton et al. 1997). It was demonstrated that a

missense mutation and a micro-deletion obstruct caveolae localization to the

sarcolemma (Minetti et al. 1998).

A CAV3 mutation has been associated with autosomal limb girdle muscular

dystrophy (LGMD1C) (Minetti et al. 1998; Galbiati et al. 1999; Carbone et al. 2000)

and rippling muscle (Vorgerd et al. 2001; Ulrich et al. 2010). This caveolin-3 missense

mutation becomes trapped in the Golgi complex decreasing expression in the

sarcolemma (Betz et al., 2001). Normal caveolin-3 is targeted to the sarcolemma

(Galbiati et al. 1999; Carbone et al. 2000; Minetti et al. 1998). There are nine point

mutations and one deletion mutation existing in CAV3 gene leading to four different

phenotypes resulting in LGMD1C, RMD, distal myopathy and idiopathic

hyperCKaemia. All four of these caveolinopathies are autosomal dominant muscle

diseases. Muscle biopsies on these patients showed decreased CAV3 at the

sarcolemma as well as an absence of CAV3 in immunoblotting tests (Roberts et al.,

2006). It has been recently reported that CAV3 mutations are in fact the actual cause of

autosomal dominant RMD (Betz et al. 2001). These patients exhibit subsarcolemmal

15

vacuoles (Kubisch et al., 2003) resulting in structural abnormalities of the T-tubular

system that could possibly lead to the rapid rolling wave-like contractions.

In 2006 Dotti discovered another mutation in the CAV-3 gene that causes RMD.

This study found a decreased concentration of CAV-3 protein in the muscles of an

Italian family. Since CAV-3 is located in skeletal sarcolemma and functions as cellular

scaffolding and signaling. Genetic analysis identified an undocumented genetic

mutation within the scaffolding domain of the CAV-3 gene in the affected family

members. It was discovered that this particular area has an essential role in homo-

oligomerization and several signaling molecule connections (Dotti et al. 2006).

Another genetic mutation in the nucleotide position 140 in the CAV-3 gene was

discovered (Lorenzoni et al. 2007). This is a missense mutation within the same

scaffolding domain, 14 nucleotides from the missense mutation discovered by Dotti et

al., 2006. The missense mutation identified by Lorenzoni is a highly conserved

negatively charged glutamine residue exchanged by a neutral alanine residue. Since

other mutations are contained inside this area in patients with RMD, it is suggested that

this missense mutation also severely compromises normal structure formation resulting

in improper function of the protein. The missense alanine mutation was found in

several patients with RMD resulting in the significance of impaired function and RMD

in this CAV-3 protein (Lorenzoni 2007).

It has been demonstrated that CAV3 impedes nitric oxide synthase in skeletal

muscle (Stamler et al. 2001). Nitric oxide is controlled by cGMP. Nitric oxide affects

glucose metabolism, signal transduction, ion-channel dynamics and excitation-

16

contraction coupling (Stamler et al. 2001). Nitric oxide (NO) is a free radical with a

rapid half-life; it is a nonadrenergic-noncholinergic neurotransmitter. Nitric oxide

synthase (NOS) is a calcium dependent enzyme that produces NO from L-arginine.

Skeletal muscle synthesizes NO via neuronal type nitric oxide synthase (nNOS) located

in the sarcolemma. The N-terminal domain of nNOS consists of a GLGF motif that

associates with dystrophin. Dystrophin is responsible for the signaling enzyme in the

muscle plasma membrane. A dysfunction in the signaling enzyme is thought to result

in Duchenne muscular dystrophy (Brenman et al. 1995). A missense mutation called

A45T or de novo missense mutation Arg26Glu on chromosome 3p25 (Vorgerd et al.,

2001; Roberts et al., 2006) in the CAV3 gene was found in an autosomal dominant

RMD family (Betz et al. 2001; Roberts et al. 2006). The de novo CAV-3 patients have

a decreased expression of alpha-dystroglycan and a reduced CAV-3 sarcolemma

distribution in the muscle fibers (Roberts et al. 2006). The de novo CAV-3 or A45T

allows a 30-40 % elevation in nitric oxide formation and results in a mislocaliztion of

caveolin-3 (Betz et al. 2001) that could possibly affect the inducibility of nitric oxide

synthase by elevating it (Betz et al. 2001; Vorgerd et al. 2001). It has been

demonstrated that an increase in the calcium concentration in the cell can cause an

increase in nitric oxide synthase (Stamler et al. 2001).

A major constituent of the dystroglycan complex in skeletal muscle is caveolin-

3. Recent experiments demonstrated a number of proteins associated with the

dystroglycan complex resulting in muscle cell damage. The dystroglycan complex is

composed of the following: alpha and beta dystroglycans, cytosolic syntrophins,

17

transmembrane sarcoglycans, dystrophin, CAV3 and nitric oxide synthase (Cohn et al.

2000; Vorgerd et al. 1999). Dystrophin is a cytoskeletal membrane protein that

interacts with extracellular and transmembrane glycoproteins, dystroglycan, laminin,

and actin. These proteins are dystrophin-associated proteins. Dystrophin has an

important function in the dystroglycan complex; it is responsible for linking up with the

F-actin and the transverse tubular membrane (Knudson et al. 1988). Quite possibly

dystrophin may have a purpose for stabilizing the location of the transverse tubules to

the A-I junction of the muscle cell by cytoskeletal and myofibril linkage (Knudson et

al. 1988). A dystrophin deficiency leads to a loss of function in all the dystrophin

associated proteins leading to necrosis in Duchenne muscular dystrophy (Ohlendieck et

al. 1993).

Another dystrophin-associated muscle difficulty is related to caveolin 3. This

muscle specific gene in conjunction with beta-dystroglycan can control the dystrophin

localization to the muscle cell plasma membrane. Laminin-2 is anchored to dystrophin

by alpha-dystroglycan. Beta-dystroglycan binds to dystrophin. If there is any

interruption in the dystrophin-glycoprotein complex it can cause muscular damage

(Sotgia et al. 2000). The deterioration of the dystrophin complex causes DMD

(Ohledieck et al. 1993). Impedement of the dystrophin/beta-dystroglycan association

interferes with the dystrophin complex. Caveolin-3 interferes with the beta-

dystroglycan association to dystrophin resulting in DMD (Sotgia et al. 2000).

There are other muscle disorders linked to the diverse constituents that comprise

the dystroglycan complex (Cohn et al. 2000; Carbone et al. 2000). HyperCKemia,

18

Limb girdle muscular dystrophy, Fukuyama muscular dystrophy are all myopathies

associated with the dystroglycan complex of the skeletal muscle (Carbone et al. 2000;

Cohn et al. 2000).

As a result of the rarity, the inconsistent phenotypic penetrance, and vague

symptoms of RMD it is suggested that this disease is not recognized and maybe

misdiagnosed (Yuen et al. 2001). Although previously reported cases of RMD were

labeled as benign, a severe case of genetic rippling muscles has been identified. This

form of RMD is recessive and presents with classic RMD symptoms with an increase in

severity (Koul et al. 2001). This severe form is associated with arrhythmic

cardiomyopathy, a thickened intraventricular septum and premature ventricular

contraction in addition to the classical RMD symptoms (Koul et al. 2001). During

research on two RMD patients that had cardiac arrhythmias leading to their death it was

suggested that the RMD resulted in the cardiac problems of these two patients (Ricker

et al. 1989). It was speculated that an abnormality in the excitation-contraction

coupling connected to ryanodine receptor cardiac isoform was the cause. This mapped

to the infamous locus 1q42 (Tiso et al. 2001). The one thing that these contractions

have in common is a suggestion of an aberrant release of calcium in the sarcomere.

It has been speculated that an elevation of calcium levels in the sarcomere

induced by mechanical deformation of the muscle fiber may produce muscle

hyperexcitability (Yuen et al. 2001) seen in RMD patients. At present, scientific

research of the skeletal muscle proteins linked in the mechanosensitive control of

contraction have not been identified thus, we are left to speculate.

19

Autoimmune Rippling Muscle Disease (Acquired)

Our laboratory started Autoimmune Rippling Muscle Disease (ARMD) research

in 1999 by examining the antisera of patients with MG and ARMD to identify the

components of a skeletal muscle cell that are attacked by autoantibodies. Our

laboratory identified autoantidodies in these patients’ antisera which were

immunoreactive with larger skeletal muscle polypeptides. Since the rippling

occurrence is electrically silent and the large proteins of the skeletal muscle cells are

under attack, it was recommended that there is an initiation of mechanosensitivity of

calcium channels. Two calcium channels, Ryanodine Receptor (RyR) and

Dihydropyridine Receptor (DHPR), are high molecular weight proteins and therefore,

suggested to have an involvement in the mechanosensitive nature of the rippling muscle

contractions (Walker et al. 1999).

In 2006, Dr. Watkins continued this research by experimenting with antisera

from ARMD patients to identify which large proteins of the muscle cell may participate

in the origin of rippling muscle contractions. Dr. Watkins discovered five proteins:

(Table 1) enolase, aldolase, ATP synthase 6, Protein Phosphatase 1 Regulatory Subunit

1 (PPP1R3) and the titin Isoform N2-A. The enzymes had nothing to do with muscle

cell contractions and were not processed. There were a total 10 immunoreactive clones,

6 react with titin Isoform N2-A (Watkins et al. 2006). Since titin is a very large muscle

protein, it was concluded to have an essential task in the Anatomy and Physiology to

the location of the muscle responsible for the rippling muscle contractions.

20

Table 2. List of proteins subject to autoantibody attachk within RMD/MG

diagnosed patients and their respective immunoreactive clones.

Source: Watkins TC, Zelinka L, Kesic M, Ansevin CF, Walker GR. Identification of

skeletal muscle autoantigens by expression library screening using sera from

autoimmune rippling muscle disease (ARMD) patients. J Cell Biochem.

2006; 99(1):79-87

Bioinformatic research analysis of the titin immunoreactive clones continued in

our laboratory until the location of each clone was discovered on the titin polypeptide.

There are two different immunogenic locations of titin that have immunoreactivity to

autoantibodies of ARMD. The Main Immunogenic Region (MIR) of titin is located by

the A- band to I- band transition, was the first location of autoantibody

immunoreactivity in MG/T patients. The other location is in the A- band near the M-

line. This is the location that titin interacts with myosin. This location and the

pRRMG6 sequence are exclusive to ARMD (Watkins et al. 2006).

21

Diagram 3. Two distinct immunogenic domains within the A-band and I-band

regions of titin. Six clones within the study completed by Watkins

show identification with the titinprotein. Four recognize a region

mapped to the I band while 2 map to a position within the Abandregion

Source: Watkins TC, Zelinka L, Kesic M, Ansevin CF, Walker GR.

Identification of skeletal muscle autoantigens by expression library

screening using sera from autoimmune rippling muscle disease (ARMD)

patients. J Cell Biochem. 2006; 99(1):79-87.

My dissertation research continued Dr. Watkins’ research of the clones by

characterization of pRMMG6. The cDNA sequence (GenBank ID: EU428784)

(Zelinka et al. 2011) matches with the titin N2-A isoform (GenBank ID: 133378)

(Watkins et al. 2006). The pRMMG6 clone sequence encompasses exons 248 (90%

coverage), 249 (100% coverage) and a piece of 250 (24.3% coverage). The DNA

sequence translates to an amino acid sequence that consists of two Fibronectin III

domains (FN3) and a portion of an Immunoglobulin domain (Ig). BLAST analysis

established a 93.9% homology to titin from a mouse. The similarity between the

22

human and mouse titin isoform N2-A is vital for future experiments in our laboratory

using C2C12 cells.

Another form of rippling muscle was found by Dr. Ansevin in 1990. At that

time the patient displayed electrically silent rippling muscles without any other

problems or complaints. In 1995 the same patient returned for treatment again. During

this evaluation the patient presented with atypical wave like contractions stimulated by

percussion and stretch as well as myasthenia gravis. These contractions were

indistinguishable from the inherited RMD identified by Ricker et al. (1989) and

Torbergsen (1975). Concluding the investigation into the patient’s medical history and

the absence of an inherited pathway it was clear that this patient was suffering from

something similar to RMD. In the genetic RMD there is a family history of the disease

however, this patient did not have a family history of RMD or any other myopathies

(Ansevin et al. 1996). The patient had nine siblings without any type of neuromuscular

diseases. Later this patient was diagnosed with a thymoma and myasthenia gravis.

Since myasthenia gravis is an autoimmune neuromuscular disease the selected

treatment was immunosuppressive drugs such as a steroid, pyridostigmine (mestinon)

also known as acetylcholinesterase to degrade the acetylcholine, a thymectomy and a

plasmaphoresis. A plasmaphoresis is designed to remove all the present autoantibodies

and the immunosuppressive drugs are designed to decrease the production of

autoantibodies to decrease the symptoms of myasthenia gravis (MG). Not only did this

treatment plan reduce the symptoms of the autoimmune MG it also decreased the

rippling muscle symptoms as well (Ansevin et al. 1996).

23

A thymoma is present in about 15 % of the patients with MG (Williams et al.

1986; Skeie et al. 1996). Usually the presence of the thymoma in conjunction with MG

is a good indicator of more severe MG symptoms. A thymoma or hyperplasia is a

lymphoepithelial tumor of the thymus gland that proliferates at a very slow rate. The

thymoma causes a B-cell proliferation and autoantibody synthesis to increase. Roughly

half of the MG/thymoma patients have IgG autoantibodies to the ryanodine receptor

(Skeie et al. 2001; Mygland et al. 1994). The titre of the ryanodine receptor antibodies

is directly proportional to the severity of the MG disease (Mygland et al. 1994; Skeie et

al. 1996). MG/thymoma patients have autoantibodies recognizing different

intracellular muscle fiber proteins in the striations of the skeletal muscle myofibrils or

A-band, I-band and A and I-bands located in the Z-line (Vetters 1967; Williams et al.

1986). Striational autoantibodies are detected in 80-90 % of patients with

MG/thymoma. Other antibodies detected in MG/thymoma patients are to the skeletal

muscle fiber proteins like myosin, actin, titin, alpha-actinin, tropomyosin (Skeie et al.,

1996; Ohta et al. 1990; Pagala et al. 1990) and IgG autoantibodies to myosin and actin

(Ohta et al. 1990). Of course the more autoantibodies produced to the sarcomere the

worse the symptoms of the disease.

Two more patients with rippling muscles linked to MG were diagnosed

(Mueller-Felber et al. 1999). These two patients were treated with immunosuppressive

therapy to treat the MG and a reduction in the symptoms of the MG as well as the

rippling muscles was documented. Due to the clinical findings and the response to

treatment of these three patients an autoimmune etiology was suggested for the rippling

24

muscles linked with MG (Ansevin et al. 1996; Ansevin 1996; Mueller-Felber et al.

1999). The new type of RMD was named autoimmune rippling muscle disease

(ARMD).

ARMD like RMD displayed electrical silence during an electromyography

examination clearly demonstrated these patients had no motor unit action potentials

(MUAPs) or myotonia. The onset of symptoms for ARMD and RMD differed and the

improvement with immunosuppressive therapy differed as well. A theory involving

autoantibodies to mechanosensitive channels (MSCs) exists for ARMD (Ansevin et al.

1996; Walker et al. 1999) because both demonstrate stretch and percussion stimulation

and MUAP is not required for the stimulation of either one. Muscle responses are not

propagated by neural sources and the ripple phenomena are electrically silent. It is

suggested that the stretch activated wave-like contraction of skeletal muscle is a

product of MSCs (Mygland et al. 1992). Another suggestion is autoantibodies to MSCs

bind causing a conformation transformation elevating the sensitivity to these channels

to stimulate contraction upon stretch or percussion (Watkins 2004). Watkins also

suggested autoantibodies to unidentified non-MSC calcium channels or muscle cellular

proteins elevating their sensitivity to stretch or percussion triggering the activation of

the actomyosin contractile apparatus. Due to these similarities between MSCs and RM,

it is hypothesized that autoimmune rippling muscle patients generate autoantibodies to

MSCs or stretch activated channels (SACs) causing a voltage alteration across the

sarcolemma. It is this depolarization that stimulates DHPR to discharge calcium to

stimulate the RyR to release calcium.

25

MSCs discovered in chick skeletal muscle by Guchray (Guchray et al. 1984).

There are two different forms of MSCs. One is stretch inactivated channels (SICs) and

the other variety is stretch activated channels (SACs). During stretch or percussion

SACs open allowing calcium to surge into the cell. Usually SACs are closed to ion

flow. SICs are the opposite of the SACs. SICs are normally open to calcium flow and

then close in response to stretch or percussion.

Mechanical stimulation and amphipaths open SACs more rapidly (Sokabe et al.

1993). An amphipath is a compound comprised of a strongly polar group and a

strongly nonpolar group such as a phospholipid or other chemicals for example

trinitrophenol or chlorpromazine. It is suggested that SACs activate by cytoskeletal

structures and lipids (Sokabe et al. 1993). Activation and inactivation may possibly

cause injury to the neighboring tissues as indicated in another experiment performed on

mdx mice. This experiment suggested MSCs regulation might result in

pathophysiological calcium release (Franco-Obregon Jr. et al. 1994) due to

neuromuscular diseases and muscular dystrophy. Integrins are proteins that anchor

extracellular matrix molecules to cytoskeletal proteins. Proteins in the dystrophin-

spectrin family are located underneath the membrane. Dystrophin contains actin-

binding domains. These actin-binding domains are responsible for causing tension in

the cytoskeleton resulting in the stimulation required to activate MSCs (Hamill et al.

1995).

As previously mentioned, ARMD is sometimes diagnosed with myasthenia

gravis. When a patient exhibits these two diseases an exacerbation of autoantibody

26

production is demonstrated. Myasthenia gravis (MG) is an autoimmune neuromuscular

disease distinguished by fluctuating weakness or complete exhaustion of skeletal

muscle (Bartoccioni et al. 1980) because muscle contraction is partially obstructed,

although muscle contraction appears normal (Pagala et al. 1989). The muscles that are

usually affected are the throat and face muscles, more specifically the extraocular

muscles surrounding the eye. The neck, arm and leg muscles can also be affected.

Following muscle fatigue, slurred speech, problems with chewing and swallowing can

occur.

MG results from an accumulation of autoantibodies to acetlycholine receptors

that bind to the post-synaptic acetylcholine receptors (AChR) on the motor end plate

(Kimball et al. 1990; Drachman 1994) hampering the response of the muscle or

neuromuscular transmission to acetylcholine (Ach). This actually causes an incomplete

coupling because of reduced neurotransmitter or ACh and AChR complexing

(Bartoccioni et al. 1980). Muscle contraction is also impaired by the decreased number

of normal AChRs (Bartoccioni et al. 1980). This autoimmune assault on the receptor

actually is responsible for the muscle weakness and fatigueability (Drachman 1994).

One of the most interesting antibodies MG patients can synthesize is to the titin MIR

epitope. Around 95% of thymoma/MG patients produce the titin MIR epitope

antibody. The presence of the titin MIR epitope antibody is directly related to the

severity of the autoimmune state (Skeie et al. 1995).

Two other clinical syndromes present like MG symptoms but are extremely

dissimilar in their etiology. Seronegative myasthenia gravis patients have a

27

proliferation of autoantibodies to muscle specific kinase (MuSK) inhibit neuromuscular

transmission. Autoantibodies to MuSK are thought to obstruct the physiology of

MuSK in the clustering of AChR at the neuromuscular junction resulting in myasthenic

symptoms (Abicht et al. 2002; Vincent 2003). The other myasthenic like syndrome is

Lambert-Eaton myasthenic syndrome (LEMS). Patients with LEMS synthesize

autoantibodies to voltage gated calcium channels (VGCCs) of motor neurons. The

autoantibodies complex to the VGCCs impeding the release of ACh resulting in

inefficient neuromuscular transmission leading too myasthenic like symptoms (Lennon

et al. 1995; Takamori et al. 2000). Also, congenital myasthenic syndromes exist.

Mutations in the genes coding for the ion channel subunits of AChR interfere with

neuromuscular transmission (Ohno et al. 1997). Due to all of these disorders affecting

the contractile units of the skeletal muscle it has been possible to characterize these

units for their structure and function. It appears that the most important component is

the connectin or titin molecule.

Skeletal Muscle Connectin/Titin

Connectin and titin are the same exact protein discovered and characterized by

two separate research groups (Maruyama et al. 1977; Wang et al. 1979). Both terms

are used interchangeably. For simplicity, the term titin will be used because that is the

term previously used in our laboratory. Titin has multiple functions in the sarcomere

such as elasticity, stabilization, assembly, a molecular ruler and titin has been reported

a being a condensed mitotic chromosomal protein (Machado et al. 1998; Trinick et al.

28

1999). Chromosomal titin has not been accepted amongst the scientific community as a

fact, more experiments need to be done to confirm chromosomal titin.

Titin is the largest single-chain molecule known with isoforms ranging between

2,970 kDa found in cardiac muscle and 3,700 kDa located in skeletal muscle. Although

there is a size variation between titin isoforms, the same basic structural functions

occur. It is the third most abundant filamentous muscle protein found in both cardiac

and skeletal muscles. Titin constitutes 10% of the myofibrillar mass of the sarcomere.

Titin has multiple splice variants translated by diverse forms of skeletal muscles

(Maruyama 2002). The titin molecule is so diverse that it has been the debate by the

medical community, biologists, physiologists and biophysicists for its size, length,

structure and function as well as abnormalities.

Titin measures half of the length of the sarcomere. Titin stretches 1m from the

Z-disc to the M-line in humans (Skeie 2000), however it spans up to 3.5 m in the huge

sarcomeres of the crayfish claw muscle (Maruyama et al. 2002; Barinaga et al. 1995).

Oddly enough there is a high degree of homology between titin molecules of

distinguishing species (Kolmerer et al. 1996). The titin molecule is attached at the Z-

line by anchoring to the C-terminal end of alpha-actinin (Young et al. 1998). Diagram

4 is a picture of the domain structure of human titin isoforms. It shows the

conformational arrangement of the titin isoforms in the sarcomere.

29

Diagram 4: Domain Structure of Titin Isoforms in human. This diagram

demonstrates the correct location and special orientation of titin in the

sarcomere. It also shows a comparison between cardiac and skeletal

muscle. Shown in red is two titin molecules, running length wise, span the

sarcomere in a mirror isomer manner. Each titin contains a carboxy-

terminus found in the center M-line and an amino-terminus positioned in

its respective Z-disc bordering the sarcomere. Source: Freiburg A,

Trombitas K, Hell W, Cazorla O,Fougerousee F, Centner T, Komerer B,

Witt C, Beckmann JS, Gregorio CC, et al. Series of exon-skipping events

in the events in the elastic spring region of titin as the structural basis for

myofibrillar elastic diversity. Circulation. (2000); 86(11):1114-1121.

30

About 90% of titin’s mass is repeating structures. These repeating structures

range from 244-297 copies of two distinguishing forms of 100 residue replicates. The

residue replicates are known as immunoglobulin like domains consisting of 112-165

motifs and 132 fibronectin like repeats (Labeit et al. 1995). Titin’s N-terminal domain

attaches to actin (Young et al. 1998) at the M-band via Myomesin (Obermann et al.

1997). Titin adheres to the thick filament via Myosin-binding protein-C. Titin’s N-

terminal domain and the PEVK area bind to actin. Titin is described as having two

divided regions: One portion that spans the I-band (the end attached to the Z-disk) the

other portion spans the A-band (which runs parallel with actin). Titin is divided like

this due to drastic changes at the I/A boundary (Kruger et al. 2011; Scott et al. 2002).

The A-band region of titin associates with M-line proteins and the myosin thick

filaments and is considered to be the outline for synthesis of the thick filament (Scott et

al. 2002; Trinick et al. 1999). A-band titin consists of ordinary preparations of a

succession of 7 and 11 domain superrepeats of Ig and FN3 sequences that makes a

lengthy repeating pattern of about 300 of the same two protein domains, (Skeie 2000)

and a kinase domain by the C-terminus in the part spanning the M-band. Titin’s super-

repeat sequence is conserved like actin and the periodicity of the FN3 and Ig domains

complements closely actin. This is suggested to allow for titin’s binding to the thick

filament (Tskhovrebova et al. 2010). Each one of these repeats is 43 nm in length

corresponding exactly to the 43 nm distances matching the myosin binding protein C

attached to titin (Skeie 2000; Labeit et al. 1997).

31

The I-band region of titin is the elastic segment that connects the myosin thick

filament of the A-band to the Z-disc (Scott 2002), this portion of titin centers the I- and

A-bands within the sarcomere (Trinick et al. 1992). Z-disc titin consists of the Z-

repeats or 45-residue motifs, immunoglobulin (Ig) domains and nonrepetitive

sequences (Trinick et al. 1999; Skeie 2002). The terminal part of alpha-actinin is

attached to the Z-repeats (Skeie 2002) and there is a free elastic portion in the I-band.

The Z-disc thickness depends on the quantity of the Z-repeats. Differential splicing of

the I-band titin gives rise to special peptide sequences. Variances in the electrophoretic

mobility of titin found in samples from different tissue types led to titin isoforms.

Different titin samples showed three variant electrophoretic bands (Vikhlyantsev et al.

2006). There are three major splice deviations: one for cardiac muscle (N2-B) and one

for skeletal muscle (N2-A) (Kolmerer et al. 1996) and N2BA. N2BA shares structural

components of both N2A and N2B and is also found only in cardiac muscle

(Kontrogianni-Konstantopoulos et al. 2009). N2BA is suggested to involve an

association between sarcomere length and its contractile properties (Greaser et al.

2002). The splice factors that create the different isoforms are not known, but a recent

experiment found the cardiomyopathy gene RBM20 as a regulator of titin’s spicing

(Guo et al. 2012).

The PEVK domain consists of areas rich in Proline, Glutamic acid, Valine and

Lysine. The I-band titin consists of Ig and the PEVK domains (Skeie 2002; Trinick et

al. 1999; Scott et al. 2002; Kontrogianni-Konstantopoulos et al. 2009). The PEVK

domains role is muscle stiffness and muscle elasticity, it is suggested that the PEVK

32

extends by unfolding during muscle stretches (Skeie 2002; Scott et al. 2002; Trinick et

al. 1999). The actual length of the PEVK domain is directly proportional to the muscle

stiffness, elasticity (Guittierez-Cruz et al. 2001) and the type of muscle tissue (Skeie

2000). A good example of the varying length of titin’s PEVK region is in cardiac

muscle it is 163 residues, a drastic difference compared to skeletal muscle, which are

1000-2000 residues (Skeie 2000). An explanation for the difference could possibly be

that the skeletal muscle does a lot more stretching than the cardiac muscle so it needs to

be longer to compensate for the stretching. As a matter of fact, longer titin isoforms

located in skeletal muscle isoforms are more elastic compared to shorter titin isoforms

identified in cardiac muscle isoforms are stiffer (Trinick et al. 1999; Granzier et al.

2003). The degree of tension is changed by altering the titin isoform that is being

expressed. For example, in cardiac muscle the N2BA/N2B ratio decreases during

development effecting tension thus, during chronic heart failure the N2BA/N2B ratio

increases to decrease tension (Kruger et al. 2011). The PEVK region is considered a

linker sequence that acts like an elastic spring (Trinick et al. 1999; Trombitas et al.

1998; Tskhovrebova et al. 2000) however at greater forces elasticity is thought to be

due to unfolding of the Ig domains (Tskhovrebova et al. 1996; Rief et al. 1997). A

study involving elasticity of I-band titin claims that unfolding of only a few Ig domains

occurs in the I-band area. Perhaps this stretch induced unfolding located adjacent to the

T-tubules may stimulate DHPR/RyR to release free calcium ultimately leading to the

rippling muscle.

33

The tertiary structure of the Ig domains and the fibronectin (FN3) domains are

comprised of two beta pleated sheets adjacent to each other. Each sheet consists of four

beta strands. These sheets are thought to function as spacers to place an interacting

component in a specific position to perform a specific function (Williams et al. 1988).

An interesting note about the N and C-terminals of the Ig and FN3 is that they

are positioned at opposite ends. It is believed that this assists in linking multiple

sequential independently folded domains (Skeie 2000).

Titin contains kinase domains responsible for monitoring sarcomere synthesis

(Trinick et al. 1999). The serine/thyrosine kinase domains are located at the Z-disc N-

terminus and the M-line at the C-terminus (Trinick et al. 2002; Skeie 2002; Young et al.

1998). Titin C-terminus and telethonin, a recently identified muscle protein located at

the Z-disc, colocalize in the precursors of myofibrils. This new information leads

researchers to discount the kinase activity as an aid in contractility (Skeie 2000). It has

been reported the kinase domain activity requires dual activation: phosphorylation of

the tyrosine stimulates the substrate binding site and binding of calcium calmodulin to

unblock the phosphate binding site (Mayans et al. 1998; Means et al. 1998).

Titin’s 400kDa segment, close to the PEVK domain that constitutes the N-

terminal elastic portion (Tatsumi et al. 2001), binds free calcium ions (Wang et al.

1985). Calcium binding to this area alters the secondary structure of titin. It was

reported that functions of titin filaments are monitored by the binding of calcium ions

(Kolmerer et al. 1996). This could possibly mean that the elasticity of the titin

molecule could alter during the contraction and relaxation phase (Tatsumi et al. 2001).

34

Sequences of titin independently experimented develop alterations in their properties

during experiments in the presence of adjacent areas (Scott et al. 2002). For this

reason, the function of titin is considered a result of the sum of its parts.

Most of the mutations in the titin leading to functional changes are incompatible

with life (Hein et al. 2002; Skeie 2000) causing myofibrillogenesis and entropy upon

sarcomere synthesis (Skeie 2000). However, mutations that result in minor alterations

will not change the overall structure ultimately not affecting function of titin. An

example of this is Hypertrophic cardiomyopathy (HCM). HCM results in ventricular

hypertrophy with myofibrillar disorder (Skeie 2000). HCM causes persistent pressure

overload resulting in cardiac hypertrophy and cardiac failure leading to decrease

regulation of titin resulting in an increase regulation of the desmin and microtubules.

This results in myocyte length increases and ultimately a malfunction. The location of

the titin gene is on the long arm of chromosome 2 at 2q31 (Kontrogianni-

Konstantopoulos et al. 2009). HCM locus is also chromosome 2q31 clearly implicating

the importance of titin in this disease. Since consistent pressure overload results in

cardiac hypertrophy, it may also result in skeletal muscle hypertrophy even though it

has not been documented.

Titin can affect cardiac physiology by an alteration in its stiffness or a change of

the membrane channel activity (Granzier et al. 2003). It has been observed that the

PEVK domain of cardiac titin complexes with actin under certain physiological

conditions differentiates it from the skeletal muscle titin isoform (Yamasaki et al.

2001). It has been speculated that this decreases the mobility of the thin filament; this

35

influences the function of the cardiac muscle (Granzier et al. 2003). The length of the

FN3 fragment of cardiac titin regulates sarcomeric calcium sensitivity by modifying the

actomyosin association. This may actually adjust the cardiac muscle contraction

(Muhle-Goll et al. 2001). Muscle stiffness in a single contraction cycle has been linked

to an elevation of calcium sensitivity during calcium influx in muscles with short

sarcomere length (Muhle-Goll et al. 2001; Granzier et al. 2003; Greaser et al. 2002).

Diagram 5 shows the cellular location of the ion channels in spatial relation to the Z-

line in the I-band and how it encompasses the skeletal triad.

36

Diagram 5: Diagram of the ion channels of the skeletal muscle triad. DHPR a

voltage gated Ca2+

channel (VGCC) of the T-tubule is linked to the RyR

a Ca2+

channel of the SR. It is postulated that the link is

electromechanical in origin and conformational changes in DHPR open

RyR (Marx et al., 1998). The result is a coordinated release of the

sarcoplasmic stores of Ca2+

directly into the Ca2+

regulated I-band of

skeletal muscle. Source: Marx S, Ondrias K, Marks A. Coupled gating

between individual skeletal muscle Ca2+

release channels (ryanodine

receptors). Science. 1998; 281(5378):818-822.

37

Ion channels may possibly be monitored by cardiac titin binding proteins.

Titin’s N-terminus associates with T-cap. T-cap has been observed to relate with mink

-subunit of the stretch-sensitive IsK potassium channel (Furukawa et al. 2001). This

association proposes a relationship involving the passive force of titin influencing

control of ion channels. There is a possibility that titin may affect the contractile

proteins by controlling the distance between the myosin heads and the actin thin

filaments (Granzier et al. 2003). Titin’s physiology could possibly change with

distance and pressure, which could explain the rippling phenomena observed in

autoimmune rippling muscle disease.

Gene Cloning and Regulation

Titin plays an essential role in the autoimmune response in patients with

ARMD. The titin sequence identified by our laboratory required sub cloning for the

immunoreactive protein expression. This involves a plasmid or vector consisting of

DNA that contains an active, easily controlled promoter located downstream from

where our titin fragment is inserted. The vector used in our laboratory was pGEX 3X.

pGEX 3X maintains tight control over protein expression by utilizing a lac promoter

and an internal lac Iq gene. The lac promoter is induced by the lactose analog

Isopropyl -D thiogalactoside (IPTG). After induction of the promoter the titin

fragment can be synthesized in mass quantities for further investigation.

Gene cloning is the process of obtaining several reproductions of a small

specific sequence of DNA by reproduction of a microorganism including the specific

38

sequence of DNA. A PCR from pBluescript containing the titin sequence was

performed and inserted into TOPO TA vector and propagated. An EcoR1 restriction

enzyme digest was performed to obtain pure titin DNA fragments and ligated into

pGEX 3X for protein expression.

Sometimes choosing the correct vector is harder than it sounds. Sometimes the

DNA fragment that needs to be cloned does not insert properly into the vector or the

DNA fragment produces proteins that are toxic to the host cell leading to the demise of

the host cell. A commonly used host cell is Escherichia coli (E. coli). The E. coli is

used for the transformation step. Transformation is the method that promotes the

bacterial cell, E. coli in this case, to take up the DNA sequence allowing the

information in the DNA sequence to become an everlasting part of the bacterial host

cell.

E. coli bacteria and the lac operon were first discovered by Dr. Jacob and Dr.

Monod to explain gene regulation. An operon is a set of simultaneously regulated

genes contiguous to each other in the genome so all the genes required to use lactose as

the carbon source are controlled as a complete unit. The lac operon contains a total of

three genes: a lac Z gene to encode -galactosidase an enzyme to split lactose into

galactose and glucose, a lac Y gene to encode the enzyme lactose permease its function

is to pump lactose into the cell, and a lac A gene to encode thiogalactosidase

transacetylase an enzyme that transfers an acetyl group from acetyl CoA to -

galactosidase. Lac genes are a regulatory circuit subject to negative control by a

repressor encoded by the lac I gene (Muller-Hill 1996).

39

X-gal is a colorless chemical compound hydrolyzed by -galactosidase to form

a blue colored product for identification purposes. Microorganisms struggle to be

metabolically competent to survive during unfavorable environmental conditions. If a

normally used carbon source like glucose is not available, a microorganism must be

prepared to produce enzymes required to metabolize different carbon sources or shut

down certain pathways when a certain carbon source is gone until a more favorable

carbon source is accessible. Thriving microorganisms must be able to use accessible

carbon or energy sources in order for survival.

E. coli grown in growth media containing glucose, which is an easily

metabolized carbon source, express decreased levels of lac Z and lac Y genes. When

these genes are repressed it is known as catabolite repression. E. coli changed to a

growth media containing lactose express increased levels of lac Z and lac Y genes.

When these genes are uninhibited lactose is considered to be the inducer of gene

expression this is termed induction.

E. coli constitutive mutants grown in media containing glucose or in the absence

of glucose always express elevated levels of lac Z and lac Y genes or these mutants do

not repress the lac operon. These mutations are located on the E. coli chromosome to

the left of the lac Z gene. The term used to describe these genes is lac I genes. The

protein encoded by the lac I gene is a repressor of gene expression so this protein is

known as the lac repressor. When an inducer or lactose is not present the lac I protein

adheres to an operator site hindering polymerase function at the promoter site. This

averts transcription of the rest of the lac genes. However if an inducer or lactose is

40

added to the E. coli culture it will decrease the attraction of the repressor protein for the

operator binding site and transcription at the promoter occurs (Beckwith 1967, Muller-

Hill 1996).

Aims and Scope of Dissertation Research

The purpose of this study is to characterize the Autoimmune rippling muscle

disease (ARMD) antigenic domain of titin recognized by an autoantibody to titin N2-A

contained in the antisera of a patient with ARMD. This will enable us to characterize

the major autoantigen connected with ARMD and allow us to understand its role in

ARMD.

This study will address the following specific aims:

1. Subclone RMMG6 into an expression vector and characterize the fusion gene

a. Characterize pG3RMMG6

i. PCR

ii. Sequence analysis

iii. Bioinformatic analysis

2. Biochemical analysis

a. Express the fusion protein pG3RMMG6

b. Characterization of the fusion protein by molecular weight and

purification by SDS-PAGE

c. Immunoreactivity to determine if the titin domain is recognized by

antisera from MG/T and ARMD by Western Blot analysis

d. pI determined by 2DGE

41

3. Structural characterization by MS (sent to OSU) and x-ray analysis (current

discussion at YSU)

42

CHAPTER II

MATERIALS AND METHODS

Strains

The strain of Escherichia coli, One Shot TOP 10, was purchased from

Invitrogen, as a kit, and was used for all transformations. These E. coli cells are

chemically competent and specific for transformation but very fragile and delicate.

When handling this strain great caution must be used to preserve cellular integrity. The

genotype is F- mcrA Δ(mrr-hsdRMS-mcrBC) Φ80lacZΔM15 Δ lacX74 recA1

araD139 Δ(ara-leu) 7697 galU galK rpsL (StrR) endA1 nupG. The vector used for all

cloning reactions was included in the kit.

The vector is pCR® 4-TOPO® supplied linearized with a single 3´ thymidine

(T) overhang specific for TA cloning and a covalently bound topoisomerase which

means it is an activated vector. Topoisomerase is from the vaccinia virus. The kit also

included T3, T7, M13 forward and reverse primers as well as sterile water, salt

solution, 10X PCR buffer, dNTP mix and controls. These primer sequences are listed

on the sequence of primers table.

43

RMMG#6 pBluescript II KS/SK(+)

RMMG#6 pBluescript II KS/SK(+) was obtained from a glycerol stock

prepared by Tom Watkins Ph.D. who screened the Lamba Zap II human skeletal

muscle cDNA library from Stratagene, INC. to obtain this clone (Watkins et. al. 2006).

Overnight cultures of pBluescript II KS/SK(+) containing the cDNA insert RMMG#6

(Watkins et. al. 2006) were propagated in LB Amp broth. The next morning plasmid

purification was performed (AMRESCO Cyclo-Prep). A spectrophotometer reading

was done by adding 10 µLs of the plasmid purification to 90 µLs of nuclease free

water.

This reading determined the dilution factor of the cyclo-prep for the PCR

reaction of RMMG#6. A 1/10 dilution was made of the cyclo-prep of pBluescript II

KS/SK (+) RMMG#6 to obtain a PCR product of RMMG#6. In a PCR tube 5 µLs of

10X PCR Buffer, 3 µLs of MgCl2, 1 µL of dNTP’s, 0.5 µL of Taq polymerase (Roche),

5 µLs of M13 forward and reverse primers (1.6 picomoles), 28.5 µLs nuclease free

water and 2 µLs of the 1/10 cyclo-prep dilution of pBluescript RMMG#6 were added

and then mixed. The tube was placed in a PTC-200TM

Peltier thermal cycler DNA

Engine Gadient cycler (MJ Research, Inc.) over a gradient of 50-62° C to determine the

optimal annealing temperature for the M13 forward and M13 reverse primers. The

optimum temperature was found to be 51° C. the first cycle was 95° C for 9 minutes

and 30 seconds, the second cycle was 95° C for 30 seconds, the third cycle was 52° C

for 30 seconds, the forth cycle was 72° C for 1 minute the fifth cycle was a repeat of

cycles 1-4 (35) times, the sixth cycle was 72° C for 7 minutes and the final cycle was a

44

hold forever cycle at 4° C. Approximately 300ng of plasmid DNA was used in a 50

µLs reaction.

If an agarose DNA gel electrophoresis detected a single band in the PCR

product, the PCR product was then ready to be cloned and transformed. If there were

multiple bands on the gel, the entire PCR sample was electrophoresed through a Sea

Plaque agarose gel (2 grams of Sea Plaque dissolved in 100 mLs of 1X TAE) to make a

2% gel. When the gel was finished running it was stained with ethidium bromide (EtBr)

for 5 minutes and viewed for adequate separation of bands. Next the band with the

desired molecular weight was cut out of the gel and weighed. A QIAquick Gel

Extraction was performed using a (Qiagen®) kit following the manufacturer’s protocol.

The final DNA elution was accomplished using 52 µLs of nuclease free water heated to

70° C. After centrifugation at 14,000 rpm for 1 minute the final quantity of eluted DNA

was 50 µLs.

Cloning and Transformation

RMMG#6 DNA insert cloning

RMMG#6 DNA insert was contained in a glycerol stock of pBluescript II

KS/SK(+). Glycerol stocks were made by Tom Watkins Ph. D. The viability, of these

glycerol stocks, was poor. In order to ensure the integrity of RMMG#6 pBluescript II

KS/SK(+) it required a vector transfer. The PCR product of RMMG#6, after proper

identification, was cloned into pCR® 4-TOPO® or TOPO TA.

45

Immediately after another PCR was finished (from the QIAquick Gel

Extraction) 4 µLs of RMMG#6 insert was added to 2 µLs of salt solution plus 4 µLs of

sterile water and 1 µL of TOPO TA vector. The cloning reaction was incubated at 22 °

C for 1 hour and 15 minutes. The One Shot Top 10 E. coli cryovial was thawed on ice

for 10 minutes.

Then 2 µLs of the cloning reaction was added to the One Shot Top 10 E. coli

cyrovial and gently mixed. The cryovial was incubated on ice for 1 hour and 15

minutes then heat shocked for 1 minute and transferred directly to the ice for 5 minutes.

Next 250 µLs of room temperature SOC medium was added to the cryovial. The

cryovial was placed in a 37 ° C incubator and horizontally rotated at 200 rpm for 2

hours. During the last hour of the incubation 2 LB/Amp selective plates were placed in

the 37 ° C incubator. When the incubation steps were completed 50 µLs and 200 µLs

of the cloning and transformation reaction was plated on the LB/Amp selective plates.

These plates were incubated at 37 ° C for 24 hours. The next day 4 colonies from each

plate were transferred to another prewarmed LB/Amp selective plate and incubated at

37 ° C for 18 hours. Each on of these colonies was grown overnight in LB Amp broth.

The following day an AMRESCO Cyclo-Prep plasmid purification was

completed per manufacturer’s directions. The final DNA elution was acquired using 52

µLs of nuclease free water warmed to 70° C. Following centrifugation at 14,000 rpm

for 1 minute the final amount of eluted DNA was 50 µLs. To ensure the validity of this

insert an EcoR1 restriction enzyme digest was executed on the purified plasmid DNA.

In an eppendorf tube 20 µLs of DNA was combined with 1 µL of nuclease free water,

46

2.5 µLs of H Buffer (SIGMA®) and 1.5 µLs of EcoR1 (SIGMA®). The eppendorf tube

was vortexed and incubated at 37 ° C for 30 minutes and then vortexed again and

incubated at 37 ° C for another 30 minutes. After incubation, 6 µLs of Stop Buffer

(AMESCO) was added. The specimen was frozen at -20 ° C overnight.

The next day an agarose gel (2%) was run at 120 volts for 3.5 hours. If the

agarose DNA gel identified a 748 bp DNA insert similar to RMMG#6 it was sent for

DNA sequencing.

Before the results of the sequence arrived, the RMMG#6 TOPO TA was

propagated overnight in 100mLs of LB Amp broth. Plasmid purification was achieved

using the Qiagen® Plasmid Midi Purification Kit following the manufacturer’s

procedure. The final purified DNA product was resuspended in 600 µLs of nuclease

free water heated to 70 ° C. The RMMG#6 TOPO TA was used to make glycerol

stocks for future testing and preservation. Also, RMMG#6 TOPO TA DNA is required

for a ligation reaction with pGEX.

pGEX and RMMG#6 Ligation

Overnight cultures of both the pGEX vector and the RMMG#6 TOPO TA DNA

insert were propagated in LB Amp broth simultaneously. Plasmid purification was

achieved using the Qiagen® Plasmid Midi Purification Kit following the

manufacturer’s procedure. The final purified DNA product was resuspended in 600 µLs

of nuclease free water heated to 70° C. After purification of both the pGEX vector and

RMMG#6 DNA insert was done an EcoR1 restriction enzyme digest was performed.

400 µLs of Qiagen® purified TOPO TA RMMG#6 DNA was placed in an eppendorf

47

tube. 20 µLs of sterile water, 50 µLs of H buffer (Sigma®) and 30 µLs of EcoR1

(SIGMA®) were pipetted into the eppendorf tube and then vortexed. The eppendorf

tube was incubated at 37° C for 30 minutes then vortexed and placed back in the

incubator for 30 minutes. After 1 hour 120 µLs of Stop Buffer (AMRESCO) was added

to inhibit the restriction enzyme. The digest was frozen at -20° C overnight. pGEX

was prepared by adding the following in an eppendorf tube: 100µLs of Qiagen®

purified pGEX, 5 µLs of sterile water, 12.5 µLs H Buffer (SIGMA®) and 7.5 µLs

EcoR1 (SIGMA®). Next the eppendorf tube was vortexed and placed in the incubator

for 30 minutes at 37° C then vortexed again and incubated another 30 minutes at 37° C.

After one hour 30 µLs of Stop Buffer (AMRESCO) was added to inactivate the

restriction enzyme. The digest was frozen overnight at -20° C.

The next day the samples were pulled out of the freezer and thawed at room

temperature while the DNA gel was assembled. 2 grams of Sea Plaque Agarose Low

gelling temperature agarose was added to 100 mLs of 1X TAE (2% agarose) and heated

in the microwave for 3 minutes. When the mixture was cool to touch the gel was

poured. After the gel solidified, 340 µLs of TOPO TA RMMG#6 was loaded and 130

µLs of pGEX was loaded as well as 7µLs of the 100bp DNA Ladder (AMRESCO®).

The gel was run at 120 volts for 3.5 hours. After the gel was finished a QIAquick Gel

Extraction was performed using a (Qiagen®) kit following the manufacturer’s protocol.

The final DNA elution was accomplished using 52 µLs of nuclease free water heated to

70° C. After centrifugation at 14,000 rpm for 1 minute the final quantity of eluted DNA

48

was 50 µLs. The concentration measured 13.5 ng/ µL for the pGEX and 7.0 ng/ µL for

the TOPO TA RMMG#6.

Ligation buffer was made by adding 1 µL of ATP (SIGMA®) and 1 µL of 10X

T4 ligase buffer (SIGMA®) in a small PCR tube on ice. Afterward in a separate small

PCR tube also on ice the following was added: 0.7 µL of nuclease free water, 1 µL of

previously made ligation buffer, 7.1 µLs of TOPO TA RMMG#6 DNA insert, 0.7 µL

pGEX vector and 0.5 µL of well mixed ligase (SIGMA®). The ligation reaction was

vortexed then placed in the PTC-200TM

Peltier thermal cycler DNA Engine Gadient

cycler (MJ Research, Inc). The ligation reaction contained two steps. The first step was

22.5 ° C for 30 minutes and the second step was to denature the ligase at 65 ° C for 10

minutes. The ligation reaction serves as a cloning step since pGEX is a vector. Thus

another cloning step is not required, and the transformation can be performed directly

after the ligation reaction.

Transformation

The E. coli One Shot TOP 10 (Invitrogen) cells were thawed on ice the last 10

minutes of the ligation reaction. The transformation has to follow immediately after the

ligation reaction. The ligation reaction (2 µLs) was added directly to the E. coli One

Shot TOP 10 cryovial and then placed on ice for 45 minutes. Next the cryovial is

transferred to a 42 ° C water bath for 1 minute to heat shock the cells and then

transferred back to ice for 5 minutes. Room temperature SOC medium (250 µLs) was

added to the cryovial and incubated at 37 ° C shaking horizontally at 200 rpm for 1

hour and 15 minutes. During this incubation 2 LB Amp plates were placed in a 37 ° C

49

incubator to warm up. Finally, 50 µLs and 200 µLs of the ligation reaction/

transformation mixture were plated on the LB Amp plates and incubated overnight at

37 ° C.

The next day 4 colonies from each plate were transferred to another LB Amp

plate. The plate is incubated at 37 ° C overnight. A sterile toothpick was used to

transfer the 8 colonies in 5mLs of LB Amp broth. The broth was incubated overnight

at 37 ° C. The next day a (AMRESCO) Cyclo-Prep plasmid purification was performed

according to the manufacturer’s protocol. The final DNA elution was obtained using

52 µLs of nuclease free water heated to 70 ° C. After centrifugation at 14,000 rpm for

1 minute the final amount of eluted DNA was 50 µLs.

An EcoR1 restriction enzyme digest was performed on the purified plasmid

DNA. In an eppendorf tube 20 µLs of DNA was combined with 1 µL of nuclease free

water, 2.5 µLs of H Buffer (SIGMA®) and 1.5 µLs of EcoR1 (SIGMA®). The

eppendorf tube was vortexed and incubated at 37 ° C for 30 minutes and then vortexed

again and incubated at 37 ° C for another 30 minutes. After incubation, 6 µLs of Stop

Buffer (AMESCO) was added.

When the restriction enzyme digest was done a DNA agarose gel (2%) was run

at 120 volts for 3.5 hours. Clones that did not contain the RMMG#6 DNA insert were

discarded. Clones that contained the RMMG#6 DNA insert were grown overnight in

LB Amp broth. Glycerol stocks were made for latter analysis and long term storage of

these clones as well as DNA sequencing from the purified plasmid.

50

Plasmid Preparation

The AMRESCO Cyclo-Prep K179 Miniprep Plasmid DNA Purification Kit did

not use an RNase. DNA gels had an enormous amount of RNA where the RMMG#6

DNA insert should appear. After determining the presence of a band, another plasmid

purification was performed on the same culture using the QIAprep Spin Miniprep Kit

(Qiagen®) according to the manufacturer’s directions. This plasmid purification kit

contained a RNase in Buffer P1 and eliminated the huge RNA cloud that obscured our

band. Also, DNA sequencing worked better when the (Qiagen®) plasmid purification

kit was used. When the AMRESCO Cyclo-Prep kit was used the DNA sequencing did

not work at all. Our lab speculated this contradiction in results due to the RNA in the

sample interfering with the DNA sequencing.

After determination of RMMG#6 DNA fragment presence, a large scale

plasmid preparation was performed using the (Qiagen®) Plasmid Midi Purification Kit

following the manufacturer’s procedure. The final purified DNA product was

resuspended in 600 µLs of nuclease free water heated to 70° C and sequenced.

DNA Sequencing

Sequencing was performed using the Beckman-Coulter CEQTM

Quick Start Kit.

Plasmid purified samples were sequenced according to the manufacturer’s suggested

procedure. Roughly 1.5 µgs of pure plasmid DNA (dilutions were made and

approximately 2µLs) was added to 2µLs of (1.6 picomole) primer, 8 µLs of nuclease

free water and 8 µLs of DTCS Quick Start Master Mix and then gently mixed. The

samples were run according to the manufacturer’s directions.

51

Next, samples were ethanol precipitated and washed following the

manufacturer’s procedure. Then the samples were dried thoroughly by vacuum

centrifugation and frozen upright overnight at -20° C. The next day the DNA pellet

was resuspended with 40 µLs of Sample Loading Solution from the Beckman-Coulter

CEQTM

Quick Start Kit. The samples were sequenced on the Beckman-Coulter CEQTM

2000XL automated sequencer. The technique used for sequence analysis was the LFR-

1+30 method to increase data collection an additional 30 minutes. When sequence data

was obtained the data was analyzed using BioEdit Sequence Alignment, 4 Peaks and

Genius software.

Protein Expression

An overnight culture of pGEX3RMMG#6 was grown for 20 hours at

approximately 22° C in 300 mLs of LB Amp broth. Then 300 μLs of Isopropyl-ß-D-

thio-galactoside (IPTG) was added to the culture (to 0.1mM) to induce the lac operon

to express our protein. The culture remained at 22° C for four hours after the IPTG

addition. After the IPTG induction the culture was poured into 50 mL conical Falcon

tubes and centrifuged at 4 ° C for 30 minutes at 3800 rpm.

52

Glutathione-S-Transferase Affinity Chromatography Purification

The bacterial cell pellet was washed by resuspending with 4 ° C TBS and then

centrifuged again at 4 ° C for 30 minutes at 3800 rpm. Supernatent was decanted and

the cells were resuspended in 5 mLs of 4 ° C TBS then 100 μLs of Sigma P-7626 FW

174.2 Phenylmethylsulfonyl Fluoride α-Toluenesulfonyl fluoride and point sonicated at

50% power for 10 seconds on and 10 seconds off for 4 cycles. Next, 0.65 mLs of 10%

Triton X-100 was added and sonicated for 3 more cycles. The Falcon tube remained in

ice the whole time. The cell suspension should be more translucent. Cellular debris

was removed by centrifugation at 4 ° C for 40 minutes at 3800 rpm. Supernatant is

aspirated of the cellular debris and placed in another 15 mL Falcon tube at 22 ° C.

Supernatant was applied to the glutathione conjugated agarose column and incubated at

room temperature on a rotator for 1 hour and then allowed to flow through the

immobilized glutathione agarose matrix by gravity. The column was washed with 10

mLs of room temperature TBS four times. Next, a 15mM glutathione/ 50 mM Tris pH

8.28 solution is applied to the column for 30 minutes at room temperature on the

rotator. This solution elutes the GST. The elutant was collected in 0.5 mL fractions in

an eppendorf tube. Eppendorf tubes were frozen until the next day to run a SDS-

PAGE.

SDS PAGE

Proteins and GST purified fusion proteins were separated on the base of

molecular size by a Sodium Dodecyl Sulfate Polyacrylamide Gel Electrophoresis

(SDS-PAGE) (Laemmli, 1970) using a mini-gel arrangement (Matsudiara and Burgess,

53

1978). The gels were made in a multi-casting fashion. A 12% gel solution was

assembled by adding the following to a 500 mL Fleaker: 54 mLs of water, 36 mLs of

40% acrylamide, 30 mLs of Resolving Gel Buffer (90.85 grams of Tris, 2 grams of

SDS, 350 mLs of double distilled water titrated to 8.8 with HCl more double distilled

water was added to a final volume of 500 mLs), 120 μLs of TEMED and 480 μLs of

10% APS (0.1 gram of Ammonium per sulfate dissolved in 1 mL of double distilled

water). The 12% gel solution is poured into the syringe after 20 mLs of water saturated

butanol is poured through the syringe to protect the gels from air as they polymerize.

After the gels are polymerized the stacking gel (6.250 mLs of ddwater, 1.250 mLs of

40% acrylamide, 2.500 mLs of stacking gel buffer (12.1 grams of Tris, 0.8 grams SDS,

180 mLs of ddwater, titrate to 6.8 with HCl more ddwater was added to a final volume

of 200 mLs) was made. Approximately 1-5 μgs of protein was loaded into each lane or

20 μLs of sample. Samples were prepared by adding 15 μLs of sample to 5μLs of 4X

SDS-Buffer. Gels were run at a constant current of 0.020 mAmps for about 1 hour and

15 minutes and then placed in Coomassie Brilliant Blue (Sigma) overnight on a shaker

at room temperature. The next morning the gels were placed in high destain for 1.5

hours and then low destain overnight on a shaker at room temperaure. The next

morning the gels were viewed for our protein at 52 kDa. The control fractions or the

GST was on another gel at about 25kDa.

Western Blot

An SDS-PAGE was performed as above but when it was finished running the

proteins were transferred onto a Polyvinylidene difluoride (PVDF) (BioRad Sequi-

54

Blot) membrane by electrophoretic transfer or a Western Blot or immunoblot (Towbin

et al., 1979). PVDF membrane was placed in 10% blocking buffer (10 grams of

powdered milk dissolved in 100 mLs of TBS-T) for 2 hours. Membranes were rinsed

with TBS-T 3 times for 15 minutes and then placed in 1% Blocking buffer (1 mL of

10% Blocking Buffer plus 9 mLs of TBS-T) and 10 μLs of serum (primary antibody)

for 1 hour at room temperature on a shaker. The membranes were placed in the

refrigerator overnight. The next morning they were placed on the shaker at room

temperature for 1 hour and then rinsed with TBS-T 4 times for 15 minutes. Secondary

antibody was labeled with horseradish per-oxidase (HRP) (Sigma, Inc). Five μLs of

secondary antibody was added to 1% Blocking Buffer for 1 hour at room temperature

on the shaker. Then the PVDF membranes were rinsed 4 times with TBS-T for 15

minutes then TBS for 15 minutes. Antigen-antibody complexes were identified by the

Luminol chemiluminescent substrate (BioRad, Inc) and exposed to X-ray film (Kodak,

Inc BioMax film) by autoradiography.

Olmsted Affinity Purification of Antibodies

The SDS-PAGE and Western Blot were performed as previously mentioned.

The PVDF membrane dried overnight. The next day the PVDF membrane was placed

in methanol for 5 seconds and then the proteins were identified on the PVDF membrane

by staining with 0.1 % Ponceau S. for 20 minutes and destained with several changes of

distilled water until detection of the protein band. The protein band was cut out using

scissors. Residual Ponceau S. was removed by several washes with PBS. Next the

55

PVDF membrane is blocked with 5% blocking buffer for 1 hour and then washed 3

times using 3-10 mLs PBS for 5 minutes on a shaker. Place the PVDF membrane strip

in 200 µLs of crude serum in a 1.5 mL eppendorf microcentrifuge tube on a shaker for

3 hours. Remove the PVDF membrane from the “depleted fraction” and wash the

membrane 3 times with 3-10 mLs PBS for 10 min on a shaker. Take the PVDF

membrane out of PBS and place in another eppendorf tube containing 200 µLs of low

pH buffer on a shaker for 15 minutes and then added 200 µLs of ice cold 100mM Tris

base to increase the pH to 7.0. The purified and neutralized antibody was stored at -22 °

C.

Immunofluorescent Microscopy

The human skeletal muscle section microscope slides were placed in 10 mLs of

2% formaldehyde solution for 30 minutes. Next they were rinsed with TBS 3 times for

10 minutes on a shaker. The slides were placed in 5% blocking buffer solution and 250

µLs of Triton-X was added then the slides were put on the shaker for 1 hour. Slides

were rinsed with TBS 3 times for 10 minutes each. Rinsed slides were placed in 10

µLs of primary antibody in 10 mLs of 1% Blocking buffer solution on a shaker for 1

hour. The primary antibodies consisted of the following: Olmsted purified antibody

from patient #1, the depleted fraction control, reabsorbed affinity purified control and

the last slide was placed in 10 mLs of 1% blocking buffer for the secondary antibody

control. Next, rinsed slides with TBS 3 times for 10 minutes on a shaker and placed

them in 3 µLs of secondary antibody (goat anti human FITC) and 10 mLs of 1%

blocking buffer solution for 1 hour on a shaker. Slides were rinsed with TBS 3 times

56

for 10 minutes on a shaker. Slides dried for a few minutes and then 2 drops of 4% N-

propyl gallate in glycerol was put on the slide followed by a cover slip then they were

sealed with clear nail polish and viewed under the OLYMPUS manual/motorized

reflected fluorescence U-LH100HG system.

Titen Gels

An acrylamide plug is required otherwise the titin gel slips out of the glass

plates while it is running. Acrylamide plug consists of 1.5 mL of 40% acrylamide

solution, 0.5 mL of Glycerol, 1.25 mL of 2M Tris-Cl for polyacrylamide plug, 1.74 mL

of diH2O, 14 µL ammonium persulfate (APS), 7.6 µL TEMED. Place 900 µL of

acrylamide plug solution in between the glass plates. Use diH2O and pour over the

acrylamide plug solution to ensure the plug polymerizes as straight as possible. Wait 1

hour for polymerization then pour out the water, use a paper towel to get it all out.

Preheat oven to 65°C and weigh out 0.8 grams of agarose I powder and place in 250

mL beaker. In a graduated cylinder add 12 mL of Glycerol and 8 mL of 5X resolving

gel buffer and 20 mL of diH2O and mix until the solution looks homogenous. After the

acrylamide plug is polymerized place the entire gel casting apparatus into the 65°C

oven along with gel combs and pipette for 30 minutes. Take the graduated cylinder

containing glycerol, 5X resolving gel buffer and water and pour into 250 mL beaker

containing 0.8 gram of agarose I powder. Weigh the beaker to replace with diH2O after

heating. Heat the beaker in the microwave with another beaker of diH2O. Heat until the

agarose solution just begins to boil then swirl the beaker and reheat until the solution

has dissolved. Weigh the agarose beaker and replace significant evaporation loss with

57

the other beaker of hot diH2O. Remove all material from the oven, aspirate agarose

solution into the pipette and pour between glass plates of the gel casting device and

place comb in between glass plates. Avoid air bubbles while pouring gels. Let the gels

cool at room temperature for 30 minutes then place the entire gel casting device into the

refrigerator for 30 minutes at 4°C. Gels can be stored at 4°C with the comb in an air

tight container with paper towels moistened with water.

Two Dimensional Gel Electrophoresis (2DGE)

The GST-RMMG6 protein was obtained from the -20°C freezer. Passive

rehydration was performed using Bio-Rad® ReadyStrip™ IPG strips. The IPG strips

used in the passive rehydration process had a pH gradient of 5-8 and the strip size used

was 7 cm. GST-RMMG6 protein samples and rehydration buffer (8-9.8M Urea, 0.5%

CHAPS, 10mM DTT, 0-0.2% w/v Bio-Lytes, 0.001% Bromophenol Blue) were added

to the rehydration/equilibration tray. The 7 cm IPG strips, 125 µL of rehydration buffer

and protein sample was used to provide a final protein concentration of 0.667 ng/µl.

The Bio-Rad® ReadyStrip™ IPG strips were placed, gel side down, on top of the

rehydration buffer/protein sample in the rehydration/equilibration tray. Any bubbles

were removed if present under the IPG strips. The IPG strips were overlaid with

mineral oil and the rehydration/equilibration tray was placed on the orbital shaker at

room temperature overnight.

The next day (approximately 24 hours), the rehydration/equilibration tray with

the IPG strips soaking in the GST-RMMG6 protein rehydration buffer was obtained

from the orbital shaker and placed on the table in order to perform the first-dimension,

58

isoelectric focusing (IEF). The Bio-Rad® Electrode Wicks were immersed in de-

ionized H2O, and placed over the wire electrodes in the Protean® IEF focusing tray.

The IPG strips were obtained from the rehydration/equilibration tray and the mineral oil

was blotted off the tips of the strips before transferring to the Protean® IEF focusing

tray. IPG strips were placed on the wire electrodes of the IEF focusing tray with the gel

side down and the positive (+) end of the strip matching the positive (+) electrode of the

IEF focusing tray. The IPG strips were overlaid with mineral oil and the lid was placed

on the IEF focusing tray. The IEF focusing tray was placed in the Bio-Rad® Protean

IEF Cell. The Bio-Rad® Protean IEF Cell was turned on and programmed according to

the 7 cm IPG strip size. The program was set at the preset method, linear ramping

mode, 40,000 V-hr, and held at 500 V.

The same day as isoelectric focusing (IEF) was performed; 12% poly-

acrylamide gels were prepared in order to perform second dimension electrophoresis

the following day. Prepartion of the 12% poly-acrylamide gels was performed first by

cleaning the gel plates with 70% ethanol and then the poly-acrylamide solution was

prepared. For 100 mL of solution: 12% acrylamide, 0.375 M Tris, 0.1% SDS, and later

0.1% ammonium persulfate, and 0.04% TEMED was added to a beaker. After the poly-

acrylamide solution was prepared, it was added in between the long and short gel plates

and allowed to polymerize. Poly-acrylamide solution was added to each individual gel

plate by using a sterile pipette. After the gels were polymerized, they were transferred

to ½ X TGS buffer (For 1 x TGS buffer: 25mM tris, 192mM glycine, 0.1% SDS, H2O,

59

pH 8.6) and stored in the cooler until ready to perform second dimension

electrophoresis.

After completion of the isoelectric focusing (IEF), the IEF focusing tray was

obtained from the Bio-Rad® Protean IEF Cell and the IPG strips were removed from

the IEF focusing tray. The IPG strips were blotted off, to drain the excess mineral oil,

and placed in the rehydration/equilibration tray with the gel sides up. The IPG strips

were immersed in equilibration buffer I (6M urea, 2% SDS, 0.375M Tris-HCL, pH 8.8,

20% glycerol, 2% DTT) and placed on orbital shaker for 10 minutes at room

temperature. After 10 minutes, the IPG strips were transferred from equilibration buffer

I to equilibration buffer II (6M urea, 2% SDS, 0.375M Tris-HCL, pH 8.8, 20%

glycerol, 2.5% iodoacetamide) and were gently shaken on orbital shaker for 10 minutes

at room temperature. The IPG strips were then removed from equilibration buffer II and

were transferred to 1 x TGS buffer for 1-3 minutes. The 12% poly-acrylamide gels

were obtained from the ½ X TGS buffer (25mM tris, 192mM glycine, 0.1% SDS, H2O,

pH 8.6) in the cooler and were filled with overlay agarose (0.5g agarose, 100 mL 1 X

TGS buffer, 1 grain of bromophenol blue) to the top of the short plate. After the overlay

agarose was added, the IPG strips were quickly placed directly on top of the 12% poly-

acrylamide gels, with gel side up and positive (+) side on left, between the long and

short plates. The gels were placed on the table 10 minutes until the agarose solidified.

Then gels were placed into the electrophoresis cell chamber in order to perform second

dimension gel electrophoresis. The electrophoresis cell chamber was filled with 1 X

TGS buffer at room temperature and then electrophoresis was started. For 7 cm IPG

60

strips gels were placed in the Bio-Rad® Mini-Protean® 3 Cell and were run on manual,

constant milli-amps at 16 milli-amps per gel for approximately 21/2

hours. After

electrophoresis, the gels were removed from the electrophoresis cell chamber and

stained with Comassie (0.25% Comassie Brilliant Blue R-250 [Sigma], 45% methanol,

10% acetic acid).

To use Comassie stain, the gels were transferred to a staining container and

were immersed in Comassie stain. The gels were kept in the staining container

overnight, while being shaken on the orbital shaker at room temperature. After being

stained, the Comassie stain was removed from the staining container and the gels were

then immersed in high de-stain (40% methanol, 10% acetic acid) for 1 hour while on

the orbital shaker, in order to de-stain the gels. After 1 hour, the high de-stain was

removed from the staining container and the gels were re-immersed in low de-stain

(10% methanol, 6% acetic acid) for approximately two hours on the orbital shaker. The

low de-stain was removed from the staining container and the gels were placed in de-

ionized H2O in order for the gels to be scanned using the EPSON Scan Program and to

be stored on the table top for future use.

61

Protein Excision and Analysis

In order to perform mass spectrophotometry of GST-RMMG6 Coomassie Blue

stained gel bands were cut out the SDS-PAGE using a sterile pipette. . The excised

protein bands were then placed directly into a sterile eppendorf tube containing 5% v/v

acetic acid. The eppendorf tubes containing the excised protein bnds were then stored at

-20ºC until submitted to the Ohio State University Mass Spectrometry and Proteomics

Facility.

In Gel Digestion

At the Ohio State University Mass Spectrometry and Proteomics Facility, the

protein samples were processed by the following procedure. First, the gels were

digested with sequencing grade trypsin (Promega) or sequencing grade chymotrypsin

(Roche) using the Multiscreen Solvinert Filter Plates (Millipore). Briefly, samples were

then trimmed as close as possible to minimize background polyacrylamide material.

The gel samples were then washed in nanopure water for 5 minutes. The wash step was

then repeated twice before samples were washed with a 1:1 methanol/ammonium

bicarbonate solution (methanol: 50 mM ammonium bicarbonate; v/v) for 10 minutes.

The samples were then dehydrated with a 1:1 acetonitrile/ammonium bicarbonate

solution (acetonitrile: 50 mM ammonium bicarbonate; v/v). Subsequently, the protein

samples were rehydrated and incubated with a dithiothreitol solution (25 mM in 100

mM ammonium bicarbonate) for 30 minutes prior to the addition of iodoacetamide (55

mM iodoacetamide in 100 mM ammonium bicarbonate) solution. The protein samples

were then incubated with iodoacetamide in the dark for 30 minutes. The samples were

62

then washed again with two cycles of water and dehydrated using a 1:1

acetonitrile/ammonium bicarbonate solution (acetonitrile: 50 mM ammonium

bicarbonate; v/v). The protease was then driven into the protein samples by rehydrating

them in 12 ng/ml trypsin in 0.01% ProteaseMAX Surfactant for 5 minutes. After

rehydration, the samples were then overlaid with 40 ml of 0.01% ProteaseMAX

Surfactant: 50 mM ABC and gently mixed on a shaker for 1 hour. The in gel digestion

was finally stopped with the addition of 0.5% TFA.

Mass Spectrophotometry

Capillary-liquid chromatography-nanospray tandem mass spectrometry (Nano-

LC/MS/MS) was immediately performed on the digested samples to ensure high

quality tryptic peptides with minimal non-specific cleavage. The Nano-LC/MS/MS was

performed on a Thermo Finnigan LTQ mass spectrometer equipped with a nanospray

source operated in a positive ion mode and the LC system was an UltiMate™ 3000

system (Dionex). To each protein sample, 5 µl of solvent A, 50mM acetic acid, and

solvent B, acetonitrile, was first injected on to the μ-Precolumn Cartridge (Dionex) and

then washed with 50 mM acetic acid. The injector port was then switched to inject and

the peptides were eluted off of the trap onto the column. A 5 cm 75 μm ID ProteoPep II

C18 column (New Objective, Inc.) packed directly in the nanospray tip was then used

for chromatographic separations. The peptides were eluted directly off the column into

the LTQ system using a gradient of 2-80%B over 45 minutes, with a flow rate of

300nl/min. The total run time was 65 minutes and the MS/MS was acquired according

to standard conditions established in the laboratory. Briefly, a nanospray source

63

operated with a spray voltage of 3 KV and a capillary temperature of 200oC was used.

The scan sequence of the mass spectrometer was based on the TopTen™ method; the

analysis was programmed for a full scan recorded between 350 – 2000 Da, and a

MS/MS scan to generate product ion spectra to determine amino acid sequence in

consecutive instrument scans of the ten most abundant peak in the spectrum. The CID

fragmentation energy was set to 35%. Dynamic exclusion was enabled with a repeat

count of 2 within 10 seconds, a mass list size of 200, an exclusion duration of 350

seconds, a low mass width of 0.5 and a high mass width of 1.5.

Data processing was performed following recommended guidelines. Sequence

information from the MS/MS data was processed by converting the raw files into a

merged file (.mgf) using an in-house program, RAW2MZXML_n_MGF_batch

(merge.pl, a Perl script). The resulting mgf files were searched using Mascot Daemon

(version 2.2.2; Matrix Science) against the full SwissProt database (version 57.5;

471472 sequences; 167326533 residues) or the National Center for Biotechnology

Information (NCBI; http://www.ncbi.nlm.hih.gov) database (version 20091013;

9873339 sequences; 3367482728 residues). The mass accuracy of the precursor ions

were set to 2.0 Da given that the data was acquired on an ion trap mass analyzer and the

fragment mass accuracy was set to 0.5 Da. Considered modifications (variable) were

methionine oxidation and carbamidomethyl cysteine. Two missed cleavages for the

enzyme were permitted. A decoy database was searched to determine the false

discovery rate (FDR) and the peptides were filtered according to the FDR and proteins

identified required bold red peptides. Protein identifications were checked manually

64

and proteins with a Mascot score of 50 or higher with a minimum of two unique

peptides from one protein having a -b or -y ion sequence tag of five residues or better

were accepted.

65

CHAPTER III

RESULTS

Specimen Integrity

The original RMMG#6 DNA fragment was contained in the plasmid

pBluescript from Dr. Thomas C. Watkins. Then it was placed in the TOPO TA vector

(Figure 2) for long term storage and finally in pGEX-3X for protein synthesis. In order

to confirm specimen integrity of the original RMMG#6 DNA fragment specimen, a

DNA gel of the PCR product pBluescript RMMG#6 was performed. The pBluescript

RMMG#6 was grown overnight in LB Amp. The next morning a plasmid purification

by an Amresco cyclo-prep was performed and then a PCR. The sample was done in

duplicate. (Figure 1) is the DNA gel of the PCR product results of pBluescript

RMMG#6. Lane 1 was left blank and lane 2 contains the 100 bp DNA Molecular

Weight Ladder. Lanes 3, 5, 7, 8, 9, and 10 are all blank lanes. Lanes 4 and 6 are the

PCR products of pBluescript RMMG#6. In both lanes 4 and 6 a concise band is

present at the 800 bp area on the DNA gel. After confirmation of the PCR product

DNA sequence analysis was performed to verify the 748 bp RMMG#6 insert matched

the exact insert from Dr. Watkins (Figure 5). According to the sequence analysis, the

anticipated size is 831 bp and DNA gel analysis as well as PCR product estimated the

66

size around 810 bp. Once the RMMG#6 DNA fragment was confirmed it was cloned

into pCR®4-TO.

Cloning and Transformation

Several RMMG#6 TOPO TA clones were grown overnight in LB Amp. The

next morning plasmid purification was performed using the Amresco cyclo-prep and

then a Restriction enzyme digest was done using EcoRI. The EcoRI digested and

undigested RMMG#6 TOPO TA clones were run on DNA gels to find the clones with

the RMMG#6 DNA fragment (Figure 2). In lanes 1,4,7,10,13 of Figure 2 they are left

blank. Lanes 3, 6, 9, and 12 are the undigested RMMG#6 TOPO TA. Lanes 2, 5, and 8

are the EcoRI digested RMMG#6 TOPO TA; these lanes do not show a band indicating

that they do not have the RMMG#6 DNA insert. Lane 12 is the nondigested pCR®4-

TOPO RMMG#6 clone 4 showing that the pCR®4-TOPO vector is slightly higher than

the other vectors in lanes 3,6,9 without an insert. Lane 14 is the 100 bp DNA

Molecular Weight Ladder. Lane 11 is the EcoRI digested pCR®4-TOPO RMMG#6

with the insert at the 700 bp region and the pCR®4-TOPO vector at the 4490 bp region.

Clone 4 was confirmed with DNA sequence analysis. This DNA fragment is in fact the

exact RMMG#6 DNA fragment from pBluescript. These results were required to

continue with the ligation reaction.

67

Ligation

Next the ligation of the RMMG#6 DNA insert and pGEX-3X was performed

(Figure 3). This is a DNA gel of pGEX-3X and pCR®4-TOPO RMMG#6. Overnight

cultures of both were grown in LB Amp. The cultures were plasmid purified by a

Qiagen plasmid purifaction kit and then by a restriction enzyme digest using EcoR1.

Lanes 1 and 2 are the pGEX-3X vector containing a single band around 4490 bp for

pGEX-3X. Lane 3 contains the 100 bp DNA Molecular Weight Ladder. Lanes 4 and 5

are pCR®4-TOPO RMMG#6. These lanes contain a band around 4490 bp signifying

pCR®4-TOPO with another band around the 700 bp region indicative of RMMG#6

DNA insert. The pGEX-3X and RMMG#6 bands were cut out of the Sea Plaque

agarose low gelling temperature agarose gel and a QIAquick Gel Extraction was

performed. Once these bands were gel purified a ligation reaction and transformation

were completed.

Confirmation of Ligation

Colonies were selected and screened for the RMMG#6 DNA insert. Figure 4 is

a DNA gel of the pGEX RMMG#6 clones that were grown overnight in LB Amp and

plasmid purified by the Qiagen plasmid purification kit followed by an EcoRI

digestion. Lane 1 is the 100 bp DNA Molecular Weight Ladder. Lanes 3,5,7,9,11,13

are nondigested clones and Lanes 2,4,6,8,10,12 are the EcoRI digested clones. Lane 6

is the EcoRI digested pGEX3 RMMG#6 with the RMMG#6 DNA insert right between

the 700 and 800 bp bands corresponding to the DNA Molecular Weight Ladder and the

68

pGEX-3X plasmid at the 4490 bp area. Lane 7 is nondigested pGEX3 RMMG#6

demonstrating the pGEX plasmid is higher than the other vectors without an insert.

The gel measurement of the linearized plasmid are subject to a larger deviation from

the predicted size due to the bands being out of the range of the DNA ladder used

(AMERESCO, Inc., 100 bp ladder). The RMMG#6 DNA insert was confirmed by

DNA sequence analysis (Figure 5). This cDNA sequence of G3RMMG#6

demonstrates similarity to human skeletal muscle titin isoform N2-A. G3RMMG#6 is

748 bp area of this isoform of titin is immunoreactive to autoimmune rippling muscle

antisera. Figure 6 is a DNA gel of PCR analysis of all three subclones and

endonuclease analysis. G1RMMG6 contains a PCR product size of 200 b.p. and DNA

sequencing with this clone has never been effective. G2RMMG6 and G3RMMG6 both

contain the expected PCR product of 810 b.p. and correspond with the size based on

DNA sequence analysis which is 831 b. p. On the right side of figure 6 is the restriction

enzyme EcoRI analysis. It demonstrates the G3RMMG6 molecular size of the insert at

about 680 b. p. which matches the expected results. The linearized pGEX is above the

molecular weight ladder and is not accurate to determine the molecular size.

69

Figure 1: This is a PCR DNA gel of a pBluescript RMMG#6. This sample was

grown overnight in LB. An Amresco cyclo-prep was performed and then a

PCR. The sample was done in duplicate. Lane 2 is the 100bp DNA

Molecular Weight Ladder. Lanes 4 and 6 are the PCR product of

pBluescript RMMG#6. There is a clear and concise band at the 800bp

region on the DNA gel. DNA sequence analysis confirmed the 748bp

RMMG#6 insert.

70

Figure 2: DNA gel of pCR®4-TOPO RMMG#6. RMMG#6 was cut out of

pBluescript by the restriction enzyme EcoR1. RMMG#6 DNA insert was

cloned and transformed into pCR®4-TOPO. The colonies were grown in

LB overnight and a cyclo-prep was performed. Then an EcoR1 digest was

done and a DNA gel. Lane 14 is the 100bp DNA Molecular Weight

Ladder. Lane 12 is the nondigested pCR®4-TOPO RMMG#6 Clone 4

demonstrating the pCR®4-TOPO vector is slightly higher than the other

vectors without an insert. Lane 11 is the EcoR1 digested pCR®4-TOPO

RMMG#6 with the insert at the 700bp region and the pCR®4-TOPO

vector at the 4490bp region.

71

Figure 3: DNA Gel of pGEX and pCR®4-TOPO RMMG#6. Lanes 1 and 2 are

pGEX. Lane 3 is the 100bp Molecular Weight Ladder. Lanes 4 and 5 are

pCR®4-TOPO RMMG#6. Overnight cultures of pGEX and pCR®4-

TOPO RMMG#6 were grown in LB. The cultures were Qiagen plasmid

purified and EcoR1 digested. A Sea Plaque agarose low gelling

temperature agarose was made and the EcoR1 digestions were run. Lanes

1 and 2 have one single band around 4490bp for pGEX. Lanes 4 and 5

have a band around 4490bp signifying pCR®4-TOPO and another band

around the 700bp region indicative of RMMG#6. The pGEX band and the

RMMG#6 bands were cut out of the DNA gel and a QIAquick Gel

Extraction was performed. Once these bands were gel purified a ligation

and transformation were completed.

72

Figure 4: Demonstrates a DNA gel of pGEX3 RMMG#6. These samples are all

different colonies from a pGEX and pCR®4-TOPO RMMG#6 ligation

and transformation grown in LB overnight. A Qiagen plasmid purification

was performed and then an EcoR1 digestion. Lane 1 is the 100bp DNA

Molecular Weight Ladder. Lanes 3,5,7,9,11,13 are nondigested clones

and Lanes 2,4,6,8,10,12 are EcoR1 digested clones. Lane 6 is the EcoR1

digested pGEX3 RMMG#6 with the RMMG#6 insert between the 700 and

800bp region and the pGEX vector at the 4900bp region. Lane 7 is the

nondigested pGEX3 RMMG#6 representing the pGEX vector is fairly

higher than the other vectors without an insert.

73

Figure 5: Sequence of the ARMD immuno-reactive titin N2-A domain of

G3RMMG6 (GenBank # EU428784). This is the cDNA sequence of

G3RMMG6 showing identity to human skeletal muscle titin isoform N2-

A. G3RMMG6 is 748 b.p. region of this isoform of titin immunoreactive

to autoimmune rippling muscle antisera. This is the exact sequence that

confirmed the inserts from figures 1, 2, 3 and 4.

74

Figure 6: PCR and Restriction endonuclease analysis of pGEX-3X-

immunoreactive domain of titin N2-A fusion constructs (G1RMMG6,

G2RMMG6 and G3RMMG6). RMMG6 (pBluescript) cDNA

Subcloned into pGEX fusion vector (G3RMMG6) A.) PCR products using

pGEX-3X primers and three pGEX-3X/titin N2-A subclones. PCR of

G1RMMG6 yields about a 200 b.p. product, which is not consistent with

DNA sequencing results. G2RMMG6 and G3RMMG6 clones both yield

748 b.p products, consistent with DNA sequence results. B.) Restriction

endonuclease analysis of G3RMMG6 is also consistent with DNA

sequencing results. EcoR1 produces 748 b.p. fragment and 4900 b.p.

linearized pGEX-3X fragment. EcoRV, BamHI and Hind III produce only

a linearized plasmid.

75

Plasmid Construction

A plasmid map of pGEX-3X containing the 748 bp cDNA insert RMMG#6

(labeled EU 428784 the blue arrow) (Figure 8) demonstrates how the plasmid was

constructed. The location of the inserted RMMG6 immunoreactive domain is at the C-

terminal end of the glutathione-S-transferase. The pGEXRMMG6 map illustrates the area

where the LAC repressor protein is located (also labeled as a blue arrow). A LAC

repressor protein is required so the lactose deactivates the Lac I repressor then transcription

of the Lac Z, Lac Y, and Lac A can occur. The phosphorylated EIIA activates adenylate

cyclase to convert ATP to camp to bind the camp receptor protein (CRP) to stimulate

transcription of the Lac genes by binding to DNA near the lac promoter associated with

polymerase to stabilize polymerase binding to the promoter. A brown colored arrow is

used to designate the beta lactamase area in the plasmid. The beta lactamase is an enzyme

used to hydrolyze the beta lactam ring in the ampicillin rendering the antibiotic useless,

thus, allowing the selected organism to grow on the media containing ampicillin. It also

shows where the cDNA translates into the GST-titin fusion protein that was expressed and

glutathione affinity purified GST- titin N2-A domain weighing 50,747 kDa. Figure 7 is a

virtual amino acid sequence analysis constructed using the DNA sequence analysis to

create a conceptual translation of the fusion protein (gst-rmmg6) encoded by GST-

RMMG#6 gene. This computer-generated protein predicts a 51,023 kDa protein with a pI

of 5.95 which corresponds to experimental data. When the ligation of pGEX-3X and the

RMMG#6 insert was complete, protein expression was the next step in the process to study

the fusion protein directly by IPTG induced expression of pG3RMMG6 and affinity

purification was performed.

76

Figure 7: Virtual Amino Acid Sequence Analysis: This figure was constructed by

using the DNA sequence analysis to construct a conceptual translation of

the fusion protein (gst-rmmg6) encoded by GST-RMMG6 gene which

predicts a 51,023 protein with a pI of 5.95.

77

Figure 8: pG3RMMG6 map. This figure is a plasmid map of pGEX-3X

containing the 748 bp insert (labeled EU428784 the region is blue). The

Lac repressor protein (also labeled in blue) and the beta lactamase region

(colored brown) are also positioned on the map. The GST-Titin is shown

in yellow. The predicted PCR product (brown) of 221 bp using pGEX

forward and reverse primers is also included in the map. This size is in

concurrence to the size of the PCR fragment.

78

Protein Expression and Purification

Overnight cultures of pGEX3RMMG#6 were grown in LB Amp at 23 degrees

celcius for 24 hours and then IPTG was added to induce protein expression. After

expression the cells were centrifuged and the pellet was frozen overnight. The next

morning the pellet was washed with TBS and sonicated to release proteins from the

cell. Centrifugation was performed to separate the cellular debris (the pellet) from the

protein (the supernatant). The supernatant was applied to the Glutathione Affinity

purification column. The protein G3RMMG6 containing the glutathione affinity tag

would adhere to the glutathione beads, while the rest of the supernatant flows through

the column. TBS was used to wash the beads then the elution buffer was applied to

release the G3RMMG6 protein. The elution buffer with G3RMMG6 protein was

collected in eppendorf tubes and frozen until the next day to run a SDS-PAGE. (Figure

9) is the SDS-PAGE of the expressed and Glutathione Affinity purification of GST-titin

N2-A domain fusion protein. The first lane is the ProSieve® Color Protein Marker or

protein molecular weight standard from Lonza. The molecular weight of the bands

starting from the top of the SDS-PAGE and weighing the greatest to the least is 176,

119, 78, 51, 41, 27, 19, 12, 10 kDa. The second lane is the unpurified glutathione-S-

transferase fusion protein construct. Lane 2 has multiple protein bands at different

molecular weights. This clearly shows that the purification process has not occurred.

Lanes 3-10 are single glutathione affinity purified GST-titin N2-A domain fusion

protein fractions at 51,000 kDa according to the molecular weight standard based on

the SDS-PAGE mobility and Image J analysis as well as protein sequencing.

79

G3RMMG6 is 50,747 kDa indicating that the G3RMMG6 has been purified. This is

the expected result for experiment success. These fractions were also cut out of the

SDS-PAGE and sent to OSU for protein sequence and analysis, Figure 13). Testing on

the G3RMMG6 was the next step to find the pI, the electrophoretic mobility while

retaining the physical integrity for enhanced resolution of the large molecular weight

protein as well as checking for immunoreactivity with the ARMD antisera.

80

Figure 9: SDS-PAGE of Expression and Glutathione Affinity purification of

GST-titin N2-A domain fusion protein. Lane 1 is the ProSieve® Color

Protein Marker from LONZA as the protein molecular weight standard.

The first band starting at the top is 176, 119, 78, 51, 41, 27, 19, 12, 10

kDa. Lane 2 is the unpurified glutathione-S-transferase fusion protein

construct and it demonstrates multiple protein bands at several weights.

Lanes 3-10 are glutathione affinity purified GST-titin N2-A domain fusion

protein fractions corresponding to the 51,000 kDa. Molecular weight

standard G3RMMG6 is 50,747 kDa indicating that G3RMMG6 was

purified.

81

Polyacrylamide Gel Electrophoresis

After the expression and glutathione affinity purification of GST-titin N2-A

domain fusion protein was complete the protein was examined using vertical agarose

acrylamide gel electrophoresis and Two dimensional gel electrophoresis. Titin has

such a high molecular weight for separation by SDS-PAGE so a technique called

Vertical Agarose Gel Electrophoresis was used. These titin specific gels contain a

composite 2 % polyacrylamide to 0.5 % Agarose gel (Agarose is normally used to

separate DNA fragments), creating a larger pore size and retaining physical integrity

for enhanced resolution of the large molecular weight protein. Figure 10 is a titin gel

showing the glutathione affinity purified gst-rmmg6 titin N2-A domain fusion protein.

This gel shows a shaper resolution of the titin band as a doublet. This was a result we

were not expecting to see. Although the Vertical Agarose Gel Electrophoresis does

provide for a better resolution a doublet band should not appear unless there was a post

translational modification that occurred or due to sample age and repeated thawing and

freezing partial proteolysis occurred.

Next a two dimensional gel electrophoresis was performed using the glutathione

affinity purified GST-titin N2-A domain fusion protein to confirm the pI and use the

spots for future MSMS studies. Two dimensional gel electrophoresis is a technique

that separates and identifies proteins using two dimensions oriented at right angles to

each other. It uses two different physical properties. In the first dimension or

isoelectric focuses for separation of proteins on their net charge. The second dimension

or SDS-PAGE separates the protein by mass so it is rare that two different proteins will

82

resolve to the same place in both dimensions. The 2DGE was performed but the

protein quantity was not sufficient to run the test in triplicate to confirm results and a

clear distinct pattern was not observed. We were not expecting these results but due to

repeat freeze and thawing of the sample it must have degraded. Perhaps future studies

in our laboratory could perform more 2DGE analysis.

Figure 10: Vertical Agarose Gel Electrophoresis of the Glutathione Affinity

Purified GST-titin N2-A domain fusion protein. The first lane shown is

the glutathione affinity purified GST-rmmg6 titin N2-a domain fusion

protein. The red arrow indicates a sharper titin band resolution. The other

lane is homogenized human skeletal muscle sample that did not show the

clear concise band morphology of titin like the purified specimen. These

were the predicted results.

83

Confirmation of Antibody Reactivity

Western Blot studies were conducted on the ARMD antisera with the

G3RMMG6. Figure 11 is the result of Western Blot studies. On the left side of the

figure is the PVDF membrane stained with Coomassie Blue and the right side of the

figure is the autoradiograph of the Western Blot analysis. The PVDF membrane

demonstrates the ProSieve® Molecular Weight Standard and it does not show up on the

autoradiograph indicating there is not any immunoreactivity with the standard and the

ARMD antisera. The next lane was used as a control. The pGEX-3X is the next lane

on the PVDF membrane. It is not detected on the autoradiograph indicating that the

ARMD antisera is not immunoreactive to the pGEX-3X plasmid. The next lane on the

PVDF membrane is blank. The final lane on the PVDF membrane is the Titin N2-A or

the G3RMMG6. The PVDF membrane shows the immunoreactive Titin N2-A band

and the autoradiograph shows detection of chemiluminescence during the Western Blot

experiment. These results demonstrate that the ARMD antisera is immunoreactive with

the titin domain of the GST- titin N2-A fusion protein. The GST-titin N2-A fusion

protein needs to be used as a probe.

84

Figure 11: ARMD antisera is immunoreactive with the titin domain of the GST-

titin N2-A fusion protein. On the left side of this figure is the PVDF

membrane stained with Coomassie Blue and on the right is the

autoradiograph of the Western Blot analysis. The PVDF membrane shows

the ProSieve ® Molecular weight standard and it does not show up on the

autoradiograph. The next lane is the pGEX-3X control on the membrane

which is not detected on the autoradiograph. G3RMMG6 is right after the

blank lane. The PVDF membrane shows the immunoreactive Titin N2-A

band and the autoradiograph demonstrates the detection of

chemiluminescence during the western blot procedure. ARMD patient sera

is immunoreactive with the titin domain of the GST-titin N2-A fusion

protein.

85

Cellular Localization

Figure 12 is the Olmsted Affinity Purified Autoantibody from ARMD antisera

using immunofluorescent microscopy to tag the cellular localization of titin N2-A.

GST-titin N2-A fusion protein was run on an SDS-PAGE and blotted over to a PVDF

membrane to be used as a probe to purify the autoantibody out the serum of an ARMD

patient for immunofluorescent microscopy. This figure actually illustrates the

striational banding pattern in all three figures of the first lane. All three figures in lane

one are the same in lane two except that lane two figures were taken with the light

microscope. The striational banding pattern is seen with the light and fluorescent

microscope indicating that the GST- titin N2- A fusion protein cellular localization is in

the striational banding pattern. Lane 3 all 3 figures are immunofluorescent images of

controls. Lane 4 all 3 figures are the same as lane 3 except lane 4 is the light

microscope images. Lanes 3 does not illustrate the striational banding pattern that is

demonstrated in lane 1. In fact lane 3 controls do not demonstrate any pattern at all

only random immunofluorescence. This figure clearly demonstrates that the GST- titin

N2-A fusion protein’s cellular localization is a striational banding pattern.

86

LANE 1

IMMUNOFLUORESCENT

LANE 2

LIGHT MICROSCOPE

LANE 3 CONTROLS

IMMUNOFLUORESCENT

LANE 4 CONTROLS

LIGHT MICROSCOPE

Figure 12: Olmsted Affinity Purified Autoantibody from ARMD antisera using

immunofluorescent microscopy for cellular localization of titin N2-A:

The GST-titin N2-A fusion protein on a PVDF membrane was used as a

probe to purify the autoantibody from sera of an ARMD patient for

immunofluorescent microscopy demonstrating striational banding in the

first lane all 3 figures. Lane 2 all 3 figures are the same as lane 1 but using

a light microscope. Lane 3 all 3 figures are immunofluorescent images of

controls and lane 4 all 3 figures are the same as lane 3 only lane 4 using a

light microscope. Lane 3 and 4 images do not demonstrate any pattern at

all only random immunofluorescence.

87

Blast X Search

Figure 13 is a comparison figure of the cDNA region from exon 248 into exon

250 of the titin N2-A translated into protein. This is a figure of the Blast X search

showing that the ARMD immunogenic domain GenBank accession # EU428784 is

equivalent to the section spanning exon 248 – 250 of titin N2-A as designated by the

green color. The analogous residues are 50,093 – 50,747. This vicinity is composed of

fibronectin III domains. This is an area located inside of the A band section of the

sarcomere.

Figure 13: Sequence alignment of EU428487 indicates that the ARMD

immuunogenic domain corresponds to the region from exon 248 into

exon 250 of titin- N2-A. Blast X searches reveal that the ARMD

immunogenic domain (Gen Bank accession # EU428784) matches to the

area spanning exon 248 to exon 250 of titin N2-A as indicated by the

green color. The corresponding residues are 50,093-50,747. This region

consists of fibronectin III domains. This is a region located inside the A

band region of the sarcomere.

88

MS/MS Protein Sequence Analysis

Sequence analysis by MS/MS was performed on gel samples of the fusion

protein (GST-RMMG6) to confirm the titin domain RMMG6 of the recombinant GST

fusion protein is actually expressed. Figure 14 demonstrates the results from the OSU

MS analysis confirm the fusion protein contains peptide sequences that align with the

predicted human titin domain sequence that spans the exons 248 to 250 of the human

Titin gene. These protein sequences have alignment with the identical area of the titin

isoform N2-A. These peptide sequences cover 0.46 % of the total titin sequence and 74

% of the recombinant titin domain. This sequence has a Mascot numerical value of

772. Scores above 50 demonstrate a good quality sequence alignment determined by

the MS/MS. These peptide sequences matched an area of the glutathione –S-

Transferase with a Mascot score of 1053 and containing 52 % sequence coverage

indicating that the (GST-RMMG6) is in fact a portion of the human titin gene. These

results are the gold standard for protein identification.

89

Figure 14: Nano LC/Ms/MS analysis of gst-RMMG6 fusion protein. The top

portion of Figure 15 is the amino acid sequence of the fusion protein

fragments that show alignment with glutathione-S-transferase. The bottom

sequence is the amino acid sequence of the fusion protein fragments that

show alignment with the immunogenic region of the human titin N2-A

(numbers indicate amino acid position in the whole titin sequence).

90

CHAPTER IV

DISCUSSION

The classification of antibodies in autoimmune disease is essential to the

detection of dysfunctional cellular apparatuses leading to the detected indications of

autoimmune diseases. The effects of an autoimmune disease can be devastating or

even deadly in some cases such as autoimmune hemolytic anemia. My research

pertains to autoimmune rippling muscle disease and the pathology it causes with

skeletal muscle. My data described and characterized the autoantigen titin N2-A and

laid down the foundation for future studies to pinpoint the location within the myocyte.

Stephanie McCann a researcher in the laboratory used the RMMG6 DNA fragment and

inserted in the Green Fluorescent Protein and then placed it in the C2C12 myocyte to

pinpoint the exact location in the myocyte. Although I was unable to identify the

mechanism involved in creating the rippling symptom I characterized and located the

position on the titin peptide associated with ARMD. For the present time we will need

to conjecture on the phenomenon of the muscle ripple recognized in both the

autoimmune and genetic rippling muscle disease. It is possible that a cascade of events

is required to occur to invoke the ripple phenomena.

A suggested mechanism for genetic rippling muscle is hyperexcitability of the

myocyte via a caveolin-3 gene mutation. This CAV3 genetic mutation causes a

decrease in the manifestation of caveolin-3 protein and a proliferation in the

91

inducibility of nNOS (Vorgerd et al. 2001; Betz et al. 2001). Another theory speculates

the chromosomal localization at 1q42 initiating a deficient RyR role (Stephan et al.

1999; Hoffman et al. 1999; Koul et al. 2001). The defect in this RyR was mapped to

chromosomal loci 1q42 to 1q43 in a ventricular tachycardia patient. This location

corresponds to the RyR2 or cardiac RyR type 2 which causes tachycardia via long-QT

interval. This leads to a delayed repolarization in contraction of the cardiac muscle

(Laitinen et al, 2001). It may be possible for the muscle rippling in RMD to originate

from a similar defect like the one occurring in the cardiac muscle contraction

imperfection developing in arrhythmia.

Although the exact mechanism required for the rippling phenomena is unknown

currently my ARMD research has lead me to suggest a post-synaptic imperfection in

the muscle contraction. However it has been speculated that the muscle ripple

phenomena is triggered by a pre-synaptic derivation via hyperexcitability of the motor

neuron. An example of a hyperexcitable motor neuron would be Acquired

neuromyotonia or Isaac’s syndrome (Vernino et al. 1999). During a personal

communication with a board certified neurologist, Dr. Carl Ansevin, proposed the

description of pre/post synaptic line is because of a clinical debate regarding the

electromyography or EMG results of ARMD. Our laboratory decided to pursue post-

synaptic effects with autoantibodies because of the “electrical silence” on early results

of EMG’s on ARMD patients. After antigenic spread created muscle inflammation and

then EMG’s that were done seemed to be pre-synaptic. This allows EMG noise and

thus decreases the statement of “electrical silence.”

92

Previous Experimental Data in Our Laboratory

Our laboratory has conducted several experiments on ARMD research each

piece of the puzzle will eventually create a picture. During the screening of patient

serum to identify particular autoantigens conducted by Dr. Tom Watkins several

experiments were conducted. First, biochemical isolation of serum autoantigen

>200kDa by sub-cellular fractionation recognized a sub-cellular fraction which

demonstrated immunoblot positive for probable ARMD autoantigen as well as DHPR

and negative in controls (ex. Autoimmunity due to thymoma or MG) as well as RyR.

ARMD patient serum immunoprecipitate exclusive autoantigens from whole muscle

when equated with controls. ARMD patient serum autoantibodies complex antigens

accompanying in biomolecular coupled with DHPR. Immunoblots of sub-cellular

fractions of T-tubules and coimmunoprecipitation of ARMD autoantigen with anti-

DHPR antibodies, demonstrate autoantibodies to T-tubule specific antigens. ARMD

patient serum complexes high molecular weight antigens in rat and human skeletal and

cardiac muscle which supports the preservation of arrangement of muscle peptides

between species. The cardiac muscle immunoblots demonstrated immunoreactivity at

high molecular weight suggesting autoantibodies to a cardiac isoform of autoantigen.

ARMD patients have autoantibodies to skeletal muscle titin. There is confirmation of

antigenic spread with ARMD. The anti-titin antibodies are located outside of the MG/T

main immunogenic area of titin and could have an affect on muscle functioning.

Immunofluorescent microscopy was used to exhibit localization of ARMD

autoantigens. Distribution of immunoreactive autoantigens using ARMD sera

93

demonstrated a striated pattern of immunofluorescense corresponding to the striational

banding pattern seen with dihydropyridine receptor and ryanodine receptor implying

the presence of autoantibodies to the cellular location of the dihydropyridine and

ryanodine receptors (Walker et al. 1999, Watkins et al. 2006, Zelinka et al. 2011).

Plasmid pRMMG-4 from Dr. Watkins’s research indicated antigen spread. A

BLASTx sequence analysis search of this plasmid revealed a high degree of similarity

with the mitochondrial ATP synthase (subunit 6) (Mava-Meyer et al. 2001).

Mitochondria are closely linked to the sarcomere and T-tubules of skeletal muscle

leading us to believe that antigenic spread may have occurred. This information

reinforced the sub-cellular localization of immunoreactivity in Dr. Watkin’s research

(Watkins et al., 2006) and was in agreement with immunofluorescent localizations of

ARMD autoimmunity found in the I-band of human skeletal muscle (Zelinka 2002,

Zelinka et al. 2011).

Other past studies used antisera from MG and ARMD patients as probes to

screen a human skeletal muscle expression cDNA library producing multiple

pBluescript clones with immunoreactive peptides or polypeptide fragments that were

identified by ARMD antibodies (Watkins et al. 2006). Established on nucleotide

sequence analysis three separate ARMD antigens were classified: ATP synthase 6,

PPP1 R3 (protein phosphatase 1 regulatory subunit 3 and titin isoform N2A (One of the

major auto-antigens identified as a sarcomere cytoskeletal protein) (Watkins et al.

2006). Classical MG antibodies identify an expressed sequence analogous to the main

immunogenic region of titin also known as MIR. However, the sequence of titin

94

recognized by ARMD antisera is different from the MIR in fact it is the titin isoform

N2-A region. Currently the contrivance for antibody penetration is unknown. Other

studies have shown that rippling muscle disease antibodies do disturb the contractile

equipment of the sarcomere developing mechanical sensitivity. Contractions can

stimulated by mechanical activation evading the actual action potential or electrically

silent. Our laboratory is working under a hypothesis that auto-immune antibodies

complex to constituents of the sarcomere’s contractile- regulatory system which react

to mechano-stimulation resulting in a changed response.

Titin’s function as a regulator of muscle contractility marks it as a target to

comprehend muscle mechanosensitive control. Titin plays an essential role in anatomy

and physiology of all living creatures. When autoimmune diseases produce antibodies

to titin, the effects can be anywhere from mild to detrimental. My research illustrates

the products of subcloning the titin isoform N2-A immunoreactive domain from

ARMD sera into glutathione- S-transferase (GST) fusion vector (pGEX-3X) and the

succeeding fusion protein (Zelinka et al. 2011). The reason glutathione-S-transferase

(GST) was selected for synthesizing a recombinant protein with GST was to allow the

fusion protein to be easily constructed, induced, purified and characterized for

additional analysis. The origin of the cDNA (GenBank #EU428784) pG3RMMG6 was

clone #6 from the novel pBluescript library, now we refer to this plasmid as

pG3RMMG6.

Preliminary studies that were performed were necessary to confirm that the

pBluescript RMMG#6 from Dr. Watkins in fact did contain the RMMG#6 DNA insert.

95

A PCR was performed on pBluescript using M13 forward and reverse primers then a

DNA gel was run (Figure 1). A clear and concise band was detected on the DNA gel at

the 800 bp region. This PCR was prepared for DNA sequence analysis and confirmed

the 748 bp RMMG#6 DNA insert. It took several attempts to get the pBluescript

RMMG#6 to grow. Since the fragile condition of pBluescript RMMG#6 delayed this

process it required a vector transfer for long term storage.

Next, RMMG#6 DNA fragment was cut out of pBluescript by the restriction

enzyme EcoRI. Then RMMG#6 DNA fragment was cloned and transformed into

pCR®4-TOPO for long term storage and viability. An EcoRI restriction enzyme digest

was performed then a DNA gel was run (Figure 2). A clear and concise band was

identified on the DNA gel at the 700 bp region. Next the PCR was prepared for DNA

sequence analysis and confirmed the presence of the RMMG#6 DNA insert. These

results were expected and required to continue the research. Then the RMMG#6 DNA

fragment needed to be ligated into the pGEX-3X vector. First overnight cultures were

grown separately of pGEX-3X and pCR®4-TOPO RMMG#6. Then a restriction

enzyme digest was performed using EcoRI (Figure 3). The pGEX-3X and RMMG#6

DNA fragment from pCR®4-TOPO RMMG#6 were cut out of the DNA gel then gel

purified, ligated and transformed into competent host cells. Figure 4 demonstrates that

after the EcoRI restriction enzyme digest and DNA gel were accomplished the pGEX-

3X ligation to RMMG#6 was a success. One clone was found to contain the RMMG#6

insert and it is the third one on the DNA gel. Screening continued and when a total of 3

clones were found, DNA sequence analysis (Figure 5) was done to confirm the DNA

96

gel results and make sure the spatial orientation of the RMMG#6 DNA fragment

inserted properly into the pGEX-3X vector. These three clones were named

pGEX1RMMG6, pGEX2RMMG6 and pGEX3RMMG6. Figure 6 A is a DNA gel of

the PCR products of all three clones. Unexpected results occurred with G1RMMG6.

G1RMMG6 PCR product size was about 200 b. p. and DNA sequence analysis with

this clone has never been effective. G2RMMG6 and G3RMMG6 both include the

expected PCR product of 810 b. p. and match with the size based on DNA sequence

analysis, which is 831 b. p. On the right side of the figure 6 B is the restriction

endonuclease analysis of pGEX3RMMG6 or G3RMMG6. G3RMMG6 is consistent

with DNA sequence results. EcoR1 restriction enzyme analysis demonstrates the

G3RMMG6 molecular size of the RMMG6 insert at about 748 b. p. fragment, which

correlates to the expected value. The linearized pGEX-3X fragment is above the

molecular weight ladder at about 4900 b.p. and therefore cannot be used to correctly

determine the molecular size. EcoRV, BamHI and Hind III produce only a linearized

plasmid which is the expected result for the restriction endonuclease analysis.

After all of the restriction enzyme studies, DNA sequence analysis, ligation,

transformation and confirmations were done, the DNA sequence analysis information

was programmed into the computer using Genious, BLASTX and NCBI and used to

construct a virtual translation of the polypeptide sequence (Figure 7) and a plasmid map

(Figure 8). The virtual amino acid sequence analysis (Figure 7) was constructed by

transforming the nucleic acid sequence into an amino acid sequence to construct the

fusion protein (gst-rmmg6) encoded by the GST-RMMG6 gene. The conceptual

97

translation predicts the molecular weight of the protein to be 51,023 kDa. This is an

expected molecular weight for the fusion protein because the GST portion of the fusion

protein weighs 26 kDa alone. The N- terminal end of the polypeptide along with the

immunogenic titin domain (rmmg6) encompasses the C-terminal end weighing about

25 kDa. The conceptual translation also predicts the pI to be 5.95. This numerical

value for the pI was confirmed on the two dimensional gel electrophoresis.

The plasmid map of pGEX-3X containing the 748 b. p. cDNA insert RMMG6

was constructed on the computer. A blue arrow labeled EU 428784 shows the position

of the inserted RMMG6 immunoreactive domain is at the C- terminal end of the

glutathione- S- transferase. Also indicated by a blue arrow is the location of the LAC

repressor polypeptide. The purpose of the LAC repressor protein is so the carbohydrate

lactose disables the LAC I repressor to stimulate transcription of the Lac Z, Lac Y and

Lac A. Then the phosphorylated EIIA stimulates adenylate cyclase to transform ATP

to camp to complex the camp receptor protein (CRP) to activate transcription of the Lac

genes by binding to DNA near the lac promoter connected with polymerase to stabilize

polymerase binding to the promoter. The brown arrow in the plasmid map represents

beta lactamase enzyme. Beta lactamase hydrolyzes the beta lactam ring in the

ampicillin antibiotic rendering the ampicillin as useless. This allows the organism to be

selected by allowing it to grow on selected media containing ampicillin. The cDNA

translates into the GST- titin fusion protein that was expressed and glutathione affinity

purified GST- titin N2- A domain estimated weight is 50,747 kDa.

98

Finally, everything was right where it needed to be to start the induction of

protein expression with IPTG. After protein expression, the next step was Glutathione

Affinity purification. G3RMMG6 protein, encompassing the glutathione affinity tag to

adhere to the glutathione beads, the beads were washed, then the elution buffer was

applied to the beads to release the G3RMMG6 protein. G3RMMG6 protein was

collected and a SDS-PAGE run. Figure 9 shows the expressed and glutathione affinity

purified GST- titin N2-A domain fusion protein. The second lane contains multiple

bands at different molecular weights. This is what the unpurified glutathione- S-

transferase fusion protein construct looks like on the SDS-PAGE before purification.

The other lanes with one single band are glutathione affinity purified GST- titin N2-A

domain fusion protein fractions at 51,000 kDa. These results were analyzed based on

the molecular weight standard based on the SDS-PAGE mobility and Image J analysis

as well as protein sequencing. Since G3RMMG6 is 50,747 kDa and there is a single

band, G3RMMG6 has been purified. These results were expected and required in order

to characterize the G3RMMG6 protein. Now that G3RMMG6 was glutathione affinity

purified the next step was to test the immunoreactivity of G3RMMG6 with ARMD

antisera by Western Blot analysis.

The results of the Western Blot analysis are shown in Figure 11. The PVDF

membrane stained with Coomassie Blue is on the left side of Figure 11 and the

autoradiograph of the Western Blot analysis is on the right side of Figure 11. The

ProSieve® Molecular Weight Standard is not detected on the PVDF membrane

indicating that there is not any immunoreactivity between the ProSieve® Molecular

99

Weight Standard and the ARMD antisera. Also pGEX-3X is on the PVDF membrane

as a control. pGEX-3X plasmid is not detected on the autoradiograph designating that

the pGEX-3X control is not immunoreactive with the ARMD antisera. We were

hoping for these results but were unsure if the ARMD antisera would be

immunoreactive with the pGEX-3X plasmid or the ProSieve® Molecular Weight

Standard. Now we know for sure the immunoreativity detected is specific for the titin

N2-A domain of the GST- titin N2-A fusion protein or G3RMMG6. Now the GST-

titin N2-A fusion protein can be used as a probe to identify the cellular location in the

sarcomere of ARMD patient.

The Olmsted Affinity Purification Process was used to affinity purify the

autoantibody from ARMD antisera for cellular localization within the sarcomere Figure

12. This process used immunofluorescent microscopy to tag the cellular location of

titin N2-A. A SDS-PAGE of the N2-A fusion protein was run then blotted onto the

PVDF membrane. The PVDF membrane was cut around the band and then the band

incubated in the ARMD antisera to absorb the antibody out of the ARMD antisera and

bind to the N2-A fusion protein band on the PVDF membrane. Figure 12 demonstrates

the striational banding pattern in the first lane with all three figures. The figures in lane

one and lane two are the same except that in lane two these figures were taken with the

light microscope and the striational banding pattern is observed with both the light and

fluorescent microscope designating that the GST- titin N2-A fusion protein cellular

localization is in the striational banding pattern. In lane three all three figures are

immunofluorescent pictures of controls and lane 4 all the pictures are the same as lane

100

3 except that they are light microscope figures. Lane 3 does not show the striational

banding pattern that is shown in the lane 1 figures. The figures in lane 3 only

demonstrate random immunofluorescence. As expected the figure clearly illustrates

that the GST – titin N2- A fusion protein’s cellular localization is a striational banding

pattern consistent with the striational banding pattern of skeletal muscle and confirms

the immunogenicity of the autoantibody in ARMD antisera to the target muscle protein

titin isoform N2-A.

A comparison of the cDNA fragment from exon 248 into exon 250 of the titin

N2- A translated into a polypeptide. Figure 13 is a figure of the Blast X search

demonstrating the ARMD immunogenic region GenBank accession # EU 428784 is

identical to the region spanning exon 248 -250 of titin N2- A as indicated by the green

color. The corresponding residues are 50,093 – 50,747. This location is constituted of

fibronectin III domains. This region is located inside of the A band section of the

muscle cell.

Polypeptide computational analysis required confirmation by MS analysis.

Figure 14 is the sequence analysis results by MS/MS performed on gel samples of the

fusion protein (GST – RMMG6) to compare the titin domain RMMG6 of the

recombinant GST fusion protein is essentially expressed. The Ohio State University

MS analysis established that the fusion protein encompasses polypeptide regions that

match with the predicted human titin domain region spanning 248 – 250 of the human

titin gene. These results showed that the polypeptide sequences have alignment with

the same region of the titin isoform N2 – A. The coverage of these protein sequences is

101

0.46 % of the total titin sequence and 74 % of the recombinant titin domain. The

Mascot numerical score is 772 for the protein sequence. Mascot numerical values

greater than 50 designate a good quality sequence alignment determined by the MS /

MS. Also these polypeptide sequences corresponded to a region of the glutathione – S

– Transferase with a Mascot numerical value of 1053 and comprised 52 % sequence

coverage designating that the (GST – RMMG6) is in fact a percentage of the human

titin gene. These results are the cutting edge technology for protein identification and

confirm the actual protein sequence of the immunoreactive domain.

A function for autoantibodies in patients suffering from ARMD occurs in the

mechanosensitive muscle contractions (Ansevin and Agmanolis 1996; Watkins 1998;

Walker et al. 1999). In striated muscle tissue the purpose of titin is to deliver support

and elasticity for the muscle cell (Wang et el. 1985). However it is now known that the

function of titin within the muscle cell is more vigorous than initially reported. Titin is

intertwined with minK and T – cap in the association of the T – tubules and the Z- disk

in cardiac sarcomeres. The cardiac sarcomeres have a stretch – sensitive responsibility

in the potassium channel movement (Furukawa et al. 2001). The elastic PEVK

sequence is a negatively charged section of titin at the A / I boundary that could be

involved in calcium binding in uM quantities according to a study by Tatsumi et al.

2000. Another proposition was made about physiological purposes of titin are actually

facilitated by the binding of calcium (Kolmerer et al. 1996). A realization of the

complexity of titin’s function has aided in the classification of the “titinopathies” in the

skeletal muscles as well as the cardiac myocytes.

102

The gene coding for human skeletal muscle titin is TTN. TTN has been

chromosomally mapped to chromosome locus 2q31 (Labeit and Kolmerer 1995). Thus

far multiple striated muscle tissue diseases have been linked to this same chromosomal

locus. Furthermore experiments describing tibial muscular dystrophy (Udd et al. 1998)

associated the M – line titin imperfection to a 11 b.p. deletion / insertion genetic

mutation to the 2q31 chromosomal locus (Hackman et al. 2002). Titin genetic

mutations have caused dynamic results in cardiac muscle tissue. For example dilated

cardiomyopathy (DCM) was associated with a truncation genetic mutation causing

tissue remodeling as well as hypertrophy (Gerull et al. 2002; Hein and Schaper 2002).

Another example is hypertrophic cardiomyopathy (HCM) was linked to a titin missense

genetic mutation Arg740Leu with an increase in the fusion attraction of titin

complexing to alpha – actinin that may result in a functional modification (Satoh et al.

1999). Genetic mutations of the sarcomeric protein troponin T have developed in

hypercontractility of the cardiac sarcomeres. This demonstrates an effect from

conformational mutations in the cardiac myocyte associated with contraction (Bonne et

al. 1998).

A drosophila cDNA library was screened using the sera from scleroderma

patients and the antibodies recognized a drosophila titin homologue that could be

involved in chromosome assembly (Machado et al. 1998). Also titin has been

designated as an autoantigen in patients with both scleroderma and MG / Thymoma. A

main immunogenic region (MIR) of the striated skeletal muscle titin was described

(Gautel t al. 1993). The MIR sequence actually is located at the A / I junction of

103

human skeletal muscle. Antigenic spread has been identified by the additional epitopes

that were recognized (Gautel et al. 1993). About 95 % of MG / Thymoma patients

produce autoantibodies to the MIR sequence, however, a pathogenic potential has not

been identified (Skeie 2000). Our laboratory data suggests a location of

immunoreactivity just outside titin’s MIR region in patients with ARMD.

There are exclusive modifications in genes that code for AChR subunits

developing in myasthenic syndromes (Engel et al. 1998). Neuromuscular

symptomology is correlated to modifications with indications triggered by an

autoimmune response. Similar symptoms are expressed in genetic RMD in comparison

with ARMD and are due to different origins. Genetic RMD demonstrates

heterogeneity (Vorgerd et al. 1999; So et al. 2001) which was genetically mapped to

loci 1q41-42 (Stephan and Hoffman 1999) and just recently it was also genetically

mapped to 3p25. The genetically mapped location to 3p25 is also correlated to a

modification in the caveolin- 3 and is suspected to have an association in rippling

(Vorgerd et al., 2001). The alteration in the caveolin – 3 is of interest because

observations that mutual mutations within caveolin – 3 are associated with RMD (Betz

et al., 2001; Vorgerd et al., 2001), hyperCK – emia (Carbone et al. 2000) and limb

girdle muscular dystrophy 1C (LGMD – 1C) (Herrmann et al. 2000), therefore

recommending further constituents or connections with caveolin – 3 developing in

these distinctive disorders due to their distinct symptoms.

The occurrence of autoantibodies to a portion of the fragments of titin in our

ARMD patients insinuates the prospect of a function for anti – titin antibodies in

104

patients with ARMD even though there is not a concise comprehension of the cellular

effects of anti-titin antibodies. Experiments have established that autoantibodies cross

the plasma cell membrane in different living cell types such as neurons, fibroblasts,

epithelial cells and other cells (Alarcon-Segovia et al. 1996). Other experiments

performed by (Ma et al. 1987) used a method called flow cytometry to tag antibodies

that can enter viable lymphocytes. This demonstrates that antibodies can enter viable

lymphocyte cells. Knowing this theory makes it possible that intracellular

autoantibodies to titin enter the skeletal muscle fiber and affect the contractility of

muscle cells. Therefore the determination of the presence and location of anti-titin

autoantibodies requires certain evidence for their possible pathogenesis in ARMD.

Also identification of titin as an autoantigen allowed me and other laboratory members

to diagnostically scrutinize all recommendations of titin with other sarcomeric and

cellular proteins.

Previous experimental data demonstrated an area of homology between two

immunoreactive cDNAs and obscurin (GenBank accession number CAC44768), a

member of a family of giant sarcomeric signaling molecules that show an association

with G- protein regulated pathways (Bang et al. 2001; Young et al. 2001). Additionally

the chromosomal position of obscurin is 1q42 (Young et al. 2001) is the exact site as a

known mutation that was found in families with the genetic form of RMD (Stephan and

Hoffman 1999). This might insinuate a fascinating association between autoantibody-

stimulated mechanosensitivity in ARMD as well as the genetic form of RMD. Another

giant sarcomeric protein is obscurin weighing in at about (800 kDa). Obscurin and titin

105

complex with each other in the muscle cell in order to aid in the collaboration of the

myofibril with other portions of the sarcomere. Another essential connection of

obscurin is with ankryin. Ankryin is a sarcoplasmic reticulum resident protein this

designates a function for obscurin linking the sarcomere with the sarcoplasmic

reticulum (Bagnato et al., 2003). Our previous laboratory experiments show BLASTx

analysis of cDNA sequences of ARMD patients with autoantibodies to titin and

conceivably to obscurin by cDNA sequence analysis. This gives rise to the thought that

autoantibodies could possibly affect the sarcoplasmic reticulum through this

association. Additional confirmation connecting a function for autoantibodies and

obscurin comes from characterization of its constituent domains. Like titin, obscurin is

assembled from repeating FN3 and Ig domains (Young et al. 2001). It is speculated

that the homology detected between immunoreactive “titin-like” sequences and

obscurin is a result of these combined domains. Keeping this in mind, an additional

suggestion that sharing of epitopes between obscurin and titin may lead to cross

reactivity of the autoantibodies. Coherent with this recommendation it was

demonstrated by our laboratory that two titin- like cDNAs have homology with the

FN3 domain.

Inferred immunoreactivity occurs outside the MG/T MIR region based on the

positional computation of alignments between the immunoreactive cDNAs and titin

isoform N2- A (GenBank accession numbers NP596869 and EU428784). Therefore

the implication of the presence of autoantibodies to titin may have an exclusive

pathogenic effect. Experiments conducted on a population of patients with MG/T years

106

ago identified autoantibodies to titin in the main immunogenic region (MIR) (Gautel et

al. 1993). It was previously demonstrated and confirmed by my results that our

sequences were outside of the conventional MIR. Alignments were performed

previously and confirmed by me by BLASTx between the published sequence of the

titin MIR (GenBank accession number AAB28119) and the N2- A titin sequence

(GenBank accession number NP596869 and EU428784). The alignment of the titin

MIR corresponding to titin isoform N2- A occurs between amino acids14257 through

14543. Previously in our laboratory the cDNA library was screened with MG/T patient

antisera (patient 10) and an immunoreactive cDNA clone was found that showed

homology with titin within the MIR sequence (Mathew Kesic personal

communication). This information allows for the possibility that there may be a

function for the autoantibodies that bind titin in the area outside the MIR in patients

with ARMD.

In general, ARMD autoantibodies happen to complex the skeletal muscle titin in

an area exterior to the MIR signifying a conceivable function for the titin

autoantibodies in ARMD. It may actually be the binding of titin autoantibodies to an

exclusive sequence of human skeletal muscle titin may actually be responsible for the

rippling muscle symptoms in ARMD by increasing the muscle’s capacity to contract in

response to mechanical stimuli. Presently several experiments demonstrate that cardiac

muscle tissue titin is sensitive to mechanical stress as a result of genetic mutations,

affecting arrhythmia and hypertrophy. Perhaps the autoantibodies to skeletal muscle

tissue may cause an abnormality such as a muscle ripple.

107

Different mutations in the same protein can cause diverse symptoms in

neuromuscular disorders. The CAV3 can be used as an example to demonstrate

mutations in different portions of caveolin- 3 result in either LGMD or genetic rippling

muscle disease. Our laboratory has a theory that the there is a possibility for

autoantibodies that can cross the cellular membrane to cause an affect on cellular

processes. In a study conducted by Alarcon-Segovia et al., (1996), some of the cellular

antibodies have been found intracellularly bound to their corresponding autoantigens.

In 2001 an experiment conducted by Skeie et al., (2001) discovered that autoantibodies

to RyR may inhibit the RyR channel dynamics in vivo and may even have a function in

severe MG. In Diagram 6 a probable mechanism for the in vivo effect of

autoantibodies to the skeletal muscle titin is proposed. Positional analysis performed

between immunogenic peptides encoded by cDNAs isolated from the cDNA library

and their positions of distinctiveness with skeletal muscle titin may be used to suggest

that there may be an effect on the extensible PEVK region of the polypeptide

(Guttierez-Cruz et al. 2001). This area is directly linked with passive stiffness and this

region is near a calcium binding segment in the I-band (Tatsumi et al. 2001). Calcium

is a crucial binding partner of titin. Recently the stiffness of the PEVK and other

extensible areas of titin were shown to be controlled by the calcium concentration

(Nocella et al. 2012). Calcium also controls titin’s placement during sarcomerogenesis

and if calcium transients are blocked, the sequence of actin and myosin is

compromised. Calcium activates the C-terminal kinase domain of titin.

108

Diagram 6: Diagram of the position of ARMD autoantibody binding on skeletal

muscle titin. The PEVK region and a 400-kDa Ca2+

binding sequence are

outside of the MIR. Boxed insert shows the region of autoimmunity.

Based on positional analysis of cDNA alignments with titin isoform N2-A

(GenBank accession number NP596869). Source: Watkins, TC. The

application of biochemical and genomic techniques to identify

autoimmune rippling muscle disease antigens [dissertation]. [Kent, (OH)]:

Kent State University; 2004. 140 p. Available from: Kent State

University, Special Collections.

This kinase domain initially subsides in the forming Z- band during sacomerogenesis,

thus, it has been suggested that titin’s connections with the thin filament are calcium

109

transient dependent (Harris et al. 2005). Telethonin or T- cap, a Z – band protein has

an extremely strong association with Z – band area of titin. A ligand of telethonin is

the transcriptional coactivator muscle LIM. In fact it is speculated that the Z-band titin,

Z- band T-cap and LIM make a sarcomeric mechanosensor complex, but the real nature

of this complex remains unknown (Kruger et al. 2011). Future research in our

laboratory may perhaps determine if autoantibodies to these areas have a function in

ARMD.

Recent experimental research in our laboratory conducted by Stephanie

McCann successfully constructed a fusion plasmid using the pGEXRMMG6. She

genetically engineered the RMMG6 immunogenic titin domain into pAcGFP1-C1. It is

now called RMMG#6/pAcGFP1-C1 fusion plasmid. The pAcGFP1-C1 attaches the

RMMG#6 immunogenic titin domain to a green fluorescent protein (McCann 2011).

Also Stephanie McCann has effectively transfected C2C12 mouse myoblasts

with the fusion plasmid RMMG#6/pAcGFP1-C1. Her work will lay down the

foundation for future research to track the immunogenic titin domain for localization

within the sarcomere in order to monitor alterations in cell differentiation, protein

expression, and cell development by over expression of the titin immunogenic domain.

Hopefully Stephanie McCann’s research will allow our laboratory to

quantitatively track specific immunogenic titin domain synthesis within the C2C12

mouse myoblasts in vitro during differentiation. Her hypothesis is that if the RMMG#6

titin immunogenic domain is over-expressed in developing C2C12 mouse myoblasts

then a distorted maturity of mytotubes should occur during myogenesis.

110

REFERENCES

Abicht A, Lochmuller H. What's in the serum of seronegative MG and LEMS? MuSK

et al. Neurology. 2002; 59(11):1672-1673.

Alarcon-Segovia D, Ruiz-Arguelles A, Lorente L. Broken dogma: penetration of

Autantibodies into living cells. Immunol Today. 1996; 17(4): 163-164.

Ansevin CF. Rippling muscles and myasthenia gravis: a stretch activated

channelopathy? Neuromuscul Disord. 1996; 6 (Suppl):S60.

Ansevin CF, Agamanolis DP. Rippling muscles and myasthenia gravis with rippling

muscles. Arch Neurol. 1996; 53(2):197-199.

Bagnato P, Barone V, Giacomello E, Rossi D, Sorrentino V. Binding of an ankyrin-1

isoform to obscurin suggests a molecular link between the sarcoplasmic

reticulum and myofibrils in striated muscles. J Cell Biol. 2003; 160(2):245-253.

Bang ML, Centner T, Fornoff F, Geach AJ, Gotthardt M, McNabb M, Witt CC, Labeit

D, Gregorio CC, Granzier H, Labeit S. The complete gene sequence of titin,

expression of an unusual approximately 700-kDa titin isoform, and its

interaction with obscurin identify a novel Z-line to I-band linking system. Circ

Res. 2001; 89(11):1065-72.

Barinaga M. Titanic protein gives muscles structure and bounce. Science. 1995;

270(5234): 23.

111

Bartoccioni E, Scuderi F, Scoppetta C, Evoli A, Tonali P, Guidi L, Bartoloni C,

Terranova T. Myasthenia gravis, thymectomy, and antiacetlycholine receptor

antibody. J Neurol. 1980; 224(1):9-15.

Beckman Coulter® Genome Lab™ Dye Terminator Cycle Sequencing with Quick Start

Kit. September 2004. p. 1-2

Bers DM, Fill M. Coordinated feet and the dance of ryanodine receptors. Science.

1998; 281(5378):790-791.

Betz R, Schoser, BGH, Kasper D, Ricker K, Ramirez A, Stein V, Torbergsen T, Lee,

YA, Nothen MM, Weinker TF, et. al. Mutations in CAV3 cause mechanical

hyperirritability of skeletal muscle in rippling muscle disease. Nat Genet. 2001;

28(3):218-219.

Bonne G, Carrier L, Richard P, Hainque B, Schwartz K. Familial hypertrophic

cardiomyopathy: from mutations to functional defects. Circ Res.1998;

83(6):580-93.

Brandt NR, Caswell AH, Brunschwig JP, Kang JJ, Antoniu B, Ikemoto N. Effects of

anti-triadin antibody on Ca2+

release from sarcoplasmic reticulum. FEBS Lett.

1992; 299(1):57-9.

Brenman JE, Chao DS, Xia H, Aldape K, Bredt DS. Nitric oxide synthase complexed

with dystrophin and absent from skeletal muscle sarcolemma in Duchenne

muscular dystrophy. Cell. 1995; 82(5):743-752.

112

Burns RJ, Bretag AH, Blumbergs PC, Harbord MG. Benign familial disease with

muscle mounding and rippling. J Neurol Neurosurg Psychiatry. 1994; 57(3):

344-347.

Carbone I, Bruno C, Sotgia F, Bado M, Broda P, Masetti E, Panella A, Zara F,

Bricarelli FD, Cordone G, Lisanti MP, Minetti C. Mutation in the CAV3 gene

causes partial caveolin-3 deficiency and hyperCKemia. Neurology. 2000;

54(6):1373-6.

Cohn RD, Campbell KP. Molecular basis of muscular dystrophies. Muscle Nerve. 2000;

23(10):1456-71.

De Paula F, Vainzof M, Bernardio ALF, McNally E, Kunkel LM, Zatz M. Mutations in

the caveolin-3 gene: when are they pathogenic? Am J Med Genet. 2001;

99(3):303-307.

Dotti MT, Malandrini A, Gambelli S, Salvadori C, De Stafano N, Federico A. A new

missense in caveolin-3 gene causes rippling muscle disease. J Neurol Sci. 2006;

243(1-2):61-64.

Drachman DB. Myasthenia gravis. N Engl J Med. 1994; 330: 1769-1797.

Engel AG, Ohno K, Sine SM. Congenital myasthenic syndromes: experiments of

nature. J Physiology Paris. 1998; 92(2):113-117.

Fisher D, Schroers A, Blumcke I, Urbach H, Zerres K, Mortier W, Vorgerd M,

Schroder R. (2003) Consequences of a novel caveolin-3 mutation in a large

German family. Ann Neurol. 2003; 53(2):233-241.

113

Franco-Obregon, Jr. A, Lansman JB. Mechanosensitive ion channels in skeletal muscle

from normal and dystrophic mice. J Physiol. 1994; 481(Pt 2):299-309.

Freiburg A, Trombitas K, Hell W, Cazorla O,Fougerousee F, Centner T, Komerer B, Witt

C, Beckmann JS, Gregorio CC, et al. Series of exon-skipping events in the events

in the elastic spring region of titin as the structural basis for myofibrillar elastic

diversity. Circulation. (2000); 86(11):1114-1121.

Furukawa T, Ono Y, Tsuchiya H, Katayama Y, Bang ML, Labeit D, Labeit S, Inagaki

N, Gregorio CC. Specific interaction of the potassium channel beta-subunit

minK with the sarcomeric protein T-cap suggests a T-tubule-myofibril linking

system. J Mol Biol. 2001; 313(4):775-84.

Galbiati F, Volonte D, Minetti C, Chu JB, Lisanti MP. Phenotypic behavior of

caveolin- 3 mutations that cause autosomal dominant limb girdle muscular

dystrohpy (LGMD-1C). J Biol Chem. 1999; 274:25632-25641.

Galbiati F, Engleman JA, Volonte D, Zhang XL, Minetti C, Li M, Hou, Jr. H, Kneitz B,

Edelmann W, Lisanti MP. Caveolin – 3 null mice show a loss of caveolae,

changes in the microdomain distribution of the dystrophin - glycoprotein

complex, and t- tubule abnormalities. J Biol Chem. 2001; 276:21425-21433.

Gautel M, Lakey A, Barlow DP, Holmes Z, Scales S, Leonard K, Labeit S, Mygland A,

Gilhus NE, Aarli JA. Titin antibodies in myasthenia gravis: identification of a

major immunogenic region of titin. Neurology. 1993; 43(8):1581-5.

114

Gerull B, Gramlich M, Atherton J, McNabb M, Trombitas K, Sasse-Klaassen S,

Seidman JG, Seidman C, Granzier H, Labeit S, Frenneaux M, Thierfelder L.

(2002) Mutations of TTN, encoding the giant muscle filament titin, cause

familial dilated cardiomyopathy. Nat Genet. 2002; 30(2):201-204.

Grabner M, Dirksen RT, Beam KG. Skeletal dihydropyridine receptor Ca2+

channel

activity is enhanced by the ryanodine receptor via the channel’s II-III loop.

Biophys J. 1998; 74(2 Pt 2):A165.

Granzier, HL, Wu Y, Trombitas K, Wit TC, Labeit S, Bell S, LeWinter M. Variable

titin-based stiffness adjustment in heart disease. Circulation 2003; 108(4): e23.

Greaser ML, Berri M, Warren CM, Mozdziak PE. Species variations in cDNA

sequence and exon splicing patterns in the extensible I-band region of cardiac

titin: relation to passive tension. J Muscle Res Cell Motil. 2002; 23(5-6): 473-

482.

Guharay F, Sachs F. Stretch activated single ion channel currents in tissue-cultured

embryonic chick skeletal muscle. J Physiol. 1984; 352(1):685-701.

Gutierrez-Cruz G, Van Heerden AH, Wang K. Modular motif, structural folds and

affinity profiles of PEVK segment of human fetal skeletal muscle titin. J Biol

Chem. 2001; 276(10):7442-7449.

Hackman P, Vihola A, Haravuori H, Marchand S, Sarparanta J, De Seze J, Labeit,

S,Witt C, Peltonen L, Richard I, Udd B. Tibial muscular dystrophy is a

titinopathy caused by mutations in TTN, the gene encoding the giant skeletal-

muscle protein titin. Am J Hum Genet. 2002; 71(3):492-500.

115

Hamill, OP, McBride Jr. Don W. Mechanoreceptive Membrane Channels. Am Sci.

1995; 83:30-37.

Harris BN, Li H, Terry M, Ferrari MB. "Calcium Transients regulate Titin Organization

during Myofibrillogenesis" Cell Motil Cytoskeleton. 2005; 60:129-139.

Hein S, Schaper J. Weakness of a giant: mutations of the sarcomeric protein titin.

Trends Mol Med. 2002; 8(7):311-3.

Herrmann R, Straub V, Blank M, Kutzick C, Franke N, Jacob EN, Lenard HG, Kroger

S, Voit T. (2000) Dissociation of the dystroglycan complex in caveolin-3-

deficient limb girdle muscular dystrophy. Hum Mol Genet. 2000; 9(15):2335-

2340.

Hoffman EP, Knudson CM, Campbell KP, Kunkel LM, Nature. 1987; 330(6150):754-

758.

Jusic A. Hereditary increased muscle mechanical irritability and progressive

contracture with stretch-induced electromyographic activity. Muscle Nerve.

1989; 12(2):103-107.

Kimball JW. Introduction to Immunology. 3rd

ed. New York: Macmillan; 1990.

Kolmerer B, Olivieri N, Witt CC, Herrmann BG, Labeit S. Genomic organization of M

line titin and its tissue-specific expression in two distinct isoforms. J Mol Biol.

1996; 256(3):556-563.

Koul RL, Chand RP, Chacko A, Ali M, Brown KM, Bushnarmuth SR, Escolar DM,

Stephan DA. Severe autosomal recessive rippling muscle disease. Muscle

Nerve. 2001; 24(11):1542-1547.

116

Knudson CM. Evidence for the association of dystrophin with the transverse tubular

system in skeletal muscle. J Biol Chem. 1988; 263(17):8480-8484.

Kravitz L. Web page. [Internet]. Albuquerque (NM): University of New Mexico; [date

unknown]. One screen from listing of media pages. Available from:

http://www.unm.edu/~lkravitz/MEDIA2/Sarcomere.jpg.

Kruger M; Linke WA. The giant protein titin: a regulatory node that integrates myocyte

signaling pathways” J Biol Chem. 2001; 276(13):9905-9912.

Kubisch C, Schoser BG, von During M, Betz RC, Goebel HH, Zahn S, Ehrbrecht A,

Aasly J, Schroers A, Popovic N, et al. Homozygous mutations in caveolin-3 cause

a severe form of rippling muscle disease. Ann Neurol. 2003;53(4):512–520.

Labeit S, Kolmerer B. The complete primary structure of human nebulin and its

correlation to muscle structure. J Mol Biol. 1995; 248(2):308-315.

Labeit, S, Kolmerer, B, Linke, WA. The giant protein titin. Emerging roles in physiology

and pathophysiology. Circ Res, 1997; 80(2):290-294.

Laitinen PJ, Brown KM, Piippo K, Swan H, Devaney JM, Brahmbhatt B, Donarum EA,

Marino M, Tiso N, Viitasalo M, Toivonen L, Stephan DA, Kontula K.

Mutations of the cardiac ryanodine receptor (RyR2) gene in familial

polymorphic ventricular tachycardia. Circulation 2001; 103(4):485-490.

Lamb GD. Excitation-contraction coupling in skeletal muscle: comparisons with

cardiac muscle. Clin Exp Pharmacol Physiol. 2000; 27(3):216-224.

Lamb GD. Rippling Muscle Disease may be caused by “silent” action potentials in the

tubular system of skeletal muscle fibers. Muscle Nerve 2005; 31(5):652-658.

117

Lennon VA, Kryzer TJ, Griesman GE, O’Suilleabhain PE, Windebank AJ, Woppmann

A, Miljanich GP, Lambert EH. (1995) Calcium channel antibodies in the

Lambert-Eaton myasthenic syndrome and other paraneoplastic disorders. N

Engl J Med. 1995; 332(22):1467-1471.

Ma JA, Chapman GV, Chen SL, Penny R, Breit SN. Flow cytometry with crystal violet

to detect intracytoplasmic fluorescence in viable human lymphocytes:

Demonstration of antibody entering living cells. J Immunol Methods. 1987;

104(1-2): 95-200.

Machado C, Sunkel CE, Andrew DJ. Human autoantibodies reveal titin as a

chromosomal protein. J Cell Biol. 1998; 141(2):321-333.

Marty I, Robert M, Villaz M. Biochemical evidence for a complex involving

dihydropyridine receptor and ryanodine receptor in triad junctions of skeletal

muscle. Proc Natl Acad Sci. 1994; 91(6):2270-2274.

Maruyama K, Murakami F, Ohashi K. Connectin, an elastic protein of muscle. J

Biochem. 1977; 82(2):339-45.

Maruyama K. beta-Actinin, Cap Z, connectin and titin: what’s in a name? Trends

Biochem Sci. 2002; 27(5):264-266.

Marx S, Ondrias K, Marks A. Coupled gating between individual skeletal muscle Ca2+

release channels (ryanodine receptors). Science. 1998; 281(5378):818-822.

Mayans O, van der Ven PFM, Wilm M, Mues A, Young P, Furst, DO, Wilmanns M,

Gautel M. (1998). Structural basis for activation of the titin kinase domain

during myofibrillogenesis. Nature. 1998; 395(6705):863-869.

118

McCann SM. 2011. Domain specific over-expression of a peptide encoded by an I-band

domain of the human TTN gene; the role of titin exons 248 – 250 in C2C12

myogenesis [master’s thesis]. Youngstown, Ohio: Youngstown State

University. Available from: Maag Library; Thesis no. 1302.

Minetti C, Sotgia F, Bruno C, Scartezzini P, Broda P, Bado M, Masetti E, Mazzocco M,

Egeo A, Donati MA, Volonte D, Galbiati F, Cordone G, Bricarelli FD, Lisanti

MP, Zara F. Mutations in the caveolin-3 gene cause autosomal dominant limb-

girdle muscular dystrophy. Nat Genet/ 1998; (18):365-368.

Minetti C, Baldo M, Broda P, Sotia F, Bruno C, Galbiati F, Volonte D, Lucania G,

Pavan A, Bonilla E, Lisanti MP, Cordone G. Impairment of caveolae formation

and T- system disorganization in human muscular dystrophy with caveolin- 3

deficiency. Am J Pathol. 2002; 160(1):265-270.

Mouton J, Ronjat M, Jona I, Villaz M, Feltz A, Maulet Y. Skeletal and cardiac

ryanodine receptors bind to the calcium sensor region of dihydropyridine

receptor alpha 1 c subunit. FEBS Lett. 2001; 505(3):441-444

Muhle-Goll C, Habeck M, Cazorla O, Nilges M, Labeit S, Granzier H. Structural and

functional studies of titin’s fn3 modules reveal conserved surface patterns and

binding to myosin S1--a possible role in the Frank-Starling mechanism of the

heart. J Mol Biol. 2001; 313(2):431-47.

Muller-Felber W, Ansevin, CF, Ricker K, Muller-Jenssen A, Topfer M, Goebel HH,

Pongratz DE. Immunosuppressive treatment of rippling muscles in patients with

myasthenia gravis. Neuromuscul Disord. 1999; 9(8):604-607.

119

Mygland A, Aarli JA, Hofstad H, Gilhus NE. Heart muscle antibodies in myasthenia

gravis. Autoimmunity 1991; 10(4):263-7.

Mygland A. Ryanodine Receptor autoantibodies in myasthenia gravis patients with a

thymoma. Ann Neurol. 1992; 32(4):589-591.

Mygland A, Aarli JA, Matre R, Gilhus NE. Ryanodine receptor antibodies related to

severity of thymoma associated myasthenia gravis. J Neurol Neurosurg

Psychiatry. 1994; 57(7):527-531.

Mygland A, Vincent A, Newsome-Davis J, Kaminski H, Zorzato F, Agius M, Gilhus N,

Aarli JA. Autoantibodies in thymoma associated myasthenia gravis with

myosistis or neuromyotonia. Arch Neurol. 2000; 57(4):527-531.

Nakai J, Dirksen R, Nguyen H, Pessah I, Beam K, Allen P. Enhanced dihydropyridine

receptor channel activity in the presence of ryanodine receptor. Nature. 1996;

380(6569):72-75.

Nocella M, Colombini B, Bagni MA, Bruton J; Cecchi G. (2012). Non-crossbridge

calcium dependent stiffness in slow and fast skeletal muscle fibres from mouse

muscle. J Muscle Res Cell Motil. 2012; 32(6):403-409.

Ohlendieck K, Matsumura K, Ionasescu VV, Towbin JA, Bosch EP, Weinstein SL,

Sernett SW, Campbell KP. Duchenne muscular dystrophy: deficiency of

dystrophin-associated proteins in the sarcolemma. Neurology. 1993; 43(4):795-

800.

120

Ohta M, Ohat K, Itoh N, Kurobe M, Hayashi K, Nishitani H. Anti-skeletal muscle

antibodies in the sera from myasthenic patients with thymoma: identification of

Anti-myosin, Actomyosin, Actin, alpha-actin antibodies by solid-phase

radioimmunoassay and Western Blot analysis. Clin Chim Acta. 1990;

187(3):255-264.

Pagala MKD, Nandakumar NV, Venkatachari SAT, Ravindran K, Namba T, Grob D.

Responses of intercostals muscle biopsies from Normal subjects and patients

with myasthenia gravis. Muscle Nerve. 1990; 13(11):1012-1022.

Parton RG, Way M, Zorzi N, Stang E. Caveolin – 3 associates with developing T-

tubules during muscle differentiation. J Cell Biol. 1997; 136(1):137-154.

QIAGEN® Plasmid Purification Handbook. [place unknown]: ; January 1997Protocol:

Plasmid or Cosmid DNA Purification Using QIAGEN Plasmid Mini and Maxi

Kits. January 1997; 14-17.

QIAprep® Miniprep handbook. Protocol: Plasmid DNA Purification Using the

QIAprep Spin Miniprep Kit and a Microcentrifuge. December 2006; 22-23.

Ricker K, Moxley RT, Rohkamm R. Rippling Muscle Disease. Arch Neurol. 1989;

46(4):405-408.

Rief M, Gautel M, Oesterhelt F, Fernandez JM, Gaub HE. Reversible unfolding of

individual titin immunoglobulin domains by AFM. Science. 1997;

276(5315):1109- 1112.

121

Satoh, M., Takahashi M, Sakamoto T, Hiroe M, Marumo F, Kimura A. Structural

analysis of the titin gene in hypertrophic cardiomyopathy: identification of a

novel disease gene. Biochem Biophys Res Commun. 1999; 262(2):411-7.

Scott KA, Steward A, Fowler SB, Clarke J. Titin; a multidomain protein that behaves

as the sum of its parts. J Mol Biol. 2002; 315(4):819-29.

Skeie GO, Bartoccioni E, Evoli A, Aarli JA, Gilhus NE. Ryanodine receptor antibodies

are associated with severe myasthenia gravis. Eur J Neurol. 1996; 3(2):136-140.

Skeie GO. Skeletal muscle titin: physiology and pathophysiology. Cell Mol Life Sci.

2000; 57(11):1570-1576.

Skeie GO, Lunde PK, Sejersted OM, Mygland A, Aarli JA, Gilhus NE. Autoimmunity

against the ryanodine receptor in myasthenia gravis. Acta Physiol Scand. 2001;

171(3):379-84.

So YT, Zu L, Barraza C, Figueroa KP, Pulst SM. Rippling muscle disease: evidence for

phenotypic and genetic heterogeneity. Muscle Nerve. 2001; 24(3):340-344.

Sokabe M, Hasegawa N, Yamamori K. Blockers and Activators for Stretch-Activated

Ion Channels of Chick Skeletal Muscle. Ann N Y Acad Sci. 1993; 707:417-420.

Sotgia F, Minetti C, Lisanti MP. Localization of the human caveolin-3 gene to the

D3S18/D3S4163/D3S4539 locus (3p25), in close proximity to the human

oxytocin receptor gene, Identification of the caveolin-3 gene as a candidate for

deletion in 3p-syndrome. FEBS Lett. 1999; 452(2):177-180.

122

Sotgia F, Lee JK, Das K, Bedford M, Petrucci TC, Macioce P, Sargiacomo M,

Bricarelli FD, Minetti C, Sudol M, Lisanti M.P. Caveolin-3 directly interacts

with the C-terminal tail of beta-dystroglycan. J Biol Chem. 2000;

275(48):38048-38058

Stamler JS, Meissner G. Physiology of nitric oxide in skeletal muscle. Physiol Rev.

2001; 81(1):209-231.

Stephan DA. A rippling muscle disease gene is localized to 1q41: evidence for multiple

genes. Neurology. 1994; 44(10):1915-1920.

Stephan DA, Hoffman EP. physical mapping of the rippling muscle disease locus.

Genomics. 1994; 55(3):268-274.

Takamori M, Komai K, Iwasa K. Antibodies to calcium channel and synaptotagmin in

Lambert-Eaton myasthenic syndrome. Am J Med Sci. 2000; 319(4):204-208.

Tanabe T, Beam K, Brett A, Niidome T, Numa S. Regions of the skeletal muscle

dihydropyridine receptor critical for excitation-contraction coupling. Nature.

1990; 346(6284):567-569.

Tatsumi R, Maeda K, Hattori A, Takahashi K. Calcium binding to an elastic portion of

connectin/titin filaments. J Muscle Res Cell Motil. 2001; 22(2):149-62.

Tiso N, Stephan DA, Nava A, Bagattin A, Devaney JM, Stanchi F, Larderet G,

Brahmbhatt B, Brown K, Bauce B, Muriago M, Basso C, Thiene G, Danieli

GA, Rampazzo A. Identification of mutations in the cardiac ryanodine receptor

gene in families affected with arrhythmogenic right ventricular cardiomyopathy

type 2 (ARVD2). Hum Mole Genet. 2001; 10(3):189-94.

123

Tortora GJ, Grabowski SR. Principles of anatomy and physiology. New York: Harper

Collins College Publishers; 1993. p. 241-250.

Torbergsen T. A family with dominant hereditary myotonia, muscular hypertrophy and

increased muscular irritability, distinct from myotonia congenital. Acta

Neurology Scand. 1975; 51(3):225-232.

Torbergsen T. Rippling muscle disease: a review. Muscle Nerve Suppl. 2002; (Supp

11):S103-107.

Trinick J. Understanding the functions of titin and nebulin. FEBS Lett. 1992; 307(1):44-

48.

Trinick J, Tskhovrebova L. Titin: a molecular control freak. Trends Cell Biol. 1999;

9(10):377-80.

Trombitas K, Greaser M, Labeit S. Titin extensibility in situ: entropic elasticity of

permanently folded and permanently unfolded molecular segments. J Cell Biol.

1998; 140(4):853-859.

Udd B, Haravuori H, Kalimo H, Partanen J, Pulkkinen L, Paetau A, Peltonen L, Somer

H. Tibial muscular dystrophy--from clinical description to linkage on

chromosome 2q31. Neuromuscul Disord. 1998; 8(5):327-32.

Vernino S, Auger RG, Emslie-Smith AM, Harper CM, Lennon VA. Myasthenia,

thymoma, presynaptic antibodies, and a continuum of neuromuscular

hyperexcitability. Neurology. 1999; 53(6):1233-1239.

124

Vincent A, Bowen J, Newsom-Davis J, McConville J. Seronegative generalised

myasthenia gravis: clinical features, antibodies, and their targets. Lancet Neurol.

2003; 2(2):99-106.

Vorgerd M, Bolz H, Patzold T, Kubisch C, Malin JP, Mortier W. Phenotypic variability

in rippling muscle disease. Neurology. 1999; 54(1):273-4.

Vorgerd M, Ricker K, Ziemssen F, Kress W, Goebel HH, Nix WA, Kubisch C, Schoser

BGH, Mortier W. A sporadic case of rippling muscle disease caused by a de

novo caveolin-3 mutation. Neurology. 2001; 57(12):2273-2277.

Walker GR, Watkins T, Ansevin CF. Identification of autoantibodies associated with

rippling muscles and myasthenia gravis that recognize skeletal muscle proteins:

Possible relationship of antigens and stretch-activated ion channels. Biochem

Biophys Res Comm. 1999; 264(2):430-435

Wang K, McClure J, Tu A. Titin: major myofibrillar components of striated muscle.

Proc Natl Acad Sci U S A. 1979; 76(8):3698-702.

Wang SM, Greaser ML. Immunocytochemical studies using a monoclonal antibody to

bovine cardiac titin on intact and extracted myofibrils. J Muscle Res Cell Motil.

1985; 6(3):293-312.

Watkins TC. Characterization of skeletal muscle antibodies in patients with

autoimmune rippling muscles and myasthenia gravis [master’s thesis].

[Youngstown, (OH)]: Youngstown State University; 1998. 79 p. Available

from: Maag Library, Thesis no.626.

125

Watkins, TC. The application of biochemical and genomic techniques to identify

autoimmune rippling muscle disease antigens [dissertation]. [Kent, (OH)]: Kent

State University; 2004. 140 p. Available from: Kent State University, Special

Collections.

Watkins TC, Zelinka L, Kesic M, Ansevin CF, Walker GR. Identification of skeletal

muscle autoantigens by expression library screening using sera from

autoimmune rippling muscle disease (ARMD) patients. J Cell Biochem. 2006;

99(1):79-87.

Williams C, Lennon V. Thymic B lymphocyte clones from patients with myasthenia

gravis secrete monoclonal striational autoantibodies reacting with myosin,

alpha-actinin, or actin. J Exp Med. 1986; 164(4):1043-1059.

Woodman SE, Sotia F, Galbiati F, Minetti C, Lisanti MP. Caveolinopathies: mutations

in caveolin – 3 cause four distinct autosomal dominant muscle diseases.

Neurology. 2004; 62(4):538- 543.

Yamasaki R, Berri M, Wu Y, Trombitas K, McNabb M, Kellermayer MS, Witt C,

Labeit D., Labeit S, Greaser M, Granzier H. Titin-actin interaction in mouse

myocardium: passive tension modulation and its regulation by calcium/S100A1.

Biophys J. 2001; 81(4):2297-2313.

Young P, Ehler E, Gautel M. Obscurin, a giant sarcomeric Rho guanine nucleotide

exchange factor protein involved in sarcomere assembly. J Cell Biol. 2001;

154(1):123-36.

126

Zelinka LM. The immunofluorescent localization of antigens associated with

autoimmune rippling muscles [master’s thesis]. [Youngstown, (OH)]:

Youngstown State University; 2002. 67 p. Available from: Maag Library,

Thesis no.759.

Zelinka L, McCann S, Budde J, Sethi S, Guidos M, Giles R, Walker GR.

Characterization of the in vitro expressed autoimmune rippling muscle disease

immunogenic domain of human titin encoded by TTN exons 248-250. Biochem

Biophys Res Commun. 2011; 411(3) 501-505.

APPENDICES

128

Appendix A: List of Abbreviations and Acronyms

Abbreviation Term Abbreviation Term

Ach

Acetylcholine MUAP Motor Unit Action Potential

AChR

Acetylcholine receptor MW Molecular Weight

ARMD Acquired Rippling Muscle

Disease MuSK

Muscle Specific Kinase

BLAST Basic Local Alignment Search

Tool MSC Mechanosensitive Channel

CAV3 Caveolin-3 NCBI National Center for

Biotechnology Information

CFA Carl F. Ansevin M.D. NO Nitric Oxide

DCM Dilated Cardiomyopathy nNOS Nitric Oxide Synthase

DHPR Dihydropyridine Receptor ORF Open Reading Frame

DMD Duchenne Muscular Dystrophy PCR Polymerase Chain Reaction

EAMG Experimental Autoimmune

Myasthenia Gravis PPP1R# Phosphoprotein Phosphatase 1

Regulatory subunit

E-C Excitation-Contraction pRMMG-# Plasmid isolated from

RM/MG patient 1 and # of

plasmid (nomenclature

system)

ES Epitope Spread PVDF Polyvinylidene Fluoride

E-value Expectation value RIPA Radio-immunoprecipitation

FASTA Fast Alignment Search Tools

Anything RM Rippling Muscles

FHC Familial Hypertrophic

Cardiomyopathy RMD Rippling Muscle Disease

FN3 Fibronectin three domain RyR Ryanodine Receptor

HCM Hypertrophic Cardiomyopathy SAC Stretch Activated Channel

HRP Horse Radish Peroxidase SDS-PAGE Sodium Dodecyl Sulfate

Polyacrylamide Gel

Electrophoresis

Ig Immunoglobulin (subtype) SR Sarcoplasmic Reticulum

IPTG Isopropyl - -D-

thiogalactopyranoside TBS Tris Buffered Saline

kDa Kilodalton VAGE Vertical Agarose Gel

Electrophoresis

LEMS Lambert Eaton Myasthenic

Syndrome VGCC Voltage Gated Calcium

Channels

LGMD Limb Girdle Muscular

Dystrophy TnC, TnI or

TnT

troponins I, T and C

MG Myasthenia Gravis Transverse

Tubular

System

T-tubule

MG/T Myasthenia Gravis/Thymoma YSU Youngstown State University

MIR Main Immunogenic Region Xg Times Gravity

(centrifugation)

MUAP Motor Unit Action Potential

129

Appendix B: List of solutions and reagents

Reagent Purpose Contents/Details

SDS-PAGE

7.5% Acrylamide

gel

Separation of

proteins: resolving

gel (larger peptides)

1.6g glycerol, 6.0 mL running gel buffer, 10mL

ddH2O, 6.0 mL 30% acrylamide gel stock, 80μL

10% ammonium persulfate, 24 μL TEMED (makes

5 minislab gels)

10% Acrylamide

gel

Separation of

proteins: resolving

gel (smaller

peptides)

1.6g glycerol, 6.0 mL running gel buffer, ddH2O,

8.0 mL 30% acrylamide gel stock, 80μL 10%

ammonium persulfate, 24 μL TEMED (makes 5

minislab gels)

5% Acrylamide

stacking gel

Stacking of proteins

entering

4.5 mL stacking gel buffer, 10.5 mL ddH2O, 3,0 mL

30% acrylamide gel stock, 60μL 10% ammonium

persulfate, 23 μL TEMED (makes 5 minislab gels)

Electrode buffer pH buffer for SDS-

PAGE

6.05g tris, 28.84g glycine, 2.00g SDS, ddH2O to

2000mL

Resolving gel

buffer

pH buffer for

resolving gel

18.17g tris, 8.20 mL 3M HCl, 0.4g SDS, ddH2O to

100mL

Stacking gel

buffer

pH buffer for

stacking gel

6.05g tris, 29.1mL 2M HCl, 0.4g SDS, ddH2O to

100mL, titrated to pH 6.8

SDS-sample

buffer (1x):

Solubilize protein

for SDS-PAGE

12.5% glycerol, 50 mM TRIS (pH 6.8), 5% 2-

mercaptoethanol and 2.3% SDS

SDS sample

buffer (4x)

Solubilize protein

for SDS-PAGE

50% glycerol, 200 mM TRIS (pH 6.8), 20% 2-

mercaptoethanol and 9.2% SDS

130

Reagent Purpose Contents/Details

Immunoblot

anti-titin

(1 antibody)

Antibody to titin Commercially available from Sigma, Inc.

Goat anti-human IgG

(Fc region specific)

(2antibody)

Antibody labeled

with HRP for

detection of

human

immunoglobulin

Commercially available from Sigma, Inc.

Chemiluminiscent

substrate

(Luminol)

Detection of

HRP labeled

immuno-

globulin(2

antibody)

Commercially available from Pierce, Inc

Colorimetric substrate Detection of

HRP labeled

immunoglobulin

Commercially available from Sigma, Inc.

PVDF membrane Binds proteins

transfered by

electroblot

Commercially available from Bio-Rad, Inc.

Low pH buffer

(Olmsted)

Decrease pH of

solution 0.2 M Glycine, 1 mM EGTA, pH 2.3-2.7

Transfer buffer Transfer of

proteins onto

PVDF 57.6g glycine, 12.1g tris, 800mL methanol, 3200

mL ddH2O

Tris buffered Saline

TBS

Buffer /pH

20mM tris, 0.5 M NaCl, titrate to pH 7.5 with

HCl

Tris buffered Saline w/

Tween-20

TBS-T

Buffer /pH

20mM tris, 0.5 M NaCl, titrate to pH 7.5 with

HCl with 0.2% Tween-20

Western (immuno)

blot

Blocking buffer (5%)

Membrane

blocking 5% powdered milk in TBS-T

Western (immuno)

blot

Blocking buffer (3%)

Membrane

blocking 3% powdered milk in TBS-T

Western (immuno)

blot Blocking buffer

(1%):

Membrane

blocking with

antibody 1% powdered milk in TBS-T

BioMax Autoradiography

film Commercially available from Kodak, Inc.

Used with Kodak, Inc. GBX processing chemicals

and procedures

131

Reagent Purpose Contents/Details

Growth Media

LB broth

LB Amp broth

Growth media

Selective growth

media

Broth: 10g NaCl, 10g tryptone, 5g yeast extract,

add ddH2O to 1L, pH 7.0 with NaOH, autoclaved

Add 1 mL Ampicillin stock to cool media

LB agar

LB Amp agar

*1000X amp

Growth media

for pBluescript

and pGEX and

TOPO

Selective media

Broth: 10g NaCl, 10g tryptone, 5g yeast extract,

add ddH2O to 1L, pH 7.0 with NaOH autoclaved

Agar: add an additional 20g agar

Add 1 mL Ampicillin stock to media

*5 grams amp dissolved in 100 mL DI water

Biologicals (Included in the Stratagene, Inc. Lambda Zap II library)

pBluescript Bacteria phage

containing

cDNA insert and

unique

restriction sites

Stratagene

132

Reagent Purpose Contents/Details

cDNA Manipulation

Agarose gel DNA electrophoresis 1% electrophoresis grade agarose in TAE

DCTS-Quick

Start

PCR kit for

sequencing

Beckman-Coulter commercial kit for amplifying

DNA for automated sequencing

EcoRI Restriction enzyme Commercially available from Sigma, Inc. for

cleaving cDNA insert from pBluescript (40

units/μL)

H-buffer Restriction

edonuclease digestion

buffer

Commercially available from Sigma, Inc

IPTG Promotes translation

of insert cDNA

Isopropyl - -D- thiogalactopyranoside a

fine chemical commercially available from Sigma,

Inc.

Plasmid mini-

prep kit

Separation of plasmid

DNA from genomic

E.Coli DNA

Kit commercially available from Eppendorf

Primer M13 PCR primer Primer sequence:

5´ GTAAAACGACGGCCAGT 3 ´

Reverse primer PCR primer Primer sequence:

5´ GGAAACAGCTATGACCATG 3´

Stop buffer(10x

loading buffer)

Stops restriction

digest and prepares

DNA for

electrophoresis

20 mL Ficoll 400, 1g SDS, 3.72g Na EDTA

dihydrate pH 8.0, 0.25g bromphenol blue

TAE Agarose gel

electrophoresis

running gel buffer

242g tris, 57.1 mL glacial acetic acid, 37.2g Na

EDTA dihydrate, ddH2O to 1L, titrated to pH 8.5

(makes 50X)

pGEX Reverse

primer

PCR primer Primer sequence: Reverse

5´ CCGGGAGCTGCATGTGTCAGAGG 3 ´

pGEX Forward

primer

PCR primer Primer sequence: Forward

5´ GGGCTGGCAAGCCACGTTTGGTG 3´

133

Appendix C: Muscle Protein Reference Table

134

135

Appendix D Miscellaneous Solutions

10X Running Buffer (TGS Buffer) (1 L)

30g Tris

144g Glycine

10 g SDS

Deionized water

Tris, Glycine, and SDS were dissolved in deionized water. The pH was titrated

to 8.3 and the final volume was adjusted to 1L with deionized water. The

running buffer was diluted to 1x before use and stored at room temperature.

2% Agarose gel

100 ml 1x TAE Buffer

2 g Agarose I

Agarose I was dissolved in 1x TAE buffer and microwaved on high for 1 – 2

minutes. When liquid cooled slightly it was poured into an electrophoresis gel

tray, a comb was inserted, and was allowed to solidify.

1% Agarose gel

100 ml 1x TAE Buffer

1 g Agarose I

Agarose I was dissolved in 1x TAE buffer and microwaved on high for 1 – 2

minutes. When liquid cooled slightly it was poured into an electrophoresis gel

tray, a comb was inserted, and was allowed to solidify.

10x Tris Buffered Saline (10x TBS Buffer) (1 L)

24.22 g Tris

87.66 g NaCl

800 ml Deionized water

Tris and NaCl were dissolved in 800 ml deionized water. The solution was

titrated to pH to 7.3 and then diluted to 1 L with deionized water. Buffer was

diluted to 1x prior to use and stored at room temperature.

136

10 mM Phosphate Buffered Solution (PBS) (pH 7.4 with TWEEN20)

0.26 g Potassium Phosphate Monobasic Crystal (KH2PO4)

2.17 g Sodium Phosphate Dibasic Anhydrous (Na2HPO4·7H2O)

8.71 g NaCl

Deionized water

0.5 ml TWEEN20

KH2PO4, Na2HPO4·7H2O, and NaCl were dissolved in 800 ml deionized water.

The solution was titrated to pH 7.4 and adjusted to a total volume of 1 L. 0.5 ml

TWEEN20 was added and stored at room temperature.

10% Ammonium Persulfate

1.0 g Ammonium persulfate

10 ml Deionized water

Ammonium persulfate was dissolved in 10 ml deionized water and stored at 4

°C.

Low De-stain Solution

100 ml Glacial Acetic Acid

150 ml Methanol

750 ml Deionized water

Glacial acetic acid, methanol and deionized water were combined and stored at

room temperature.

High De-stain Solution

100 ml Glacial Acetic Acid

400 ml Methanol

500 ml Deionized water

Glacial acetic acid, methanol and deionized water were combined and stored at

room temperature.

Coomassie Stain

2.5 g Coomassie Brilliant Blue R-250

100 ml Glacial Acetic Acid

450 Methanol

450 ml Deionized water

High Destain / Sypro Fixing Solution 100 ml glacial

Combined and stirred overnight and stored room temperature.

137

Elution Buffer

0.461 g Glutathione

0.788 g Tris-HCl

Dissolve in 90 mL DI water pH 9.0 then bring solution to 100 mL final volume.

Strong Elution Buffer

0.641 g Glutathione

1.576 g Tris-HCl

0.701 g NaCl

Dissolve in 90 mL DI water pH 8.0 then bring solution to 100 mL final volume.

Equilibration Buffer

10 mM PBS-T pH 7.4

150 mM NaCl

Cleansing Buffer 1

M borate buffer pH 8.5

0.5 M NaCl

Adjust pH with NaOH

Cleansing Buffer 2

M Acetate Buffer pH 4.5

0.5 NaCl

Adjust pH with acetic acid

Storage Buffer

Use 2 M NaCl

mM sodium azid

138

Appendix E Vertical Agarose Titin Gel Electrophoresis

Sample buffer - this mixture must be stirred sufficiently for a long time on the stir

plate

Urea 48.05 g

Thiourea 15.22 g

SDS 3.00 g

Bromophenol blue 0.03 g

Tris 0.6055 g

Dissolve in diH2O

Titrate with concentrated (12 M) HCl until pH 6.8________________________

Final volume 100 mL

2M Tris·Cl for polyacrylamide plug (In the 4°C fridge, labeled)

Tris 24.20 g

Dissolve in diH2O about 90 mL

Titrate with concentrated (12M) HCl until pH 9.3________________________

Final Volume 100 mL

5x Resolving Gel Buffer (In the 4°C fridge, labeled; also can dilute 10x TGS buffer

accordingly)

Tris 3.0275 g

Glycine 14.40 g

SDS 0.50 g

Dissolve in diH2O_________________________________________________

Final Volume 100 mL

Electrode buffer

Tris 12.10 g

Glycine 28.84 g

SDS 2.00 g

Dissolve in diH2O_________________________________________________

Final volume 2000 mL

0.04% Coomassie Stain

Coomassie 0.40 g

Methanol 500 mL

Glacial acetic acid 100 mL

diH2O ________

Final volume 1000 mL

139

Appendix F: Vertical Agarose Titin Gel Electrophoresis Gel Casting

Gel Casting- makes 4 mini-gels (8 cm x 7.3 cm)

1. Assemble Bio-rad Mini-PROTEAN 3 gel casting frames and stands as directed

in the equipment manual.

2. Acrylamide Plug- must be ready to pour when APS and/or TEMED is added.

Make sure APS is still good

40% acrylamide solution 1.5 mL

Glycerol 0.5 mL

2M Tris·Cl for polyacrylamide plug 1.25 mL

diH2O 1.74 mL

10% ammonium persulfate (APS) 14 μL

TEMED 7.6 μL

Final volume 5 mL

3. Add about 900 μL of solution to the gel casting apparatus to create a plug about

1 cm high. Overlay with a layer of diH2O to form a flat interface. Allow to

polymerize for about an hour. While waiting, preheat oven to 65°C and prepare

solutions for agarose gel.

4. Weigh out 0.8 g of agarose powder and place in a 250 mL beaker.

5. In a graduated cylinder combine 12 mL glycerol with 8 mL of 5x resolving gel

buffer. Bring solution to 40 mL. Parafilm the top of the cylinder and invert to

mix.

6. After polyacrylamide plug has polymerized drain water using a paper towel or

Kimwipe if necessary to absorb water. Place entire gel casting apparatus in

65°C incubator with serological pipette and enough gel combs. Allow to be in

oven for 30 minutes.

7. Near the end of the 30 minutes combine liquid agarose solutions with agarose

powder in the 250 mL beaker. Cover with plastic wrap and vent cover. Weigh

beaker and take note. Place beaker in microwave with another beaker with

about 40 mL of water. Heat until agarose solution just begins to boil. Stop the

microwave and with an insulated glove swirl the mixture around. Repeat two or

three times. Weigh beaker again and replace any significant evaporation loss

with water from microwave.

140

8. Remove gel casting apparatus, pipette, and combs from the oven. Using a bulb,

draw solution into pipette and slowly pour between plates on the gel casting

apparatus to avoid bubbles. Place comb when mixture has reached a sufficient

level but not so early as to produce gaps. If combs cause mixture to overflow,

wipe up. Allow gels to cool at room temperature for 30 minutes. After that,

place gel casting apparatus in 4°C refrigerator for another 30 minutes. Store

gels with plates and comb in 4°C refrigerator with moistened paper towel in gel

box to avoid drying out.