downloaded from on march 12, 2020 by guest€¦ · 11/03/2013 · 119 searches against the...
TRANSCRIPT
1
Role of the Phenylalanine Hydroxylating System in Aromatic Substance 1
Degradation and Lipid Metabolism in the Oleaginous Fungus Mortierella 2
alpina 3
Running title: Phenylalanine Hydroxylating System in M. alpina 4
5
Hongchao Wanga,b, Haiqin Chenb＃, Guangfei Haoa,b, Bo Yanga,b, Yun Fengc, Yu Wanga,b, 6
Lu Fengc, Jianxin Zhaob, Yuanda Songb, Hao Zhangb, Yong Q. Chena,b, Lei Wangc, Wei 7
Chena,b＃ 8
9
State Key Laboratory of Food Science and Technology, Jiangnan University, Wuxi 10
214122, P.R. Chinaa 11
School of Food Science and Technology, Jiangnan University, Wuxi 214122, P.R. Chinab 12
TEDA School of Biological Sciences and Biotechnology, Nankai University, Tianjin 13
Economic-Technological Development Area, Tianjin 300457, P. R. Chinac 14
15
＃Corresponding authors: Haiqin Chen and Wei Chen 16
Mailing address: 1800 Lihu Ave, Wuxi, Jiangsu 214122, P.R. China. 17
Phone: 0086-510-85912155. Fax: 0086-510-85912155. 18
E-mail: [email protected]; [email protected] 19
20
Journal section: Genetics and molecular biology 21
Copyright © 2013, American Society for Microbiology. All Rights Reserved.Appl. Environ. Microbiol. doi:10.1128/AEM.00238-13 AEM Accepts, published online ahead of print on 15 March 2013
on October 11, 2020 by guest
http://aem.asm
.org/D
ownloaded from
2
Abstract 22
Mortierella alpina is a filamentous fungus commonly found in soil, which is able to 23
produce lipids in the form of triacylglycerols that account for up to 50% of its dry weight. 24
Analysis of the M. alpina genome suggests that there is a phenylalanine hydroxylating 25
system for the catabolism of phenylalanine, which has never been found in fungi before. 26
We characterized the phenylalanine hydroxylating system in M. alpina to explore its role 27
in phenylalanine metabolism and its relationship to lipid biosynthesis. Significant 28
changes were found in the profile of fatty acids in M. alpina grown on medium 29
containing an inhibitor of the phenylalanine hydroxylating system compared to M. alpina 30
grown on medium without inhibitor. Genes encoding enzymes involved in phenylalanine 31
hydroxylating system (phenylalanine hydroxylase, pterin-4α-carbinolamine dehydratase, 32
and dihydropteridine reductase) were expressed heterologously in Escherichia coli and 33
the resulting proteins were purified to homogeneity. Their enzymatic activity was 34
investigated by HPLC or VIS-UV spectroscopy. Two functional phenylalanine 35
hydroxylase (PAH) enzymes were observed, encoded by distinct gene copies. A novel 36
role for tetrahydrobiopterin in fungi as a cofactor for PAH is suggested, which is similar 37
to its function in higher life forms. This study establishes a novel fungal scheme for the 38
degradation of an aromatic substance (phenylalanine) and suggests that the phenylalanine 39
hydroxylating system is functionally significant in lipid metabolism. 40
Key words: M. alpina, phenylalanine hydroxylating system, phenylalanine degradation, 41
amino acid metabolism, lipid metabolism 42
on October 11, 2020 by guest
http://aem.asm
.org/D
ownloaded from
3
INTRODUCTION 43
The phenylalanine hydroxylating system catalyzes the irreversible hydroxylation 44
of phenylalanine to tyrosine, which is the rate-limiting step in animal phenylalanine 45
catabolism and protein and neurotransmitter biosynthesis, and results in the formation 46
of one molecule of fumarate and one of acetyl-CoA from each molecule of 47
phenylalanine (1, 2). The animal phenylalanine hydroxylating system consists of 48
several essential components: phenylalanine hydroxylase (PAH; EC1.14.16.1), 49
pterin-4α-carbinolamine dehydratase (PCD; EC4.2.1.96), dihydropteridine reductase 50
(DHPR; EC1.5.1.34), and the obligatory cofactors tetrahydrobiopterin (BH4) and 51
molecular oxygen (3, 4) (Fig. 1). PAH is one of the BH4-dependent aromatic amino 52
acid hydroxylases, which also include tryptophan hydroxylase (TrpOHase; 53
EC1.14.16.4) and tyrosine hydroxylase (TyrOHase; EC1.14.16.2) (5). BH4 is 54
regenerated following PAH-mediated phenylalanine hydroxylation by two additional 55
enzymes, PCD and DHPR (Fig. 1) (6). The PAH, PCD, and DHPR genes responsible 56
for the phenylalanine hydroxylating system in animals have already been 57
characterized (7, 8). 58
Phenylalanine is an important aromatic compound, one of the structurally diverse 59
and second most abundant class of organic substrates (9). The greatest challenge for 60
organisms using aromatic compounds as growth substrates is the stabilizing resonance 61
energy of the aromatic ring system (10). This aromatic structure makes the substrate 62
unreactive to oxidation or reduction, and thus requires elaborate degradation strategies 63
(9). The degradation of aromatic substances is dominated by aerobic and anaerobic 64
on October 11, 2020 by guest
http://aem.asm
.org/D
ownloaded from
4
bacteria and aerobic fungi, and the strategies used by these organisms are quite 65
different from those of animals (10). Unlike higher organisms, most bacteria, fungi, 66
and plants do not convert phenylalanine into tyrosine. The presence of PAH has only 67
been reported in a few bacteria based on the identification of related genes (11-14). In 68
fungi Aspergillus nidulans and Aspergillus fumigatus, tyrosine was thought to be be 69
synthesized from phenylalanine by PAH (15, 16); however, no gene encoding PAH 70
was found in their genomes (Table S1). To date, no PAH, PCD, or DHPR involved in 71
the phenylalanine hydroxylating system has been identified in any fungi. 72
Phenylalanine is converted into phenylacetate in Penicillium chrysogenum, 73
Aspergillus nidulans, and Aspergillus niger (Fig. 2A), or into cinnamic acid in 74
Bjerkandera adusta and Schizophyllum commune (Fig. 2C) (17-20). The cinnamate 75
thus formed is converted to protocatechuate through benzoate, whereas 76
phenylpyruvate is converted to homogentisate, which is catabolized by cleavage of 77
the aromatic ring to yield fumarate and acetyl-CoA. Recently, we sequenced the 78
whole genome of M. alpina (ATCC 32222) (21), and our analysis suggested that there 79
are two putative copies of BH4-dependent PAH gene for the catabolism of 80
phenylalanine in M. alpina. Genes encoding PCD and DHPR, which are required for 81
the regeneration of BH4, an essential component of the phenylalanine hydroxylating 82
system (6), were also found in the M. alpina genome. The BH4 de novo synthesis 83
pathway in M. alpina was first purified and characterized in our laboratory (22), but 84
the function of BH4 in fungi is still not well understood. The presence of the 85
phenylalanine hydroxylating system in M. alpina suggests that fungi can make use of 86
on October 11, 2020 by guest
http://aem.asm
.org/D
ownloaded from
5
this system in their phenylalanine degradation strategy. 87
Mortierella alpina is a well-known polyunsaturated fatty acid (PUFA) producing 88
oleaginous fungus commonly found in soil (23). Some of the genes necessary for lipid 89
synthesis in M. alpina have been cloned and partially characterized (24-28), and 90
several biochemical reactions have been studied in detail (29, 30). However, the 91
molecular mechanism of efficient lipid biosynthesis is still not well understood in 92
oleaginous fungi in general, and in M. alpina in particular. PAH and its cofactor BH4 93
have been suggested to be essential for lipid metabolism in higher organisms (31-36), 94
and some amino acid metabolism pathways have been postulated to be involved in 95
fatty acid biosynthesis in oleaginous fungi (37, 38). However, the functional 96
significance of the phenylalanine hydroxylating system in the biosynthesis of lipids 97
and closely related compounds has yet to be fully elucidated. In higher organisms, the 98
phenylalanine hydroxylating system is inhibited by p-chlorophenylalanine or esculin. 99
Both are complete and irreversible inhibitors of PAHs in vivo (39, 40). M. alpina is 100
noteworthy for its production of PUFA de novo, and due to its high lipid content (23) 101
provides an interesting model for studying the relationship between the phenylalanine 102
hydroxylating system and lipid metabolism. 103
In this study, we investigate the role of the phenylalanine hydroxylating system 104
in lipid metabolism, and probed its possible function in the degradation of aromatic 105
substances. We establish a novel role for BH4 in fungi, similar to that known to exist 106
in higher life forms. We characterized the genes encoding PAH, PCD, and DHPR and 107
their functions in the phenylalanine hydroxylating system in vitro. We identified two 108
on October 11, 2020 by guest
http://aem.asm
.org/D
ownloaded from
6
functional PAH genes (PAH-1 and PAH-2) and measured kinetic parameters and the 109
effects of temperature, pH and aromatic amino acids on PAHs activity. Multiple 110
sequence alignment and phylogenetic analysis of the PAH proteins with other 111
homologous proteins were also performed. 112
113
114
115
MATERIALS AND METHODS 116
Gene search. Predicted proteins in the M. alpina (ATCC 32222) genome 117
(GenBank accession number ADAG00000000) were annotated by BLAST (41) 118
searches against the following protein databases with the E-value 1E-5: NR 119
(www.ncbi.nlm.nih.gov), KOGs and COGs (42), KEGG(43), Swiss-Prot, and 120
UniRef100 (44), BRENDA (45), and by InterProScan (46) using the default parameter 121
settings. Pathway mapping was conducted by associating the EC assignment and KO 122
assignment with the KEGG metabolic pathways based on the BLAST search results. 123
The predicted PAH-1, PAH-2, PCD, and DHPR proteins in the M. alpina genome 124
were searched against predicted proteins of sequenced fungal genomes by BLAST 125
with the E-value 1E-5. 126
Strains and growth conditions. M. alpina (ATCC 32222) was cultured on 127
potato dextrose agar at 25ºC for 5–7 days. The fungal cultures were initially cultivated 128
in 200 ml of Kendrick medium (47) and incubated at 25ºC for 6 days. The mycelia 129
were then collected by filtration through sterile cheesecloth, and frozen immediately 130
on October 11, 2020 by guest
http://aem.asm
.org/D
ownloaded from
7
in liquid nitrogen for RNA extraction. 131
Aromatic compound degradation test. The indicated sole carbon sources 132
(glucose at 3%, phenylalanine at 25 mM, phenylacetate at 10 mM and Tyrosine at 133
25 mM) (15) were added to minimal medium to test the aromatic compound 134
degradation in M. alpina. The minimal medium contained 0.3% diammonium tartrate, 135
0.7% KH2P04, 0.2% Na2HP04, 0.15% MgS04·7H20, 0.67% yeast nitrogen base and 136
2% agarose, pH 6.0. The plates were photographed after 3 days of incubation at 25°C. 137
The mycelia of M. alpina were stained with 0.01% triphenyltetrazolium chloride 138
(TTC) to facilitate growth measurements (48). This experiment was replicated three 139
times. 140
Effect of a PAH inhibitor on lipids synthesis. For the whole-cell inhibition 141
studies, cultures were grown in 50 ml of Kendrick medium (50 g/l glucose, 2 g/l 142
diammonium tartrate, 7.0 g/l KH2PO4, 2.0 g/l Na2HPO4, 1.5 g/l MgSO4.7H20, 1.5 g/l 143
Bacto yeast extract, 0.1 g/l CaCl22H2O, 8 mg/l FeCl3.6H2O, 1 mg/l ZnSO4.7H2O, 0.1 144
mg/l CuSO4.5H2O, 0.1 mg/l Co(NO3)2.6H2O and 0.1 mg/l MnSO4.5H2O, pH 6.0) with 145
the addition of 5 mM p-chlorophenylalanine. The medium and incubation protocols 146
were as previously described (21). The lipid composition of M. alpina was also 147
investigated when p-chlorophenylalanine (5 mM) and tyrosine (5 mM) were both 148
added to the medium. M. alpina cultures were incubated at 25°C for 6 days. 149
Aspergillus oryzae is another oleaginous fungus (49, 50), and genome analysis 150
suggests there is no phenylalanine hydroxylating system in A. oryzae (Table S2). The 151
addition of PAH inhibitor in A. oryzae was included to verify whether there were any 152
on October 11, 2020 by guest
http://aem.asm
.org/D
ownloaded from
8
changes in lipids in the absence of a phenylalanine hydroxylating system. A. oryzae 153
was incubated at 25°C for 6 days. The mycelia were then collected by filtration and 154
approximately 20 mg was used for each lipid extraction. Accurately weighed portions 155
of pulverized mycelium were extracted using the method of Bligh and Dyer (51) 156
under acidified conditions with pentadecanoic acid and heneicosanoic acid added as 157
internal standards (21). This experiment was replicated 3 times. 158
Cloning and plasmid construction. Total RNA extraction was performed using 159
Trizol Reagent (Invitrogen) according to the manufacturer’s instructions. RNA was 160
subjected to RNase-free DNase digestion and then purified using the RNeasy Mini kit 161
(Qiagen). The quantity and quality of the total RNA were evaluated using a NanoDrop 162
ND-1000 spectrophotometer (NanoDrop Technologies, Inc.). The total RNA was 163
reverse transcribed with the PrimeScript RT reagent kit (Takara Bio, Inc.) following 164
the manufacturer’s instructions, before the PCR amplification of PAH-1, PAH-2, PCD, 165
and DHPR genes using the primer pairs shown in Table 1. The PCR conditions used 166
were as follows: denaturation at 95ºC for 30 s, annealing at 50ºC for 45 s, and 167
extension at 72ºC for 1 min (for 25 cycles in total). The final volume in each well was 168
50 µl. The amplified product was cloned into pET28a+ to construct pwl47864 169
(containing PAH-1), pwl47866 (containing PAH-2), pwl39696 (containing PCD), or 170
pwl39698 (containing DHPR). The presence of inserts in the plasmids was confirmed 171
by sequencing using an ABI 3730 Sequencer. 172
Protein expression and purification. E. coli BL21 carrying pwl47864, 173
pwl47866, pwl39696, or pwl39698 was grown overnight at 37ºC with shaking in LB 174
on October 11, 2020 by guest
http://aem.asm
.org/D
ownloaded from
9
medium containing 50 μg/ml of kanamycin. The overnight culture (10 ml) was 175
inoculated into 500 ml of fresh medium and grown until the OD600 reached 0.6. 176
PAH-1 expression was induced by the addition of 0.1 mM IPTG at 30ºC for 20 h, 177
PAH-2 expression was induced by 0.01 mM of IPTG at 30ºC for 20 h, and PCD or 178
DHPR expression was induced by 0.5 mM of IPTG at 37ºC for 16 h. After the IPTG 179
induction, cells were harvested by centrifugation, washed with binding buffer (50 mM 180
Tris-HCl, 300 mM NaCl, and 10 mM imidazole; pH 8.0), resuspended in the same 181
buffer (supplemented with 1 mM phenylmethanesulfonyl fluoride and 1 mg/ml 182
lysozyme), and then sonicated. Cell debris were removed by centrifugation, and the 183
supernatants (containing the soluble proteins) were collected. The His-tagged fusion 184
proteins were purified by nickel ion affinity chromatography using a Chelating 185
Sepharose Fast Flow column (GE Healthcare) according to the manufacturer’s 186
instructions. Unbound proteins were washed through with 100 ml of wash buffer (50 187
mM Tris-HCl, 300 mM NaCl, and 25 mM imidazole; pH 8.0). Fusion proteins were 188
eluted with 3 ml of elution buffer (50 mM Tris-HCl, 300 mM NaCl and 250 mM 189
imidazole; pH 8.0) and dialyzed overnight at 4°C against 50 mM Tris-HCl buffer 190
containing 20% glycerol (pH 7.4). The protein concentrations were determined by the 191
Bradford method. The purified proteins were stored at -80°C. 192
Enzyme activity assays. The PAH activity was assayed using the method of 193
Bailey and Ayling (52) with minor modifications. The reaction mixture for PAH 194
contained 100 mM Tris-HCl (pH 7.0), 1 mM phenylalanine, 1 mg/ml catalase, and 195
0.14 µg/ml purified PAH-1 protein or 0.22 µg/ml purified PAH-2 protein, and was 196
on October 11, 2020 by guest
http://aem.asm
.org/D
ownloaded from
10
maintained at 25ºC for 5 min. Then, 100 µM ferrous ammonium sulphate was added 197
and allowed to incubate for 1 min. The reaction was started by the addition of 100 µM 198
BH4 (Sigma) or 6-methyltetrahydropterin (Sigma) and 5 mM DTT in a total volume of 199
50 µl. After a period of 15 min, the reaction was stopped by adding 50 µl 2 M 200
trichloroacetic acid. Samples were prepared for high performance liquid 201
chromatography (HPLC) after centrifugation. The HPLC was performed on a 202
SHIMADZU Model LC-20AT equipped with a Rheodyne loop of 20 µl, an Inertsil 203
ODS-3 column (5 µm, 150 x 4.6 mm; GL Science), and a SHIMADZU Model 204
RF-20A fluorescence detector. The mobile phase consisted 0.1 M NH4OH adjusted to 205
pH 4.6 with acetic acid at a flow rate of 1.5 ml/min. To observe the separation of 206
phenylalanine and tyrosine, the excitation and emission wavelengths of fluorescence 207
detector were set at 260 and 282 nm, respectively (53). To determine the amount of 208
tyrosine, the excitation and emission wavelengths of fluorescence detector were set at 209
274 and 304 nm, respectively (52). Quantitation was based on external calibration 210
using a standard curve prepared with different amounts of tyrosine. 211
The reaction mixture for DHPR contained 100 mM Tris-HCl (pH 7.0), 10 µg/ml 212
peroxidase, 10 mM hydrogen peroxide, 10 µM BH4, and 0.1 mM NADH. After an 213
incubation period of 4.5 min at 25 ºC, the reaction was started by adding 3.99 µg/ml 214
purified DHPR protein in a final volume of 1 ml. The initial rates were obtained from 215
the initial rate of decrease of A340 nm (e340 nm for NADH is 6200 M-1cm-1) (54, 55). The 216
background reactions were eliminated when the reaction was catalyzed by peroxidase 217
or DHPR alone. 218
on October 11, 2020 by guest
http://aem.asm
.org/D
ownloaded from
11
The 50 µl PCD assay reaction mixture contained 100 mM Tris-HCl (pH 7.0), 1 219
mg/ml catalase, 1 mM L-phenylalanine and 0.14 µg/ml purified PAH-1 protein. This 220
mixture was incubated for 2 min at 25ºC, and 20 µM BH4 and 5 mM DTT were added. 221
After a 5-hour PAH reaction, 0.1 mM NADH and 6.24 µg/ml purified PCD protein 222
and 3.99 µg/ml purified DHPR protein were added. The amount of tyrosine formed 223
after 24 hours was determined fluorometrically and corrected for the tyrosine formed 224
in controls without PCD (56, 57). The background reactions were eliminated when the 225
reaction was catalyzed by PCD or DHPR alone. These experiments were replicated 3 226
times. 227
Determination of the temperature and pH optima, and effects of aromatic 228
amino acids on PAH activity. In order to determine the optimum temperature, PAH 229
reactions were carried out at 5°C, 15°C, 25°C, 37°C, 50°C, and 60°C for 15 min at pH 230
7.0. For determinations of optimum pH, three different buffers were used over a range 231
of pH 3 to 11, including 100 mM sodium acetate-acetic acid (pH 3-6), 100 mM 232
Tris-HCl (pH 7-8), and 100 mM glycine-NaOH (pH 10-12). These reactions were 233
carried out for 15 min at 25°C. A range of amino acid concentrations (0.5 µM-5 mM) 234
were used to test their effects on the PAH activity, including tryptophan, glycine, 235
alanine, p-chlorophenylalanine, and esculin. These reactions were carried out for 15 236
min at 25°C pH 7.0. These experiments were replicated 3 times. 237
Measurement of kinetic parameters. To measure the Km and Vmax values for 238
both PAHs using phenylalanine, reactions were carried out using various 239
concentrations of phenylalanine (0.5-2 mM) in conjunction with a fixed concentration 240
on October 11, 2020 by guest
http://aem.asm
.org/D
ownloaded from
12
of BH4 (1 mM). To measure the Km and Vmax values for both PAHs acting on BH4, 241
reactions were carried out using various concentrations of BH4 (70–400 µM) but with 242
a fixed concentration of phenylalanine (1 mM). The PAH reactions were performed in 243
Tris-HCl pH 7.5 at 25°C for 15 min in a final volume of 50 µl. The conversion of 244
phenylalanine to tyrosine was monitored by HPLC. The kinetic parameters were 245
obtained by fitting the initial rates of reaction measured at various concentrations of 246
one substrate at a fixed concentration of the other to the Michaelis–Menten equation 247
using nonlinear regression. This experiment was replicated 3 times. 248
249
250
251
RESULTS 252
Gene search. Putative PAH-1, PAH-2, PCD, and DHPR genes were found in the 253
M. alpina genomes (GenBank accession numbers JN982953, JN982954, JQ281474, 254
and JQ281475), suggesting the presence of a phenylalanine hydroxylating system in 255
this fungus. The search results of all of the sequenced fungal genomes are shown in 256
Table S1. 257
Aromatic compound degradation test. The growth phenotypes of M. alpina are 258
shown in Fig. S1. M. alpina showed a fine hyphal growth on medium containing 259
phenylalanine (Fig. S1B) or tyrosine (Fig. S1E) as the sole carbon source. The growth 260
of M. alpina was repressed by the addition of p-chlorophenylalanine to medium 261
containing phenylalanine as the sole source of carbon (Fig. S1D). M. alpina was 262
on October 11, 2020 by guest
http://aem.asm
.org/D
ownloaded from
13
unable to grow on medium containing phenylacetate as the sole carbon source (Fig. 263
S1C), even if it was incubated for over 2 weeks or at a higher phenylacetate 264
concentration (1 M), which is in contrast to other fungi such as Penicillium 265
chrysogenum, Aspergillus nidulans, and Aspergillus niger (17-20). Thus, these results 266
illustrate that M. alpina can degrade phenylalanine and tyrosine but not phenylacetate. 267
Effects of p-chlorophenylalanine on PUFA synthesis. To explore the 268
relationship between the phenylalanine hydroxylating system and lipid synthesis, we 269
investigated the effects of 5 mM p-chlorophenylalanine, an inhibitor of the 270
phenylalanine hydroxylating system in higher organisms, on the fatty acid status 271
(Table. S2). The M. alpina cultures grown in medium plus inhibitor showed reduced 272
total saturated fatty acids (SAFA), ω6 PUFA, ω3 PUFA and total fatty acid (FA) 273
accumulation levels by about 30%, 50%, 20% and 30% respectively, while the level 274
of monounsaturated fatty acid (MUFA) was increased by about 30% (Fig. 3). The 275
addition of tyrosine did not change the inhibitory effects of p-chlorophenylalanine on 276
lipids when M. alpina was grown in medium plus inhibitor and tyrosine (Fig. 3). The 277
lipid status of A. oryzae grown on PAH inhibitor medium did not change compared to 278
medium without inhibitor (Table S2), suggesting that the PAH inhibitor used in our 279
experiment is selective. 280
Expression and purification of PAHs, PCD, and DHPR. PAH-1, PAH-2, PCD, 281
and DHPR were expressed as His-tagged fusion proteins in E. coli BL21 by IPTG 282
induction, and purified to near homogeneity by nickel ion affinity chromatography 283
(Fig. S2). The molecular masses estimated from the SDS-PAGE analysis were 54 kDa 284
on October 11, 2020 by guest
http://aem.asm
.org/D
ownloaded from
14
for PAH-1 and PAH-2, 14 kDa for PCD, and 27 kDa for DHPR, which correspond 285
well with the calculated masses (excluding the His tag, these were 50 kDa, 50 kDa, 11 286
kDa, and 23 kDa, respectively). The yield of PAH-1, PAH-2, PCD, and DHPR was 287
1.40 µg/ml, 2.24 µg/ml, 62.44 µg/ml, and 39.88 µg/ml, respectively. 288
Activity of PAHs, PCD, and DHPR. Phenylalanine was incubated with the 289
purified PAH proteins and the reaction products were identified by HPLC, as shown 290
in Fig. S3. Phenylalanine was observed at 6.5 min, corresponding to the position of 291
the phenylalanine standard (Fig. S3B) in the sample incubated in the absence of the 292
PAHs (Fig. S3C). Phenylalanine was converted to a peak that eluted at 2.6 min, 293
corresponding to the position of the tyrosine standard (Fig. S3A) in the reaction 294
catalyzed by PAH-1 (Fig. S3D) or PAH-2 (Fig. S3E). These results confirm that the 295
recombinant proteins show PAH activity, which are dependent on the presence of all 296
of the substrates (including BH4 and 6-methyltetrahydropterin). To examine whether 297
the purified DHPR protein showed DHPR activity, we determined the initial velocity 298
of its NADH consumption. When the reaction was catalyzed by peroxidase or DHPR 299
alone, it has no effect on the rate of NADH oxidation. The initial rate of NADH 300
oxidation was dramatically increased by the addition of the recombinant protein, 301
indicating that the purified protein possesses DHPR activity (Fig. S4). The specific 302
activity of the recombinant DHPR protein was 29.92 µmoles/min/mg. One unit of 303
DHPR activity was defined as being the amount of enzyme that caused the oxidation 304
of 1 µmol NADH per minute under the above the conditions. PCD activity was 305
assayed by the ability to stimulate PAH activity in the presence of BH4. When the 306
on October 11, 2020 by guest
http://aem.asm
.org/D
ownloaded from
15
reaction was catalyzed by PCD or DHPR alone, it has no effect on the rate of tyrosine 307
production. The amount of tyrosine formed with the addition of PCD was 0.17 mmol, 308
and the tyrosine formed in controls without PCD was 0.13 mmol. Thus, the specific 309
activity of the recombinant PCD protein was 0.35 µmol/min/mg. One unit of PCD 310
activity is defined as 1 µmol of tyrosine formed in 30 min under the above the 311
conditions. The data shown are the averages of three independent experiments. 312
Effects of temperature, pH, and aromatic amino acids on PAH activity. 313
PAH-1 and PAH-2 were active at each of the temperatures tested (in the range of 314
15°C–65°C), with the greatest activity detected at 37°C and 40°C (Fig. 4A). One 315
hundred percent activity in the PAH-1 and the PAH-2 reaction occurred at 37°C under 316
the aforementioned conditions. The optimal temperatures for PAH-1 and PAH-2 are in 317
accordance with data previously obtained for humans and Dictyostelium discoideum 318
(58, 59), but are different from data obtained for Chromobacterium violaceum, 319
Colwellia psychrerythraea, and Chloroflexus aurantiacus (13, 60, 61). PAH-1 activity 320
decreased quickly at higher temperatures, and was limited at 50°C (Fig. 4A). For 321
PAH-2, high activity (65%) was observed at temperatures up to 50°C, and activity 322
was still found at 60°C (Fig. 4A). Therefore, PAH-2 was more heat-stable than 323
PAH-1. 324
PAH-1 and PAH-2 both showed optimal activity at pH 7.5 in 100 mM Tris-HCl 325
buffer (Fig. 4B), which is similar to the optimum pH for recombinant human and C. 326
violaceum PAHs (59, 60). Maximal activity for both PAH-1 and PAH-2 occurred at 327
pH 7.0 under the aforementioned conditions. The PAHs were active over a broad 328
on October 11, 2020 by guest
http://aem.asm
.org/D
ownloaded from
16
range of pH values (4–10), which contrasts with the significantly decreased activity of 329
human PAH below pH 5.5. PAH-1 and PAH-2 exhibited a very similar pH sensitivity 330
profile. 331
Some aromatic amino acids will react with the substrate binding site of PAH and 332
can be hydroxylated under appropriate conditions in vitro or can competitively inhibit 333
the hydroxylation of phenylalanine (59). PAH-1 activity was significantly inhibited by 334
5 mM concentrations of a variety of amino acids, including tryptophan (90% 335
inhibition) and p-chlorophenylalanine (96% inhibition) (Fig. 4C). PAH-1 activity was 336
also significantly inhibited by 5 mM esculin (98% inhibition) (Fig. 4C). The 337
inhibition profile of PAH-2 activity was similar: tryptophan (70% inhibition), 338
p-chlorophenylalanine (95% inhibition), and esculin (95% inhibition) (Fig. 4D). 339
However, low concentrations of p-chlorophenylalanine and esculin were more 340
effective in reducing PAH-2 than PAH-1 activity. Glycine and alanine had little effect 341
on PAH-1 and PAH-2 activity. One hundred percent activity was defined as a PAH 342
reaction without competing amino acids under the previous PAH activity assay 343
condition. The inhibitory effect of the aromatic amino acids and esculin was also 344
observed for PAH in humans, and this inhibition is one of the hallmarks of PAH 345
activity (59). 346
Comparative analysis of M. alpina PAH proteins and other homologous 347
proteins. The kinetic parameters of PAH-1 and PAH-2 (for phenylalanine and BH4) 348
were measured. The kinetics of the reactions catalyzed by these enzymes present a 349
good fit with the Michaelis–Menten model, and nonlinear regression of the 350
on October 11, 2020 by guest
http://aem.asm
.org/D
ownloaded from
17
experimental data to the Michaelis–Menten equation yielded the kinetic parameters 351
shown in Table 2. PAH-1 and PAH-2 share 12.7-55.3% identity with other 352
characterized PAH proteins, and are most similar to those from Dictyostelium 353
discoideum. Multiple sequence alignment of the M. alpina PAHs and other 354
characterized PAH proteins revealed the presence of certain conserved motifs and 355
residues (Fig. S5), including two motifs, Gly-Ala-Leu (residues 46–48 in human PAH) 356
and Ile-Glu-Ser-Arg-Pro (residues 65–69 in human PAH), that form a 357
phenylalanine-binding pocket (62); a Gly-Leu-Leu-Ser-Ser motif (residues 247-251 in 358
human PAH) involved in BH4 cofactor-binding (13, 63, 64); two motifs, 359
Tyr-Thr-Pro-Glu-Pro (residues 277-281 in human PAH) and 360
Gly-Ala-Gly-Leu-Leu-Ser (residues 344-350 in human PAH), involved in 361
substrate-binding (13, 64); four iron-binding residues (human His146, Arg158, 362
His285, and His290) (65-67); four residues (human Arg270, Trp326, Phe331, and 363
Glu353) involved in substrate-binding (13, 64); six residues (human Phe254, Leu255, 364
His264, Glu286, Ala322, and Tyr325) involved in BH4 cofactor-binding (13, 63, 64); 365
and six residues (human Pro122, Leu128, Phe131, Ala132, Arg158, and His146) 366
involved in the N-terminal regulatory domain. The residues of the pterin binding loop, 367
the N-terminal loop, and the loop region between residues 272–282 differ from 368
bacterial and human versions of PAH, creating a tenfold higher specific activity for 369
BH4 in C. violaceum than in humans (65, 68). These residues in human PAH are 370
almost all conserved in M. alpina PAH except for human Ile125, Ile135, gly272, and 371
the N-terminal autoregulatory sequence (NARS, human residues 19–33) (65), which 372
on October 11, 2020 by guest
http://aem.asm
.org/D
ownloaded from
18
is consistent with the similar activity observed in human PAH and M. alpina PAHs. 373
Residues Asp116, Lys274, and Ser439, which are responsible for dimer and tetramer 374
formation, substrate binding, and deamidation rates, respectively (65, 67), are not 375
conserved in PAH-1 but do occur in PAH-2. The increased Km of M. alpina PAH-1 376
compared with PAH-2 may be due to the loss of one or several of these residues, 377
which may consequently impair substrate binding and decrease catalytic activity. The 378
other enzymatic properties of PAH-1 and PAH-2 are generally similar, which is 379
consistent with the data observed for eukaryotes (58, 59). 380
Phylogenetic analysis of PAH. A phylogenetic tree was generated with amino 381
acid hydroxylase (AAH) sequences from fungi, animals, protists, plants, and bacteria 382
(Fig. S6). The tree is rooted with PAHs from plant species as an outgroup, and further 383
recognizes PAH as an ancestral AAH function and gives insight into the evolution of 384
AAHs (58, 69). Based on the search results in the fungal genomes (Table S1), M. 385
alpina, Allomyces macrogynus, Batrachochytrium dendrobatidis, Rhizopus oryzae, 386
Spizellomyces punctatus, M. circinelloides and Phycomyces blakesleeanus are fungi 387
that contain a putative PAH gene. The BH4 de novo pathway is conserved in all of 388
these fungi except A. macrogynus, due to the absence of the 389
6-pyruvoyltetrahydropterin synthase gene (EC4.2.3.12) (Table S1). PAH cannot work 390
in A. macrogynus due to the lack of cofactor BH4, which may be why A. macrogynus 391
PAH and other fungal PAHs cluster as a distinct group in the phylogenetic tree. Our 392
phylogenetic analysis of fungal PAH sequences and animal, protist, plant, and 393
bacterial AAHs of known specificity places the fungal proteins closest to those of 394
on October 11, 2020 by guest
http://aem.asm
.org/D
ownloaded from
19
animals. The tree illustrates the clear distinction between fungi that contain the 395
phenylalanine hydroxylating system and those that do not, and also shows the close 396
relationship between M. alpina and animal PAH (Fig. S6). Based on sequence 397
comparisons and enzymatic properties, the PAHs from M. alpina and animals are 398
thought to have evolved from the same ancestor. 399
400
401
DISCUSSION 402
The fungal BH4 synthesis pathway has only been characterized at the molecular 403
level in M. alpina (22), and BH4 only acts as a cofactor in nitric oxide synthesis in the 404
fungi Phycomyces blakesleeanus and Neurospora crassa (70, 71). Because most fungi 405
do not synthesize BH4 and lack BH4-dependent monooxygenases, the function of BH4 406
in fungi is unclear. The BH4-dependent PAH is present in only about 7% of the fungal 407
genomes sequenced so far (Table S1), and other BH4-dependent enzymes have not 408
been discovered in M. alpina. This work provides direct biochemical evidence that 409
BH4 can function as a biological cofactor for PAH in fungi, based on the 410
characterization of the BH4 synthesis pathway and PAH homologues in M. alpina. 411
This function has never been demonstrated in fungi before, and thus we hypothesize 412
that BH4 plays a novel role in fungi, similar to that known to exist in higher life forms. 413
In most fungi, phenylalanine is converted into phenylacetate. The conventional 414
aerobic route for phenylacetate, which leads to homogentisate, occurs in fungi (Fig. 2) 415
(17-20). However, the M. alpina genome sequence lacks an ortholog of phenylacetate 416
on October 11, 2020 by guest
http://aem.asm
.org/D
ownloaded from
20
2-hydroxylase (EC1.14.13.-) to catalyze the hydroxylation of phenylacetate to 417
homogentisate (Fig. 2B), which is consistent with the inability of M. alpina to grow 418
on medium containing phenylacetate as the sole carbon source (Fig. S1C). This is in 419
contrast to the fact that most fungi can grow on phenylacetate medium (15). Because 420
this step is needed for the complete oxidation of phenylalanine to carbon dioxide and 421
water (14), conventional fungal phenylalanine catabolism is blocked in M. alpina. 422
However, M. alpina can grow on phenylalanine as the sole carbon source (Fig. S1B), 423
which means that it has an unconventional strategy of phenylalanine metabolism. In 424
this report, we have shown that in this organism, phenylalanine is hydroxylated to 425
tyrosine by the phenylalanine hydroxylating system; tyrosine can then be converted 426
into 4-hydroxyphenylpyruvate, followed by hydroxylation to homogentisate, the same 427
intermediate as in other fungi (Fig. 2). The putative genes needed for tyrosine 428
oxidation are all present in the M. alpina genome, which was proved by the fact that 429
M. alpina could grow on tyrosine as the sole carbon source (Fig. S1E). Our 430
characterization of the phenylalanine hydroxylating system provides the molecular 431
basis for a novel scheme for the degradation of an aromatic substance (phenylalanine) 432
in fungi. This paradigm for phenylalanine catabolism differs significantly from the 433
established knowledge in other fungi. Conserved genes of the phenylalanine 434
hydroxylating system have been found in 7% of the sequenced fungi species thus far 435
(Table S1). These species belong to the groups of mucoromycotina (M. alpina, R. 436
oryzae, M. circinelloides and P. blakesleeanus) and chytridiomycota (B. dendrobatidis 437
and S. punctatus). Thus, this scheme for aromatic degradation is of major importance, 438
on October 11, 2020 by guest
http://aem.asm
.org/D
ownloaded from
21
but is not widespread in fungi. 439
In higher organisms, PAH and its cofactor BH4 are suggested to be essential for 440
lipid metabolism. Mutations in the human PAH gene result in the metabolic disorder 441
known as phenylketonuria (PKU) (67), and PKU patients present with lower 442
concentrations of long-chain polyunsaturated fatty acids (LCPUFA) such as AA and 443
eicosapentaenoic acid and higher concentrations of oleic acid 18:1 (31, 32). It has also 444
been suggested that the PAH cofactor BH4 is essential for the desaturation or omega 445
oxidation of long-chain fatty acids and the incorporation of unsaturated fatty acids 446
into phospholipids (33-36). Significant changes were observed in the concentration of 447
total ω6 PUFA and AA in M. alpina grown on PAH inhibitor medium compared to M. 448
alpina grown on medium without inhibitor (Fig. 3). Of all the fatty acids, AA – the 449
main commercial product of M. alpina (23) – showed the most pronounced change. 450
Interestingly, the trends in the lipid status of M. alpina grown on PAH inhibitor 451
medium parallel those observed in PKU patients. These results suggest that the 452
phenylalanine hydroxylating system may control lipid accumulation, either on its own 453
or via interactions with other as yet unrecognized regulatory factors in M. alpina. 454
Acetyl-CoA and NADPH are two key factors in lipid metabolism. Acetyl-CoA is the 455
essential building block and necessary precursor of fatty acids (30), and NADPH is 456
the critical reducing agent and limiting factor in fatty acid synthesis (72). Based on the 457
genome information, the phenylalanine catabolism pathway in M. alpina was 458
constructed to map the utilization of phenylalanine (Fig. 2). The M. alpina 459
phenylalanine hydroxylating system is supposed to be blocked by PAH inhibitor, 460
on October 11, 2020 by guest
http://aem.asm
.org/D
ownloaded from
22
which may interfere with fatty acid synthesis by reducing the production of NADPH 461
and acetyl-CoA through the tricarboxylic acid cycle. We hypothesize that the function 462
of the phenylalanine hydroxylating system in M. alpina, including PAH and BH4, is to 463
contribute NADPH and acetyl-CoA for lipid accumulation by the utilization of 464
phenylalanine and tyrosine, and this may also explain in part how M. alpina achieves 465
its high level of lipid synthesis. Moreover, as there are two copies of PAH in M. 466
alpina and PAH is the rate-limiting factor in animal phenylalanine catabolism (1, 2), 467
ectopic overexpression of PAH should enhance the ability of M. alpina to use 468
phenylalanine for lipid synthesis. RNAi of PAH genes should be utilized in future 469
work to explore the relationship between the phenylalanine hydroxylating system and 470
lipid synthesis. 471
It was suggested that NADPH, produced by malic enzymes, was the unique source 472
of reducing power for fatty acid synthesis in fungi like M. circinelloides and M. alpina, 473
and that malic enzyme is consequently the rate-limiting step for fatty acid 474
biosynthesis (73). Recently, leucine metabolism was found to be another bottleneck in 475
lipid accumulation in oleaginous fungi M. circinelloides (37). In that work, the 476
overexpression of the LEU2 (a gene encoding β-isopropylmalate dehydrogenase 477
involved in leucine biosynthesis) significantly increased lipid content, in accordance 478
with the previous observations in Saccharomyces cerevisiae (74). Comparative 479
genome analysis of the non-oleaginous and oleaginous strains points to a relationship 480
between the lipid and amino acid metabolisms, including leucine and lysine 481
degradation and lysine biosynthesis, in the biosynthesis of the important intermediate 482
on October 11, 2020 by guest
http://aem.asm
.org/D
ownloaded from
23
metabolite acetyl-CoA, which might relate to the capability of the oleaginous 483
microorganisms to accumulate high levels of lipids (38). Leucine and lysine metabolic 484
pathways were all conserved in M. alpina’s genome. Our study suggests that 485
phenylalanine metabolism in M. alpina may also be important for lipid accumulation. 486
It may support previous data postulating amino acid metabolism as one of the 487
pathways involved in the generation of the acetyl-CoA required for fatty acid 488
biosynthesis (38, 74). The relationship between the lipid and amino acid metabolisms 489
is thus of major importance, and is probably widespread in oleaginous fungi. Our 490
identification of a phenylalanine hydroxylating system involved in amino acid 491
metabolism and lipid accumulation extends the range of target candidates for genetic 492
manipulation in M. alpina for obtaining strains with increased amounts of lipids. 493
In conclusion, the phenylalanine hydroxylating system has been characterized at 494
the molecular level in a fungus, M. alpina. Genes encoding PAH, PCD, and DHPR 495
were functionally characterized in vitro. Two functional PAH genes (PAH-1 and 496
PAH-2) were observed. A novel role for tetrahydrobiopterin in fungi as a cofactor for 497
PAH is suggested, which is similar to that known to exist in higher life forms. This 498
work establishes a novel fungal scheme for the degradation of an aromatic substance 499
(phenylalanine) and suggests that the phenylalanine hydroxylating system is 500
functionally significant in lipid metabolism. 501
ACKNOWLEDGMENTS 502
This work was supported by the National Science Fund for Distinguished Young 503
Scholars (31125021), the National Natural Science Foundation of China (21276108, 504
on October 11, 2020 by guest
http://aem.asm
.org/D
ownloaded from
24
31271812, 31171636 and 20836003), the National High Technology Research and 505
Development Program of China (2011AA100905), the National Basic Research 506
Program of China 973 Program (2012CB720802), the 111 project B07029, the 507
Fundamental Research Funds for the Central Universities (JUSRP51320B), and 508
Doctor Candidate Foundation of Jiangnan University (JUDCF11026). 509
510
on October 11, 2020 by guest
http://aem.asm
.org/D
ownloaded from
25
REFERENCES 511
1. Kappock, T. J., and J. P. Caradonna. 1996. Pterin-Dependent Amino Acid 512
Hydroxylases. Chemical Reviews 96:2659-2756. 513
2. Neckameyer, W. S., C. M. Coleman, S. Eadie, and S. F. Goodwin. 2007. 514
Compartmentalization of neuronal and peripheral serotonin synthesis in 515
Drosophila melanogaster. Genes Brain and Behavior 6:756-769. 516
3. Ding, Z., C. O. Harding, A. Rebuffat, L. Elzaouk, J. A. Wolff, and B. Thony. 517
2008. Correction of murine PKU following AAV-mediated intramuscular 518
expression of a complete phenylalanine hydroxylating system. Molecular 519
Therapy 16:673-81. 520
4. Kaufman, S. 1971. The phenylalanine hydroxylating system from mammalian 521
liver. Adv Enzymol Relat Areas Mol Biol 35:245-319. 522
5. Werner-Felmayer, G., G. Golderer, and E. R. Werner. 2002. 523
Tetrahydrobiopterin biosynthesis, utilization and pharmacological effects. Curr 524
Drug Metab 3:159-73. 525
6. Thony, B., G. Auerbach, and N. Blau. 2000. Tetrahydrobiopterin biosynthesis, 526
regeneration and functions. Biochemical Journal 347 Pt 1:1-16. 527
7. Shiman, R., D. W. Gray, and M. A. Hill. 1994. Regulation of rat liver 528
phenylalanine hydroxylase. I. Kinetic properties of the enzyme's iron and enzyme 529
reduction site. Journal of Biological Chemistry 269:24637-46. 530
8. Martinez, A., P. M. Knappskog, S. Olafsdottir, A. P. Doskeland, H. G. Eiken, 531
R. M. Svebak, M. Bozzini, J. Apold, and T. Flatmark. 1995. Expression of 532
on October 11, 2020 by guest
http://aem.asm
.org/D
ownloaded from
26
recombinant human phenylalanine hydroxylase as fusion protein in Escherichia 533
coli circumvents proteolytic degradation by host cell proteases. Isolation and 534
characterization of the wild-type enzyme. Biochemical Journal 306 ( Pt 535
2):589-97. 536
9. Teufel, R., V. Mascaraque, W. Ismail, M. Voss, J. Perera, W. Eisenreich, W. 537
Haehnel, and G. Fuchs. 2010. Bacterial phenylalanine and phenylacetate 538
catabolic pathway revealed. Proc Natl Acad Sci U S A 107:14390-5. 539
10. Fuchs, G., M. Boll, and J. Heider. 2011. Microbial degradation of aromatic 540
compounds - from one strategy to four. Nat Rev Microbiol 9:803-16. 541
11. Zhao, G., T. Xia, J. Song, and R. A. Jensen. 1994. Pseudomonas aeruginosa 542
possesses homologues of mammalian phenylalanine hydroxylase and 4 543
alpha-carbinolamine dehydratase/DCoH as part of a three-component gene 544
cluster. Proc Natl Acad Sci U S A 91:1366-70. 545
12. Nakata, H., T. Yamauchi, and H. Fujisawa. 1979. Phenylalanine hydroxylase 546
from Chromobacterium violaceum. Purification and characterization. Journal of 547
Biological Chemistry 254:1829-33. 548
13. Leiros, H. K., A. L. Pey, M. Innselset, E. Moe, I. Leiros, I. H. Steen, and A. 549
Martinez. 2007. Structure of phenylalanine hydroxylase from Colwellia 550
psychrerythraea 34H, a monomeric cold active enzyme with local flexibility 551
around the active site and high overall stability. Journal of Biological Chemistry 552
282:21973-86. 553
14. Arias-Barrau, E., E. R. Olivera, J. M. Luengo, C. Fernandez, B. Galan, J. L. 554
on October 11, 2020 by guest
http://aem.asm
.org/D
ownloaded from
27
Garcia, E. Diaz, and B. Minambres. 2004. The homogentisate pathway: a 555
central catabolic pathway involved in the degradation of L-phenylalanine, 556
L-tyrosine, and 3-hydroxyphenylacetate in Pseudomonas putida. Journal of 557
Bacteriology 186:5062-77. 558
15. Fernandez-Canon, J. M., and M. A. Penalva. 1995. Fungal metabolic model 559
for human type I hereditary tyrosinaemia. Proc Natl Acad Sci U S A 92:9132-6. 560
16. Schmaler-Ripcke, J., V. Sugareva, P. Gebhardt, R. Winkler, O. Kniemeyer, T. 561
Heinekamp, and A. A. Brakhage. 2009. Production of pyomelanin, a second 562
type of melanin, via the tyrosine degradation pathway in Aspergillus fumigatus. 563
Appl Environ Microbiol 75:493-503. 564
17. Rodriguez-Saiz, M., J. L. Barredo, M. A. Moreno, J. M. Fernandez-Canon, 565
M. A. Penalva, and B. Diez. 2001. Reduced function of a 566
phenylacetate-oxidizing cytochrome p450 caused strong genetic improvement in 567
early phylogeny of penicillin-producing strains. Journal of Bacteriology 568
183:5465-71. 569
18. Kishore, G., M. Sugumaran, and C. S. Vaidyanathan. 1976. Metabolism of 570
DL-(+/-)-phenylalanine by Aspergillus niger. Journal of Bacteriology 571
128:182-91. 572
19. Lapadatescu, C., C. Ginies, J. L. Le Quere, and P. Bonnarme. 2000. Novel 573
scheme for biosynthesis of aryl metabolites from L-phenylalanine in the fungus 574
Bjerkandera adusta. Appl Environ Microbiol 66:1517-22. 575
20. Rao, P. V., K. Moore, and G. H. Towers. 1967. Degradation of aromatic amino 576
on October 11, 2020 by guest
http://aem.asm
.org/D
ownloaded from
28
acids by fungi. II. Purification and properties of phenylalanine ammonia-lyase 577
from Ustilago hordei. Can J Biochem 45:1863-72. 578
21.Wang, L., W. Chen, Y. Feng, Y. Ren, Z. Gu, H. Chen, H. Wang, M. J. Thomas, 579
B. Zhang, I. M. Berquin, Y. Li, J. Wu, H. Zhang, Y. Song, X. Liu, J. S. Norris, 580
S. Wang, P. Du, J. Shen, N. Wang, Y. Yang, W. Wang, L. Feng, C. Ratledge, 581
and Y. Q. Chen. 2011. Genome characterization of the oleaginous fungus 582
Mortierella alpina. PLoS One 6:e28319. 583
22. Wang, H., B. Yang, G. Hao, Y. Feng, H. Chen, L. Feng, J. Zhao, H. Zhang, Y. 584
Q. Chen, L. Wang, and W. Chen. 2011. Biochemical characterization of the 585
tetrahydrobiopterin synthesis pathway in the oleaginous fungus Mortierella alpina. 586
Microbiology 157:3059-70. 587
23. Sakuradani, E., A. Ando, J. Ogawa, and S. Shimizu. 2009. Improved 588
production of various polyunsaturated fatty acids through filamentous fungus 589
Mortierella alpina breeding. Appl Microbiol Biotechnol 84:1-10. 590
24. Michaelson, L. V., C. M. Lazarus, G. Griffiths, J. A. Napier, and A. K. 591
Stobart. 1998. Isolation of a Delta5-fatty acid desaturase gene from Mortierella 592
alpina. J Biol Chem 273:19055-9. 593
25. Sakuradani, E., M. Kobayashi, and S. Shimizu. 1999. Delta6-fatty acid 594
desaturase from an arachidonic acid-producing Mortierella fungus. Gene cloning 595
and its heterologous expression in a fungus, Aspergillus. Gene 238:445-53. 596
26. Sakuradani, E., M. Kobayashi, and S. Shimizu. 1999. Delta 9-fatty acid 597
desaturase from arachidonic acid-producing fungus. Unique gene sequence and 598
on October 11, 2020 by guest
http://aem.asm
.org/D
ownloaded from
29
its heterologous expression in a fungus, Aspergillus. Eur J Biochem 260:208-16. 599
27. Sakuradani, E., M. Kobayashi, T. Ashikari, and S. Shimizu. 1999. 600
Identification of Delta12-fatty acid desaturase from arachidonic acid-producing 601
mortierella fungus by heterologous expression in the yeast Saccharomyces 602
cerevisiae and the fungus Aspergillus oryzae. Eur J Biochem 261:812-20. 603
28. Sakuradani, E., T. Abe, K. Iguchi, and S. Shimizu. 2005. A novel fungal 604
omega3-desaturase with wide substrate specificity from arachidonic 605
acid-producing Mortierella alpina 1S-4. Appl Microbiol Biotechnol 66:648-54. 606
29. Ratledge, C. 2002. Regulation of lipid accumulation in oleaginous 607
micro-organisms. Biochem Soc Trans 30:1047-50. 608
30. Ratledge, C. 2004. Fatty acid biosynthesis in microorganisms being used for 609
Single Cell Oil production. Biochimie 86:807-15. 610
31. Moseley, K., R. Koch, and A. B. Moser. 2002. Lipid status and long-chain 611
polyunsaturated fatty acid concentrations in adults and adolescents with 612
phenylketonuria on phenylalanine-restricted diet. Journal of Inherited Metabolic 613
Disease 25:56-64. 614
32. Giovannini, M., G. Biasucci, C. Agostoni, D. Luotti, and E. Riva. 1995. Lipid 615
status and fatty acid metabolism in phenylketonuria. Journal of Inherited 616
Metabolic Disease 18:265-72. 617
33. Kaufman, S. 1993. New tetrahydrobiopterin-dependent systems. Annu Rev Nutr 618
13:261-86. 619
34. Forrest, H. S., and C. Van Baalen. 1970. Microbiology of unconjugated 620
on October 11, 2020 by guest
http://aem.asm
.org/D
ownloaded from
30
pteridines. Annu Rev Microbiol 24:91-108. 621
35. Kaufman, S. 1967. Pteridine cofactors. Annu Rev Biochem 36:171-84. 622
36. Rudzite, V., E. Jurika, G. Baier-Bitterlich, B. Widner, G. Reibnegger, and D. 623
Fuchs. 1998. Pteridines and lipid metabolism. Pteridines 9:103-112. 624
37. Rodriguez-Frometa, R. A., A. Gutierrez, S. Torres-Martinez, and V. Garre. 625
2012. Malic enzyme activity is not the only bottleneck for lipid accumulation in 626
the oleaginous fungus Mucor circinelloides. Appl Microbiol Biotechnol. 627
38. Vorapreeda, T., C. Thammarongtham, S. Cheevadhanarak, and K. Laoteng. 628
2012. Alternative routes of acetyl-CoA synthesis identified by comparative 629
genomic analysis: involvement in the lipid production of oleaginous yeast and 630
fungi. Microbiology 158:217-28. 631
39. Valdivieso, F., C. Gimenez, and F. Mayor. 1975. In vivo inhibition of rat liver 632
phenylalanine hydroxylase by p-chlorophenylalanine and Esculin. Experimental 633
model of phenylketonuria. Biochem Med 12:72-8. 634
40. Guroff, G. 1969. Irreversible in vivo inhibition of rat liver phenylalanine 635
hydroxylase by p-chlorophenylalanine. Archives of Biochemistry and Biophysics 636
134:610-1. 637
41. Altschul, S. F., T. L. Madden, A. A. Schaffer, J. Zhang, Z. Zhang, W. Miller, 638
and D. J. Lipman. 1997. Gapped BLAST and PSI-BLAST: a new generation of 639
protein database search programs. Nucleic Acids Res 25:3389-402. 640
42. Tatusov, R. L., N. D. Fedorova, J. D. Jackson, A. R. Jacobs, B. Kiryutin, E. V. 641
Koonin, D. M. Krylov, R. Mazumder, S. L. Mekhedov, A. N. Nikolskaya, B. S. 642
on October 11, 2020 by guest
http://aem.asm
.org/D
ownloaded from
31
Rao, S. Smirnov, A. V. Sverdlov, S. Vasudevan, Y. I. Wolf, J. J. Yin, and D. A. 643
Natale. 2003. The COG database: an updated version includes eukaryotes. BMC 644
Bioinformatics 4:41. 645
43. Kanehisa, M., S. Goto, S. Kawashima, Y. Okuno, and M. Hattori. 2004. The 646
KEGG resource for deciphering the genome. Nucleic Acids Res 32:D277-80. 647
44. Wu, C. H., R. Apweiler, A. Bairoch, D. A. Natale, W. C. Barker, B. 648
Boeckmann, S. Ferro, E. Gasteiger, H. Huang, R. Lopez, M. Magrane, M. J. 649
Martin, R. Mazumder, C. O'Donovan, N. Redaschi, and B. Suzek. 2006. The 650
Universal Protein Resource (UniProt): an expanding universe of protein 651
information. Nucleic Acids Res 34:D187-91. 652
45. Chang, A., M. Scheer, A. Grote, I. Schomburg, and D. Schomburg. 2009. 653
BRENDA, AMENDA and FRENDA the enzyme information system: new 654
content and tools in 2009. Nucleic Acids Res 37:D588-92. 655
46. Quevillon, E., V. Silventoinen, S. Pillai, N. Harte, N. Mulder, R. Apweiler, 656
and R. Lopez. 2005. InterProScan: protein domains identifier. Nucleic Acids Res 657
33:W116-20. 658
47. Kendrick, A., and C. Ratledge. 1992. Desaturation of polyunsaturated fatty 659
acids in Mucor circinelloides and the involvement of a novel membrane-bound 660
malic enzyme. Eur J Biochem 209:667-73. 661
48. Zhu, M., L. J. Yu, Z. Liu, and H. B. Xu. 2004. Isolating Mortierella alpina 662
strains of high yield of arachidonic acid. Letters in Applied Microbiology 663
39:332-335. 664
on October 11, 2020 by guest
http://aem.asm
.org/D
ownloaded from
32
49. Meng, X., J. M. Yang, X. Xu, L. Zhang, Q. J. Nie, and M. Xian. 2009. 665
Biodiesel production from oleaginous microorganisms. Renewable Energy 666
34:1-5. 667
50. Shi, S., J. O. Valle-Rodriguez, V. Siewers, and J. Nielsen. 2011. Prospects for 668
microbial biodiesel production. Biotechnol J 6:277-85. 669
51. Bligh, E. G., and W. J. Dyer. 1959. A rapid method of total lipid extraction and 670
purification. Can J Biochem Physiol 37:911-7. 671
52. Bailey, S. W., and J. E. Ayling. 1980. An assay for picomole levels of tyrosine 672
and related phenols and its application to the measurement of phenylalanine 673
hydroxylase activity. Analytical Biochemistry 107:156-64. 674
53. Kand'ar, R., and P. Zakova. 2009. Determination of phenylalanine and tyrosine 675
in plasma and dried blood samples using HPLC with fluorescence detection. J 676
Chromatogr B Analyt Technol Biomed Life Sci 877:3926-9. 677
54. Armarego, W. L., R. G. Cotton, H. H. Dahl, and N. E. Dixon. 1989. High-level 678
expression of human dihydropteridine reductase (EC 1.6.99.7), without 679
N-terminal amino acid protection, in Escherichia coli. Biochemical Journal 680
261:265-8. 681
55. Craine, J. E., E. S. Hall, and S. Kaufman. 1972. The isolation and 682
characterization of dihydropteridine reductase from sheep liver. Journal of 683
Biological Chemistry 247:6082-91. 684
56. Davis, M. D., and S. Kaufman. 1989. Evidence for the formation of the 685
4a-carbinolamine during the tyrosine-dependent oxidation of tetrahydrobiopterin 686
on October 11, 2020 by guest
http://aem.asm
.org/D
ownloaded from
33
by rat liver phenylalanine hydroxylase. Journal of Biological Chemistry 687
264:8585-96. 688
57.Hauer, C. R., I. Rebrin, B. Thony, F. Neuheiser, H. C. Curtius, P. Hunziker, N. 689
Blau, S. Ghisla, and C. W. Heizmann. 1993. Phenylalanine 690
hydroxylase-stimulating protein/pterin-4 alpha-carbinolamine dehydratase from 691
rat and human liver. Purification, characterization, and complete amino acid 692
sequence. Journal of Biological Chemistry 268:4828-31. 693
58. Martinez, A., J. Siltberg-Liberles, I. H. Steen, and R. M. Svebak. 2008. The 694
phylogeny of the aromatic amino acid hydroxylases revisited by characterizing 695
phenylalanine hydroxylase from Dictyostelium discoideum. Gene 427:86-92. 696
59. Ledley, F. D., H. E. Grenett, and S. L. Woo. 1987. Biochemical characterization 697
of recombinant human phenylalanine hydroxylase produced in Escherichia coli. 698
Journal of Biological Chemistry 262:2228-33. 699
60. Zoidakis, J., B. Loaiza, K. Vu, and M. M. Abu-Omar. 2005. Effect of 700
temperature, pH, and metals on the stability and activity of phenylalanine 701
hydroxylase from Chromobacterium violaceum. Journal of Inorganic 702
Biochemistry 99:771-775. 703
61. Pey, A. L., and A. Martinez. 2009. Iron binding effects on the kinetic stability 704
and unfolding energetics of a thermophilic phenylalanine hydroxylase from 705
Chloroflexus aurantiacus. Journal of Biological Inorganic Chemistry 14:521-531. 706
62. Gjetting, T., M. Petersen, P. Guldberg, and F. Guttler. 2001. Missense 707
mutations in the N-terminal domain of human phenylalanine hydroxylase 708
on October 11, 2020 by guest
http://aem.asm
.org/D
ownloaded from
34
interfere with binding of regulatory phenylalanine. American Journal of Human 709
Genetics 68:1353-1360. 710
63. Andersen, O. A., T. Flatmark, and E. Hough. 2001. High resolution crystal 711
structures of the catalytic domain of human phenylalanine hydroxylase in its 712
catalytically active Fe(II) form and binary complex with tetrahydrobiopterin. J 713
Mol Biol 314:279-91. 714
64. Andersen, O. A., T. Flatmark, and E. Hough. 2002. Crystal structure of the 715
ternary complex of the catalytic domain of human phenylalanine hydroxylase 716
with tetrahydrobiopterin and 3-(2-thienyl)-L-alanine, and its implications for the 717
mechanism of catalysis and substrate activation. J Mol Biol 320:1095-108. 718
65. Erlandsen, H., J. Y. Kim, M. G. Patch, A. Han, A. Volner, M. M. Abu-Omar, 719
and R. C. Stevens. 2002. Structural comparison of bacterial and human 720
iron-dependent phenylalanine hydroxylases: similar fold, different stability and 721
reaction rates. J Mol Biol 320:645-61. 722
66. Kobe, B., I. G. Jennings, C. M. House, B. J. Michell, K. E. Goodwill, B. D. 723
Santarsiero, R. C. Stevens, R. G. Cotton, and B. E. Kemp. 1999. Structural 724
basis of autoregulation of phenylalanine hydroxylase. Nature Structural Biology 725
6:442-8. 726
67. Fusetti, F., H. Erlandsen, T. Flatmark, and R. C. Stevens. 1998. Structure of 727
tetrameric human phenylalanine hydroxylase and its implications for 728
phenylketonuria. Journal of Biological Chemistry 273:16962-7. 729
68. Erlandsen, H., E. Bjorgo, T. Flatmark, and R. C. Stevens. 2000. Crystal 730
on October 11, 2020 by guest
http://aem.asm
.org/D
ownloaded from
35
structure and site-specific mutagenesis of pterin-bound human phenylalanine 731
hydroxylase. Biochemistry 39:2208-17. 732
69. Pribat, A., A. Noiriel, A. M. Morse, J. M. Davis, R. Fouquet, K. Loizeau, S. 733
Ravanel, W. Frank, R. Haas, R. Reski, M. Bedair, L. W. Sumner, and A. D. 734
Hanson. 2010. Nonflowering plants possess a unique folate-dependent 735
phenylalanine hydroxylase that is localized in chloroplasts. Plant Cell 736
22:3410-22. 737
70. Maier, J., R. Hecker, P. Rockel, and H. Ninnemann. 2001. Role of nitric oxide 738
synthase in the light-induced development of sporangiophores in Phycomyces 739
blakesleeanus. Plant Physiol 126:1323-30. 740
71. Ninnemann, H., and J. Maier. 1996. Indications for the occurrence of nitric 741
oxide synthases in fungi and plants and the involvement in photoconidiation of 742
Neurospora crassa. Photochem Photobiol 64:393-8. 743
72. Zhang, Y., I. P. Adams, and C. Ratledge. 2007. Malic enzyme: the controlling 744
activity for lipid production? Overexpression of malic enzyme in Mucor 745
circinelloides leads to a 2.5-fold increase in lipid accumulation. Microbiology 746
153:2013-25. 747
73. Wynn, J. P., A. bin Abdul Hamid, and C. Ratledge. 1999. The role of malic 748
enzyme in the regulation of lipid accumulation in filamentous fungi. 749
Microbiology 145 ( Pt 8):1911-7. 750
74. Kamisaka, Y., N. Tomita, K. Kimura, K. Kainou, and H. Uemura. 2007. 751
DGA1 (diacylglycerol acyltransferase gene) overexpression and leucine 752
on October 11, 2020 by guest
http://aem.asm
.org/D
ownloaded from
36
biosynthesis significantly increase lipid accumulation in the Deltasnf2 disruptant 753
of Saccharomyces cerevisiae. Biochemical Journal 408:61-8. 754
755
756
on October 11, 2020 by guest
http://aem.asm
.org/D
ownloaded from
Figure legends Figure 1. The animal phenylalanine hydroxylating system.
on October 11, 2020 by guest
http://aem.asm
.org/D
ownloaded from
38
Figure 2. The fungal degradation of an aromatic substance (phenylalanine) in 761
Penicillium chrysogenum, Aspergillus nidulans, and Aspergillus niger (A), M. alpina 762
(B), and Bjerkandera adusta and Schizophyllum commune (C). 763
764
on October 11, 2020 by guest
http://aem.asm
.org/D
ownloaded from
39
Figure 3. Effects of an inhibitor (p-chlorophenylalanine) of phenylalanine 765
hydroxylating system on fatty acids synthesis in M. alpina. The hatched bars, grey 766
bars, and empty bars were M. alpina grown in inhibitor medium, inhibitor and 767
tyrosine medium, and inhibitor-free medium respectively. Data was normalized to the 768
concentration of fatty acids (mg/g cell dry weight) from M. alpina grown on 769
inhibitor-free medium, defined as 100%. The data shown is the average of three 770
independent experiments. 771
772
on October 11, 2020 by guest
http://aem.asm
.org/D
ownloaded from
40
Figure 4. Effects of temperature (A), pH (B), and aromatic amino acids (C) on PAH-1 773
(C) and PAH-2 (D) activity. The open circle (○) indicates the activity of PAH-1 and 774
the open square (□) indicates the activity of PAH-2. The cross-hatched bars, white 775
hatched bars, grey hatched bars, grey bars and empty bars show the effects of 776
tryptophan, glycine, alanine, p-chlorophenylalanine, and esculin on PAH activity, 777
respectively. Each point represents the average of three independent measurements. 778
779
on October 11, 2020 by guest
http://aem.asm
.org/D
ownloaded from
41
Tables 780
Table 1. Primers used in the study 781
Gene Primer sequence used for cloninga
PAH-1 (Forward) CGGAATTCATGTCTGCTGCTGCCAACCACCT
PAH-1 (Reverse) CCCAAGCTTTTACGCCAGCTTCTGCAGGGC
PAH-2 (Forward) CGGAATTCATGTCCTCCACCCCAGGCC
PAH-2 (Reverse) CCCAAGCTTTTACATCTTCTGCAGGGCATCGAC
PCD (Forward) CGGAATTCATGACTCTCAAGAAGCTCGATG
PCD (Reverse) CCGCTCGAGTTATTGCTTGAAGATCTCATCG
DHPR (Forward) CGGAATTCATGGTTTCTAGCATCGTCGTCTAT
DHPR (Reverse) CCGCTCGAGTTACTTCTCGGTGTACGTGGTGT
a Restriction cleavage sites are underlined. 782
783
on October 11, 2020 by guest
http://aem.asm
.org/D
ownloaded from
42
Table 2. Kinetic parametersa 784
Enzyme Substrate Km Vmax
(mM) (μM/min)
PAH-1 Phenylalanine 0.1750±0.003962 3.827±0.1342
PAH-1 BH4 0.1253±0.002518 2.176±0.03927
PAH-2 Phenylalanine 0.06885±0.002018 11.21±0.2164
PAH-2 BH4 0.04778±0.001889 5.879±0.06391 a The data shown are the averages of three independent experiments. 785
on October 11, 2020 by guest
http://aem.asm
.org/D
ownloaded from
