The subcellular localisation, tissue expression,
substrate specificity and binding partners of
Stress-Activated Protein Kinase-3
By
Naomi Wynne Court
Bachelor of Science (Hons)
This thesis is submitted for the degree of Doctor of Philosophy
University of Western Australia
School of Biomedical & Chemical Sciences
Discipline of Biochemistry & Molecular Biology
2004
DECLARATION
The research presented in this thesis is my own work, with the exception of staining of
E16.5 and E13.5 mice with the SAPK3 antibody (Figure 4.8 and Figure 4.9), which was
performed by Emerald Perlas. This work was carried out at the School of Biomedical
and Chemical Sciences in the Discipline of Biochemistry and Molecular Biology at the
University of Western Australia. This thesis has not been submitted for any other degree
Naomi Wynne Court
18-06-2004
i
ACKNOWLEDGEMENTS There are a number of people who I would like to extend my sincere appreciation to. First and foremost, my supervisor Marie, the kinase queen, for all her patience, enthusiasm and wisdom. Thank you for always encouraging me and challenging me, for your advice, for listening to my presentations, proof-reading my work, and writing references. It has been a real privilege to learn from you and I greatly appreciate everything you have done for me. Secondly, to the Bogoyevitch lab members (past and present) for all the fun times – I will leave with many fond memories! I think I will be hard-pressed to find such a great group of people to work with in the future. Special thanks to Renae, Dom (aka “Twinny”), Bahareh, Cecilia, Ingrid and Marilyn who made the lab a happy place to be and who have been great friends in and out of the lab. I will miss all the cake! Thank you to Oonagh and Ivana, for helping me to make the Sab mutant GST-fusion proteins during their third-year projects. Special thanks to Oonagh for carrying on the SAPK3 project! I would also like to thank “non-Bogoyevitch lab” people for making the Biochemistry department such a friendly place to be. Particularly Roopwant Judge, Corrine Porter, Lauren Goldie, Eiling Tan, Sean Lim and Sandra Tanz. I would like to thank Peter Klinken for letting me perform the yeast-two hybrid part of my project in his lab at the Western Australian Institute for Medical Research. Special thanks to Evan Ingley, who helped me to perform the library screen, and for his patience with my endless questions. Thank you to Miranda Grounds for allowing me to steal people from her lab to help me with mouse work. Special thanks to Marilyn Davies for euthanasing mice for me and always being happy to help me out. Thank you to Paul Rigby, for his friendly help with the use of the confocal microscope. Thank you to Nadia Rosenthal and her lab members for making me feel so welcome when I was there to learn about mouse embryology lab techniques. Special thanks to Maria Paola, Esfir, and Emerald for helping me out with mouse work. Thank you to Simone Ross for breeding mice for me. I would like to thank the following people for supplying constructs, samples and antibodies during the course of my project: Patrick Humbert, for the Scribble antibody; Jim Whelan, for the HSP60 antibody; Pietro De Camilli, for the HA-OMP25 construct; Carolyn Wiltshire, for the Sab constructs (wild-type and KIM mutants); Ana Cuenda, for
ii
the GST-α1-Syntrophin construct; Angel Nebreda, for the MalE-MKK6(DD) construct; and Cris dos Remedios for the human heart samples. Thank you to George Yeoh for the use of his camera to photograph the embryo sections. Thank you to Jenny, Greg, Jude and Eddy for your help with all things administrative and computers! I would like to sincerely thank the Heart Foundation and Australian Federation of University Women for providing me with scholarships during the course of my PhD. Finally (almost), I would like to thank the people outside of university who have kept me sane during my PhD. This includes all of my friends (you know who you are), and family: Dad, Kate, Sam, Harry, Bernie, Wez and particularly Mum, who has always been supportive of me in whatever I do. And last but certainly not least, Dave, for being the kind and warm-hearted person that you are – thank you for putting up with all my bad moods and helping me to see the light at the end of the tunnel. I love you!
iii
PUBLICATIONS
Data presented in this thesis has been published or submitted for publication as follows:
Court NW, Ingley E, Klinken SP, and Bogoyevitch MA. Outer Membrane Protein 25 – a
mitochondrial anchor and inhibitor of Stress-Activated Protein Kinase-3. Submitted.
Court NW, Kuo I, Quigley O, and Bogoyevitch MA. (2004). Phosphorylation of the
mitochondrial protein Sab by stress-activated protein kinase 3. Biochem Biophys Res
Commun. 319, 130-137.
Court NW, dos Remedios CG, Cordell J, and Bogoyevitch MA. (2002). Cardiac
expression and subcellular localization of the p38 mitogen-activated protein kinase
member, stress-activated protein kinase-3 (SAPK3). J Mol Cell Cardiol. 34, 413-426.
Additional contributions during the candidature of this degree included:
Bogoyevitch MA and Court NW. (2004). Counting on mitogen-activated protein kinases - ERKs 3, 4, 5, 6, 7 and 8. Cell Signal. In Press.
Ng DC, Court NW, dos Remedios CG, Bogoyevitch MA. (2003). Activation of signal
transducer and activator of transcription (STAT) pathways in failing human hearts.
Cardiovasc Res. 57, 333-346.
Bogoyevitch MA, Ng DC, Court NW, Draper KA, Dhillon A, and Abas L. (2000). Intact
mitochondrial electron transport function is essential for signalling by hydrogen
peroxide in cardiac myocytes. J Mol Cell Cardiol. 32,1469-1480.
iv
ABBREVIATIONS
APAAP Alkaline Phosphatase and Anti-Alkaline
Phosphatase
ASK1 Apoptosis signal-regulating kinase 1
ATP Adenosine triphosphate
BCIP 5-bromo-4-chloro-3-indolyl-phosphate
BSA Bovine serum albumin
DEPC Diethyl pyrocarbonate
Dlg Discs-large
DLK Dual leucine zipper-bearing kinase
DMSO Dimethyl sulfoxide
DNA Deoxyribonucleic acid
DTT Dithiothreitol
EDTA Ethylenediaminetetraacetic acid
EGF Epidermal growth factor
ERK Extracellular signal-regulated kinase
FCS Foetal calf serum
FGF Fibroblast growth factor
GDP Guanine diphosphate
GEF Guanine nucleotide exchange factor
GST Glutathione-S-transferase
GTP Guanine triphosphate
HA Hemagglutinin
v
HEK Human embryonic kidney
HtrA2 High temperature requirement A 2
IPTG Isopropyl-beta-D-thio galactopyranoside
IL-1 Interleukin-1
JIP1 JNK interacting protein 1
JNK c-Jun N-terminal kinase
KIM Kinase interaction motif
LB Luria-Bertani
LIF Leukemia inhibitory factor
MalE Maltose binding protein
MDCK Madin-Darby canine kidney
MAPK Mitogen-activated protein kinase
MEF Myocyte enhancing factor
MEK Mitogen-activated protein kinase kinase/ERK
kinase
MEKK Mitogen-activated protein kinase kinase
kinase/ERK kinase kinase
MKK Mitogen-activated protein kinase kinase
MKK Mitogen-activated protein kinase kinase kinase
MLK Mixed-lineage kinase
MORG1 Mitogen-activated protein kinase organizer 1
MP1 MEK partner 1
MRK Mixed lineage kinase-related kinase
NBT Nitroblue tetrazolium chloride
vi
NCBI National Center for Biotechnology Information
NCS Newborn calf serum
NES Nuclear export signal
NGF Nerve growth factor
OMP25 Outer membrane protein 25
PAK1 p21-activated kinase 1
PAPK Polyploidy-associated protein kinase
PBS Phosphate-buffered saline
PCR Polymerase chain reaction
PDZ PSD-95/Discs-Large/ZO-1
PEG Polyethylene glycol
PH Pleckstrin homology
PICK1 Protein that interacts with C-kinase 1
PKA Protein kinase A
PKC Protein kinase C
PKN Protein kinase N
PMSF Phenyl methyl sulfonyl fluoride
PSD-95 Post-synaptic density-95
PTB Phospho-tyrosine binding
RNA Ribonucleic acid
RT Room temperature
Sab SH3 domain-binding protein that preferentially
associates with Btk
SAPK Stress-activated protein kinase
SB Smithkline Beecham
SDS-PAGE Sodium dodecyl sulphate polyacrylamide gel
electrophoresis
vii
SH2 Src homology 2
SH3 Src homology 3
Sos Son of sevenless
SAP90 Synapse-associated protein 90
TAB Transforming growth factor-β-activated protein
kinase 1-binding protein 1
TAK1 Transforming growth factor-β-activated kinase 1
TBST Tris-Buffered Saline with Tween
TNF Tumour necrosis factor
ZO-1 Zona occludens-1
viii
TABLE OF CONTENTS
Declaration i
Acknowledgements ii
Publications iv
Abbreviations v
Table of contents ix
List of figures xv
List of tables xix
Abstract xx
Chapter 1: Introduction and Literature Review 1
1.1 Intracellular signalling and protein kinases 1
1.2 The Mitogen-Activated Protein Kinases: Extracellular Signal- 2
Regulated Kinases as the paradigm
1.3 Parallel MAPK signalling pathways 5
1.3.1 The JNK MAPK family 6
1.3.2 The p38 MAPK family 6
1.3.3 Regulation of interactions in the MAPK pathways 8
1.4 Stress-Activated Protein Kinase-3 10
1.4.1 Evolutionary conservation and structure of SAPK3 10
1.4.2 SAPK3 expression and activation 11
1.4.3 SAPK3 substrate specificity and potential roles in the cell 13
1.4.4 SAPK3 intracellular localisation 14
1.4.5 SAPK3 contains a unique C-terminal tail 14
1.5 Study aims 16
Chapter 2: Materials and Methods 18
2.1 Reagents and chemicals 18
2.2 Antibodies 19
2.3 Methods 19
ix
2.3.1 Culture of cell lines 19
2.3.2 Isolation of rat neonatal cardiac myocytes 20
2.3.3 Preparation of coverslips for immunostaining 21
2.3.4 Cell transfection 22
2.3.4(a) Lipofectamine only transfection protocol 23
2.3.4(b) Lipofectamine and Lipofectamine Plus transfection
protocol 23
2.3.5 Cell treatments 24
2.3.6 Isolation of embryonic mice and embryonic mouse hearts 25
2.3.7 Processing of embryos for sectioning 26
2.3.8 Immunostaining 27
2.3.8(a) Immunostaining of cultured cells 27
2.3.8(b) Immunostaining of mouse embryo sections 28
2.3.8(c) Wholemount staining of mouse embryos 29
2.3.9 Haematoxylin and eosin staining 30
2.3.10 Scanning confocal microscopy 30
2.3.11 Preparation of cell extracts 31
2.3.12 Preparation of extracts from tissue samples 32
2.3.13 Protein estimation 32
2.3.13(a) Spectrophotometric estimation 32
2.3.13(b) Estimation using SDS-PAGE separated proteins 32
2.3.14 Immunoprecipitation for subsequent Western blotting 33
2.3.15 Immunoprecipitation for subsequent kinase assays 33
2.3.16 Activation of GST-SAPK3, GST-JNK2 and GST-ERK2 34
2.3.17 Kinase assays 34
2.3.18 SDS-PAGE 35
2.3.19 Western blotting 36
2.3.20 Stripping Western blots 37
2.3.21 Preparation of competent E. coli 38
2.3.22 Transformation of XL1-Blue and BL21 DE3 plyss E.coli
strains with plasmid DNA 39
x
2.3.23 Preparation of plasmid DNA using the QIAGEN miniprep and
maxiprep kits 39
2.3.24 Isolation of RNA from embryonic, neonatal and adult mouse
hearts 40
2.3.25 Quantitation of RNA and DNA samples 40
2.3.26 Agarose gel electrophoresis 40
2.3.27 DNA sequencing 41
2.3.28 Expression and purification of recombinant proteins 42
2.3.29 Recombinant DNA techniques 43
2.3.30 Restriction enzyme digest 44
2.3.31 Polymerase chain reaction (PCR) 44
2.3.32 Reverse transcription PCR 45
2.3.33 DNA ligation 46
2.3.34 Site-directed mutagenesis 46
2.3.35 Yeast two-hybrid screening 47
2.3.36 Preparation of selective media for yeast two-hybrid screening 48
2.3.37 Large-scale yeast transformation 49
2.3.38 β-galactosidase assay 51
2.3.39 Preparation of glycerol stocks of yeast two-hybrid screening
positive colonies 51
2.3.40 Isolation of DNA from the S. cerevisiae strain L40 52
2.3.41 Preparation of electrocompetent KC8 cells 52
2.3.42 Bacterial electroporation 53
2.3.43 Isolation of plasmid DNA from KC8 bacterial cells 54
2.3.44 Small-scale yeast transformation 54
2.3.45 Screening of a cDNA library with the SAPK3 antibody 55
2.3.46 Initial preparation for the library screening procedure 55
2.3.47 Establishing the library titre 55
2.3.48 Screening procedure 56
xi
Chapter 3: Evaluation of the expression and localisation of SAPK3 in
cell culture models 58
3.1 Introduction 58
3.2 Results 61
3.2.1 A specific anti-SAPK3 monoclonal antibody suitable for
immunoblotting and immunolocalisation 61
3.2.2 SAPK3 shows a punctate localisation in HEK293 fibroblasts
and cardiac myocytes 62
3.2.3 Leptomycin B treatment confirms SAPK3 cytoplasmic
localisation 64
3.2.4 SAPK3 co-localises with mitochondrial markers 64
3.2.5 SAPK3 overexpression does not appear to alter the morphology
or survival of cardiac myocytes 65
3.2.6 SAPK3 phosphorylation and expression in response to agonist
treatment 66
3.3 Discussion 66
Chapter 4: Evaluation of the expression and activation of SAPK3 in the
intact heart 71
4.1 Introduction 71
4.2 Results 73
4.2.1 SAPK3 is expressed in the heart 73
4.2.2 SAPK3 expression levels do not change in human heart disease 75
4.2.3 SAPK3 is expressed throughout embryonic and postnatal
development of the heart 76
4.3 Discussion 79
Chapter 5: Investigation of the substrate specificity of SAPK3 83
5.1 Introduction 83
5.2 Results 86
5.2.1 The activation of SAPK3 in vitro 86
xii
5.2.2 Investigating the phosphorylation of mitochondrial proteins
by SAPK3 87
5.2.3 Investigating the phosphorylation of the mitochondrial protein
Sab by SAPK3 89
5.2.4 Loss of the first Kinase Interaction Motif (KIM) of Sab prevents
its phosphorylation by SAPK3 90
5.2.5 Serine 321 in Sab is the major site of phosphorylation by SAPK3
and JNK2 92
5.2.6 Surrounding sequence composition and location dictate the
favouring of Ser321 in Sab 93
5.3 Discussion 95
Chapter 6: Identification of proteins that bind to SAPK3 by a PDZ
domain-mediated interaction 103
6.1 Introduction 103
6.2 Results 105
6.2.1 Screening a yeast two-hybrid library with full-length SAPK3 105
6.2.2 SAPK3 interacts with Scribble and Lin-7C by yeast two-hybrid
analysis 107
6.2.3 SAPK3 interacts with the mitochondrial outer membrane protein,
OMP25 110
6.2.4 OMP25 can act as an inhibitor of SAPK3 in vitro 113
6.3 Discussion 114
Chapter 7: General Discussion 120
7.1 General Discussion 120
7.1.1 Evaluating the expression and subcellular localisation of SAPK3
in cultured cells 120
7.1.2 SAPK3 expression in the intact heart and evaluation of its role
in cardiac development and disease 122
7.1.3 Determining the substrate specificity of SAPK3 123
xiii
7.1.4 Searching for binding partners of SAPK3 127
7.2 Conclusions 128
Chapter 8: References 130
Appendices 157
xiv
Appendix II could not be included in this digital thesis for copyright reasons. Please refer to the print copy of the thesis, held in the University Library.
LIST OF FIGURES
Figure 1.1 Protein kinases 1a
Figure 1.2 Schematic diagram of the organisation of the ERK MAPK
pathway 3a
Figure 1.3 The structure of inactive and active (phosphorylated) ERK2 4a
Figure 1.4 Parallel MAPK phosphorylation cascades 6a
Figure 1.5 The structure of activated SAPK3 complexed with ATP 10a
Figure 1.6 Potential signalling intermediates leading to the activation
of SAPK3 12a
Figure 1.7 A Class I PDZ domain complexed with a peptide substrate 15a
Figure 2.1 Insertion of full-length rat SAPK3 into pBTM116 for yeast
two-hybrid screening 43a
Figure 2.2 The design of primers to insert a fragment of OMP25 into
the pVP16 vector 43b
Figure 2.3 Insertion of amino acids 37-177 of rat OMP25 into pVP16 43c
Figure 3.1 SAPK3 can be detected in HEK293 and neonatal rat cardiac
myocyte cell lysates 62a
Figure 3.2 Endogenous SAPK3 shows a punctate cytoplasmic distribution
in HEK293 fibroblasts 63a
Figure 3.3 Endogenous SAPK3 shows a punctate cytoplasmic distribution
in neonatal rat cardiac myocytes 63b
Figure 3.4 SAPK3 has a punctate cytoplasmic localisation and this does not
alter with Leptomycin B treatment of neonatal rat cardiac
myocytes 64a
Figure 3.5 SAPK3 does not co-localise with Paxillin in cardiac myocytes 64b
Figure 3.6 SAPK3 co-localises with mitochondrial markers 65a
Figure 3.7 Overexpression of SAPK3 in cardiac myocytes does not appear
to induce morphological changes or cell death 65b
Figure 3.8 Overexpression of SAPK3 in cardiac myocytes does not appear
to induce morphological changes or cell death 65c
xv
Figure 3.9 SAPK3 expression levels do not change in response to agonist
treatment of cultured cardiac myocytes 66a
Figure 3.10 Agonist treatment stimulates phosphorylation of SAPK2a, but
not SAPK3, in cultured cardiac myocytes 66b
Figure 4.1 SAPK3 is expressed in the whole heart 73a
Figure 4.2 SAPK3 expression decreases in neonatal cardiac myocytes with
increased culture time 74a
Figure 4.3 SAPK3 is expressed in the hearts of various species 75a
Figure 4.4 SAPK3 shows a relatively restricted tissue distribution in the
mouse 75b
Figure 4.5 SAPK3 expression levels do not change in failing human hearts 76a
Figure 4.6 SAPK3 is constantly expressed during cardiovascular
development 77a
Figure 4.7 Haematoxylin and eosin staining of E16.5, E13.5 and E12.5 mice 78a
Figure 4.8 SAPK3 is expressed in various tissues of the E16.5 mouse 78b
Figure 4.9 SAPK3 is expressed in various tissues of E13.5 and E12.5 mice 78c
Figure 4.10 SAPK3 expression in E8.5 and E10.5 embryos using wholemount
staining 78d
Figure 5.1 Optimising a protocol for GST-SAPK3 activation 86a
Figure 5.2 GST-SAPK3 pre-incubated with MalE-MKK6(DD) shows
increased activity towards GST-ATF2 87a
Figure 5.3 Expression of overexpressed mitochondrial proteins in HEK293
fibroblasts 87b
Figure 5.4 Immunoprecipitation of mitochondrial proteins from HEK293
fibroblast lysates 88a
Figure 5.5 SAPK3 can phosphorylate mitochondrial proteins involved in
apoptosis 89a
Figure 5.6 Sab is a substrate of SAPK3 in vitro 90a
Figure 5.7 GST-JNK2 shows different substrate preferences to GST-SAPK3
in vitro 90b
Figure 5.8 GST-ERK2 does not phosphorylate Sab in vitro 90c
xvi
Figure 5.9 A C-terminal SAPK3 peptide inhibits the phosphorylation of
α1-Syntrophin but not Sab, by SAPK3 91a
Figure 5.10 Loss of the first Kinase Interaction Motif of Sab prevents its
phosphorylation by SAPK3 91b
Figure 5.11 A Ser321Ala mutant of Sab is not phosphorylated by SAPK3 93a
Figure 5.12 A Ser321Ala mutant of Sab is not phosphorylated by JNK2 93b
Figure 5.13 The phosphorylation of Sab by SAPK3 is dependent on the
surrounding sequence and the position of the site within Sab 94a
Figure 5.14 Analysis of sequence determinants for phosphorylation at the
+2 and +3 positions of Ser321 95a
Figure 6.1 pBTM116-SAPK3 is unable to activate transcription alone in
the yeast two-hybrid system 106a
Figure 6.2 Screening the yeast two-hybrid EML Clone.1 cDNA library
using full-length SAPK3 106b
Figure 6.3 The identification of Scribble and Lin7C as SAPK3-interacting
proteins by yeast two-hybrid screening 107b
Figure 6.4 Scribble and Lin7C clones isolated in yeast two-hybrid screening 107c
Figure 6.5 The expression of Scribble in adult mouse tissues 109a
Figure 6.6 Determining the localisation of SAPK3 and Scribble in MDCK
cells 109b
Figure 6.7 Schematic diagram of Outer Membrane Protein 25 (OMP25) 110a
Figure 6.8 Overexpression of HA-OMP25 in HEK293 fibroblasts 110b
Figure 6.9 Confirmation of OMP25 and SAPK3 co-localisation 111a
Figure 6.10 Interaction of SAPK3 with OMP25 detected by yeast two-hybrid
analysis 111b
Figure 6.11 SAPK3 and OMP25 are co-immunoprecipitated from cells 112a
Figure 6.12 Using HA-OMP25(NLS) to alter the subcellular localisation of
SAPK3 113a
Figure 6.13 The expression of GST-OMP25 in bacteria 113b
Figure 6.14 OMP25 is not a substrate of SAPK3 in vitro 114a
xvii
Figure 6.15 GST-OMP25 inhibits the phosphorylation of GST-Sab and
GST-α1-Syntrophin by SAPK3 in vitro 114b
xviii
LIST OF TABLES
Table 1.1 Cells and tissues with detected expression of SAPK3
mRNA or protein. 11a
Table 2.1 List of Primary Antibodies Used During the Course
of this PhD Project 19a
Table 2.2 List of Secondary Antibodies Used During the Course
of this PhD Project 19b
Table 2.3 Eukaryotic Expression Vectors and Inserts. 22a
Table 2.4 GST- and MalE-Fusion Proteins. 42a
Table 2.5 List of Mutations Made to Proteins During the Course
of this PhD Project 47a
Table 6.1 Summary of SAPK3 interacting clones isolated
using yeast two-hybrid analysis 107a
xix
ABSTRACT
Cells need to be able to detect changes in their surrounding environment
and transduce these signals into the appropriate cellular compartments. One of the
major ways that the cell achieves this signal transduction is through the process of
phosphorylation. Protein kinases are the enzymes responsible for catalysing this transfer
of phosphate groups from ATP to amino acid residues of their specific substrates. A
subfamily of serine/threonine kinases known as the Mitogen-Activated Protein Kinases
(MAPKs) is essential in a diverse range of cell processes including growth, metabolism,
differentiation and death.
The first identified MAPKs, the Extracellular Signal-Regulated Kinases
(ERKs), were found to be activated in response to mitogenic stimuli such as growth
factors. However, since the discovery of the ERKs, other pathways leading to the
activation of related kinases have been recognised. These kinases are preferentially
activated in response to stress, and are thus termed “Stress-Activated Protein Kinases” or
SAPKs. They consist of the c-Jun N-terminal kinase isoforms 1, 2 and 3 (also called
SAPK1γ, SAPK1α and SAPKβ respectively) and the p38 MAPKs, p38α, p38β, p38γ
and p38δ (also called SAPK2a, SAPK2b, SAPK3 and SAPK4 respectively). A major
challenge in this field has been to identify the substrates and functions of the SAPKs.
This has been partly achieved by the development of inhibitors for the JNK MAPKs and
SAPK2a/b. However, no inhibitors currently exist that specifically inhibit SAPK3 and
SAPK4. Therefore, elucidating the function of these SAPKs has proved more difficult.
Recent studies suggest that SAPK3 may play a unique role in the cell
compared to other members of the p38 MAPK family. For example, several signalling
proteins appear to specifically activate SAPK3 in certain circumstances while not
activating other members of the p38 MAPK family. In addition, SAPK3 contains a
unique sequence motif that allows it to bind to specialised domains known as PDZ
domains. The interaction of SAPK3 with proteins containing these domains may
regulate its subcellular localisation and interactions with other proteins in the cell.
xx
This project was undertaken to expand the knowledge on the expression,
localisation, substrate specificity and binding partners of SAPK3. In Chapter 3 of this
thesis, a SAPK3 monoclonal antibody was evaluated for its ability to specifically
recognise endogenous SAPK3 protein. SAPK3 was found to be expressed in
immortalised cell lines and primary cultures of neonatal rat myocytes, and to be co-
localised with the mitochondria of these cells. This co-localisation remained unaltered
in response to treatment with the nuclear export inhibitor Leptomycin B, and with
exposure to osmotic shock, suggesting that SAPK3 substrates may be localised at the
mitochondria.
In Chapter 4, the expression of SAPK3 in different tissue types was
examined. SAPK3 was found to be expressed at its highest levels in skeletal muscle
tissue, with lower levels in other tissues such as lung, testes and heart. SAPK3
expression was detected in heart samples of various mammalian species, suggesting its
evolutionary conservation. SAPK3 was also identified in samples of left ventricular
tissue taken from patients with heart failure and non-failing donor hearts, and during
pre- and post-natal development of the rat and mouse heart. These results suggest a
potential role for SAPK3 in heart disease and development.
In Chapter 5 SAPK3 was shown to phosphorylate various mitochondrial
substrates, including various members of the Bcl2 protein family, and Sab, an in vitro
substrate previously attributed to JNK. Mutational analysis of this substrate identified
sequence determinants required for SAPK3 phosphorylation. Finally, Chapter 6
employed a Yeast 2-hybrid screening approach to identify binding partners that may
interact with SAPK3 in a cellular context. This screen identified the PDZ proteins Lin-
7C and Scribble, suggesting that SAPK3 interactions are governed by its PDZ domain
binding motif. SAPK3 was also shown to interact with the mitochondrial PDZ protein
OMP25. Subsequently, it was demonstrated that OMP25 could inhibit SAPK3 activity,
suggesting a novel mechanism for negative regulation of this kinase within the cell.
xxi
In conclusion, the results presented in this thesis expand the knowledge on
a poorly-characterised member of the p38 MAPK family. The tissue distribution,
mitochondrial localisation, substrate specificity and binding partner selection place
SAPK3 as a unique member of the p38 MAPK family. In combination with future in
vivo studies employing the use of specific inhibitors and knockout models of this kinase,
these results should allow the importance of SAPK3 in cell signalling systems to be
realised.
xxii
Chapter 1
Introduction and Literature Review
1.1 Intracellular signalling and protein kinases
Alterations in the extracellular environment are communicated into and
throughout a cell via complex intracellular signalling pathways. These signalling
pathways contribute to the regulation of a variety of different cellular responses,
including growth, morphogenesis, differentiation, and death (Assoian, 2002). A variety
of different molecules act in these pathways, and these include the transmembrane
receptor proteins themselves as well as adaptor proteins, scaffolding proteins, enzymes
and inhibitors (Marshall, 2000). Of the enzyme catalysed reactions, protein
phosphorylation has been extensively studied as a critical control mechanism in
intracellular signalling.
Protein kinases are the enzymes responsible for catalysing the transfer of
the γ-phosphate of adenosine triphosphate (ATP) to a specific amino acid residue on a
protein acceptor molecule in a process commonly referred to as phosphorylation (Hanks
and Hunter, 1995). This is summarised in Figure 1.1A. The addition of phosphate
groups to protein substrates alters their structure, and this usually equates to a change in
function or activity. Protein kinases are classified according to the amino acid which
they phosphorylate. Thus, there are the serine/threonine kinases, which can
phosphorylate either serine or threonine residues (Graves et al., 1995), the tyrosine
kinases, which can only phosphorylate tyrosine residues (Tsygankov, 2003), and the
dual specificity kinases, which are capable of phosphorylating serine, threonine or
tyrosine residues in a protein substrate (Dhanasekaran and Premkumar, 1998). It has
also become apparent that other groups of protein kinases exist which do not
phosphorylate these typical amino acid residues, such as the histidine kinases, however
in many of the reported cases of histidine kinases, the γ-phosphate is transferred via an
intermediate amino acid (such as aspartate) before its transfer to histidine of the
substrate (Steeg et al., 2003).
In addition to the catalysis of the phosphorylation reaction, serine/threonine
or tyrosine protein kinases can also be identified by their conserved amino acid
1
A
O P O-
O-
O
Protein
Protein Kinase
Protein
Protein Phosphatase H2OPi
OH
Mg2+ ATP Mg2+ ADP
B
GXGXXGK E
DXXXXNDFG
APEDXXXXG R
I II V VIA VIB VII VIII IX X XIIII IV
Amino-terminal lobe (ATP binding)
Carboxy-terminal lobe(peptide binding and phosphotransfer)
Figure 1.1: Protein kinases.(A) The covalent attachment of phosphate to the side-chain hydroxyl group of an amino acid residue (serine, threonine or tyrosine) is carried out by protein kinases. Protein phosphatases catalyse removal of the phosphate by hydrolysis.(B) Protein kinase sequences have been divided into eleven subdomains, which contain regions of conserved sequence. These sequence motifs are critical for processes such as ATP binding and substrate recognition by the kinase. Taken from: Hanks, Genome Biology 4: 111 (2003).
1a
sequences, which have been divided into a series of subdomains. This subdomain
structure is represented in Figure 1.1B, with conserved amino acids critical for protein
kinase activity indicated. Protein kinases have been conserved throughout evolution,
and are found in all mammalian species as well as in a variety of lower eukaryotes, such
as the worm, fly and yeast, as well as in prokaryotes (Manning et al., 2002a; Steeg et al.,
2003). Eukaryotic protein kinases are one of the largest groups of protein families,
making up 1.5% - 2.5% of all eukaryotic genes (Manning et al., 2002a; Manning et al.,
2002b). The conservation of protein kinases and their high levels of representation in
the genome reinforce the likely importance of protein phosphorylation in intracellular
signalling events.
1.2 The Mitogen-Activated Protein Kinases: Extracellular Signal-Regulated
Kinases as the paradigm
A superfamily of serine/threonine protein kinases known as the Mitogen-
Activated Protein Kinases (MAPKs), is activated in response to a variety of stimuli.
These stimuli include mitogens such as growth factors or hormones, but also cytokines
such as interleukin-1, tumour necrosis factor (TNF) and leukemia inhibitory factor
(LIF), and stresses such us ultra-violet and gamma irradiation, shear stress, osmotic
shock and chemical poisons (Widmann et al., 1999). The activation of MAPKs results
in the phosphorylation of substrates such as transcription factors, cytoskeletal proteins,
membrane proteins and other protein kinases (Widmann et al., 1999). Thus, MAPKs
can serve to link cytoplasmic and nuclear events in response to specific stimuli.
The archetypical MAPK members, the Extracellular signal-Regulated
Kinases (ERKs) 1 and 2, were originally found to be activated in response to insulin and
showed activity towards microtubule-associated protein-2 (Boulton et al., 1990). Since
this initial discovery, ERKs have been implicated in a variety of different cellular
functions, most commonly being associated with cell survival and proliferation (Okuda
et al., 1992; Cobb et al., 1994; Guyton et al., 1996). However ERK signalling has also
been associated with cell death (Stanciu et al., 2000; Stanciu and DeFranco, 2002;
2
Murray et al., 1998; Levinthal and DeFranco, 2004; Alessandrini et al., 1999). These
differences in signalling outcomes may arise from the differences in the kinetics and/or
duration of ERK signalling, the specific cell type in which the signalling occurs, and the
localisation of the ERK signalling events within the cell (Stanciu et al., 2000; Stanciu
and DeFranco, 2002). These additional considerations result in signalling events and
outcomes of even greater complexity.
The ERKs and other members of the MAPK family are activated in
response to mitogens and stress stimuli via a cascade of protein kinases in which a
protein kinase phosphorylates and activates the subsequent downstream protein kinase.
One result of this cascade of events is the amplification of signals (Seger and Krebs,
1995; Tibbles and Woodgett, 1999). The ERK cascade is the best-characterised of the
MAPK pathways and has acted as a paradigm for the study of other MAPK pathways
(Denhardt, 1996; Tibbles and Woodgett, 1999). This kinase cascade is typically
activated via transmembrane receptors such as the Epidermal Growth Factor (EGF)
receptor, which upon engaging their stimulus, autophosphorylate on tyrosine residues
(Margolis and Skolnik, 1994) (Figure 1.2). The following series of events then take
place. The tyrosine phosphorylated EGF receptor recruits proteins containing Src
Homology 2 (SH2) domains such as the protein Grb2, which recognise phosphorylated
tyrosine residues within specific sequence contexts (Kuriyan and Cowburn, 1997). Grb2
also contains a SH3 domain, which allows it to recruit the proline-rich motif of the
nucleotide exchange factor, Son of Sevenless (Sos) (Buday and Downward, 1993;
Chardin et al., 1993; Rozakis-Adcock et al., 1993). Thus, Grb2 acts as an adaptor
protein in the ERK signalling pathway, bringing upstream and downstream components
of the pathway together. Sos is a guanine nucleotide exchange factor (GEF) for the
small GTP-binding protein Ras, allowing for the exchange of Ras-bound guanine
diphosphate (GDP) for guanine triphosphate (GTP) (Chardin et al., 1993; Rozakis-
Adcock et al., 1993). Thus, Ras acts as a molecular switch, being inactive when bound
to GDP, and becoming active when bound to GTP (Shih et al., 1986).
3
Epidermal Growth Factor
EGF Receptor(Receptor Tyrosine Kinase)
PGrb2
Sos Ras
Raf PP
MKK1/2PP
ERK1/2PP
MKK1/2
ERK1/2
CytoskeletalproteinsTranscription
FactorsProtein Kinases
Cell Membrane
Extracellular Region
Intracellular Region
Farnesylmodification
Figure 1.2: Schematic diagram of the organisation of the ERK MAPK pathway.When growth factors (in this case, epidermal growth factor) activate their specific transmembrane receptors, these receptors undergo tyrosine phosphorylation. This creates binding sites for adaptor proteins with SH2 domains, such as Grb2. The SH3 domain of Grb2 binds proline-rich motifs of the guanine nucleotide exchange factor, Sos. This protein mediates the activation of the small GTP-binding protein, Ras, which is held at the cell membrane by a farnesylmodification. Once activated, Ras recruits the MAPKKK Raf to the membrane. Raf is then phosphorylated and adopts an active conformation, allowing it to catalyse the transfer of phosphate from ATP to MKK1/2. Once activated, MKK1/2 can then phosphorylate the MAPKs, ERK1/2. ERK1/2 are then able to phosphorylate a variety of different substrates, including transcription factors, cytoskeletal proteins and other protein kinases. The phosphorylation of these substrates alters their structure and thus their activity, leading to a specific cell response to the original stimulus.
3a
Ras remains localised at the cell membrane due to its C-terminal farnesyl
modification, catalysed by farnesyl transferase (Casey et al., 1989; Maltese et al., 1990;
Reiss et al., 1990). The activation of Ras results in the recruitment of the
serine/threonine kinase Raf to the cell membrane. This recruitment and subsequent
phosphorylation of Raf results in its activation, thus marking the beginning of the
MAPK phosphorylation cascade, with the subsequent phosphorylation of the dual
specificity kinase, MAPK kinase (MKK) 1/2. Once phosphorylated by Raf, MKK1/2
becomes active and is able to phosphorylate the MAPKs, ERK1 and ERK2 (Widmann et
al., 1999).
MAPKs such as ERK1 and ERK2 become activated by dual
phosphorylation on a Thr-Xaa-Tyr motif in a surface loop known as the
“phosphorylation loop”, located in subdomain VIII of the kinase (Figure 1.1) (Payne et
al., 1991; Ahn et al., 1991). In the case of ERK1/2, this phosphorylation occurs on a
Thr-Glu-Tyr motif, and phosphorylation of threonine and tyrosine leads to over 1000-
fold activation of ERK1 and ERK2 (Robbins et al., 1993). Phosphorylation of Thr183
allows ionic contacts to be made with residues in the N-terminal domain of the kinase.
This causes the N- and C-terminal domains to rotate toward each other, organising
catalytic residues within the active site and therefore exposing the substrate binding site
(Canagarajah et al., 1997) (Figure 1.3). The phosphorylation of Tyr185 positions this
residue on the surface of the enzyme where it can participate in substrate recognition. It
is thought that this forms the basis for MAPK specific substrate recognition of serine or
threonine residues that are directly followed by a proline residue (Canagarajah et al.,
1997; Alvarez et al., 1991; Clark-Lewis et al., 1991).
The phosphorylation of Thr183 and Tyr185 appears essential for the
activation of ERK2, and mutations of these residues to glutamate (which can mimic
phosphorylation and thus activity for some protein kinases (Mansour et al., 1994)) does
not confer constitutive activation (Robbins et al., 1993; Canagarajah et al., 1997).
Therefore, studies evaluating the effects of overexpressing activated MAPKs within
cells cannot simply be achieved by the mutation of the MAPK itself. Instead these
4
Figure 1.3: The structure of inactive and active (phosphorylated) ERK2.(A) The phosphorylation loop (Lip) of inactive ERK2 occludes the active site of the kinase. (B) In the active form of ERK2, phosphorylated Thr183 forms ionic contacts with residues in the N-terminal domain, causing domain rotation and a re-organisation of catalytic residues within the active site, exposing the substrate binding site. Phosphorylated Tyr185 is positioned on the surface of the enzyme where it can participate in substrate recognition. This is thought to form the basis for ERK2 recognition of substrate phosphorylation sites that are directly followed by a proline residue. The catalytic loop (“C-loop”) in subdomain VI contains the conserved Asp147 and Asn152 residues which are important in catalysis. Taken From: Canagarajah et al., Cell 90: 859-869 (1997).
B
A
4a
studies require the co-expression of the MAPK with its upstream activating kinases or
the addition of a MAPK-activating stimulus to the cells.
Once phosphorylated, ERKs can phosphorylate substrates such as other
protein kinases (Chen et al., 1992), cytoskeletal proteins (Lefebvre et al., 2002; Terret et
al., 2003), or membrane proteins (Wu et al., 2003). Alternatively, ERKs have been
shown to translocate to the nucleus, where they phosphorylate transcription factors
(Chen et al., 1992; Boulton TG et al., 1991).
The phosphorylation of substrates by MAPKs is proline-directed in that
MAPKs phosphorylate serine or threonine residues directly followed by a proline.
Specifically, the consensus site for MAPK phosphorylation has been determined as Pro-
Xaa-Ser/Thr-Pro or Xaa-Xaa-Ser/Thr-Pro, where Xaa is any amino acid (Alvarez et al.,
1991; Clark-Lewis et al., 1991). This was determined by sequence alignment of
different MAPK substrates, as well as by the use of synthetic peptides to define the
optimal consensus phosphorylation site (Alvarez et al., 1991; Clark-Lewis et al., 1991).
However not all serine or threonine residues followed by proline residues are
phosphorylated in intracellular proteins and clearly additional substrate recognition
motifs must exist for the MAPKs.
1.3 Parallel MAPK signalling pathways
Since the initial identification of the ERK MAPK signalling pathway, other
similar pathways have been identified (Bogoyevitch and Court, 2004; Barr and
Bogoyevitch, 2001; Kyriakis and Avruch, 2001). These pathways are most commonly
activated in response to stress stimuli rather than mitogenic stimuli. The two pathways
that have been studied the most to date are those leading to the activation of the c-Jun N-
terminal Kinases (JNKs) and the p38 MAPKs (Kyriakis and Avruch, 2001).
5
1.3.1 The JNK MAPK family
The JNK MAPKs were first identified as kinases activated in response to
UV irradiation that could phosphorylate amino acids Ser63 and Ser73 of the
transcription factor c-Jun and result in increases in its transcriptional activity (Derijard et
al., 1994; Hibi et al., 1993; Westwick et al., 1994). The JNK MAPKs are
phosphorylated by the upstream activators, MKK4 and MKK7 (Derijard et al., 1995;
Yao et al., 1997) (Figure 1.4). Since their initial identification, the JNKs have been
implicated in a diverse number of processes including cell survival, proliferation,
differentiation, development and apoptosis (Lamb et al., 2003; Du et al., 2004; Nagata et
al., 1998; Kim and Freeman, 2003; Kuan et al., 1999; Deng et al., 2003). Due to their
activation in response to stress stimuli, the JNKs have also been referred to as “Stress-
Activated Protein Kinases” (SAPKs) and the three JNK isoforms (JNK1, JNK2 and
JNK3) are also termed SAPKγ, SAPKα and SAPKβ respectively (Cohen, 1997).
1.3.2 The p38 MAPK family
The p38 MAPKs are also activated mainly in response to environmental
stress, as well as cytokines such as interleukin-1 (IL-1) and tumour necrosis factor
(TNF)-α (Han et al., 1994; Raingeaud et al., 1995). The archetypical member of the p38
MAPK family, p38α, was first identified when activated in response to
lipopolysaccharide (Han et al., 1994). Since this initial discovery, a further three p38
MAPK family members have been identified, namely p38β, p38γ, and p38δ (Jiang et al.,
1996; Li Z et al., 1996; Jiang et al., 1997). Due to their activation in response to stress,
the p38 MAPKs are also referred to as SAPK2a, SAPK2b, SAPK3 and SAPK4,
respectively (Cohen, 1997).
SAPK2a and SAPK2b share 74% sequence identity and comparable tissue
distribution patterns with regards to mRNA expression (Jiang et al., 1996).
Furthermore, these two kinases share similar substrate preferences and are both
susceptible to inhibition by the ATP-competitive pyridinyl imidazole SmithKline
6
Raf, Mos
MEKK1-4, MLK2/3,
TPL2, DLKTAK1,
PAK, ASK1MKKK
MEKK1
MKK MKK1, MKK2
MKK4, MKK7
MKK3,MKK6
MKK4
MAPK ERK JNK p38/SAPK2a
Figure 1.4: Parallel MAPK phosphorylation cascades.MAPKs are activated by a cascade of protein kinases in which a MKKK phosphorylates and activates a MKK which then phosphorylates and activates a MAPK. Although cross-talk occurs at the level of the MKKK, the interactions of MKKs with their MAPKs is very specific. This is supported by MKKs having the lowest number of members in the MAPK cascade. In contrast, a relatively large number of MKKKs have been identified. These proteins often contain motifs suchas Pleckstrin Homology (PH) domains, proline-rich regions for binding SH3 domains, as well as phosphorylation sites for serine/threonine and tyrosine kinases. The presence of these different domains allows for a diverse set of interactions within each cascade (Garrington and Johnson, 1999).
6a
Beecham inhibitors SB202190 and SB203580 (Jiang et al., 1996; Enslen et al., 1998).
In contrast, the more recently identified members of the p38 MAPK subfamily, SAPK3
and SAPK4, are insensitive to inhibition with these compounds (Kumar et al., 1997;
Cuenda et al., 1997; Goedert et al., 1997a). It has been determined that the alteration of
a single amino acid in the ATP binding region of JNK1, SAPK3 or SAPK4 confers
sensitivity to SB203580, highlighting the structural similarities of the MAPK
superfamily (Eyers et al., 1998). Due to the lack of inhibitors for SAPK3 and SAPK4,
elucidating the substrate specificity and function of SAPK3 and SAPK4 has proved to be
a more challenging task (Cohen, 1997).
The p38 MAPK family members are phosphorylated by the direct upstream
activators, MKK3 and MKK6 (Enslen et al., 1998) (Figure 1.4). Phosphorylation of the
p38 MAPK family members occurs on a Thr-Gly-Tyr motif in their activation loop
(Raingeaud et al., 1995), in contrast to the ERKs where phosphorylation occurs on a
Thr-Glu-Tyr motif (Payne et al., 1991; Ahn et al., 1991), and JNKs, on a Thr-Pro-Tyr
motif (Derijard et al., 1994). SAPK2a, SAPK3 and SAPK4 can be phosphorylated by
either MKK3 or MKK6, whilst SAPK2b can be phosphorylated by MKK6 only (Enslen
et al., 1998; Fleming et al., 2000). MKK4, and to a lesser extent, MKK7, are also
capable of phosphorylating SAPK2a (Lin et al., 1995; Derijard et al., 1995; Moriguchi et
al., 1995; Fleming et al., 2000). This suggests that some level of cross-talk may occur
between the different MAPK pathways at the level of MKKs in certain circumstances.
In a unique mechanism, SAPK2a has also been found to associate with transforming
growth factor-β-activated protein kinase 1-binding protein 1 (TAB1), and this interaction
allows SAPK2a to autophosphorylate, conferring SAPK2a activity that is comparable to
incubation with MKK6 (Ge et al., 2002). Thus, it appears that other mechanisms
besides the typical MKKK-MKK-MAPK cascade may exist to activate members of the
MAPK family (Ge et al., 2002).
7
1.3.3 Regulation of interactions in the MAPK pathways
MAPK signalling events appear to be controlled by a variety of factors,
including binding domain interactions, scaffolding interactions, and spatial and temporal
organisation of pathway components (Schaeffer and Weber, 1999). A substrate docking
site, comprised of a series of acidic amino acids, has been identified in the C-terminal
domain of MAPKs (Tanoue et al., 2000; Kallunki et al., 1994). This site is important for
the specificity of interactions between MAPKs and their upstream activators,
phosphatases and substrates (Tanoue et al., 2000). For example, this substrate-binding
groove is necessary for the binding and subsequent phosphorylation of c-Jun by JNK2
(Kallunki et al., 1994). The replacement of this region of sequence in JNK1 with the
corresponding sequence in JNK2 improved the JNK1-c-Jun binding interaction, to the
strength of the JNK2-c-Jun interaction (Kallunki et al., 1994). Recent studies have
determined that MAPK substrates, activators and phosphatases contain “Docking
domains” or “Kinase Interaction Motifs” (KIMs) (Gavin and Nebreda, 1999; Jacobs et
al., 1999; Smith et al., 1999; Tanoue et al., 2000). These KIMs are comprised of short
clusters of positively charged amino acids, thus explaining the requirement for acidic
residues in the MAPK docking regions (Tanoue et al., 2000).
Several different “scaffolding” proteins have been identified in the MAPK
pathways, which are thought to be responsible for bringing the individual components of
the phosphorylation cascades into the correct location and orientation for signal
transduction (Morrison and Davis, 2003). For example, JNK-interacting protein 1 (JIP1)
selectively binds to JNK, the upstream JNK activator MKK7, and the MKK7 activators
mixed-lineage kinase 3 (MLK3) and dual leucine zipper-bearing kinase (DLK), and
facilitates signalling through this pathway (Whitmarsh et al., 1998). Furthermore,
MKK/ERK kinase (MEK) partner 1 (MP1) selectively binds to ERK1 and MKK1,
enhancing MKK1 activation by Raf in vitro and ERK activation when overexpressed in
cells (Schaeffer et al., 1998). Furthermore, despite the sequence similarity between
ERK1 and ERK2, MP1 does not bind to ERK2 and MKK2, suggesting that scaffolding
proteins may represent a regulatory mechanism for selectively activating specific protein
8
kinase members within a single MAPK pathway (Schaeffer and Weber, 1999).
Recently, other potential scaffolds for MAPK pathways have also been identified,
including mitogen-activated protein kinase organizer 1 (MORG1) (Vomastek et al.,
2004) and dystroglycan (Spence et al., 2004). It is likely that other scaffolding proteins
will be identified that are responsible for organising other MAPK signalling cascades in
response to specific extracellular stimuli.
The subcellular localisation of MAPKs allows the correct transmission of
signals to their substrates. This localisation may be regulated by the interaction of
MAPKs with as yet unidentified anchoring proteins, similar to the Protein Kinase A
anchoring molecules that target that kinase to its specific subcellular locations (Klauck
et al., 1996; Michel and Scott, 2002). Alternatively, this localisation may be mediated
by MAPK substrates or upstream regulators. For example, the ERK1/2 upstream
activators, MKK1/2, contain a leucine-rich stretch of sequence which acts as a nuclear
export signal (NES) (Fukuda et al., 1996). In unstimulated cells, ERK1/2 remains
localised in the cytoplasm complexed with MKK1/2 (Fukuda et al., 1997a). The
activation of ERK leads to the dissociation of the MKK1/2-ERK1/2 complex and the
translocation of ERK1/2 to the nucleus, whilst MKK1/2 remains in the cytoplasm
(Fukuda et al., 1997a). Mutation of the MKK1/2 NES exaggerates the activity of
ERK1/2 (Fukuda et al., 1997b). This suggests that the MKK1/2 NES acts as a
regulatory mechanism to ensure the correct localisation of ERK1/2 and prevent
unwanted sustained signalling events (Fukuda et al., 1997b).
It has also been shown that ERKs can remain cytoplasmic or translocate to
the nucleus following their activation. It has become increasingly clear that this
translocation is dependent upon the original stimulus and the level of ERK activation.
Thus, stimulation of PC12 cells with Nerve Growth Factor (NGF) leads to the sustained
activation of ERKs, their translocation to the nucleus, and cell differentiation, whereas
EGF stimulation results in transient ERK activation, cytoplasmic localisation, and cell
growth (Nguyen et al., 1993; Qui and Green, 1992; Boglari et al., 1998). However, this
response appears to also be dependent on the cellular context, since sustained activation
9
of ERKs in NIH3T3 fibroblasts leads to cellular growth and transformation (Cowley et
al., 1994). The sustained versus transient activation of MAPK family members may also
be dependent on negative feedback loops and the action of specific phosphatases
(Schaeffer and Weber, 1999; Camps et al., 2000; Keyse, 2000; Theodosiou and
Ashworth, 2002).
1.4 Stress-Activated Protein Kinase-3
The focus of the studies presented in this thesis has been the p38 MAPK
family member, Stress-Activated Protein Kinase-3, or SAPK3. In the following
sections, a more detailed description is given on the similarities shared between MAPK
and SAPK3 signalling. Major differences are also highlighted, emphasising that this
protein kinase may play unique roles in intracellular signalling.
1.4.1 Evolutionary conservation and structure of SAPK3
The p38 MAPK family member SAPK3, with a calculated molecular
weight of 42 kDa, was initially isolated from human (Li et al., 1996), mouse (Lechner et
al., 1996) and rat (Mertens et al., 1996) tissue, and was called p38γ MAPK, ERK6, and
SAPK3 respectively. Due to the sole use of the rat sequence for this project, SAPK3
will be the name used throughout this thesis. The structure of phosphorylated SAPK3 is
shown in Figure 1.5 (Bellon et al., 1999). Activation of SAPK3 is conferred by
phosphorylation on Thr183 and Tyr185 within a Thr-Gly-Tyr motif within the
phosphorylation loop sequence within subdomain VIII (Mertens et al., 1996).
Similarities can be drawn when comparing the structure of phosphorylated SAPK3 and
phosphorylated ERK2. For example, phosphorylation of Thr183 in SAPK3 promotes
the rotation of the N- and C-terminal domains toward each other, organising catalytic
residues within the active site and exposing the substrate binding site (Bellon et al.,
1999). Furthermore, in the active SAPK3 structure, phosphorylated Tyr185 shows an
almost identical conformation to that seen in active ERK2, suggesting that both of these
10
N-terminal lobe
P-Thr 183; P-Tyr 185
C-terminal lobe
ATP
Figure 1.5: The structure of activated SAPK3 complexed with ATP.The structure of activated SAPK3 is similar to that of activated ERK2. Phosphorylated Thr183 and Tyr185 are shaded in green. When compared to the structures of inactive ERK2 and SAPK2a, phosphorylation of Thr183 in subdomain VIII of SAPK3 promotes the rotation of the N- and C-terminal domains toward each other, organising catalytic residues within the active site and exposing the substrate binding site. Phosphorylated Tyr185 is positioned on the surface of the kinase where it can participate in specific substrate recognition. Taken from Bellon et al., Structure 7: 1057-1065 (1999).
10a
MAPKs use the same mechanism for specific recognition of proline in their substrates
(Bellon et al., 1999).
SAPK3 shows 60% sequence homology to mouse SAPK2a, 45% to the
SAPK2a yeast homologue, Hog1, 47% to human JNK1, and 42% to rat ERK2 (Mertens
S et al., 1996). In addition to being cloned from human, mouse and rat, SAPK3 has also
been cloned from zebrafish, and more recently, Xenopus (Fabre S et al., 2000;
Perdiguero et al., 2003). The identification of SAPK3 expression in a range of species
suggests the conservation of SAPK3 throughout evolution, and thus supports an
important role for this stress-activated protein kinase.
1.4.2 SAPK3 expression and activation
SAPK3 was initially found to be expressed in a variety of different tissues
at the mRNA level, including heart and lung, with highest levels in skeletal muscle
(Mertens et al., 1996; Lechner et al., 1996; Li et al., 1996). Since its initial cloning,
SAPK3 has also been found to be expressed in a variety of other cells and tissues, and
these are summarised in Table 1.1.
An initial study found that SAPK3 was activated by stresses such as
osmotic shock, anisomycin (a protein synthesis inhibitor) and UV irradiation as well as
pro-inflammatory cytokines such as IL-1 and TNF-α when overexpressed in HEK293
cells, supporting its role as a “stress-activated” kinase (Cuenda et al., 1997). In other
reports, overexpressed SAPK3 has also been activated in response to the DNA damaging
agent cisplatin (Pillaire et al., 2000; Losa et al., 2003).
Further studies have since examined the activation of endogenous SAPK3,
and most of these have been performed in immortalised cell lines. Using antibodies
directed against the phosphorylated form of p38 MAPKs, it was determined that SAPK3
and SAPK2a could be activated in response to hypoxia in PC12 cells (Conrad et al.,
1999). Furthermore, SAPK3 was shown to be activated by γ-irradiation in U2OS cells
11
Table 1.1: Cells and tissues with detected expression of SAPK3 mRNA or protein.
Tissues:Skeletal musle (Mertens et al., 1996; Lechner et al., 1996; Li et al., 1996)Lung, heart, testes (Mertens et al., 1996)
Blood cells:early hematopoietic cells (Uddin et al., 2004)primary erythroid progenitors (Uddin et al., 2004)endothelial cells (Hale et al., 1999)
Immortalised cell lines:C2C12 myoblasts (Lechner et al., 1996; Tortorella et al., 2003)Sol8 and L6 myoblasts (Tortorella et al., 2003)OVCAR3 ovarian carcinoma cell line (Abdollahi et al., 2003)
Tissues:Skeletal muscle (Boppart et al., 2000)
Cells of neural origin:hippocampal neurons (Kimonides et al., 1999; Sabio et al., 2004)cerebellar granular cells (Sabio et al., 1999)
Blood cells:lymphocytes (Fabre et al., 2000)
Immortalised cell lines:C2C12 myoblasts (Cuenda and Cohen, 1999)PC12 cells (Conrad et al., 1999; Sabio et al., 2004) THP1-wtCD14 and U937 human monocytic cell lines (Fearns et al., 2000)OVCAR3 ovarian carcinoma cell line (Abdollahi et al., 2003)SH-SY5Y cells (Singh et al., 2003)OCM-1 human melanoma cell line (Pillaire et al., 2000)U2OS human osteosarcoma cell line (Wang et al., 2000)
mRNA
Protein
11a
(Wang et al., 2000). Another study examined the activation of JNK and p38 isoforms in
skeletal muscle samples taken from marathon runners, and showed preferential
activation of JNK1 and SAPK3 (Boppart et al., 2000). Thus, these studies with
endogenous SAPK3 support a role for SAPK3 as a “stress-activated” kinase.
Recent studies have shed some light on the upstream signalling events that
lead to SAPK3 activation. The different proteins implicated in the activation of SAPK3
are represented in Figure 1.6. One study has suggested that the GTP binding protein Rit
is involved in SAPK3 activation leading to cellular transformation (Sakabe et al., 2002).
Other studies have examined the role of the GTP binding protein RhoA in SAPK3-
specific activation (Marinissen et al., 2001; Singh et al., 2003). In these reports, there
appeared to be specific activation of SAPK3 via these signalling intermediates.
Therefore other MAPKs are not always activated in parallel with SAPK3, suggesting a
unique role for this kinase.
Several kinases have also been implicated in signalling upstream of
SAPK3. Polyploidy-Associated Protein Kinase (PAPK) and Protein Kinase N (PKN)
have been shown to be required for SAPK3 activation, being implicated as MKKKKs in
the pathway leading to SAPK3 phosphorylation (Marinissen et al., 2001; Takahashi et
al., 2003; Nishigaki et al., 2003). Furthermore, the role of PKN as a potential scaffold
protein in this pathway has been demonstrated (Takahashi et al., 2003). Both Mixed
Lineage Kinase-Related Kinase (MRK) and the oncoprotein Cot have been implicated as
MKKKs in the phosphorylation cascade leading to SAPK3 activation (Gross et al.,
2002; Chiariello et al., 2000). Finally, both MKK6 and MKK3 are able to phosphorylate
SAPK3 on its TGY motif, resulting in activation (Cuenda et al., 1997; Enslen et al.,
1998). It has been suggested that the level of MKK6 activity may dictate its preference
for p38 MAPK family member phosphorylation (Alonso et al., 2000). Thus, low levels
of MKK6 activity have been found to only activate SAPK2a, whereas highly activated
MKK6 can phosphorylate SAPK2a and SAPK3, both in vitro and in cells (Alonso et al.,
2000). This suggests that the level of MKK6 activity from a given stimulus may
determine the pattern of downstream p38 MAPK signalling events (Alonso et al., 2000).
12
Hypoxia, inflammatory cytokines, osmotic stress, UV and γ-irradiation
Stimulus
Rit, RhoAG-Proteins
MKKKK PKN
MKKK MRK, PAPK, Cot
MKK MKK3, MKK6
SAPK3MAPK
Figure 1.6: Potential signalling intermediates leading to the activation of SAPK3.The general arrangement of the SAPK3 signalling pathway follows a similar series of steps shown in Figure 1.4 for the ERK, JNK and p38/SAPK2a pathways. The SAPK3 signalling pathway is activated by a variety of different stresses. The activation of small G-proteins leads to the activation of upstream kinases and the subsequent phosphorylation of specific signalling intermediates ultimately leads to the phosphorylation and activation of SAPK3.
12a
1.4.3 SAPK3 substrate specificity and potential roles in the cell
SAPK3 can phosphorylate a variety of different substrates in vitro. These
include transcription factors such as Activating Transcription Factor 2 (ATF2), Elk-1,
Myocyte Enhancing Factor (MEF) 2A, MEF2B and MEF2D; cytoskeletal proteins such
as the microtubule-associated protein Tau; and proteins localised at the cell membrane
such as α1-Syntrophin and Synapsin-Associated Protein 90 (SAP90) (Kumar et al.,
1997; Cuenda et al., 1997; Goedert et al., 1997a; Marinissen et al., 1999; Goedert et al.,
1997b; Hasegawa et al., 1999; Sabio et al., 2004). Only two of these proteins have been
confirmed as SAPK3 substrates in intact cells, Tau (Buee-Scherrer and Goedert M.,
2002) and SAP90 (Sabio et al., 2004). The identification of a wide array of SAPK3
substrates suggests diverse roles for this kinase.
Recent reports support this hypothesis. SAPK3 has been implicated in a
variety of disease states, including muscular dystrophy, where microarray analysis
showed that SAPK3 levels were downregulated (Chen et al., 2000). SAPK3 has also
been found to be upregulated in hepatocellular carcinoma (Liu et al., 2003), and
implicated in the activation of the c-jun promoter leading to cellular transformation
(Marinissen et al., 2001). SAPK3 was also found to be downregulated following
interleukin-8 treatment, and upregulated following TNF-related apoptosis-inducing
ligand treatment of the ovarian carcinoma cell line OVCAR3 (Abdollahi et al., 2003). It
has recently been identified that SAPK3 is upregulated in postnatal development of
skeletal muscle, suggesting that SAPK3 may have a role in the development of this
tissue (Tortorella et al., 2003). SAPK3 has also recently been proposed to regulate
glucose transport in skeletal muscle (Ho et al., 2004).
Several studies have implicated SAPK3 in cell cycle arrest and
differentiation. For example, it was initially shown that overexpression of SAPK3 in the
C2C12 myoblast cell line enhanced the differentiation of these cells into myotubes
13
(Lechner et al., 1996). The identification of RhoA, a mediator of muscle differentiation
(Takano et al., 1998), as an upstream activator of SAPK3 (Marinissen et al., 2001; Singh
et al., 2003) further supports this hypothesis. A recent study implicated SAPK3 in γ-
irradiation-induced G2 arrest (Wang et al., 2000). Furthermore, SAPK3 mediates the
downregulation of cyclin D1 in response to hypoxia, in a calcium-dependent manner
(Conrad et al., 1999; Conrad et al., 2000). Taken together, these results suggest that
SAPK3 may promote cell cycle arrest and differentiation (Seta and Sadoshima, 2002).
1.4.4 SAPK3 intracellular localisation
The localisation of MAPKs within the cell determines the substrates that
they can phosphorylate. For example, the nuclear localisation of active ERK is required
for its phosphorylation of cAMP response element-binding protein (CREB) and the
ternary complex factor Elk-1 (Davis et al., 2000). Overexpressed, phosphorylated
SAPK3 has been shown to be expressed in the nucleus when co-transfected into NIH3T3
cells with MKK6 and RhoA (Marinissen et al., 2001). Endogenous SAPK3 has also
been reported to translocate into the nucleus from the cytosol of hippocampal cells in
response to corticosterone treatment (Kimonides et al., 1999). Other reports have shown
endogenous SAPK3 to be localised at the synaptic junctions in hippocampal neurons
(Sabio et al., 2004) and the neuromuscular junction in skeletal muscle (Hasegawa et al.,
1999). Thus, it appears that SAPK3 may exhibit different localisation patterns in
different cell types, and this may affect its substrate preferences.
1.4.5 SAPK3 contains a unique C-terminal tail
An interesting feature of SAPK3 is its conserved C-terminal, which has the
sequence of Lys-Glu-Thr-Xaa-Leu, where Xaa is Ala in rat, mouse, Xenopus and
zebrafish, or Pro in human (Fabre et al., 2000). This C-terminal tail enables SAPK3 to
bind to proteins containing specialised protein interaction domains called PDZ domains,
named after the first three proteins this domain was identified in: Post-Synaptic Density-
95 (PSD-95), Discs-Large (Dlg), and Zona Occludens-1 (ZO-1) (Hasegawa et al., 1999;
14
Cho et al., 1992; Woods and Bryant, 1989; Anderson et al., 1988). PDZ domains are
often found in scaffolding proteins that also contain a number of other domains. Thus,
PDZ domain-containing proteins often function to organize components of signalling
pathways, or to anchor other proteins to their correct subcellular location (Sheng, 1996;
Hung and Sheng, 2002; Pawson and Scott, 1997). The vast majority of PDZ domain-
containing proteins are localised to the cell membrane (Fanning and Anderson, 1999).
PDZ domains have been classified into 3 distinct classes, based on the C-
terminal or internal hairpin-forming sequence of their protein ligands (Hung and Sheng,
2002). Within an individual class, sequences of representative domains show
approximately 50 – 70% homology (Daniels et al., 1998). Class I PDZ domains bind to
the consensus sequence of Ser/Thr-Xaa-Ø-COOH, where Ø is any hydrophobic amino
acid (Hung and Sheng, 2002). The dissociation constants for PDZ-ligand interactions
range from approximately 50 nM to 10 µM (Songyang et al., 1997).
An example of a Class I PDZ domain bound to its ligand is shown in
Figure 1.7 (Doyle et al., 1996). PDZ domains consist of six β strands and two α helices
(Doyle et al., 1996; Daniels et al., 1998). The protein ligand binds to the PDZ domain at
a 1:1 ratio in a groove of the PDZ domain, between the βB strand and the αB helix,
antiparallel to the βB strand (Doyle et al., 1996). A connecting loop (termed the
carboxylate binding loop) between the βA and βB strands contains the conserved
sequence Gly-Leu-Gly-Phe. These amino acids play an important role in binding the
ligand, forming a hydrophobic pocket in which the most C-terminal amino acid binds,
explaining the requirement for a hydrophobic amino acid at the carboxylate terminal of
the ligand (Doyle et al., 1996).
The SAPK3 C-terminal tail has been found to be essential for the
interaction of SAPK3 with the Dystrophin complex protein, α1-Syntrophin (Hasegawa
et al., 1999). Furthermore, this tail is required for the phosphorylation of α1-Syntrophin
by SAPK3 (Hasegawa et al., 1999). Recently, it has been determined that SAPK3 can
also use this tail to interact with the PDZ domain of another substrate protein, SAP90
15
Figure 1.7: A Class I PDZ domain complexed with a peptide substrate.Class I PDZ domains bind to protein ligands with the consensus sequence of Ser/Thr-Xaa-Ø-COOH. The PDZ domain is comprised of eight elements of secondary structure, with six β-strands and two α-helices. The protein ligand (denoted in orange) binds in a groove between the β-B-strand and the α-B-helix. Amino acids within the β-B-strand, the α-B-helix, and the carboxylate binding loop form contacts with the protein ligand.Taken from Doyle et al., Cell 85: 1067-1076 (1996).
15a
(Sabio et al., 2004). The identification of further PDZ domain-binding partners for
SAPK3 may help to elucidate its function in different tissues.
1.5 Study aims
At the commencement of this study, little was known about the function
that SAPK3 plays in any tissue; few substrates had been identified for this kinase, and
there were no reports addressing the localisation of endogenous SAPK3 within any cell
type. Furthermore, although the expression of SAPK3 had been previously identified to
be highest at the mRNA level in skeletal muscle, there were no reports on the expression
of endogenous SAPK3 protein in any tissues. Therefore, this study was designed to
address some of these unknown features of SAPK3, with the ultimate aim to more
clearly understand the possible biological role of SAPK3.
Aim 1 of this study was to characterise the use of a SAPK3 monoclonal
antibody to determine its expression and localisation in cells. In Chapter 3, a SAPK3
monoclonal antibody was evaluated for its ability to recognise the endogenous protein in
both Western blotting and immunocytochemical protocols.
Aim 2 of this study was to determine the expression of SAPK3 within
whole tissues rather than isolated cell models. This was considered an important step in
determining the role that SAPK3 may play in a living organism. In Chapter 4, SAPK3
expression was evaluated within different tissues, with emphasis on its expression in the
heart in normal and diseased states. In addition, this Chapter also evaluated the
expression of SAPK3 during development. Specifically, expression levels of this kinase
were compared in the adult and neonatal heart, as well as during embryonic
development from embryonic days 8.5 – 18.5. This provided information on the spatial
expression of SAPK3 (the pattern of tissue expression) and the temporal expression of
SAPK3 (the tissues with earliest expression or high expression) during development.
16
Aim 3 of this study was to determine the substrate specificity of SAPK3.
Studies in Chapter 5 involved the development of an in vitro protocol to activate SAPK3
for subsequent use in the identification of potential substrates of this kinase. In addition,
by using site-directed mutagenesis, sequence determinants responsible for the favouring
of certain phosphorylation sites by SAPK3 were evaluated.
Finally, Aim 4 of this study was to use screening approaches to identify
possible substrates and/or binding partners of SAPK3. In Chapter 6, a yeast two-hybrid
screening approach was used to identify potential SAPK3 interacting proteins. Two
PDZ domain-containing binding partners were identified in this screen and evaluated for
their possible role as physiological SAPK3 interactors. The results of this screen
prompted the study into other potential PDZ domain-containing binding partners of
SAPK3.
In summary, by determining the expression patterns, subcellular
localisation, substrate specificity and binding partners of SAPK3, advances have been
made in elucidating the role that SAPK3 may play in mammalian cells.
17
Chapter 2
Materials and Methods
2.1 Reagents and chemicals
The general reagents used during the course of this PhD project were of the
highest purity available, and purchased from the following companies:
AJAX Chemicals (NSW, Australia), Ambion Incorporated (Texas, USA), Amersham
Biosciences (England, UK), Amresco (Ohio, USA), Astral (NSW, Australia), BDH
Laboratory Supplies (England, UK), Bio-Rad (California, USA), Calbiochem
(California, USA), Clontech (California, USA), DAKO Laboratories (NSW, Australia),
Fisher Biotec (WA, Australia), Pharmacia Biotech (New Jersey, USA), PIERCE
(Illinois, USA), ProSci Tech (Queensland, Australia), Roche Applied Science (Indiana,
USA), Sigma Chemical Company (Missouri, USA) and Vector Laboratories (California,
USA).
Reagents for mammalian cell line culture, including media, foetal calf serum, and
trypsin-EDTA, were purchased from Invitrogen Life Technologies (California, USA),
Sigma Chemical Company (Missouri, USA) and Thermo Trace (Melbourne, Australia).
Components of bacterial media, including Bacto-Yeast extract and Bacto-Tryptone, and
agar, were purchased from DIFCO Laboratories (Michigan, USA).
Molecular biological reagents were purchased from Invitrogen Life Technologies
(California, USA), Promega, Inc. (Wisconsin, USA), QIAGEN Sciences (Maryland,
USA) and Stratagene (California, USA).
The SAPK3 C-terminal peptide based on the C-terminal PDZ domain-binding motif
sequence of rat SAPK3 (sequence: Biotin-Aminohexanoic acid-Arg-Gln-Leu-Gly-Ala-
Arg-Val-Pro-Lys-Glu-Thr-Ala-Leu-OH) was synthesized by Proteomics International
(Perth, Australia).
[γ-32P]-adenosine triphosphate ([γ-32P]-ATP) was purchased from Perkin Elmer
(Massachusetts, USA).
18
2.2 Antibodies
Table 2.1 and Table 2.2 list the primary and secondary antibodies,
respectively, used during the course of this PhD project, as well as the suppliers of these
antibodies.
2.3 Methods
2.3.1 Culture of cell lines
Cell lines (human embryonic kidney (HEK) 293 fibroblasts and Madin-
Darby canine kidney (MDCK) epithelial cells) were maintained in a controlled
humidified environment of 5% (v/v) CO2 at 37°C. All cell lines used were grown in 175
cm2 tissue culture flasks in Dulbecco’s Modified Eagle Medium (DMEM) supplemented
with 10% (v/v) heat-inactivated foetal calf serum (FCS) and 1% (v/v) penicillin-
streptomycin (hereafter referred to as "growth DMEM").
To passage confluent cells, culture flasks were rinsed with 1x Dulbecco’s Phosphate
Buffered Saline (PBS) (without Mg2+ or Ca2+) and then exposed to trypsin-
ethylenediaminetetraacetic acid (EDTA) (0.05 % (w/v) trypsin; 0.53 mM EDTA) for 5
min to dissociate cells from the flask. Growth DMEM (10 ml) was then added to this
cell suspension to inactivate the trypsin. The cell suspension was then centrifuged
(1,000 x g, 5 min, room temperature; RT). The supernatant was discarded and the cell
pellet resuspended in 10 ml fresh growth DMEM. A small volume (1 ml) of this cell
suspension was then added to a 175 cm2 culture flask and made to a total volume of 25
ml with growth DMEM.
A cell count was then derived from a sample of the remaining cell
suspension. This involved taking a small aliquot of cells (20 µl) and diluting with
medium to a final volume of 200 µl. The counting chambers of a haemocytometer were
then filled with this mixture and cells counted using a phase contrast microscope (10x
19
objective magnification). The number of cells per ml of the original cell culture was
calculated by obtaining an average count per chamber (which holds 0.1 µl), multiplying
this by 104 (to obtain number of cells per ml) and multiplying this number by the
dilution factor (10). Once a cell count was obtained, cells were diluted in growth
DMEM and aliquoted into 60 mm cell culture dishes (6 x 105 cells per dish) for cell
treatments. Cells to be used for microscopy were aliquoted into 35 mm cell culture
dishes (2 x 105 cells per dish) containing glass coverslips (22 x 22 mm).
2.3.2 Isolation of rat neonatal cardiac myocytes
Neonatal Sprague-Dawley rats were sacrificed by decapitation and the
hearts removed into ice-cold filter-sterilised ADS Buffer (116 mM NaCl, 20 mM
HEPES, 1 mM NaH2PO4, 5.5 mM glucose, 5.4 mM KCl and 0.8 mM MgSO4; pH 7.3).
Atria and connective tissue were removed and the remaining ventricles cut and spread
out to expose more surface area for the action of the dissociation enzymes. The hearts
were then transferred to a sterile 100 ml Schott bottle and 6 ml of sterile Dissociation
Mix (0.4 mg/ml collagenase and 0.6 mg/ml pancreatin in ADS buffer) was added. The
Schott bottle was then placed in a 37°C waterbath for 3 min with shaking at 160 rpm.
The supernatant was then discarded, as this first digestion mainly consists of non-viable
cells and red blood cells (MA Bogoyevitch, unpublished observation). Another 6 ml of
sterile Dissociation Mix was added to the hearts and the Schott Bottle placed in the
waterbath for 20 min with shaking at 200 rpm. Following this digestion, the supernatant
was removed into a separate 15 ml Falcon tube and 6 ml Dissociation Mix was added to
the hearts to commence the next digestion. The supernatant containing myocytes was
centrifuged (120 x g, 5 min, RT). The supernatant was then removed and discarded, and
the cell pellet gently resuspended in 5 ml newborn calf serum (NCS) and maintained at
37°C in a tissue culture incubator (5% (v/v) CO2). This digestion procedure was
repeated a further 4 times, and following this, the supernatants containing myocytes
were pooled into 30 ml of NCS.
20
The cell suspension was then centrifuged (120 x g, 5 min, RT) and the
supernatant discarded. The cell pellet was then gently resuspended in 20 ml of Plating
Media (68% (v/v) M199, 17% (v/v) DMEM, 10% (v/v) horse serum, 5% (v/v) FCS and
0.68% (v/v) penicillin/streptomycin) and re-centrifuged (120 x g, 5 min, RT). The cells
were then again gently resuspended in Plating Media and transferred to a 75 cm2 flask
and maintained at 37°C with 5% (v/v) CO2 for 45 min. This incubation time allowed
“pre-plating” of the cells, where the fibroblasts present within the culture adhered to the
bottom of the flask, but the myocytes remained in suspension. Following this pre-
plating step, the media containing the suspended cardiac myocytes was removed from
the flask into a 50 ml Falcon tube. Plating Media (2 x 5 ml) was then added to the flask
to wash off any remaining myocytes, and these washes added to the Falcon tube to give
a total of 30 ml.
The concentration of myocytes in the cell suspension was determined by
counting of the cells using phase contrast microscopy. An aliquot (100 µl) of cells was
diluted with the addition of 400 µl PBS and 500 µl trypan blue. This cell suspension
was then loaded into a haemocytometer and counted. Viable cells were identified by
their ability to exclude trypan blue that crosses the membrane of dead cells. A typical
yield of cardiac myocytes from the isolation procedure was approximately 4 x 106 cells
per heart.
After counting, cells were seeded into gelatin-coated 60 mm dishes or 35
mm dishes containing laminin-coated glass coverslips, at a density of 4 x 106 or 1 x 106
cells, respectively. Cells were then maintained at 37°C in a humidified atmosphere
containing 5% (v/v) CO2.
2.3.3 Preparation of coverslips for immunostaining
When cells were immunostained, glass coverslips (22 x 22 mm) were used.
It was important to clean the coverslips to allow cell adhesion and optimal visualisation
of cells. Therefore, before use, coverslips were washed in a dilute (120 mM) HCl
21
solution, rinsed in double-deionised H2O (ddH2O), and stored in 70% (v/v) ethanol until
further use. Immediately prior to use, coverslips were briefly passed through the flame
of a bunsen burner. This evaporated the ethanol and sterilised the coverslips.
To coat glass coverslips with laminin (required for the adhesion of cardiac
myocytes), 10 µg/ml laminin in PBS was pipetted on to the surface of the coverslips.
After 45 – 60 min in a sterile laminar flow cabinet to allow the laminin to coat the
coverslips, excess laminin was removed and the coverslips left to air-dry for
approximately 45 min before the cells were added.
2.3.4 Cell transfection
Plasmids used for transfecting mammalian cells are listed in Table 2.3.
To prepare these plasmids for transfection into mammalian cells, overnight cultures of
the Escherichia coli strain XL1-blue containing the plasmid of interest were subjected to
a plasmid purification protocol, as described in the QIAGEN® Plasmid Maxikit (see
Section 2.3.23). Following the preparation of plasmid DNA, the purity of the DNA was
confirmed by DNA gel electrophoresis, typically using 1% agarose gels containing 200
µg/ml ethidium bromide.
MDCK or HEK293 cells aliquoted into 60 mm tissue culture dishes
(approximately 6 x 105 MDCK or HEK293 cells in 3 ml growth DMEM) or into 35 mm
tissue culture dishes (approximately 2 x 105 MDCK or HEK293 cells in 2 ml growth
DMEM) with glass coverslips were left to adhere to dishes/coverslips overnight (37°C, 5
% CO2). Cardiac myocytes were isolated and aliquoted into 35 mm dishes containing
coverslips and left to adhere to coverslips overnight (37°C, 5 % CO2).
Cells were transfected with the appropriate plasmid DNA using two
different methods, employing Lipofectamine® and Lipofectamine Plus® Reagents, or
using Lipofectamine Reagent® only. Typically, Lipofectamine only was used when no
more than 1.2 µg of DNA was to be transfected into cells. Lipofectamine and
22
Lipofectamine Plus Reagent were used in combination when 1.2 µg – 2 µg of DNA was
to be transfected into cells. These two methods are described below.
2.3.4(a) Lipofectamine only transfection protocol
Preparation of transfection mixtures was performed in sterile bacterial petri
dishes. In sterile Eppendorf tubes, each plasmid DNA was diluted to a concentration of
0.044 mg/ml in sterile PBS. Diluted DNA was then added to each labelled area on a
petri dish to a total amount of 1.2 µg in 27 µl PBS for 60 mm tissue culture dishes, or
0.7 µg in 16 µl PBS for 35 mm tissue culture dishes. PBS (17µl for 60 mm dishes and
10 µl for 35 mm dishes) was then pipetted next to each DNA mixture. Lipofectamine
Reagent (10 µl for 60 mm dishes or 6 µl for 35 mm dishes) was added to the PBS. The
DNA and PBS/Lipofectamine mixtures were then mixed together. The lid was then
replaced on the petri dish for 15 min and the DNA:Lipofectamine complex allowed to
form.
During this incubation time, the cells were washed once in DMEM without
serum (hereafter referred to as "serum-free DMEM"). Serum-free DMEM (1.4 ml for 60
mm dishes and 0.8 ml for 35 mm dishes) was then added to each dish of cells. A small
volume (340 µl for 60 mm dishes; 200 µl for 35 mm dishes) of serum-free DMEM was
added to each DNA:lipofectamine transfection complex and each entire mixture slowly
and gently pipetted into each dish of cells. The cells were then returned to the incubator
(37°C, 5% (v/v) CO2) for 6 hours. Following this incubation, the cells were washed in
growth DMEM and incubated in growth DMEM for 40 hours, or as otherwise specified,
before fixation or lysis.
2.3.4(b) Lipofectamine and Lipofectamine Plus transfection protocol
In sterile Eppendorf tubes, each plasmid DNA was diluted to a
concentration of 1 mg/ml in sterile PBS. Sterile tubes were then labeled for each
individual dish to be transfected. Diluted DNA (up to 2 µg) was then added to each tube
as needed, and the volume made up to 150 µl with 1 x sterile PBS. To this DNA-PBS
mixture, 10 µl of Lipofectamine Plus reagent was added, mixed and left at RT for 15
23
min. During this time a dilution of the Lipofectamine Reagent was prepared, consisting
of 6 µl Lipofectamine with 150 µl PBS per transfection.
Following the 15 min Lipofectamine Plus incubation, 150 µl of the diluted
Lipofectamine was added to each transfection, mixed and left to incubate at RT for a
further 15 min. This allowed the DNA:Lipofectamine complex to form. During this
incubation time, the cells were washed once in serum-free DMEM, and then serum-free
DMEM was added to each dish (1.2 ml for 60 mm dishes; 0.55 ml for 35 mm dishes).
Following this incubation time, 200 µl of serum-free DMEM was added to the
transfection mixes and pipetted up and down, before being carefully distributed over the
cells in each dish. The cells were then returned to the incubator (37°C, 5% (v/v) CO2)
for 6 hours. Following this incubation, the cells were washed in growth DMEM and
incubated in growth DMEM for 40 hours, or as otherwise specified, before fixation or
lysis.
2.3.5 Cell treatments
Following the plating of cells into dishes, cells were cultured for
approximately 20 hours in growth DMEM, followed by approximately 20 hours in
serum-free DMEM (37°C, 5% (v/v) CO2). Cells were then treated with the appropriate
agonist by the addition of agonists directly to the culture medium or by the replacement
of the culture medium with serum-free medium containing the agonist for specified
periods of time (37°C, 5% (v/v) CO2). Specifically, for sorbitol-treatment of cells,
sorbitol was dissolved directly in serum-free DMEM, and this used to replace the serum-
free DMEM in which the cells had been cultured. As a control, media on cells was
replaced with fresh serum-free DMEM containing no sorbitol. In contrast, for
endothelin-1, isoproterenol and phenylephrine, stock solutions of these agonists were
diluted in serum-free DMEM and then small volumes of these solutions added directly
to the media already covering the cells to give the final desired concentration. The
controls for these treatments were cell cultures with the addition of extra media to each
dish. For interleukin-1, leukemia inhibitory factor and lysophosphatidic acid, stocks
24
were diluted in PBS containing 0.1% (v/v) bovine serum albumin (BSA), and these
diluted reagents added directly to the media already covering the cells. The control for
these treatments was to add PBS containing 0.1% (v/v) BSA to the dish. Following
treatments, the media was then removed and the cells washed with ice-cold PBS. Cells
were then immunostained (Section 2.3.8) and visualised by Confocal Scanning
Microscopy (Section 2.3.10) or lysed (Section 2.3.11).
2.3.6 Isolation of embryonic mice and embryonic mouse hearts
Wild-type Friends virus B (FVB) mice, aged 2-5 months, were bred by
staff at the L Block Animal Care Unit, Queen Elizabeth II Medical Centre, Nedlands
(Perth). Female mice were driven into oestrus by the administration of gonadotrophin
and chorionic gonadotrophin prior to mating with males. Copulation was determined by
the presence of a vaginal plug the following morning, and this was considered day 0.5 of
pregnancy, and the equivalent of embryonic day (E) 0.5.
Pregnant mice were euthanased by cervical dislocation. The abdominal
cavity was then opened, exposing the uterine horns. These were removed into ice-cold
PBS and each embryo sac was removed carefully to expose the embryo within. If
embryos were to be used for wholemount staining, they were placed into ice-cold Dent’s
fixative solution (20% (v/v) dimethyl sulfoxide (DMSO), 80% (v/v) methanol) and
gently rocked at 4°C overnight. If embryos were to be used for sectioning, they were
placed into ice-cold sectioning fixative (4% (w/v) paraformaldehyde in PBS) and gently
rocked at 4°C overnight. If only the embryonic hearts were required for RNA or protein
isolated, these were quickly removed from the embryos and snap-frozen in liquid
nitrogen.
25
2.3.7 Processing of embryos for sectioning
Following overnight fixation (see Section 2.3.6), embryos were transferred
to 70% (v/v) ethanol and stored at 4°C until processing. The processing procedure was
performed in a Shandon Citadel 1000 processor with a 10-hour cycle, as listed:
90% (v/v) ethanol 90 min
100% ethanol 90 min
100% ethanol 90 min
100% ethanol 90 min
Toluene 60 min
Toluene 60 min
Wax (56°C melting point) 60 min
Wax (56°C melting point) 60 min
Wax vacuum 30 min
Therefore, this procedure comprised of four stages – ethanol, to remove all water from
the embryos; removal of ethanol from the embryos and the addition of a clearing agent
(toluene); addition of wax as a supporting medium for the tissue; and vacuum to remove
all air from the sample. Following processing, embryos were then embedded in wax in
cassettes, ready for sectioning.
Sectioning of embryos was performed using a Leica Rotary Microtome,
model #2135. Sections were cut at a thickness of 5 µm, and floated on to slides coated
with a 175:2 ratio of acetone:3-aminopropyltriethoxysilane. Sections were then placed in
a 45°C oven overnight to dry, then stored at room temperature until use.
26
2.3.8 Immunostaining
2.3.8(a) Immunostaining of cultured cells
Cells were cultured on coverslips in 35 mm tissue culture dishes in
preparation for immunostaining, and were either transfected with plasmid DNA and
incubated in growth DMEM for up to 40 hours following transfection, or plated out
without transfection and cultured for up to approximately 40 hours. If cells were to be
treated with a particular agonist, they were incubated in growth DMEM for
approximately 20 hours after plating, followed by an additional 20 hours in serum-free
DMEM. Cells were then treated with the appropriate agonist for the specified times.
In preparation for staining, media was removed and cells were rinsed with
1x PBS. When Leptomycin B was used, cells were incubated in growth DMEM
containing Leptomycin B (10 ng/ml) for 3.5 hours (37°C, 5% (v/v) CO2), then washed
with 1 x PBS prior to fixation. When Mitotracker Red was used, cells were incubated in
growth DMEM containing 300 µM Mitotracker Red for 45 min (37°C, 5% (v/v) CO2),
then washed with 1 x PBS prior to fixation. Cells were fixed with 4% (w/v)
paraformaldehyde in sodium cacodylate buffer (0.1 M sodium cacodylate trihydrate; pH
7.9) for 20 min at room temperature. Cells were then rinsed thoroughly with PBS, and
permeabilised with 0.2% (v/v) Triton X-100 in PBS for 15 min at room temperature.
Cells were again rinsed in PBS, and then blocked by incubating the coverslips with 5%
(v/v) FCS in Wash Buffer (0.5% Bovine Serum Albumin (BSA); 0.02% glycine in 1 x
PBS) for 60 min at room temperature. Primary antibody (see Table 2.1 for
concentrations) was added to the coverslips and left to incubate for 60 min at 37ºC.
Following washing of cells with Wash Buffer, secondary antibody (see Table 2.2 for
concentrations) was added and incubated with cells for 60 min at 37ºC. Typically, this
secondary antibody was conjugated to a fluorophore for visualisation of cells using
confocal microscopy.
Following the secondary antibody incubation, the cells were again washed
in Wash Buffer, and Hoescht 33258 stain (2 µg/ml in 5 mM Tris-HCl, 1 mM EDTA; pH
27
7.4) was added for 5 min to stain nuclear DNA. Therefore, the nuclei of all cells on the
coverslip could be visualised and counted under fluorescent illumination. Calculating
the ratio of the number of stained cells to the total number of cells (Hoescht 33258
stained nuclei) allowed the estimation of transfection efficiency. After washing the cells
several times in PBS, the coverslips were air-dried (although not permitted to over-dry),
and a small drop of Vectashield Mounting Medium was added to each coverslip. The
coverslips were then inverted on to glass microscopy slides, and nail polish was used to
seal the edges of the coverslips. Stained cells were then stored at 4°C for not longer than
1 week before being viewed on the confocal microscope.
2.3.8(b) Immunostaining of mouse embryo sections
Sections were de-waxed in 2 x 10 min incubations of xylene, then washed
in 100% ethanol (2 x 5 min) followed by 100% methanol (10 min). Sections were then
fixed overnight in Dent’s fixative solution (4°C).
The following day, sections were rinsed in 100% methanol (10 min, RT),
and then re-hydrated in graded methanol solutions, diluted in ddH2O (75% (v/v); 50%
(v/v); 25% (v/v); 10 min each solution). Sections were then washed in embryo TBST
(140 mM NaCl, 2.7 mM KCl, 25 mM Tris-HCl pH 7.5, 0.1% (v/v) Tween-20) (3 x 5
min), then blocked in embryo blocking solution (2% (w/v) BSA in embryo TBST) for 2
hours at RT. Slides were then incubated with SAPK3 antibody diluted in blocking
solution, or blocking solution only, overnight at 4°C.
The following day, sections were washed in embryo TBST (3 x 5 min),
then incubated in DAKO rabbit anti-rat immunoglobulin diluted in blocking solution for
1 hour (RT). Sections were then washed in embryo TBST (3 x 5 min) before incubation
in rat monoclonal APAAP (soluble complexes of calf intestinal Alkaline Phosphatase
and Anti-Alkaline Phosphatase) for 1 hour (RT), diluted in blocking solution. Sections
were then washed in embryo Tris-Buffered Saline with Tween (TBST) (3 x 5 min), then
washed in NaCl/Tris/MgCl2/Tween (NTMT) buffer (100 mM NaCl, 100 mM Tris-HCl
pH 9.5, 50 mM MgCl2, 0.1% (v/v) Tween-20) (2 x 10 min). This was then removed
28
from the sections and replaced with substrates (45 µg/ml Nitroblue tetrazolium chloride
(NBT) and 175 µg/ml 5-bromo-4-chloro-3-indolyl-phosphate, 4-toluidine salt (BCIP))
diluted in NTMT buffer. The reaction was allowed to proceed for approximately 1 hour,
until colouration occurred. The reaction was then stopped by washing slides in stop
solution (2 mM EDTA in PBS) (2 x 10 min). Slides were then briefly rinsed in ddH2O,
then dehydrated through graded ethanols diluted in ddH2O (50% (v/v), 70% (v/v), 95%
(v/v), 100%; 2 min per solution). Slides were then placed into xylene (at least 2 min)
then mounted on to coverslips with DEPEX mounting medium, and left to dry overnight
at RT. Embryo sections could then be viewed using a dissecting microscope or inverted
microscope and photographed.
2.3.8(c) Wholemount staining of mouse embryos
Following overnight fixation in Dent’s fixative solution, embryos were
washed with cold 100% methanol (2 x 10 min). The embryos could then be stored at
-20°C for several months, or processed for wholemount staining as follows:
Embryos were rehydrated in graded methanol solutions diluted in embryo
TBST (75% (v/v); 50% (v/v); 25% (v/v); 15 min per solution). Embryos were then
washed in embryo TBST (1 x 15 min), then blocked for 4 hours in embryo blocking
solution (RT). Embryos were then transferred to 2 ml Eppendorf tubes and immersed in
SAPK3 antibody diluted in embryo blocking solution, or embryo blocking solution only,
overnight at 4°C.
The following morning, embryos were washed in embryo blocking solution
(4 x 15 min), then incubated with DAKO rabbit anti-rat immunoglobulin, diluted in
embryo blocking solution, for 2 hours. Embryos were then washed again (4 x 15 min) in
embryo blocking solution, then incubated with rat APAAP solution, diluted in embryo
blocking solution, for 1 hour. Embryos were then washed again (4 x 15 min) in embryo
blocking solution, before washing in NTMT buffer (2 x 10 min). This was then
removed from the sections and replaced with NBT and BCIP diluted in NTMT buffer.
The reaction was allowed to proceed for 15 – 45 min, until colouration occurred. The
29
reaction was then stopped by washing embryos in stop solution (2 mM EDTA in PBS)
(2 x 10 min).
Following the staining detection, embryos were transferred to cold 4%
(w/v) paraformaldehyde in PBS and fixed overnight at 4°C. The following day,
embryos were washed in PBS (3 x 15 min; RT), then equilibrated in 50% (v/v) glycerol
in PBS for at least 1 hour, before transfer to 70% (v/v) glycerol in PBS. Once embryos
had sunk to the bottom of the tubes they could be visualised using the dissecting
microscope and photographed.
2.3.9 Haematoxylin and eosin staining
To visualise the histological features of embryo sections, they were stained
with haematoxylin and eosin. Embryo sections were placed into a 60°C oven for 30
min, then dewaxed in 3 x 3 min changes of xylene. Sections were then rehydrated by
incubation in 100% ethanol (2 x 3 min), 70% (v/v) ethanol (1 x 3 min) and water (1 x 3
min). Sections were then incubated in haematoxylin stain to stain cell nuclei (1 x 1
min), then washed thoroughly in 2 changes of water (until the water ran clear). Sections
were then washed in 70% (v/v) ethanol (1 x 3 min) before incubation in eosin stain to
stain the cell cytoplasm (1 x 15 sec). Sections were then washed in 3 x 3 min changes of
70% (v/v) ethanol, then dehydrated through 2 x 3 min changes of 100% ethanol.
Sections were then incubated in xylene (3 x 3 min), before mounting on coverslips with
DEPEX mounting medium and allowing to dry overnight at RT. Embryo sections could
then be viewed using a dissecting microscope or inverted microscope and photographed.
2.3.10 Scanning confocal microscopy
Following the immuostaining procedure using fluorescently labelled
secondary antibodies as described in Section 2.3.8a, cells were viewed using the Bio-
Rad MRC 1000/1024 UV Scanning Confocal Microscope (Bio-Rad Microscience,
California, USA) at the Biomedical Confocal Microscopy Research Centre, located in
30
the Department of Pharmacology, Queen Elizabeth II Medical Centre, Nedlands (Perth).
To visualise red fluorescence (excitation 540 nm; emission 580 nm), a green HeNe
mixed gas laser was used. Green fluorescence (excitation 488 nm; emission 530 nm)
was visualised with a blue Argon ion UV laser. To visualise Hoescht staining, an Argon
ion UV laser was used, selecting the 351 nm laser line. Acquired images were subjected
to Kalman filtering to reduce noise. For all samples, a 40x oil immersion objective lens
and a 1 - 1.5x zoom factor were used.
2.3.11 Preparation of cell extracts
Cell extracts were prepared from untreated cells, or cells that had been treated with
agonists. After treatment of cells with the appropriate agonist, they were washed in ice-
cold PBS. If cells were to be left untreated, they were simply cultured for approximately
40 hours then washed in ice-cold PBS. Following removal of excess PBS, cells were
lysed by addition of 100 µl ice-cold Lysis Buffer (20 mM HEPES, 2.5 mM MgCl2, 0.1
mM EDTA, 20 mM β-glycerophosphate, 100 mM NaCl; pH 7.7) supplemented
immediately prior to use with 0.05% (v/v) Triton X-100, 500 µM dithiothreitol (DTT),
100 µM Na3VO4, 20 µg/ml leupeptin, 100 µg/ml phenyl methyl sulfonyl fluoride
(PMSF) and 20 µg/ml aprotinin. Cell debris was removed by centrifugation (20,800 x g,
10 min, 4°C), and the supernatant collected as the cell lysate. For protein estimation, 20
µl of the lysate was used in the protocol described in Section 2.3.13. The remainder of
the cell lysates were used either to perform immunoprecipitations or sodium dodecyl
sulphate polyacrylamide gel electrophoresis (SDS-PAGE) followed by Western blotting.
For SDS-PAGE samples, the lysate was diluted with 40 µl of 3x concentrated SDS
sample buffer (187.5 mM Tris-HCl, 6% (w/v) SDS, 30% (v/v) glycerol, 15% (v/v) β-
mercaptoethanol, 0.015% (w/v) bromophenol blue; pH 6.8). Samples were then stored
at -20°C prior to use in the protocols described in Section 2.3.18. For
immunoprecipitation, lysate was directly used in the protocols described in Sections
2.3.14 or 2.3.15.
31
2.3.12 Preparation of extracts from tissue samples
Tissue samples from various sources (as referred to throughout this thesis)
were ground to a fine powder under liquid nitrogen in a mortar and pestle, and then
weighed. These samples were then lysed with the addition of Lysis Buffer (5:1; lysis
buffer:tissue) and vortexing. Samples were then placed immediately on ice for 10 min
and then centrifuged (20,800 x g, 10 min, 4°C). The supernatant was then removed and
20µl of this was set aside for protein estimation. To the remainder of the supernatant, 3
x concentrated SDS sample buffer was added in preparation for SDS-PAGE. Samples
were then stored at -20°C prior to use in the protocols described in Section 2.3.18 and
2.3.19.
2.3.13 Protein estimation
Quantitation of protein concentrations was performed using one of two
methods. Both of these methods required the use of a protein standard. This was a
commercial preparation of bovine serum albumin (BSA) with an initial stock
concentration of 2 mg/ml.
2.3.13(a) Spectrophotometric estimation
The first of these methods involved a spectrophotometric assay where a
linear range of known BSA concentrations was prepared (0 - 0.5 µg protein). Dilutions
of the protein sample were also prepared. An acidic dye (Bradford Reagent) was then
added to each protein solution and the absorbance subsequently measured at a
wavelength of 595nm with a microplate reader. The standard curve that was produced
allowed for a relative measurement of protein concentrations in the protein sample of
interest.
2.3.13(b) Estimation using SDS-PAGE separated proteins
The second method was used to confirm both the protein concentration
and purity of recombinant proteins (Section 2.3.28). This method involved preparation
32
of a linear range of concentrations of BSA (2.5 – 10 µg protein) and a series of dilutions
of the protein of interest in SDS sample buffer. These protein solutions were then
separated by SDS-PAGE. The resulting gel was then stained with Coomassie Brilliant
Blue (Coomassie stain; 45% (v/v) methanol, 45% (v/v) glacial acetic acid, 0.05% (w/v)
Coomassie Brilliant Blue) and destained (7.5% (v/v) methanol, 7.5% (v/v) glacial acetic
acid), therefore allowing the protein of interest as well as any contaminating proteins to
be visualised on the stained gel. Following destaining, the intensity of the bands was
quantitated by photographing the gel and using Image Gauge computer program. The
concentration of the sample protein could then be measured relative to the BSA standard
curve.
2.3.14 Immunoprecipitation for subsequent Western blotting
HEK293 fibroblasts were transfected with mammalian expression
constructs (Table 2.3) as described in Section 2.3.4 and incubated for approximately 24
hours in growth DMEM to allow protein expression. Cells were then lysed and lysates
containing 100 µg protein were incubated with mixing at 4 °C overnight with the
appropriate antibody (amounts listed in Table 2.1). The following morning, 30 µl of
Protein G-sepharose slurry (1:1 Protein G-sepharose:Lysis Buffer) was added and this
mixed at 4°C for a further 3 hours to capture the antibody-antigen complex. Samples
were then briefly centrifuged and the pellet washed three times in Lysis Buffer. Excess
buffer was removed from the pellet and 25 µl of 3 x concentrated SDS-sample buffer
added in preparation for SDS-PAGE according to protocols described in Section 2.3.18.
2.3.15 Immunoprecipitation for subsequent kinase assays
HEK293 fibroblasts were transfected with mammalian expression
constructs (Table 2.3) as described in Section 2.3.4 and the cells then incubated for
approximately 40 hours in growth DMEM to allow protein expression. The cells were
then lysed, and lysates containing 300 µg protein incubated with Flag or Hemagluttinin
(HA) antibodies overnight to capture the expressed proteins (see Table 2.1). The
33
following day, Protein G sepharose was added to the lysates and mixed at 4°C for 3
hours to capture the antibody-antigen complex. The sepharose resin was then separated
from the lysates by centrifugation and washed twice with Lysis Buffer and twice with
Activation Buffer (50 mM Tris-HCl, 10 mM MgCl2, 20 mM β-glycerophosphate; pH
7.5) to remove any contaminating proteins. Excess buffer was then removed and
immunoprecipitates used in kinase assays (Section 2.3.17).
2.3.16 Activation of GST-SAPK3, GST-JNK2 and GST-ERK2
GST-SAPK3, GST-ERK2 and GST-JNK2 (80 µg/ml of each) were
incubated with MalE-MKK6(DD), GST-MKK1(EE) or GST-MKK4(ED) (160 µg/ml of
each) respectively, in Activation Buffer containing 330 µM ATP, overnight at 30°C (see
Section 2.3.28 for recombinant protein production). The following day, glutathione-
sepharose (GSH-sepharose) resuspended in EDTA-stop solution (10mM EDTA pH 8.0,
50mM Tris-HCl pH 7.5) was added at an equal volume to the reaction mix to terminate
the reaction, and this was mixed end-over-end at 4°C to capture the GST-fusion proteins.
The GSH-sepharose, bound to GST-fusion proteins, was then washed several times in
Activation Buffer to remove the other reaction components, and the GST-fusion proteins
eluted with the addition of 5 mM reduced glutathione in 50 mM Tris-HCl (pH 8.0). This
was repeated a further three times and the supernatants were pooled and dialysed against
Activation Buffer. The proteins could then be directly added to kinase assays (Section
2.3.17), or stored at 4°C for later use.
2.3.17 Kinase assays
Activated kinase (1 µg) was added to immunoprecipitates from HEK293
fibroblasts or 10 µg of recombinant protein substrate (see Section 2.3.28), in Activation
Buffer containing 10 µM ATP and 1µCi-3µCi of [γ-32P]-ATP (as specified in Figure
Legends) then incubated at 30°C for 35 min. When the SAPK3 C-terminal peptide was
used (see Section 2.1 and Chapter 5) it was included at a final concentration of 10µM or
100µM and pre-incubated with the substrate for 10 min at 30°C prior to the protein
34
kinase assay. This allowed the C-terminal peptide time to bind to GST-α1-Syntrophin
or GST-Sab substrates being used in the assay of SAPK3 activity. When GST-
OMP25(1-177) was used as an inhibitor, 1 – 10 µg of the protein was pre-incubated
with activated GST-SAPK3 for 10 min at 30°C prior to the protein kinase assay. This
allowed GST-OMP25 to bind to GST-SAPK3. The reactions were terminated by the
addition of 3 x concentrated SDS sample buffer to give a 1 x final concentration. The
samples were then boiled and the reaction components separated by SDS-PAGE (10 or
12% acrylamide gels, as specified in Figure Legends). The resulting gels were then
Coomassie stained for 20 min and destained overnight as described in Section 2.3.13b.
Gels were then dried (Bio-Rad model 583 gel dryer), photographed, and exposed to
autoradiographic film. The protein bands of interest were then excised and 32P
incorporation quantitated using Cerenkov counting.
2.3.18 SDS-PAGE
Samples consisting of cell lysates or kinase assay components that had
been diluted in 3 x SDS sample buffer were heated for 5 – 10 min at 95°C. To perform
SDS-PAGE, the small-format mini-PROTEAN II or mini-PROTEAN III gel
electrophoresis system (Bio-Rad) was routinely used. Unless otherwise stated, 10%
resolving gels (10% (w/v) acrylamide, 0.25% (w/v) bis-acrylamide, 0.1% (w/v) SDS,
0.375M Tris-HCl pH 8.8) and 6% stacking gels (6% (w/v) acrylamide, 0.15% (w/v) bis-
acrylamide, 0.1% (w/v) SDS, 0.125 M Tris-HCl pH 8.8) with 10 wells were cast. Gels
of 0.75 mm thickness were used when loading sample volumes not exceeding 25 µl.
Gels of 1.5 mm thickness were used when loading sample volumes not exceeding 50 µl.
These gels were polymerized by the addition of 0.1% (v/v) TEMED and 0.875 M
ammonium persulphate. Gel electrophoresis was performed at 200V (constant voltage)
for approximately 45 min so that the dye front was approximately 0.5 cm from the
bottom of the glass plates. For large-format gels, the Hoefer Vertical Slab Gel SE400
was used in a similar manner, except that electrophoresis was at 100V for approximately
1 hour (until the samples had run out of the loading wells), followed by approximately 4
hours at 160V.
35
2.3.19 Western blotting
Following SDS-PAGE, the stacking gel was discarded and the resolving
gel was soaked in transfer buffer (48 mM Tris-HCl, 39 mM glycine, 1.2 mM SDS, 20%
(v/v) methanol; pH 8.0) for approximately 15 min. Meanwhile, 6 pieces of Whatmann
3MM filter paper and a nitrocellulose membrane, all cut to the size of the SDS-PAGE
separation gels, were soaked separately in transfer buffer. If PVDF membranes were to
be used for transfer, these were first soaked in 100% methanol, followed by soaking in
DDH2O, then in transfer buffer. The transfer was then set up as follows:
Top Cathode (-ve)
3 pieces of presoaked filter paper
polyacrylamide gel
nitrocellulose membrane
3 pieces of presoaked filter paper
Bottom Anode (+ve)
The electrophoretic transfer of proteins to nitrocellulose membranes was
routinely performed with the Trans-Blot Semi-Dry electrophoretic transfer cell (Bio-
Rad). This transfer was performed at 12V (constant voltage) for 45 min for 0.75 mm
gels and 90 min for 1.5 mm gels. In some cases for the transfer of large (>200 kDa)
proteins (see Chapter 6 and experiments evaluating the SAPK3 interacting partner
Scribble), the mini trans-blot module (Bio-Rad), utilizing a wet transfer system, was
used. Here, the transfer tank was filled with transfer buffer, and the polyacrylamide gel
sandwiched next to the nitrocellulose membrane and filter papers held in the transfer
cassette. This wet transfer was performed at 100V (constant voltage) for 60 min and
used only for the transfer of proteins from 0.75 mm gels.
Following transfer, the nitrocellulose membrane was blocked with 5%
(w/v) non-fat milk powder in TBST (10 mM Tris-HCl, 150 mM NaCl, 0.1% v/v Tween
36
20; pH 7.5) for 60 min with gentle agitation. Membranes were then incubated with
primary antibody (diluted in 5% (w/v) non-fat milk powder or 5% (w/v) BSA in TBST;
see Table 2.1) overnight at 4°C with agitation. When 5% (w/v) BSA was used as the
diluent for the primary antibody, membranes were rinsed in several changes of TBST
after incubation in the blocking prior to the incubation in the presence of the appropriate
primary antibody.
The following morning, the nitrocellulose membrane was washed (3x5 min
in ~50 ml TBST for each wash) to remove any excess primary antibody. The membrane
was then incubated with secondary antibody conjugated to horseradish peroxidase for at
least 2 hours at RT. This secondary antibody was diluted in 1% (w/v) non-fat milk
powder in TBST (see Table 2.2 for antibody dilutions). Following further washing (3x5
min + 1x10 min in ~50 ml TBST for each wash; RT), membranes were treated with
Supersignal Chemiluminescent Substrates for 5 min. Western blots were then exposed
to Hyperfilm for <5 min.
To determine whether transfer of proteins was even across the membrane,
the membranes were briefly re-hydrated in TBS, then incubated in Ponceau S stain
(0.1% (w/v) Ponceau SS Acid Red 150 in 2% (v/v) glacial acetic acid) for approximately
2 min, then destained in 2% (v/v) glacial acetic acid.
2.3.20 Stripping Western blots
Western blot membranes were re-hydrated in TBS for 5 min with gentle
agitation. Strip solution (62.5 mM Tris-HCl pH 6.8, 2% (w/v) SDS, 0.1% (v/v) β-
mercaptoethanol), pre-heated to approximately 60°C, was then added to immunoblots
and incubated in a 60°C waterbath for 20 min. This strip solution was then changed and
membranes incubated for a further 25 min. The strip solution was then removed, and
immunoblots washed extensively in TBS, followed by extensive washing in TBST. The
immunoblots were then blocked in 5% (w/v) non-fat milk powder in TBST, and
processed as for Western Blotting (section 2.3.19).
37
2.3.21 Preparation of competent E. coli
All solutions to be used for making competent cells were prepared sterile
and cooled to 4°C overnight. Two different E.coli strains were used for transformation
with plasmid DNA – the XL1-Blue and BL21 DE3 pLyss cells. For XLI-Blue E. coli,
glycerol stocks were streaked on to a Luria-Bertani (LB; 1% (w/v) bacto-tryptone, 0.5%
(w/v) bacto-yeast extract, 170 mM NaCl; pH 7.0)-agar (15 g/L) plate and incubated
overnight at 37°C. The same protocol was followed for BL21 DE3 pLyss cells except
that the LB plates were additionally supplemented with 100 µg/ml chloramphenicol to
ensure the presence of the pLyss plasmid. The following day, 50 ml of autoclaved LB
(or LB/chloramphenicol) was inoculated with 1 colony and grown to saturation
overnight at 37°C, 200 rpm.
The following day, 2 x 25 ml of the overnight culture was added to 2 x 250
ml of LB (or LB/chloramphenicol for E. coli containing pLyss), equilibrated to 37°C.
These cultures were then grown to an optical density at 650 nm (OD650nm) of 0.2 (37°C,
200 rpm; approximately 30 min). Meanwhile, another 150 ml of culture medium was
equilibrated to 37°C. After the cultures had reached the correct density, 75 ml of
equilibrated medium was added to each culture and grown for a further 30 min, at 37°C,
200 rpm. Cells were then harvested by centrifugation (3000 x g, 20 min, 4°C). The
supernatant was decanted, and cells washed in 90 ml of 100 mM MgCl2. Cells were
then incubated on ice for 5 min before centrifugation (1500 x g, 10 min, 4°C). The
supernatant was decanted, and cells washed with 15-20 ml of ice-cold 100 mM CaCl2.
Cells were then incubated on ice for 20 min, and then harvested by centrifugation at
(1300 x g, 10 min, 4°C). Cells were then resuspended in 3.5 ml of storage solution (85
mM CaCl2, 15% (v/v) glycerol), aliquoted, and slowly frozen in a polystyrene box at
-80°C.
38
2.3.22 Transformation of XL1-Blue and BL21 DE3 plyss E. coli strains with
plasmid DNA
A 100µl aliquot of XL1-Blue or BL21 cells was incubated on ice with
entire ligation mix (in the case of subcloning procedures) or 400 – 800 ng of plasmid
DNA for 40 – 60 min. Cells were then heat-shocked by incubation in a 42°C water bath
for 90 sec, before being plunged into ice for 10 min, and then incubated at RT for 5 min.
Cells were then diluted into 0.5 ml LB media previously warmed to 37°C and allowed to
recover at 37°C for 1 hour, 200 rpm. The E. coli were then plated out on LB-agar plates
containing the required antibiotic/s, and incubated at 37°C overnight.
2.3.23 Preparation of plasmid DNA using the QIAGEN miniprep and maxiprep
kits
E. coli containing the plasmid DNA of interest were streaked out on an LB-
agar plate containing the appropriate antibiotics for selection, and grown overnight at
37°C. When using the miniprep kit, a single colony was selected from the plate the
following day and grown overnight at 37°C, 200 rpm in 5 ml LB media containing the
appropriate antibiotics for selection. When using the maxiprep kit, a single colony was
selected from the plate and grown for 8 hours in 2 ml LB media containing the
appropriate antibiotics. An aliquot of this starter culture (400 µl) was then used to
inoculate 2 L of LB media containing the appropriate antibiotics, and grown overnight
(37°C, 200 rpm). The following day, 700 µl of the overnight bacterial culture was
diluted with the addition of 700 µl 40% glycerol and stored at -80°C in a cryotube as a
glycerol stock. The remaining culture was used to isolate plasmid DNA from the
bacterial cells using the miniprep or maxiprep kit, according to the manufacturer’s
instructions.
39
2.3.24 Isolation of RNA from embryonic, neonatal and adult mouse hearts
All reagents to be used for RNA isolation were diluted where appropriate in
diethyl pyrocarbonate (DEPC)-treated water. Immediately prior to use, all equipment to
be used for RNA isolation was washed in “RNase ZAP solution” (Ambion). Trizol
reagent (500 µl) was added to each group of hearts (3-5 hearts for each embryo stage, 2
hearts for neonatal, 1 heart for adult) and these were then homogenised using a hand-
held mortar and pestle. Homogenates were then centrifuged (12,000 x g, 10 min, 4°C),
and the supernatant retained. The supernatant was incubated for 5 min (RT) before the
addition of 100 µl chloroform. The tube was then mixed vigorously for 15 sec, then
incubated at RT for 3 min. This was then centrifuged again (12,000 x g, 10 min, 4°C),
and the upper aqueous phase transferred into a new tube. The RNA was then
precipitated with the addition of 250 µl isopropanol followed by mixing and then
incubating at RT for 10 min. This solution was then centrifuged (12,000 x g, 10 min,
4°C) and the supernatant discarded. The pellet was then washed in 550 µl 75% (v/v)
ethanol, before centrifugation (7,500 x g, 5 min, 4°C). The supernatant was then
discarded and the pellet air-dried for 10 min, before resuspending in 30 µl sterile ddH2O.
2.3.25 Quantitation of RNA and DNA samples
RNA and DNA, diluted in ddH2O, were quantitated using the Eppendorf
Biophotometer on the “RNA” or “double-stranded DNA” settings, respectively. ddH2O
was used as a blank reading. Calculations of RNA and DNA concentration were
determined based on an A260 of 1 = 40 µg/ml, or A260 of 1 = 50 µg/ml, respectively.
2.3.26 Agarose gel electrophoresis
Prior to electrophoresis, DNA samples were resuspended in 6 x
concentrated DNA loading buffer (0.25% (w/v) Bromophenol blue, 0.25% (w/v) xylene
cyanol, 30% (v/v) glycerol). DNA samples were routinely electrophoresed on 1% (w/v)
agarose gels (1% (w/v) agarose, 40 mM Tris-acetate pH 8.0, 1 mM EDTA, 200 µg/ml
40
ethidium bromide) in TAE Buffer (40 mM Tris-acetate pH 8.0, 1 mM EDTA) at 90 V
for 50 min in a MiniSub horizontal gel electrophoresis tank (Bio-Rad, California, USA).
DNA bands were then visualised and photographed under UV illumination.
2.3.27 DNA sequencing
Plasmid DNA was sequenced using dye-labelled dideoxynucleotides, and
the method was based on the Sanger dideoxy sequencing method (Sanger, 1981).
Sequencing reactions were carried out in 0.2ml Polymerase Chain Reaction (PCR) tubes.
These reactions typically consisted of 300 – 600 ng DNA template and 1.6 pmol primer,
diluted in Big Dye Terminator Mix (Applied Biosystems; version 3.1) up to a volume of
10 µl. Reagents were mixed together and overlaid with PCR wax to prevent evaporation
of reaction components during the PCR reaction. Reaction components were then
subjected to a PCR reaction with the following conditions:
96°C 10 seconds
25 x 50°C 5 seconds
60°C 4 minutes
4°C hold
Following the sequencing reaction, the PCR products were precipitated by
the addition of 25 µl 95% (v/v) ethanol and 1 µl of 3 M sodium acetate pH 5.0 followed
by incubation for 30 min (RT). The samples were then centrifuged (20 min, 20,800 x g,
RT) and the supernatants removed. The pellets were washed with 250 µl of 70% (v/v)
ethanol, and the samples were then centrifuged again (20,800 x g, 10 min, RT). The
supernatants were decanted and the pellets air dried. The DNA pellets were then
sequenced by the DNA sequencing service at the Australian Neuromuscular Research
Institute (Queen Elizabeth II Medical Centre, Nedlands, Perth).
41
2.3.28 Expression and purification of recombinant proteins
The E. coli strain BL21 DE3 plyss was transformed with expression vectors
encoding either the proteins of interest fused to glutathione-S-transferase (GST) or MalE
(Maltose Binding Protein). Glycerol stocks of each of these E.coli lines were stored at -
80°C. Autoclaved LB Medium (50 ml) containing the required antibiotics (50µg/ml
ampicillin, 10µg/ml chloramphenicol) were inoculated with the glycerol stock of
interest. Cultures were incubated for 12-16 hours at 37°C, 200 rpm. Cultures were then
diluted up to 1 L with LB medium containing the required antibiotics and grown (37 °C,
200rpm) to an optical density of OD600 = 0.6. Following this incubation, the expression
of the GST-fusion protein was induced with 0.1 - 1mM isopropyl-beta-D-thio
galactopyranoside (IPTG) (see Table 2.4) and in the majority of cases the cultures were
left to grow at 37°C, 200 rpm for a further 4 hours. For certain proteins, this induction
was performed at 23°C at 200 rpm for 6 hours (see Table 2.4). The cell pellets were
then centrifuged (3,500 x g, 10 min, 4°C) and resuspended in 20 - 40 ml Resuspension
Buffer (50 mM Tris-HCl, 100 mM NaCl, 1 mM EDTA, 1 mM benzamidine, 10 mM β-
mercaptoethanol, 10 µg/ml leupeptin; pH 8.0). These resuspended pellets were then
snap-frozen in liquid nitrogen and stored at -80°C.
The recombinant proteins were extracted and purified by sonicating the
thawed resuspended E.coli pellets (4 x 45 second bursts) with the Sonifier B-12
(Branson, Danbury, Conneticut, USA). The detergent BRIJ35 was then added to a final
concentration of 0.02% (v/v) and the suspension centrifuged (10,000 x g, 35 min, 4°C)
to remove the cell debris. Glutathione-sepharose or amylose resin 1:1 gel slurry (1 ml)
pre-washed in Wash Buffer (50 mM Tris-HCl, 100 mM NaCl, 1 mM EDTA, 1 mM
benzamidine, 10 mM β-mercaptoethanol, 0.02% v/v BRIJ35; pH 8.0) was added to the
supernatant and incubated with mixing for 1 hour at 4°C. The glutathione-sepharose or
amylose resin was then collected (3,000 x g, 5 min, RT) and washed in Wash Buffer
(1x25 ml and 2x15 ml).
42
The recombinant proteins were eluted from glutathione-sepharose by
adding 800 µl volumes of 5 mM reduced glutathione in 50 mM Tris-HCl (pH 8.0) or
from amylose resin by adding 800 µl volumes of maltose elution buffer (50mM NaCl,
1mM dithiothreitol (DTT), 0.1mM EDTA, 12mM maltose, 50mM Tris-HCl pH7.5),
mixing briefly, centrifuging, and collecting the supernatant. This was repeated a further
three times and the supernatants were pooled and dialysed against Dialysis Buffer (50
mM Tris-HCl, 100 mM NaCl, 1 mM EDTA, 1 mM benzamidine, 10 mM β-
mercaptoethanol, 0.02% (v/v) BRIJ 35, 5% (v/v) glycerol; pH 8.0). MalE-MKK6(DD),
which was to be used in activating GST-SAPK3, was dialysed into supplemented
Activation Buffer containing no MgCl2 (20mM β-glycerophosphate, 1mM benzamidine,
0.5mM DTT, 20mM HEPES; pH 7.6). The resulting solution containing the
recombinant protein of interest was then quantitated using the Bradford protein assay
and gel electrophoresis (Section 2.3.13), aliquoted, and stored at -80°C until further use.
2.3.29 Recombinant DNA techniques
During the course of this PhD project, recombinant DNA techniques were
used to introduce specific DNA sequences into particular vectors for applications such
as the production of recombinant proteins (Section 2.3.28) and screening in the yeast
two-hybrid system (Sections 2.3.35 – 2.3.44). Two different methods were used for
subcloning –
(i) Restriction enzyme digestion and religation. In this method the vector containing the
insert of interest (“donor vector”) was digested with the appropriate restriction
endonucleases. This insert was then ligated with the new (“acceptor”) vector. An
example of this procedure, used to insert full-length SAPK3 into the pBTM116 vector
for Yeast 2-hybrid screening, is shown in Figure 2.1.
(ii) PCR amplification, restriction enzyme digestion and religation. In this method PCR
primers were designed to flank the insert in the donor vector. Amplification of the insert
with these primers in PCR reactions allowed the introduction of new restriction
endonuclease sites. The PCR fragment and acceptor vector were then digested with the
appropriate restriction endonucleases and subsequently ligated (Figure 2.2 and 2.3).
43
AmpR
EcoRI site:GAATTC
EcoRI site:GAATTC
EcoRISmaI
BamHISalIPstI
pBTM116~ 5.5 kb
AmpR
LexApEFm-plink
~ 6.5 kb
Full-length rat SAPK3
Polycloningsite
Digest with EcoRI
Run digested vector and insert on gel
pBTM116
SAPK3 insert
“Donor Vector” “Acceptor Vector”
LexA
AmpR
pBTM116(EcoRI digested)
~5.5 kb
Full-length rat SAPK3 insert
Agarose Gel
pEFm-plink
Extract DNA, ligate overnight
Transform DNA into XLI-Blue cells; select for
Ampicillin-resistant colonies
AmpR
LexA
pBTM116~6.6 kb
Full-length rat SAPK3
Figure 2.1. Insertion of full-length rat SAPK3 into pBTM116 for yeast two-hybrid screening.The “donor vector” pEFm-plink (containing full-length rat SAPK3) and the “acceptor vector” empty pBTM116 were digested with EcoRI and the digested products separated on an agarosegel. The resulting bands of DNA were then excised from the gel and the DNA extracted using a QIAGEN Gel Extraction Kit. The vector was treated with alkaline phosphatase, and subsequently incubated with the SAPK3 insert overnight at 16°C, in the presence of T4 DNA Ligase. The following day, the ligation mixture was transformed into competent XLI-Blue cells. Ampicillin-resistant colonies were selected and sequenced to confirm the insertion of full-length SAPK3 into the pBTM116 vector, as an in-frame fusion with LexA.
43a
A
AmpR
pcDNA3(HA)~ 6 kb
Full-length rat OMP25
HA tag
rat OMP25 PCR fragment
pVP16~ 8 kb
NLS
VP16
PCR
AmpR
“OMP PDZ Forward Primer”: 5’ CGGAGAGCAGTCAGATGGATCCTGATGAACGG 3’
“OMP PDZ Reverse Primer”:5’ TACAGGAACTCCGCGGCCGCCTAACTCG 3’
Full-lengthrat OMP25
BAmphipathic helix PDZ domain TM
1 73 160 178 200 206
37 160 177PDZ domain
Residues 37-177rat OMP25
Figure 2.2: The design of primers to insert a fragment of OMP25 into the pVP16 vector.(A) pcDNA3(HA) was obtained from P. DeCamilli containing the full-length rat OMP25 sequence. To insert nucleotides encoding amino acids 37-177 of OMP25 into pVP16, primers were created to flank the nucleotides in pcDNA3(HA) encoding amino acids 37-177. The “OMP PDZ Forward” primer sequence included a BamHI restriction site (underlined) to enable insertion of a BamHI site upstream of the required fragment, and extra nucleotides (shown in italics) to ensure an in-frame fusion of the OMP25 fragment with VP16. The “OMP PDZ Reverse” primer included a STOP codon (shown in red), followed by a NotI restriction site (underlined) to insert downstream of the required fragment, by PCR reaction. Digestion of the PCR product and pVP16 with BamHI and NotI could then be carried out, and the PCR product and pVP16 ligated. (B) A schematic of the full-length rat OMP25 protein is shown, and residues 37-177 which were inserted into the pVP16 vector.
43b
AmpR
pcDNA3(HA)~ 6 kb
Full-length rat OMP25
HA tagBamHIKpnINotI
EcoRI
pVP16~ 7.5 kb
AmpR
VP16
Polycloningsite
NLS
Perform PCR with “OMP25 PDZ Forward” and “OMP25
PDZ Reverse” primers
PCR product
Digestion of PCR product and pVP16 with BamHI and NotI
Agarose Gel
vector
PCR product
Run digested vector and PCR product on Agarose gel
Extract DNA from gel and ligate pVP16 vector and PCR product overnight
pVP16~ 8 kb
AmpR
VP16
NLS
OMP25 PCR fragment
Transform DNA into XLI-Blue cells; select for
Ampicillin-resistant colonies
Figure 2.3. Insertion of amino acids 37-177 of rat OMP25 into pVP16.Primers were designed around nucleotides encoding amino acids 37-177 of rat OMP25 (see Fig 2.2). PCR was performed to amplify this region of OMP25 and the PCR product and pVP16 were digested with BamHI and NotI restriction endonucleases. The digested products were separated on an agarose gel, and the vector and PCR products were excised from the gel. The DNA was extracted using a QIAGEN Gel Extraction Kit. The vector and insert DNA was then incubated together overnight at 16°C, in the presence of T4 DNA Ligase. The following day, the ligation mixture was transformed into competent XLI-Blue cells. Ampicillin-resistant colonies were selected and sequenced to confirm the insertion of the OMP25 fragment into the pVP16 vector.
43c
The various methods used during these subcloning procedures are described individually
in Sections 2.3.30, 2.3.31 and 2.3.32.
2.3.30 Restriction enzyme digest
Analytical restriction enzyme digests were carried out for 1 -3 hours at
37°C. For a typical restriction digest, approximately 1 µg of DNA template was
incubated with approximately 5 U1 of the required restriction endonuclease (Promega),
with the appropriate buffer and 2µg acetylated BSA, made up to a final volume of 20 µl
in ddH2O.
If restriction digest products were to be used for subsequent ligation
reactions, the digests were typically scaled up to a final volume of 50 µl containing 4 µg
of DNA template, 10 U of the required restriction enzyme (Promega), with the
appropriate buffer and 5 µg acetylated BSA. The digested DNA was then separated
from other reaction components with the use of PCR purification columns (QIAGEN),
according to the manufacturer’s instructions.
2.3.31 Polymerase Chain Reaction (PCR)
A typical PCR reaction consisted of 50 ng plasmid DNA as a template, 0.5
µM forward primer, 0.5 µM reverse primer, 0.2 mM dNTP mixture, 1.5 mM MgCl2 and
2.5 U2 Platinum® Taq Polymerase, made up to a final volume of 50 µl in PCR Buffer
(50 mM KCl, 20 mM Tris-HCl pH 8.4). PCR reaction mixtures in sterile 0.2 ml tubes
were overlaid with PCR wax to prevent evaporation of the reaction components during
the PCR reaction. PCR reactions were carried out using a MiniCycler™ (MJ Research,
California, USA). Typical conditions for a PCR reaction were:
1 One unit of restriction endonuclease activity is defined as the amount of enzyme required to completely digest 1 µg of substrate DNA in one hour at 37°C. 2 One unit of Platinum® Taq Polymerase incorporates 10 nmol of deoxyribonucleotide into acid-precipitable material in 30 min at 74°C.
44
94°C 4 min
94°C 1 min
30 x 40°C - 60°C 1 min (annealing temperature varied according to
the primers used – see Appendix I)
72°C 1 min
72°C 10 min
4°C hold
Colony screen PCR was used to identify bacterial colonies from cloning and yeast
colonies from yeast two-hybrid analysis (see Section 2.3.35) that contained the plasmid
insert of interest. In this procedure, a normal PCR reaction mix was assembled, with a
scaled-down final volume of 12 µl. A small amount of colony was then added to the
tube as the template for the PCR reaction. Normally, a gene-specific primer was used in
combination with a vector-specific primer to amplify the insert. This increased the
specificity of the reaction.
2.3.32 Reverse Transcription PCR
Reverse transcription PCR (RT-PCR) was used to amplify SAPK3 mRNA
from heart and skeletal muscle samples. The Access RT-PCR system (Promega) was
used for this protocol. The reaction consisted of 1 µg total RNA as a template, 1 µM
forward primer, 1 µM reverse primer, 0.2 mM dNTP mixture, 1 mM MgCl2, 5 U3 AMV
Reverse Transcriptase and 5 U Tfl DNA Polymerase, made up to a final volume of 50 µl
in AMV/Tfl reaction buffer (components unspecified by manufacturer). PCR reactions
were assembled in sterile 0.2 ml tubes using nuclease-free water as a diluent.
Conditions for the RT-PCR reaction were:
3 1 unit of AMV reverse transcriptase is defined as the amount of enzyme required to catalyse the incorporation of 1nmole of dTTP into acid insoluble form in 10 minutes at 37°C using poly(A)-oligo(dT) as a template.
45
48°C 45 min
94°C 2 min
94°C 30 sec
40 x 60°C 1 min
72°C 2 min
72°C 7 min
4°C hold
2.3.33 DNA ligation
Ligations were prepared using 100 ng of vector DNA. The amount of
insert DNA added was then varied to give an insert:vector concentration ratio of 3:1, 5:1
and 10:1. T4 DNA Ligase (1.5 units4) and T4 DNA Ligase Buffer (50 mM Tris-HCl pH
7.5, 10 mM MgCl2, 10 mM DTT, 1 mM ATP, 25 µg/ml BSA) were then added to the
reaction, and the final volume made to 10 µl with ddH2O. The reactions were then
placed in a thermocycler at 16°C overnight.
2.3.34 Site-directed mutagenesis
Primers were designed to incorporate the desired mutation and covered
approximately 15-20 bases on either side of the mutated area (see Appendix I for primer
sequences). Site-directed mutagenesis was carried out using the Stratagene
QuikChange® Site-Directed Mutagenesis Kit according to the manufacturer’s
instructions. Briefly, a PCR reaction was set up to contain 50 ng DNA template, 125 ng
forward primer, 125 ng reverse primer, 200 µM dNTP mix and 3 U5 Pfu DNA
polymerase in Pfu Buffer (20 mM Tris-HCl pH 8.8, 10 mM KCl, 10 mM (NH4)2SO4, 2
mM MgSO4, 0.1% (v/v) Triton X-100 and 0.1 mg/ml nuclease-free BSA).
This reaction mixture was then overlaid with PCR wax and subjected to the
4 0.01 unit (Weiss unit) of T4 DNA ligase is defined as the amount of enzyme required to catalyse the ligation of greater than 95% of the Hind III fragments of 1 µg of Lambda DNA at 16°C in 20 min.
46
following conditions:
95°C 30 sec
95°C 30 sec
12-18 times6 55°C 1 min
68°C 2 min/kb of plasmid length
Following the reaction, the PCR wax was removed. The reactions were
then placed on ice to cool for at least 5 min, and 1 µl of DpnI restriction enzyme added.
The reaction mixture was then mixed and placed in a 37°C waterbath for 1 hour. The
purpose of this incubation time was to allow the DpnI enzyme to digest the parental
(non-mutated) DNA. Since plasmid DNA isolated from most E.coli strains is dam
methylated, it is susceptible to DpnI digestion, which is specific for methylated and
hemimethylated DNA. Following this incubation, 5 µl of the mixture was transformed
into XL1-Blue competent cells (see section 2.3.22).
During the course of this project, site-directed mutagenesis was used to
introduce mutations into SAPK3, Sab and OMP25. The exact mutations made are listed
in Table 2.5.
2.3.35 Yeast two-hybrid screening
To isolate binding partners of SAPK3, yeast two-hybrid screening was
carried out. This involved cloning the full-length rat SAPK3 protein into the LexA
fusion vector pBTM116 (Figure 2.1), and screening a pVP16 cDNA library made from
mRNA prepared from the lymphohemopoietic progenitor cell line, EML Clone.1. The
pBTM116 vector contains the TRP1 gene and therefore yeast cells containing this
plasmid grew in the absence of the amino acid tryptophan. The pVP16 vector contains
5One unit of Pfu DNA Polymerase incorporates 10 nmol of deoxyribonucleotide into acid-precipitable material in 30 min at 75°C. 6The number of cycles required, according to Stratagene is: nucleotide point mutations, 12 cycles; single amino acid changes, 16 cycles; multiple amino acid deletions or insertions, 18 cycles.
47
the LEU2 gene and therefore yeast cells containing this plasmid grew in the absence of
leucine.
The general principles underlying yeast two-hybrid screening are outlined
in Figure 6.2. Briefly, the Saccharomyces cerevisiae L40 strain (MATα, his3∆200, trp1-
901, leu2-3, 112, ade2, LYS2::(lexAop)4-HIS3, URA3::(lexAop)8-lacZ, GAL4) was co-
transformed with LexA-SAPK3 and the pVP16 cDNA library. If an interaction occurred
between SAPK3 and a protein present within the cDNA library, the DNA binding
domain of the LexA protein and the transactivation domain of the VP16 protein would
be brought into close proximity to reconstitute an active transcription factor. Therefore,
the reporter genes HIS3 and lacZ would be activated, resulting in the growth of yeast in
the absence of the amino acid histidine, and the changing of yeast colonies to a blue
colour when 5-bromo-4-chloro-3-indolyl-beta-D-galactopyranoside (X-gal) was added
(Section 2.3.37, 2.3.38).
To determine whether these interacting proteins were “true positives”,
genomic and plasmid DNA was isolated from L40 yeast cells (Section 2.3.40), and
introduced into competent KC8 bacterial cells (2.3.41, 2.3.42). pVP16 DNA was then
selectively isolated from the bacterial cells (Section 2.3.43) and re-introduced into L40
yeast cells (2.3.44), where the library proteins were again tested for their ability to
interact with pBTM116-SAPK3, alongside other proteins, sub-cloned into pBTM116 to
act as negative controls (see Chapter 6). If the expressed library proteins were again
shown to be positive for interaction with SAPK3, the DNA encoding these proteins was
sequenced (Section 2.3.27) and these matched with sequences on the National Center for
Biotechnology Information (NCBI) database.
2.3.36 Preparation of selective media for yeast two-hybrid screening
To select yeast transformed with either pBTM116 or pVP16 or both
plasmids, or to select for an interaction between pBTM116-SAPK3 and proteins cloned
into pVP16, selective media was required. Selective media was made up in filter-
48
sterilised Synthetic Defined (SD) media (0.17% (w/v) yeast nitrogen base, 4 mM
ammonium sulfate, 100 mM D-glucose) with the appropriate antibiotics omitted. For
example, if yeast were to be selected containing the pBTM116 plasmid (which contains
the TRP1 gene), tryptophan was omitted from the selective media. If selection was to be
carried out using a plating method rather than in liquid media, agar was used at a
concentration of 15 g/L of media. Amino acids were made up at the following
concentrations (to produce 50x concentrated stock solutions): adenine, 2 mg/ml;
histidine, 1 mg/ml; leucine, 3 mg/ml; tryptophan 2 mg/ml. These amino acids were then
used in selective media at 1 x concentration as required.
2.3.37 Large-scale yeast transformation
A glycerol stock of the S. cerevisiae L40 strain, previously transformed
with pBTM116 containing full-length SAPK3 (see Section 2.3.44), was streaked on to a
Trp- selective plate and allowed to grow for 2 days at 30°C. A yeast colony was then
selected from this plate and grown overnight in 200 ml Trp- selective media, at 30°C,
180 rpm. The following morning, the overnight culture was added to 1 L Yeast extract-
peptone-dextrose medium + adenine (YPAD) (1% (w/v) yeast extract, 2% (w/v)
peptone, 0.1% (w/v) adenine, 100 mM D-glucose) and grown for approximately 3.5
hours to reach an optical density of OD600 = 0.6 - 0.8. The cells were then collected by
centrifugation (1050 x g, 5 min, RT). Immediately after centrifugation, the supernatant
was decanted and the pellet resuspended in 500 ml sterile ddH2O. The cells were then
centrifuged (1050 x g, 5 min, RT) and the pellet resuspended in 20 ml Tris-EDTA
(TE)/lithium acetate (LiAc) solution (50 mM Tris, 5 mM EDTA, 100 mM LiAc pH 7.5).
Denatured, sheared salmon sperm DNA (10 mg) and pVP16 cDNA library
made from the lymphohemopoietic progenitor cell line, EML Clone.1 (500 µg) were
mixed together and added to the resuspended cells. After thorough mixing, 140 ml
Polyethylene Glycol (PEG)/TE/LiAc mixture (40% (w/v) PEG-4000, 100 mM Tris, 10
mM EDTA, 100 mM LiAc pH 7.5) was added and incubated at 30°C, 90 rpm for 30
min. Following this incubation, 18 ml DMSO was added and the flask swirled to mix.
49
The flask was then placed in a 42°C waterbath for 6 min, to heat shock the yeast cells
and allow uptake of the cDNA library. This flask was swirled every 20 sec to allow heat
transfer. The flask contents were then transferred to a sterile 1 L Schott bottle
containing 400 ml Yeast extract-peptone medium + adenine (YPA) (YPAD without
glucose) at RT. This was mixed and transferred to centrifuge tubes, then centrifuged
(1050 x g, 5 min, RT). The supernatant was removed immediately and the cells
resuspended in 500 ml YPA. The cells were then re-centrifuged as before and the
supernatant removed immediately. The pellets were then resuspended in 1 L YPAD,
pre-warmed to 30°C, and incubated at 30°C, 100 rpm, for 1 hour to allow recovery of
the cells.
After this incubation, cells were centrifuged (1050 x g, 5 min, RT) and the
pellet resuspended in 500 ml Trp- Leu- selective media. Cells were then re-centrifuged
(1050 x g, 5 min, RT), resuspended in 1 L Trp- Leu- selective media pre-warmed to
30°C, then incubated at 30°C, 100 rpm, for 4 hours. Cells were then centrifuged (1050 x
g, 5 min, RT), supernatant decanted, and pellets resuspended in 250 ml tryptophan-,
histidine-, uracil-, leucine-, and lysine-deficient (THULL-) media (40 µg/ml adenine in
SD media). This washing in THULL- media removed all traces of histidine that would
interfere with the subsequent selection of SAPK3-interacting partners by growth in the
absence of histidine (HIS3 reporter). Cells were then re-centrifuged as before (1050 x g,
5 min, RT) and resuspended in 250 ml THULL- media. After another centrifugation
step, the supernatant was decanted and the cells resuspended in 10 ml THULL- media.
To check transformation effieciency, 10 µl of this cell suspension was spread on a 90
mm T- L- selective plate. The remainder of the cell suspension was spread on to 20
THULL- agar plates (each 137 mm in diameter). All plates were then left at RT
overnight to dry, and placed in a 30°C incubator for 3 days to allow growth of the yeast
colonies.
50
2.3.38 β-Galactosidase assay
Following the growth of transformed yeast colonies on THULL- (or Trp-
Leu- plates in the case of a small-scale transformation), yeast were re-streaked to a grid
on fresh THULL- (or Trp- Leu-) plates and left to grow at 30°C for 2 days. A
nitrocellulose membrane and Whatman 3MM filter paper was cut to fit the size of the
plate, and the nitrocellulose membrane was laid over the yeast colonies, ensuring that no
air bubbles appeared. The membrane was then lifted from the plate and allowed to dry
for approximately 5 min on the bench (colony side up). To fix colonies to the
membrane, the membrane was placed colony side up on a pre-cooled aluminium boat
floating in liquid nitrogen for 30 sec, then immersed in liquid nitrogen for 5 sec. The
membrane was then removed from the boat and placed at RT until thawed. Meanwhile,
a Petri dish was prepared for the reaction. In the lid of a Petri dish, 3 ml of X-gal
solution (0.27% (v/v) β-mercaptoethanol, 0.33 mg/ml X-gal in Z buffer (60 mM
Na2HPO4, 40 mM NaH2PO4, 10 mM KCl, 1 mM MgSO4, pH7.0)) was pipetted and the
circle of filter paper placed in this. The membrane was then laid over the filter paper,
colony side up, avoiding air bubbles. This was then covered with the bottom of the dish,
and placed at 30°C, for up to 4 hours. Strong interactions generally resulted in a colour
change within 30 min.
2.3.39 Preparation of glycerol stocks of yeast two-hybrid screening positive
colonies
Following testing of library interactors for lacZ reporter activation, glycerol
stocks of the positive colonies were made for extraction of plasmid DNA and re-
transformation into yeast cells. Glycerol stock mix (His- Trp- Leu- media containing
15% (v/v) glycerol) was pipetted into several 96-well plates (50 µl per well), and a
single colony was placed into each well. The lids of the plates were then replaced and
sealed tightly with Parafilm, before storing at -80°C.
51
2.3.40 Isolation of DNA from the S. cerevisiae strain L40
Glycerol stocks of yeast colonies were streaked out on Leu- plates to select
for pVP16 plasmids, and left to grow at 30°C for 2 days. Liquid cultures (5 ml) in Leu-
selective media were then made from single colonies, and grown for 2 days at 30°C, 180
rpm. Cultures were then centrifuged (1050 x g, 5 min, RT) and the supernatants
decanted. The cell pellets were then resuspended in 200 µl Yeast Lysis Solution (2%
(v/v) Triton X-100, 1% (w/v) SDS, 100 mM NaCl, 10 mM EDTA, 10 mM Tris-HCl pH
8.0). Acid-washed glass beads (425-600 microns) were aliquoted into Eppendorf tubes
up to the 100 µl graduation, and the resuspended cells added. One volume of
phenol:chloroform (1:1) was added and each sample vortexed for 2 min. Samples were
then centrifuged (13,000 x g, 10 min, RT) and the supernatants transferred to clean
Eppendorf tubes. The plasmid DNA was then precipitated with the addition of 20 µl 3
M sodium acetate (pH 5.0), mixing, and adding 500 µl 100% ethanol with mixing. This
was then placed in a -20°C freezer for 20 min. The samples were then centrifuged
(13,000 x g, 20 min, RT) and the supernatant decanted. To wash the pellets, 500 µl 70%
ethanol was added and the tubes re-centrifuged (13,000 x g, 10 min, RT). The
supernatant was then decanted and the pellets allowed to air-dry for approximately 10
min. Pellets were then resuspended in 25 µl TE Buffer (100 mM Tris, 10 mM EDTA)
and stored at -20°C until use.
2.3.41 Preparation of electrocompetent KC8 cells
A glycerol stock of the E. coli strain KC8 was streaked on to a LB-agar
plate containing 30 µg/ml kanamycin, and grown overnight at 37°C. The following day,
colonies were added to LB media containing 30 µg/ml kanamycin and the cultures
grown at 37°C, 250 rpm, until an A600 of 0.6-0.8 was reached. The cells were chilled on
ice for 20 min, then centrifuged (3000 x g, 7 min, 2°C). The supernatant was decanted
and the pellets resuspended in 1 litre of sterile ice-cold ddH2O. The cells were then
centrifuged again (3500 x g, 10 min, 2°C). The pellets were then resuspended in 500 ml
of sterile ice-cold ddH2O and re-centrifuged (4000 x g, 10 min, 2°C). The supernatant
52
was decanted and the pellet resuspended in 20ml of ice-cold 10% (v/v) glycerol in
ddH2O. This was then centrifuged (2300 x g, 20 min, 2°C). The supernatant was
removed and the pellet was resuspended in 1 ml of ice-cold 10% (v/v) glycerol in
ddH2O. The cells were then electroporated or stored at -80 °C for later use.
2.3.42 Bacterial electroporation
Freshly prepared electrocompetent cells, or frozen electrocompetent cells
thawed on ice were used for electroporation. Approximately 100 ng (2 µl) of DNA
isolated from yeast (Section 2.3.40) was mixed with 40 µl of competent KC8 cells in a
cold 1.5 ml Eppendorf tube and kept on ice for 1 – 10 min. This mixture was then
transferred to a cold 0.2 cm electroporation cuvette (Bio-Rad), and the cuvette tapped to
ensure the mixture evenly covered the base. The Bio-Rad Gene Pulser was set at 25 µF,
2.5 kV and the pulse controller set at 200 Ω. The cuvette was placed into a safety
chamber slide and the slide pushed into the chamber of the Gene Pulser until the cuvette
was seated between the contacts at the base of the chamber. One pulse was then
delivered, resulting in a time constant of approximately 4.5 msec. Immediately after
pulse delivery, 1 ml of sterile SOC Buffer (2% (w/v) Bacto-tryptone, 0.5% (w/v) Yeast
extract, 8.6 mM NaCl, 2.5 mM KCl, 10 mM MgCl2; pH 7.0) was added and the cells
resuspended. The resuspended cells were then transferred to 1.5 ml Eppendorf tubes and
incubated at 37°C for 1 hour. After this incubation time, cells were centrifuged (13,000
x g, 1 min, RT) and the supernatant removed. The cell pellet was then resuspended in
100 µl M9 salts solution (22 mM KH2PO4, 48 mM Na2HPO4, 8.6 mM NaCl2, 18.6 mM
NH4Cl; pH 7.2), and centrifuged again (13,000 x g, 1 min, RT). The supernatant was
decanted and the pellet resuspended in 100 µl M9 salts solution, before being spread on
to Minimal Media plates (20% (v/v) M9 salts solution, 2 mM MgSO4, 20 mM D-
glucose, 100 µM CaCl2, 40 µg/ml L-tryptophan, 20 µg/ml L-histidine, 100 µg/ml
ampicillin, 30 µg/ml kanamycin, 1 mM thiamine-HCl, 1.5% (w/v) agar). Plates were
incubated for 2 days at 37°C to allow growth of bacterial colonies.
53
2.3.43 Isolation of plasmid DNA from KC8 bacterial cells
Following the growth of KC8 bacterial colonies on Minimal Media plates,
single colonies were picked, inoculated into 2.5 ml Minimal Media, and grown
overnight (37°C, 200 rpm). The following morning, minipreps were performed to
isolate plasmid DNA using the QIAGEN miniprep kit, according to the manufacturer’s
instructions.
2.3.44 Small-scale yeast transformation
A glycerol stock of the S. cerevisiae L40 strain was streaked on to a
YPAD-agar plate (YPAD containing 1.5% (w/v) agar) and left to grow overnight at
30°C. The next day, 40 ml of YPAD media was inoculated with a single colony of L40
yeast and grown overnight at 30°C, 180 rpm.
The following day, the culture was centrifuged (670 x g, 5 min, RT) and
the pellet resuspended in 40 ml ddH2O. The resuspended cells were then re-centrifuged
(670 x g, 5 min, RT) and the pellet resuspended in 5 ml of LiAc/TE solution. The cells
were then incubated at RT for 10 min. Meanwhile, DNA to be transformed into yeast
cells was aliquoted into 1.5 ml Eppendorf tubes. This consisted of 1 µl of pBTM116
plasmid DNA, containing the insert of interest, 1 µl of pVP16 plasmid DNA containing
the insert of interest, and 10 µl (100 µg) of denatured, sheared salmon sperm DNA. The
DNA was mixed together thoroughly before addition of 100 µl of the yeast cell mix.
After thorough mixing, 700 µl LiAc/PEG/TE mixture was added, the contents
thoroughly mixed, and the tubes incubated at 30°C for 30 min. Following this
incubation time, 88 µl DMSO was added to each tube, mixed, and incubated at 42°C for
7 min. Tubes were then centrifuged at 13,000 x g for 10 sec and the supernatants
removed. The pellets were then resuspended in 100 µl TE Buffer and spread on to
plates containing the required selective media. Plates were left to dry at RT for
approximately 1 hour before being placed in a 30°C incubator for 3 days to allow growth
of transformed yeast colonies.
54
2.3.45 Screening of a cDNA library with the SAPK3 antibody
A λ phage heart cDNA library was screened with the SAPK3 antibody to
isolate SAPK3 clones and confirm both the specificity of SAPK3 antibody specificity
and the cardiac expression of SAPK3. This method involved plating out a λ phage heart
cDNA library on a bacterial (Y1090r-) lawn and allowing the phage to lyse the bacterial
cells. Plates were then overlaid with IPTG-impregnated nitrocellulose filters to induce
protein expression of the library. Filters were then removed from the plates, blocked,
and subjected to immunoblotting with the SAPK3 antibody. Positive plaques were then
identified by a colourimetric detection system, isolated and sequenced.
2.3.46 Initial preparation for the library screening procedure
At least two days prior to screening, LB agar plates containing MgSO4 (LB
medium, 10 mM MgSO4, 15g/L agar; pH 7.0; autoclaved) were poured and stored at
4°C. Top agarose (LB medium, 10 mM MgSO4, 7.2 g/L agarose; pH 7.0; autoclaved)
was also made and stored at 4°C. Two days before screening, the E.coli host strain
Y1090r- was streaked on to an LB agar plate containing 50 µg/ml ampicillin and left to
grow overnight at 37 °C. The following day, 50 ml of LB medium was inoculated with
a single colony isolated from this plate and left to grow overnight (37 °C, 200 rpm).
2.3.47 Establishing the library titre
Before the commencement of library screening, it was necessary to titre the
library to confirm the number of plaques formed per ml of library. This would then
allow for the control of the number of plaques per plate in the screening procedure.
Therefore, serial dilutions of the library were made in Sterile Media (SM) (100 mM
NaCl, 8 mM MgSO4, 0.1 % (w/v) gelatin, 50 mM Tris-HCl, pH 8.0; autoclaved) and
mixed with the host bacterial strain and top agarose, as described in Section 2.3.44.
These were left to grow for 3 hours at 37 °C and then transferred to 42 °C for
55
approximately 5 hours. The resulting plaques were then counted to obtain the plaques
formed per ml of library. From this, the amount of stock phage required to give
approximately 15,000 plaques per plate for primary library screening was calculated (a
dilution of 1 in 105).
2.3.48 Screening procedure
An aliquot of the Rat Heart 5'-STRETCH PLUS cDNA Library (Clontech)
was diluted in SM (1 in 105) and stored at 4°C. Diluted phage (300 µl) were mixed with
600 µl of the overnight bacterial culture and incubated for 15 min at 37°C. Top agarose
warmed to 45°C was added to a final volume of 10 ml and this entire mixture quickly
poured over a warm agar plate (150 mm) on a level platform. After the top agarose had
solidified, plates were then left inverted at 42°C to allow bacterial growth and lysis by
phage for approximately three hours. During this period, nitrocellulose filters were
soaked in sterile 10 mM IPTG in ddH2O and dried in a sterile laminar flow hood. The
plates were then overlaid with these dried, IPTG-impregnated filters to induce protein
expression. Reference points were marked on the filters by piercing through the filters
and agar with a sharp instrument. The plates were then incubated for approximately 4
hours at 37 °C (until plaques were approximately 1 mm in diameter) to induce protein
expression. The filters were removed from the LB agar plates and incubated with 10 ml
Blocking Solution (5% (w/v) skim milk powder in TBST; RT), then incubated overnight
at 4°C with the SAPK3 antibody diluted in blocking solution.
The following day, the filters were washed in TBST (3 x 5 min; RT), and
then incubated with anti-rat antibody linked to horseradish peroxidase. The filters were
then washed again in TBST (3 x 5 min; 1 x 10 min; RT). Positive plaques were detected
with 2.8 mM 4-chloro-1-napthol in 10 mM imidazole buffer (pH 8.1) containing 17%
methanol and 3.7 mM hydrogen peroxide for approximately 30 min (RT). The reaction
was stopped with 3 x 5 min washes in ddH2O.
56
Well-isolated homogeneously-positive colonies for sequencing required a
2-3 further screening rounds. Therefore, filters were aligned with their corresponding
agar plates, and tentatively positive colonies were excised from the agar and placed into
1 ml SM containing 20 µl chloroform. These were then left at 4 °C overnight to allow
lysis of bacterial cells. The diluted phage were then titered as described in Section
2.3.47 to determine the volume required to give approximately 100-200 plaques on a 90
mm petri dish. This low plaque density was to enable the plaques to grow to a larger
size than in the primary screen, giving stronger signals and permitting individual
positives to be more easily identified and selected. Following titering, the diluted phage
were screened as described for primary screening, with the exception that plates were
incubated overnight following induction of protein expression with IPTG-impregnated
filters, to allow increased growth of plaques.
57
Chapter 3
Evaluation of the expression and localisation of SAPK3 in cell culture models
3.1 Introduction
The activation of protein kinase signalling pathways such as the MAPK
pathways has been implicated in a wide variety of diseases, including neurodegenerative
diseases, arthritis, muscular dystrophy, cancer and cardiovascular disease (Hunot et al.,
2004; Anguita et al., 2002; Nakamura et al., 2001; Kolodziejczyk et al., 2001;
MacDonald et al., 2001; Cook et al., 1999). For this reason, protein kinases are now
considered by some researchers to be the second most important group of drug targets,
after the G-protein-coupled receptors (Cohen, 2002; Vlahos et al., 2003).
Cardiovascular disease is the leading cause of death in Australia,
accounting for 39% of all deaths in 2000 (National Heart Foundation of Australia). This
incidence is similar in other developed countries and is likely to approach these levels in
developing countries as they adopt more sedentary lifestyles, a higher fat intake,
relatively lower intakes of plant foods, and lower levels of everyday physical activity
(Yusuf, 1998; Walker et al., 2004). The molecular mechanisms responsible for the
development of cardiovascular disease are poorly understood, but are thought to involve
intracellular signalling pathways (Chien, 1999). Many MAPK family members are
expressed in the heart (Kim et al., 1998), and their expression as well as their activation
state has been shown to change both during normal heart development and during heart
disease, implicating them for a role in these processes (Corson et al., 2003; Cook et al.,
1999; Lemke et al., 2001).
It was first proposed that the ERK MAPKs could mediate the development
of cardiac hypertrophy (Bogoyevitch et al., 1993), the disease process in which the
cardiac myocytes undergo enlargement without cell division to adapt to a demand in
increased workload (Chien et al., 1991). This has been independently confirmed by
studies using selective ERK MAPK pathway inhibitors to prevent cardiac hypertrophy
(Yue et al., 2000), or by the cardiac-restricted overexpression of active MKK1 (the
upstream activator of ERK MAPKs) to cause concentric hypertrophy in vivo (Bueno et
al., 2000). ERK signalling may also play a cardioprotective role. For example, ERK2
58
signalling protects the myocardium from ischemia-reperfusion injury in vivo (Lips et al.,
2004).
The role of JNK and p38 MAPK family members in cardiac tissue remains
controversial, with many studies supporting the role of these MAPK family members in
the progression to heart failure, and others in a cardioprotective function. For example,
the use of transgenic mouse models with targeted expression of active MKK7 in cardiac
myocytes led to heart failure, suggesting that activated JNK MAPKs facilitate the
processes leading to heart failure (Petrich et al., 2004). Conversely, another study has
shown that the MEKK1-JNK pathway plays a protective role in pressure overload in
vivo through the use of MEKK1 knockout mice (Sadoshima et al., 2002).
JNK and SAPK2a activation have been found to be increased in heart
samples from patients with heart failure secondary to ischemic heart disease (Cook et al.,
1999). A pro-apoptotic role for SAPK2a during ischemia is suggested by the protection
of cardiac myocytes from ischemic damage by the specific p38 isoform inhibitor,
SB203580 (Mackay and Mochly-Rosen, 1999). Indeed, a role for SAPK2a in stress
signalling in the heart is implicated by its activation in response to a variety of different
agonists in cardiac myocytes, including ischemia and reperfusion (Bogoyevitch et al.,
1996), cytokines (Clerk et al., 1999), hypertrophic agonists (Clerk and Sugden, 1999)
and mechanical stretch (Kudoh et al., 1998). However, despite the implication of
SAPK2a in cardiac cell death, this kinase has also been implicated in beneficial
signalling in the heart. For example, SAPK2a signalling has been implicated in
mediating ischemic preconditioning of the heart (Nakano et al., 2000).
Despite continued interest in the p38 pathway, no studies to date have
addressed the role of p38 isoforms other than SAPK2a and SAPK2b in the heart. The
role of the two p38 MAPK isoforms SAPK2a and SAPK2b has been described
following their overexpression in vitro (Wang et al., 1998a). Thus, SAPK2b mediated
cardiac hypertrophy but SAPK2a mediated apoptotic cell death when overexpressed in
cardiac myocytes (Wang et al., 1998a). This highlights that different members within a
59
single SAPK family can play distinct roles in the heart. One study has examined the in
vivo effects of constitutive p38 MAPK family signalling in the heart. In this study,
transgenic mice with ventricular-specific expression of the constitutively active p38
MAPK upstream activators MKK3 and MKK6 showed differential effects on heart
chamber remodelling and premature death (Liao et al., 2001). In contrast to early
studies which showed that SAPK2b mRNA was expressed in the heart (Stein et al.,
1997; Jiang et al., 1996), SAPK2b protein was not detected in these hearts, suggesting
that the differences in cardiac phenotypes could be attributed to differential activation of
other p38 isoforms (Liao et al., 2001). The absence of SAPK2b mRNA and protein in
the heart is supported by Lemke et al., who reported that SAPK2a is the predominant
isoform expressed in human heart, with lower levels of SAPK3 and SAPK4 detected
(Lemke et al., 2001). Thus, it remains possible that other members of the p38 MAPK
family could play a role in these signalling events in the heart.
SAPK3, a distinct p38 MAPK isoform, has been shown to be expressed (at
the mRNA level) in a variety of tissues, with the highest levels of expression in skeletal
muscle (Mertens S et al., 1996). SAPK3 is also phosphorylated and activated by the
upstream activators, MKK3 and MKK6 (Enslen et al., 1998; Cuenda et al., 1997). The
identification of binding of SAPK3 to the α1-syntrophin PDZ domain suggests that
SAPK3 may have distinct subcellular localisation in muscle (Hasegawa et al., 1999).
SAPK3 and other p38 isoforms are therefore unlikely to be functionally redundant.
The work in this Chapter was undertaken to determine the expression and
localisation of SAPK3 in the human embryonic kidney (HEK) 293 cell line and primary
cultures of isolated neonatal cardiac myocytes. To perform these analyses, a specific
SAPK3 antibody was required. As described in Chapter 1, the first aim of this project
was to characterise the use of a specific SAPK3 monoclonal antibody for detecting
endogenous SAPK3. In this Chapter, HEK293 fibroblasts were used for initial
characterisation of this antibody due to the ease of culturing and transfecting these cells.
Once the expression and localisation of SAPK3 could be determined in the HEK293
60
fibroblast models, this would then allow similar analyses to be performed on the
neonatal cardiac myocytes.
3.2 Results
3.2.1 A specific anti-SAPK3 monoclonal antibody suitable for immunoblotting and
immunolocalisation
Previous studies have reported the expression of SAPK3 mRNA in a
variety of tissues, with particularly high levels in skeletal muscle (Mertens et al., 1996;
Lechner et al., 1996; Li et al., 1996). The characteristics of exogenously overexpressed
SAPK3 (as introduced by transient transfection) have been studied at the protein level
(Lechner et al., 1996; Cuenda et al., 1997), however at the commencement of these
studies the expression and activation of endogenous SAPK3 protein was poorly
characterised with only a limited number of studies being performed in immortalised cell
lines (Conrad et al., 1999; Wang et al., 2000) and only one study in skeletal muscle
(Boppart et al., 2000). To begin to characterise this kinase, a monoclonal antibody
against full-length recombinant SAPK3 was used. This had previously been generated
by Jacky Cordell at the Institute for Cancer Research Hybridoma Unit (London, UK).
The specificity of the SAPK3 antibody had been previously confirmed in
overexpression systems that allowed inclusion of appropriate controls not possible when
examining endogenously-expressed proteins. Because these results have been presented
previously in a Bachelor of Science Honours thesis they are not presented here. Instead,
the reader is referred to Appendix II of this thesis (Court et al., 2002). Briefly, in those
studies HEK293 fibroblasts were transiently transfected with a myc epitope-tagged
SAPK3 construct. SAPK3 expression was then confirmed by immunoblotting with a
myc epitope tag antibody and the SAPK3 antibody. Both detected a protein of ~45 kDa
in cells transfected with > 0.1 µg SAPK3 plasmid DNA (Appendix II, Figure 1).
Allowing for the size of the myc epitope tag, this agreed with the reported size of murine
SAPK3 (42 kDa) (Mertens et al., 1996) which is larger than SAPK2a (41 kDa) (Han et
61
al., 1994). To determine whether the SAPK3 antibody was capable of detecting
endogenous levels of SAPK3, HEK293 cells were seeded into dishes, lysed, and
subjected to Western blotting using the SAPK3 antibody. As seen in Figure 3.1A, the
SAPK3 antibody detected a single band of approximately 44 kDa in size.
MAPKs and SAPKs have been suggested to play important roles in the
heart, being implicated in the growth, development, differentiation, disease and death of
this tissue (Braz et al., 2002; Ueyama et al., 2000; Corson et al., 2003; Regan et al.,
2002; Davidson and Morange, 2000; Liao et al., 2001; Cook et al., 1999; Kaiser et al.,
2004; Aoki et al., 2002). Due to the implication of MAPKs and SAPKs in these
processes in cardiac tissue, it was of interest to determine whether SAPK3 was detected
in the heart. Primary cultures of neonatal rat cardiac myocytes have previously been
used to show expression of MAPK family members and their activation in response to
specific stimuli (Bogoyevitch et al., 1993; Bogoyevitch et al., 1994). Therefore, cultured
neonatal rat cardiac myocytes were lysed and subjected to Western blotting using the
SAPK3 antibody. The SAPK3 antibody detected a single band at approximately 42 kDa
in size (Fig 3.1B). Two fainter bands were also detected. Thus, the SAPK3 antibody
appeared to be capable of recognising both overexpressed (Appendix II) and endogenous
(Figure 3.1) SAPK3.
3.2.2 SAPK3 shows a punctate localisation in HEK293 fibroblasts and cardiac
myocytes
Previous work has shown that SAPK3 localises throughout the cell
cytoplasm and is largely excluded from the nucleus when overexpressed in Cos and
HEK293 fibroblasts (N. Court, BSc Hons). Again, the reader is referred to Appendix II.
However, at the time of commencing these studies, the localisation of endogenous
SAPK3 had not been reported in any tissue or cell type. Having confirmed the
specificity of the SAPK3 antibody by detecting overexpressed SAPK3 by Western
blotting and staining, and endogenous SAPK3 by Western blotting, this antibody was
used to examine the localisation of endogenous SAPK3 in cultured HEK293 fibroblasts
62
Aα-SAPK3
45 kDa
30 kDa
66 kDa97 kDa
220 kDa
20.1 kDa
SAPK3
Bα-SAPK3
45 kDa
30 kDa
66 kDa97 kDa
220 kDa
20.1 kDa
SAPK3
Figure 3.1: SAPK3 can be detected in HEK293 and neonatal rat cardiac myocyte cell lysates.(A) HEK293 fibroblasts were seeded into dishes and cultured for 40 hours before lysis. Cell lysates (65 µg) were then subjected to Western blotting with the SAPK3 monoclonal antibody. (B) Neonatal rat cardiac myocytes were isolated from 1-day old Sprague-Dawley rats and seeded into dishes. Cells were cultured for 40 hours before lysis. Cell lysates (40 µg) were then subjected to Western blotting with the SAPK3 monoclonal antibody. Open arrows indicate lower molecular weight bands that are possible degradation products of the SAPK3 protein. The slight decrease in apparent molecular weight of rat SAPK3 compared to human (HEK293 fibroblasts) SAPK3 was confirmed when comparing the expression of SAPK3 in tissue samples from the two species (Chapter 4).
62a
(Fig 3.2). Staining of HEK293 fibroblasts using this antibody showed SAPK3 to have a
punctate, cytoplasmic distribution (Fig 3.2A). This staining was reduced to control
levels (where the primary antibody was omitted; Fig 3.2C) when the SAPK3 antibody
had been previously incubated with a 100-fold excess (by weight) of GST-SAPK3 (Fig
3.2B).
Having determined that the SAPK3 antibody was appropriate for
immunostaining of HEK293 fibroblasts, this antibody was then used to determine the
localisation of SAPK3 in cultured cardiac myocytes. The localisation of SAPK3 in
cultured cardiac myocytes was compared to that of SAPK2a/b using the SAPK3
antibody and a commercial antibody which was raised against the human SAPK2a
sequence (Fig 3.3). SAPK2a and SAPK2b share 74% sequence identity (Jiang et al.,
1996) and therefore the commercial SAPK2a antibody recognises both proteins.
However, previous studies have shown that SAPK2b was not expressed in the heart at
the mRNA or protein level (Lemke et al., 2001). The staining of cardiac myocytes using
this antibody therefore should be mainly, if not solely, attributed to the SAPK2a protein.
The localisation of SAPK2a has been reported previously, and shown to be
cytoplasmic and nuclear in 293T cells (Ben Levy et al., 1998; Lee et al., 2000).
Overlaying the images of SAPK3 (Fig 3.3A) and SAPK2a (Fig 3.3C) showed distinct
patterns of protein localisation (Fig 3.3E). SAPK2a was expressed throughout the cell
with high levels in the nucleus, as demonstrated when co-staining with Hoechst 33258
(Fig 3.3F). In contrast, SAPK3 was excluded from the nucleus and showed a punctate
distribution in the cell cytoplasm, suggesting organelle-specific localization (Fig 3.3A,
3.3F). This closely resembled the pattern seen in HEK293 fibroblasts (Figure 3.2) and
therefore was not likely the result of non-specific cross-reaction with proteins of smaller
molecular weight seen in Figure 3.1. No immunofluorescence was detected when
primary antibodies were omitted (Fig 3.3B, 3.3D).
63
SAPK3
A
Pre-absorbed SAPK3
B
α-rat-Alexa 488 only(no SAPK3 antibody)
C
Figure 3.2: Endogenous SAPK3 shows a punctate cytoplasmic distribution in HEK293 fibroblasts.HEK293 cells were cultured for 40 hours, then fixed, permeabilised and stained with SAPK3 antibody (A) or SAPK3 antibody that had been incubated overnight with 100-fold excess (by weight) recombinant GST-SAPK3 protein (B). No staining was visualised when the primary antibody was omitted (C). Cells were also stained with Hoescht 33258 to visualise the nuclei (A, B, C). Results shown are representative of 2 independent experiments. Scale bar = 20 µm.
63a
SAPK3
SAPK3 +
SAPK2a
SAPK2a
A B
DC
E F
α-rat-Alexa 488 only (no SAPK3 antibody)
α-rabbit-Alexa 546 only (no SAPK2a/b antibody)
SAPK3+
SAPK2a+
Hoechst 33258
Figure 3.3: Endogenous SAPK3 shows a punctate cytoplasmic distribution in neonatal rat cardiac myocytes.Neonatal rat cardiac myocytes on laminin-coated glass coverslips were cultured for 2 days, then fixed in 4% paraformaldehyde and stained with anti-SAPK3 antibody (A), SAPK2a/b antibody (C), or both antibodies together (E). No immunofluorescence was detected when the primary antibodies were omitted (B, D). Hoechst 33258 stain identified the nuclei (F). Results shown are representative of 3 independent experiments. Scale Bar = 36 µm.
63b
3.2.3 Leptomycin B treatment confirms SAPK3 cytoplasmic localisation
Inactive SAPK2a is a nuclear protein complexed with one of its substrates,
MAPKAPK2 (Ben Levy et al., 1998). The results presented here support the nuclear
localisation of SAPK2a (Fig 3.3C; 3.3F), but show nuclear exclusion of endogenous
SAPK3 (Fig 3.3A; 3.3F). Therefore the inhibitor of nuclear export signal-dependent
transport, Leptomycin B, was used (Wolff et al., 1997). This approach has been used
previously to inhibit the MKK1/2 nuclear export signal-dependent shuttling of ERK
between the nucleus and cytoplasm (Adachi et al., 2000). This study showed that the
shuttling of ERK between the nucleus and cytoplasm was dependent on ERK interacting
with its upstream activators, MKK1/2 (Adachi et al., 2000).
SAPK3 localisation in cardiac myocytes was unaltered following treatment
with Leptomycin B (compare Fig 3.4A with Fig 3.4C). In contrast, more SAPK2a was
detected in the nucleus following Leptomycin B treatment (compare Fig 3.4E with Fig
3.4G). Controls showed no staining when primary antibodies were omitted (Fig 3.4B,
3.4D, 3.4F, 3.4H). This confirmed that inactive SAPK3 was cytoplasmic whereas
inactive SAPK2a was nuclear in agreement with earlier reports (Ben Levy et al., 1998).
3.2.4 SAPK3 co-localises with mitochondrial markers
SAPK3 staining appeared to show a punctate pattern in both HEK293
fibroblasts and cardiac myocytes. This punctate staining showed some similarities to
that expected for focal adhesion points in the cell (P. Rigby, personal communication).
Therefore, cardiac myocytes were stained with a specific antibody against the protein
Paxillin, which localises to focal adhesions (Turner et al., 1990). As seen in Figure 3.5,
SAPK3 staining did not co-localise with Paxillin. The SAPK3 staining appeared to
represent punctate structures (Fig 3.5A). These were further inside the cell, rather than
at the cell periphery where Paxillin was localised (Fig 3.5B).
64
Figure 3.4: SAPK3 has a punctate cytoplasmic localisation and this does not alter with Leptomycin B treatment of neonatal rat cardiac myocytes.Neonatal rat cardiac myocytes were pretreated with Leptomycin B (a nuclear export inhibitor) for 3.5 hours, then fixed in 4% paraformaldehyde and stained with antibodies specific for SAPK3 or a related family member, SAPK2a. When cells are treated with Leptomycin B, SAPK2a is retained in the nucleus, and therefore brighter staining is observed (G), compared to control (E). However, LeptomycinB treatment did not alter SAPK3 localisation (compare panels A and C), suggesting that it is primarily a cytoplasmic protein. Scale Bar = 40 µm.
α-SAPK3
α -SAPK3 + Leptomycin B
α-SAPK2a/2b+ Leptomycin B
α-rat Alexa 488(no SAPK3 antibody)
α-rabbit Alexa 546(no SAPK2a/b antibody)
α-rat Alexa 488(no SAPK3 antibody)
α-rabbit Alexa 546(no SAPK2a/b antibody)
A B
C D
E F
G H
α -SAPK2a/2b
64a
Overlay+ Hoescht 33258SAPK3 Paxillin
A CB
Hoescht 33258 +α-rat-Alexa 488 only(no SAPK3 antibody)
Hoescht 33258 +α-rabbit-Alexa 546 only(no Paxillin antibody)
ED
Figure 3.5: SAPK3 does not co-localise with Paxillin in cardiac myocytes.Cardiac myocytes were isolated from 1 day old Sprague-Dawley rats and maintained in culture for 2 days. Cells were then fixed, permeabilised and stained with anti-SAPK3 (A) or anti-Paxillin (B). Panel C shows an overlay of panels A and B. Green staining indicates position of SAPK3 in cells; red staining indicates Paxillin. Hoescht 33258 staining (blue) is also included to indicate the position of nuclei in the cells. No staining was visualised when the primary antibodies were omitted (Panels D, E). Scale Bar = 20 µm.
64b
To determine whether SAPK3 staining represented co-localisation with the
mitochondria, cardiac myocytes and HEK293 fibroblasts were treated with the dye
Mitotracker Red that accumulates in actively respiring mitochondria, or the cells were
stained with an antibody against the mitochondrial protein HSP60. The cells were then
co-stained with the SAPK3 antibody. As shown in Figure 3.6, cells stained with the
SAPK3 antibody demonstrated a punctate pattern of staining (Fig 3.6A, D, G, and J),
and this staining pattern was also observed with Mitotracker (Fig 3.6B and H) or the
anti-HSP60 antibody (Fig 3.6E and K). Overlaying these images showed SAPK3
staining co-localising with Mitotracker or HSP60 staining in both cardiac myocytes and
HEK293 fibroblasts (Fig 3.6C, F, I and L).
3.2.5 SAPK3 overexpression does not appear to alter the morphology or survival of
cardiac myocytes
The overexpression of MAPKs and their upstream activators can induce
morphological changes in neonatal rat cardiac myocytes, indicating roles for these
proteins in cardiac hypertrophy and cell death (Ueyama et al., 2000; Wang et al., 1998a).
Thus, myc-tagged SAPK3 was overexpressed in neonatal rat cardiac myocytes to
examine its effects. Cells were also co-stained with phalloidin-TRITC to assess cell
morphology and the organization of actin filaments. In addition, Hoechst 33258 staining
was used to examine nuclei for indications of cell death. This stain has previously been
used to differentiate between nuclei from normal, necrotic and apoptotic cells (Chihab et
al., 1998). Figures 3.7 and 3.8 show cardiac myocytes overexpressing SAPK3 (Fig
3.7A, 3.7B, 3.8A, 3.8B). The pattern of actin filaments and size of these cells was
similar to non-transfected cells (Fig 3.7C, 3.7D, 3.8C, 3.8D), suggesting that no
morphological changes followed SAPK3 overexpression. Furthermore, the staining of
nuclei with Hoechst 33258 indicated that cells were not undergoing cell death, a
situation that would be evident by the appearance of brightly staining small nuclei (Fig
3.7E, 3.7F, 3.8E, 3.8F) (Chihab et al., 1998). Overlaying all three images shows SAPK3
overexpression in the cytoplasm and nucleus (Fig 3.7G, 3.7H, 3.8G, 3.8H), in contrast to
the endogenous protein which is expressed in the cytoplasm only (Fig 3.3A).
65
Mitotracker Overlay + Hoescht 33258SAPK3
A B C
SAPK3 Overlay + Hoescht 33258HSP60
D E F
Overlay + Hoescht 33258MitotrackerSAPK3
H IG
HSP60SAPK3 Overlay + Hoescht 33258
K LJ
Figure 3.6: SAPK3 co-localises with mitochondrial markers.Panels A-F: Cardiac myocytes were isolated from 1 day old Sprague-Dawley rats and maintained in culture for 2 days. Cells were then treated with Mitotracker Red for 40 min (panel B) or left untreated, then fixed, permeabilised and stained with anti-SAPK3 (A, D). Cells not treated with Mitotracker were then stained with anti-HSP60 (panel E). Panels C and F show the overlay of panels A and B, or D and E, respectively. Yellow staining represents where SAPK3 (green) and mitochondrial markers (red) co-localise. Hoescht 33258 staining (blue) is also included to indicate the position of nuclei in the cells. Scale Bar = 36 µm.Panels G-L: HEK 293 fibroblasts were seeded into dishes and cultured for 2 days. Cells were treated with Mitotracker Red for 40 min (panel H) or left untreated, then fixed, permeabilised and stained with anti-SAPK3 (G, J). Cells not treated with Mitotracker were then stained with anti-HSP60 (panel K). Panels I and L show the overlay of panels G and H, or J and K, respectively. Yellow staining represents where SAPK3 (green) and mitochondrial markers (red) co-localise. Hoescht 33258 staining (blue) is also included to indicate the position of nuclei in the cells. Scale Bar = 18 µm.
65a
A
Hoechst33258
Phalloidin-TRITC
Myc
B
E F
DC
G H
Overlay
Figure 3.7: Overexpression of SAPK3 in cardiac myocytes does not appear to induce morphological changes or cell death.Cardiac myocytes were cultured for 18 hours, transfected with 0.4 µg plasmid encoding myc-SAPK3, then fixed 40 hours post-transfection. Cells were stained with anti-Myc antibody (A, B). Phalloidin-TRITC identified actin filaments (C, D) and was therefore used to examine cell morphology. Hoechst 33258 stain identified the nuclei (E, F), and this was used to evaluate whether transfected cells were undergoing apoptosis or necrosis. Overlaying images shows both nuclear and cytoplasmic localisation of overexpressed SAPK3 (G, H). Arrows indicate transfected cells. Results shown are representative of 2 independent experiments. Scale Bar = 40µm.
65b
A B
SAPK3
C D
Phalloidin-TRITC
FE
Hoechst33258
HG
Overlay
Figure 3.8: Overexpression of SAPK3 in cardiac myocytes does not appear to induce morphological changes or cell death.Cardiac myocytes were cultured for 18 hours, transfected with 0.4 µg plasmid encoding myc-SAPK3, then fixed 40 hours post-transfection. Cells were stained with anti-SAPK3 antibody (I, J). Phalloidin-TRITC identified actin filaments (K, L) and was therefore used to examine cell morphology. Hoechst 33258 stain identified the nuclei (M, N), and this was used to evaluate whether transfected cells were undergoing apoptosis or necrosis. Overlaying images shows both nuclear and cytoplasmic localisation of overexpressed SAPK3 (O, P). Arrows indicate transfected cells. Results shown are representative of 2 independent experiments. Scale Bar = 40µm.
65c
3.2.6 SAPK3 phosphorylation and expression in response to agonist treatment
Primary cultures of neonatal rat cardiac myocytes serve as a model system
for studying hypertrophic changes in the pathological myocardium (van Bilsen and
Chien, 1993). Therefore, neonatal cardiac myocytes cells were treated with a variety of
different hypertrophic agonists and examined for changes in SAPK3 expression levels.
As seen in Figure 3.9, SAPK3 protein expression levels did not change with agonist
treatment. When these same samples were analysed for the presence of phospho-p38,
activation of SAPK2a could be detected with Interleukin-1, Leukemia Inhibitory Factor,
and Lysophosphatidic Acid treatment (Figure 3.10). However, no bands were seen at
the expected size for phospho-SAPK3 (Figure 3.10). Furthermore, when these cells
were treated with other agonists of the p38 MAPK pathways such as sorbitol, sodium
arsenite or anisomycin (Hoover et al., 2000; Wang and Proud, 1997; Barros et al., 1997)
for periods ranging from 5 to 60 min, no phospho-SAPK3 bands could be detected
(results not shown). These results suggest that SAPK3 is not phosphorylated and
therefore not activated in cardiac myocytes upon acute or chronic stimulation with the
agonists tested.
3.3 Discussion
Several groups have reported the expression of SAPK3 at the mRNA level
in a variety of tissues (Mertens et al., 1996; Lechner et al., 1996; Li et al., 1996).
However, the expression or activation of endogenous SAPK3, other than in
immortalised cell lines, has been poorly studied. The generation of a specific
monoclonal antibody against SAPK3 has allowed the expression and subcellular
localisation of endogenous SAPK3 to be evaluated in cultured cells, including HEK293
fibroblasts and neonatal rat cardiac myocytes.
The accessibility of a protein kinase to a substrate is one level of control in
the phosphorylation reactions that occur in each cell. Thus, the subcellular localisation of
66
SAPK346 kDa
Vehicle Control ET-1 (100 nM) Iso(100µM) PE (100µM)Time (h): 24 48 72 24 48 72 24 48 72 24 48 72
Vehicle Control IL-1 (1ng/mL) LIF (10ng/mL) LPA (50 µM)Time (h): 24 48 72 24 48 72 24 48 72 24 48 72
46 kDaSAPK3
Figure 3.9: SAPK3 expression levels do not change in response toagonist treatment of cultured cardiac myocytes. Cardiac myocytes were isolated from 1 day old Sprague-Dawley rats and cultured for 24 hours. Cells were then serum-starved for a further 24 hours, then incubated with various hypertrophic agents as indicated for 24, 48 or 72 hours. Cell lysates were then immunoblotted with the monoclonal SAPK3 antibody. Arrows indicate the position of SAPK3. Results shown are representative of 2 independent experiments.Abbreviations: ET-1 = Endothelin-1; Iso = Isoproterenol; PE = Phenylephrine; IL-1 = Interleukin-1; LIF = Leukemia Inhibitory Factor; LPA = Lysophosphatidic acid.
66a
Phospho-SAPK2a
Vehicle Control IL-1 (1ng/mL) LIF (10ng/mL) LPA (50 µM)Time (h): 24 48 72 24 48 72 24 48 72 24 48 72
46 kDa
SAPK3SAPK2a
46 kDa
Figure 3.10: Agonist treatment stimulates phosphorylation of SAPK2a, but not SAPK3, in cultured cardiac myocytes. Cardiac myocytes were isolated from 1 day old Sprague-Dawley rats and cultured for 24 hours. Cells were then serum-starved for a further 24 hours, then incubated with various hypertrophic agents as indicated for 24, 48 or 72 hours. Cell lysates were then immunoblotted with the phospho-p38 MAPK antibody (top panel), or SAPK3 rat monoclonal antibody and SAPK2a rabbit polyclonal antibody in parallel (bottom panel). Results shown are representative of 2 independent experiments. Abbreviations: IL-1 = Interleukin-1; LIF = Leukemia Inhibitory Factor; LPA = Lysophosphatidic acid.
66b
a protein kinase can provide useful information on the possible substrate proteins for
each specific kinase. For example, SAPK2a has been identified as a nuclear protein in
its inactive state, bound to its substrate, MAPKAPK2 (Ben Levy et al., 1998).
Following activation, SAPK2a phosphorylates MAPKAPK2, and this phosphorylation
masks a nuclear localization signal in MAPKAPK2, resulting in the export of both
proteins into the cytoplasm (Ben Levy et al., 1998). This mechanism would therefore
allow SAPK2a and MAPKAPK2 to phosphorylate cytoplasmic substrates. It was
investigated whether SAPK3 was localised to the nucleus of cardiac myocytes.
However, whilst SAPK2a was localised to the nucleus and cytoplasm of these cells,
SAPK3 was exclusively in the cell cytoplasm and showed a punctate distribution (Figure
3.3). This staining was shown to co-localise with mitochondrial markers (Figure 3.6).
The distinct intracellular localisation of SAPK3 supports a model in which this p38
MAPK isoform has the potential to play distinct roles in the heart.
The co-localisation of SAPK3 with the mitochondria suggests that its
substrates will be identified at this organelle. The lack of a mitochondrial targeting
sequence in the SAPK3 protein (unpublished observations), and the fact that only low
levels of non-ionic detergents are required to isolate it from cell lysates (Figure 3.1
lysates were prepared using 0.5% Triton X-100) suggests that it is localised on the outer
mitochondrial membrane rather than the inner mitochondrial membrane, intermembrane
space or mitochondrial matrix. Treatment of HEK293 fibroblasts with 0.5 M sorbitol for
time periods ranging from 5 min to 60 min did not result in SAPK3 translocation to
other areas of the cell (unpublished observations). This hyperosmotic stress has
previously been shown to activate overexpressed SAPK3 in HEK293 cells with 30 min
treatment (Cuenda et al., 1997); N. Court, BSc Hons thesis). This suggests that SAPK3
may be activated in response to a different subset of cellular stresses.
It cannot be ruled out that SAPK3 translocates to other areas of the cell in
response to other stimuli which remain to be tested. For example, stimuli resulting in
the sustained activation of SAPK3 may also cause its translocation to other
compartments of a cell. This would be similar to the situation observed for ERK when
67
PC12 cells are treated with NGF, causing the sustained activation of ERK and its
translocation to the nucleus (Nguyen et al., 1993; Boglari et al., 1998). It should be
noted however, that unlike other MAPKs such as ERK, SAPK3 is monomeric in
structure (Bellon et al., 1999). It has been found that the homo-dimerisation of
phosphorylated ERK2 is essential for its translocation to the nucleus (Khokhlatchev et
al., 1998). Thus, it would appear unlikely that SAPK3 is subject to the same regulation
mechanisms that result in nuclear translocation of ERK MAPKs. At this stage, however,
other mechanisms cannot be ruled out.
When cells overexpressing SAPK3 were examined for any changes in
morphology or cell death, no changes were evident. However, further studies will be
required to determine whether SAPK3 when overexpressed and activated by appropriate
stimuli could exert other short- or long-term biological effects, such as metabolic
changes or alterations in gene expression patterns. For example, the activation of
overexpressed SAPK2a in CCL39 Chinese hamster fibroblasts has previously been
shown to significantly inhibit mitogen-induced cyclin D1 expression, whereas inhibition
of SAPK2a activity with SB203580 enhanced cyclin D1 transcription and protein level
(Lavoie et al., 1996). Both SAPK2a and SAPK3 were found to increase the
transcriptional activity of MEF2A in NIH 3T3 fibroblasts when they were overexpressed
in conjunction with MEF2A and MKK6 (Marinissen et al., 1999).
The use of transient transfection by cationic liposomes such as
Lipofectamine in cardiac myocytes shows approximately 1-2 % transfection efficiency
(unpublished observations). To undertake a more complete study of SAPK3
overexpression in these cells, adenoviral expression therefore should be used in future
work because with this approach over 90% of primary cell cultures of neonatal rat
mycocytes can be made to overexpress the protein of interest (Liao et al., 2002). For
example, this approach has been used to overexpress constitutively active mutants of the
upstream JNK and p38 MAPK family members, MKK3 and MKK7 in cardiac myocytes
(Liao et al., 2002; Wang et al., 1998b). These studies implicated JNK and SAPK2a in
cardiac hypertrophy and the inhibition of cardiac contractility, respectively (Wang et al.,
68
1998b; Liao et al., 2002). To investigate the role of SAPK3 activation in these cells,
future studies would involve adenoviral overexpression of SAPK3 with a constitutively
active mutant of MKK6. However these studies would also require the additional
control of the SAPK2a/b inhibitor SB203580 so that effects could be attributed to
SAPK3.
No alterations in SAPK3 expression levels or phosphorylation were
detected in cardiac myocytes treated with a variety of different agonists either in long-
term exposure (Figure 3.9 and Figure 3.10) or acute exposure (unpublished
observations). It remains unknown why phospho-SAPK3 bands could not be detected in
these protocols. The phospho-antibody that has been used (Figure 3.10) has been used
previously to detect phosphorylated forms of SAPK2a and SAPK3 (Conrad et al., 1999;
Boppart et al., 2000). However, one possible explanation for the inability to detect
phospho-SAPK3 in cardiac myocytes might be reduced sensitivity of this antibody
towards phospho-SAPK3. This is possible because this antibody is raised against the
phosphorylated human SAPK2a protein rather than phosphorylated SAPK3.
Specifically there is 20% sequence difference in the ten amino acids either side of the
Thr-Gly-Tyr motif in the phosphorylation loop of the two proteins and this could be
responsible for reduced sensitivity to phospho-SAPK3. Alternatively, it could be due to
the relatively high levels of SAPK2a compared to SAPK3 in the heart (Lemke et al.,
2001). Thus when evaluating phosphorylation levels in cardiac myocyte lysates,
immunoblots are dominated by a phospho-SAPK2a band. This explanation seems likely
to be the case, since when the C2C12 skeletal myoblast cell line was treated with
arsenite and sorbitol for time periods ranging from 15 to 60 min and immunoblotted for
the presence of phospho-SAPK3, phospho-SAPK3 could be detected (unpublished
observations).
The development of an effective assay for measuring the phosphorylation
status or activity of SAPK3 in the heart should provide further clues on its role in this
tissue. For example, it may be possible to identify changes in the phosphorylation state
of SAPK3 by iso-electric focusing. The iso-electric point of SAPK3 should be altered
69
when it becomes phosphorylated, and therefore the inactive protein would theoretically
show a different migration to the active, phosphorylated protein based on this property.
This approach has previously been used to separate phosphorylated and non-
phosphorylated forms of HSP25 and HSP27 (Clerk et al., 1998a). Alternatively, the
development of a SAPK3 antibody that efficiently and specifically immunoprecipitates
endogenous SAPK3 from cells would be extremely useful. However, the SAPK3
antibody used in this Chapter, although showing high specificity and avidity for SAPK3
in Western blotting and immunocytochemistry applications, fails to immunoprecipitate
SAPK3 efficiently (results not shown). Furthermore, although another SAPK3 antibody,
raised to the C-terminal tail sequence of this protein, has been shown to
immunoprecipitate SAPK3, it interferes with some subsequent assays of activity
(Hasegawa et al., 1999). An antibody recognising another domain of SAPK3 and that
does not interfere with its kinase activity is therefore desirable.
In summary, the results presented in this Chapter show the expression of
SAPK3 in HEK293 fibroblasts and cultured neonatal cardiac myocytes, and a unique
subcellular localisation of endogenous SAPK3 compared to that of SAPK2a. Through
the development of inhibitors for SAPK3 and methods to assay its activity, the role of
SAPK3 in these cells may be better understood. The expression of SAPK3 in isolated
cardiac myocytes suggests a role for this kinase in cardiac tissue. In the following
Chapter this will therefore be addressed by investigating the expression of SAPK3 in
whole heart tissue taken from embryonic, neonatal and adult animals.
70
Chapter 4
Evaluation of the expression and activation of SAPK3 in the intact heart
4.1 Introduction
Despite the usefulness of cardiac myocytes as a model for the processes
occurring in the whole heart, discrepancies arise when comparing the results from
different studies using these cells. Specifically, while most reports tend to agree on a role
for ERK in mediating cardiac myocyte hypertrophy and survival (Bueno and Molkentin,
2002), there is disagreement on the role of JNK and p38 MAPK family members in this
process. For example, several studies have found that activation of JNK and p38 MAPK
family members leads to hypertrophy in cardiac myocytes (Ramirez et al., 1997; Wang et
al., 1998b; Clerk et al., 1998b; Zechner et al., 1997), while others have suggested that
these SAPKs play a role in cardiac myocyte apoptosis (Wang et al., 1998a; Adams et al.,
1998; Aoki et al., 2002; Remondino et al., 2003). It has been suggested that factors
including cardiac myocyte culture density and the extent of culture contamination with
fibroblasts may be responsible for such discrepancies (Hines et al., 1999; Liang and
Molkentin, 2003).
One example which highlights the danger of using overexpression models to
evaluate the cardiac function of MAPKs is a study which investigated the role of p38
MAPK family members in cardiac myocytes. This study used overexpression of wild-
type and dominant-negative mutants of SAPK2a and SAPK2b in cardiac myocytes to
implicate these proteins in pro-apoptotic and hypertrophic roles, respectively (Wang et
al., 1998a). Although other reports have supported a pro-apoptotic role for SAPK2a/b in
the heart (Iwai-Kanai et al., 2001; Iwakura et al., 2001; Mackay and Mochly-Rosen,
1999), other studies have claimed that SAPK2b mRNA and protein cannot be detected in
the heart, therefore appearing to dismiss any role for this protein in the wild-type heart
(Lemke et al., 2001; Liao et al., 2001).
More recent studies aimed at evaluating the role of MAPKs in the failing
heart have turned to transgenic mouse models, in which individual MAPKs or their
upstream activators are overexpressed specifically in the heart, or knockout models, in
which the expression of individual MAPKs or their upstream activators is lost. Although
71
the results from these studies appear to be more uniform than those in cardiac myocytes,
this approach has still provided some contradicting results on the role of JNKs and p38
MAPKs in the heart. For example, some studies suggest that JNKs and p38 MAPKs are
involved in the hypertrophic response (Pellieux et al., 2000; De Windt et al., 2000; Dash
et al., 2003), whereas others have dismissed the role of these kinases in stimulating
cardiac hypertrophy (Sadoshima et al., 2002; Braz et al., 2003; Petrich et al., 2002). One
explanation for these contradictory results could be that the upregulation of MAPK
activities in these pathways can lead to spurious effects (Liang and Molkentin, 2003).
Alternatively, deletion of the MAPK of interest may alter the activities of other similar
protein kinases to compensate for the loss (Liang and Molkentin, 2003). Furthermore,
the cardiac phenotypes displayed in these studies may (where applicable) be dependent
on the type of stimulus that is used to stress the heart (Izumiya et al., 2003). Therefore,
whilst cardiac myocyte and transgenic mouse models can help to define the roles of
MAPK signalling proteins in the heart, ultimately studies that evaluate the expression and
activation of endogenous MAPK signalling molecules in the heart will be required.
As well as their proposed role in heart disease, MAPKs have been
implicated in mediating signalling events in the developing heart. At least two groups
have detected ERK activity in the embryonic cardiovascular system, as well as in other
regions of the developing embryo (Corson et al., 2003; Lai and Pawson, 2000).
Furthermore, ShcA, which acts as an adaptor protein upstream of the ERK signalling
cascade, is required for the development of the heart and the establishment of mature
blood vessels (Lai and Pawson, 2000). Specifically, ShcA-deficient embryos were found
to have impaired ERK activation and defects in the cardiovascular system, and died by
day 12 of gestation (Lai and Pawson, 2000).
SAPK3 mRNA has been previously detected in the heart (Mertens S et al.,
1996; Lemke et al., 2001), however no studies have examined the expression of SAPK3
protein in cardiac muscle tissue. In Chapter 3 it was shown that SAPK3 is expressed in
primary cultures of neonatal cardiac myocytes. This Chapter therefore addresses the
72
second aim of this project, which is to examine the expression of SAPK3 in different
tissues with specific emphasis on the heart.
4.2 Results
4.2.1 SAPK3 is expressed in the heart
The role of p38 MAPKs in the heart has been suggested in a number of
studies examining the activation of SAPK2a/b (Bogoyevitch et al., 1996; Behr et al.,
2001), the effects of overexpressing SAPK2a/b (Wang et al., 1998a) and the use of the
SAPK2a/b inhibitor SB203580 (Mackay and Mochly-Rosen, 1999; Martin et al., 2001).
Based on earlier studies describing the skeletal muscle-restricted expression of SAPK3,
the role of SAPK3 in the heart has been discounted (Lechner et al., 1996; Li et al., 1996).
However, these previous studies did not examine SAPK3 expression at the protein level,
and it is not clear that the protocols used in these studies were optimised for detection of
lower levels of SAPK3 expression in tissues other than skeletal muscle.
The results presented in Chapter 3 showed that SAPK3 is expressed in
HEK293 fibroblasts, as well as in primary cultures of neonatal rat cardiomyocytes. It
was therefore of interest to evaluate the expression of SAPK3 in the whole heart. Lysates
from adult rat heart were immunoblotted with antibodies for either SAPK2a/b, SAPK3,
or both antibodies together (Fig 4.1A). A protein was detected with the SAPK3 antibody
(Fig 4.1A, lane 2), and its size (~42 kDa) agreed with that expected for SAPK3 (Mertens
et al., 1996). An antibody specific for SAPK2a/b detected a protein at ~41 kDa (Fig
4.1A, lane 1). A protein doublet was detected when immunoblotting with both antibodies
simultaneously (Fig 4.1A, lane 3). This confirmed the expression of SAPK3 in whole
isolated heart tissue and the difference in size of the p38 MAPK isoforms, and further
showed that the SAPK3 antibody did not cross-react with other closely-related p38
MAPKs.
73
α-S
APK
2a/b
46 kDa
SAPK3
α-S
APK
3
α-S
APK
2a/b
+α
-SA
PK3
SAPK2a
A
Bα-rat alkaline phosphatase only
(no SAPK3 antibody)
Figure 4.1: SAPK3 is expressed in the whole heart.(A) Rat hearts lysates were subjected to SDS-PAGE on large-format gels, before immunoblotting using the anti-SAPK3 antibody, anti-SAPK2a/b antibody, or both antibodies. (B) Whole hearts were isolated from adult mice, fixed, paraffin embedded and sectioned, before being subjected to staining with the SAPK3 antibody (left panel) or anti-rat secondary antibody only (right panel).
α-SAPK3left ventricleright ventricle
60X 60X
73a
To determine whether SAPK3 staining could be visualised in the isolated
whole heart, sections of heart ventricles from wild-type FVB mice were stained with the
SAPK3 antibody, followed by detection with an anti-rat antibody linked to alkaline
phosphatase. As seen in Figure 4.1B, SAPK3 staining could be detected throughout the
left and right ventricles of the heart and no staining was detected when the primary
antibody was omitted. This agreed with the results of the Western blot analysis by
showing SAPK3 expression in the heart.
Having found SAPK3 to be expressed in rat and mouse heart, a rat heart
cDNA library was screened with the SAPK3 antibody. All 3 positive clones identified
from 5 x 105 plaques screened were confirmed to be SAPK3 following phage purification
and sequencing. The membranes from a sample screening procedure are shown in
Appendix III together with the corresponding sequencing results that identified the
positive plaques as SAPK3. The sequence was identical to that in the publicly available
databases (accession number NM_021746). This further confirmed the antibody
specificity and cardiac SAPK3 expression.
To address the possible differences that may occur between SAPK3
expression levels in cultured cardiac myocytes versus the whole heart, lysates were
obtained from myocytes at different culturing times. Thus, hearts freshly obtained from
neonatal rats were lysed and the expression of SAPK3 compared to lysates of isolated
myocytes at 16, 24 and 40 hours of culture (Figure 4.2A). In parallel, these lysates were
also immunoblotted with the SAPK2a/b antibody (Figure 4.2B). As shown in Figure
4.2A, SAPK3 expression appeared to decrease with increasing time in culture in cardiac
myocytes following their isolation from the heart, whereas no changes in the level of
SAPK2a expression were observed (Figure 4.2B).
Because the expression of SAPK3 in skeletal muscle has been well-
documented (Mertens S et al., 1996; Lechner C et al., 1996; Li Z et al., 1996), the relative
levels of SAPK3 in heart and skeletal muscle of adult mice were compared. Results
indicated similar levels of SAPK3 expression in fast-twitch (extra digitorium longus,
74
A
Hours of culture: 0 16 24 40
45 kDaα-SAPK3 SAPK3
45 kDaPonceau
BHours of culture: 0 16 24 40
45 kDaα-SAPK2a/b SAPK2a/b
45 kDaPonceau
Figure 4.2: SAPK3 expression decreases in neonatal cardiac myocytes with increased culture time. Hearts were dissected from 1 day-old Sprague-Dawley rats and lysed, or the cardiac myocytes isolated and cultured for periods ranging from 16 to 40 hours before lysis. Lysates were then subjected to Western blotting with the SAPK3 antibody (A, upper panel) or the SAPK2a/b antibody (B, upper panel). Results shown are representative of 2 independent experiments. To show even loading of samples, nitrocellulose membranes were stained with Ponceau Acid Red following transfer of protein to the membranes.
74a
EDL), slow-twitch (soleus, Sol) or mixed-fibre (tibialis anterior, TA and quadriceps,
Quad) skeletal muscle (Fig 4.3A, lanes 1-4). SAPK3 expression was also detected in
heart (Figure 4.3A, lane 5). SAPK3 expression was then compared in heart samples
obtained from human, mouse, rat, dog and pig. For each species, there was
immunoreactivity with a single band migrating between 43 and 46 kDa (Fig 4.3B, upper
panel). Other bands detected in rat and pig samples resulted from cross-reactivity with
secondary antibody (Fig 4.3B, middle panel). Therefore the cardiac expression of
SAPK3 appears to be conserved across this range of mammalian species. When heart
lysates were immunoblotted in parallel with SAPK2a/b antibody, a single band (~41
kDa) was detected for each species (Fig 4.3B, lower panel).
To determine the expression of SAPK3 in different tissues, lysates from
mouse heart, skeletal muscle, brain, liver, lung, thymus, testes, spleen and kidney were
immunoblotted with the SAPK3 antibody. In parallel, these tissues were also
immunoblotted with the SAPK2a/b antibody. SAPK2a/b expression was detected at
similar levels in all tissues examined (Fig 4.4, lower panel). In contrast, SAPK3
expression was extremely low in brain, liver, spleen and kidney (Fig 4.4, upper panel).
Higher expression levels were detected in heart, skeletal muscle, lung, thymus and testes
(Fig 4.4, upper panel). The expression of SAPK3 protein therefore appears to be
relatively restricted.
4.2.2 SAPK3 expression levels do not change in human heart disease
Previous studies have shown that the expression as well as the activation
states of MAPKs can be altered in disease states. For example, reports have suggested
that JNK MAPK expression decreases in cardiac failure (Cook et al., 1999), and that
SAPK3 mRNA decreases in the skeletal muscle of Duchenne Muscular Dystrophy
patients (Chen et al., 2000). To determine whether SAPK3 expression levels change
during heart disease, samples of left ventricular tissue were collected from human
patients from ischemic heart disease (IHD) or dilated cardiomyopathy (DCM) at the time
of transplantation surgery. A group of patients with normal or non-diseased hearts who
75
A Skeletal MuscleQuad Sol EDL TA H
SAPK346 kDa
BH
uman
Mou
se
Dog
Rat
Pig
46 kDa
2° Abcross-reaction
α-SAPK3SAPK3
46 kDa2° Abcross-reactionα-rat-HRP
only
46 kDaSAPK2a
α-SAPK2a/b
Figure 4.3: SAPK3 is expressed in the hearts of various species.(A) Mouse skeletal muscle and heart tissue were crushed under liquid nitrogen. Protein lysates were prepared and then subjected to Western blotting using the anti-SAPK3 antibody.Quad = Quadriceps; Sol = Soleus; EDL = Extra Digitorium Longus; TA = Tibialis Anterior.(B) Hearts from different animal species were crushed under liquid nitrogen. Protein lysates were prepared and then subjected to Western blotting using the anti-SAPK3 antibody (upper panel). Non-specific bands due to secondary antibody cross-reactivity are indicated (middle panel). Tissue lysates were also subjected to immunoblotting with anti-SAPK2a/b antibody (lower panel).
75a
H Skm B Li Lu Th Te S K
SAPK2a/b
SAPK346 kDa
46 kDa
Figure 4.4: SAPK3 shows a relatively restricted tissue distribution in the mouse.Mouse tissues were crushed under liquid nitrogen. Protein lysates were prepared and then subjected to Western blotting using the anti-SAPK3 antibody (upper panel) or anti-SAPK2a/b antibody (lower panel). Abbreviations: H = Heart; Skm = Skeletal Muscle; B = Brain; Li = Liver; Lu = Lung; Th = Thymus; Te = Testes; S = Spleen; K = Kidney.
75b
were found to be unsuitable for donor hearts due to other complications (for example,
renal tumours) were used as a control group. A total of 25 human samples were
examined for expression levels of SAPK3, SAPK2a/b and phosphorylated forms of p38
MAPK family members (Figure 4.5).
No consistent differences in SAPK3 expression were detected when
comparing failing and non-failing samples of human hearts (Figure 4.5). This was
further confirmed by subjecting selected donor, IHD and DCM samples to SDS-PAGE
and Western blotting on the same gels (results not shown). Furthermore, no change was
observed in the expression of SAPK2a/b in human hearts, which is consistent with
previous results (Fig 4.5) (Cook et al., 1999). However, when immunoblotted with a
phospho-p38 MAPK antibody, which detects the phosphorylated form of all p38
isoforms, only a single band was detected and this was consistent with the size of
SAPK2a, not SAPK3. When comparing the intensity of these bands between samples,
phospho-SAPK2a levels appeared to be increased in IHD and DCM samples (Figure 4.5).
A full statistical analysis of these samples with internal controls for each individual gel
found that although SAPK2a phosphorylation was increased in IHD and DCM, only the
increase in SAPK2a phosphorylation in IHD was significant compared to donor hearts
(Ng et al., 2003). The significant increase in SAPK2a phosphorylation in ischemic heart
disease agrees with previous results (Cook et al., 1999). No phospho-SAPK3 bands
appeared to be visualised when using the phospho-p38 MAPK antibody (Figure 4.5).
This may reflect the lower levels of SAPK3 activation or that changes are below the level
of detection with this technique.
4.2.3 SAPK3 is expressed throughout embryonic and postnatal development of
the heart
MAPK levels have previously been shown to change during heart postnatal
development (Kim et al., 1998). To determine whether any changes in cardiac expression
of SAPK3 occur in postnatal development, ventricular heart samples from neonatal and
76
A: Donorα-SAPK3
45 kDa SAPK3
45 kDaSAPK2a
α-SAPK2a
45 kDa
45 kDa
45 kDa
66 kDaα-Phospho-p38 MAPK
P-SAPK2a
B: Ischemic Heart Disease
66 kDa
45 kDa
α-SAPK3
α-SAPK2a
α-Phospho-p38 MAPK
SAPK3
SAPK2a
P-SAPK2a45 kDa
C: Dilated Cardiomyopathy
45 kDa
α-SAPK3
α-SAPK2a
α-Phospho-p38 MAPK66 kDa
45 kDa
SAPK3
SAPK2a
P-SAPK2a
Figure 4.5: SAPK3 expression levels do not change in failing human hearts.Human heart samples (donor, A; ischemic heart disease, B; or dilated cardiomyopathy, C) were crushed under liquid nitrogen. Protein lysates were prepared and then subjected to Western blotting using the anti-SAPK3 antibody (upper panels), anti-SAPK2a/b antibody (middle panels) or anti-phospho p38 MAPK antibody (lower panels). Open-ended arrows indicate non-specific bands.
76a
adult rats were examined. However, no difference was seen in SAPK3 expression levels
when comparing these neonatal and adult hearts by Western blotting analysis (Fig 4.6A).
It was therefore assessed whether any changes may occur in SAPK3 protein
expression during embryonic development of the heart. Hearts were collected from
mouse embryos, ranging in age from embryonic day (E) 12.5 until birth. To initially
determine whether SAPK3 mRNA could be detected, embryonic hearts were
homogenised and total RNA was isolated. This RNA was then subjected to reverse-
transcription PCR (RT-PCR) with SAPK3 specific primers, to amplify SAPK3 mRNA.
As seen in Figure 4.6B, SAPK3 mRNA could be detected from as early as E12.5, and
continued to be detected throughout embryogenesis and in the newborn and adult heart.
To determine whether the SAPK3 protein levels in the heart may change throughout
embryonic development, hearts were homogenised and total protein isolated. These
protein lysates were then subjected to Western blotting with the SAPK3 antibody. As
shown in Fig 4.6C, SAPK3 protein could be detected throughout embryonic development
of the heart, with no changes seen in the expression levels throughout embryonic
development or compared to the adult heart. Western blots using the phospho-p38
MAPK antibody did not detect any phosphorylated SAPK2a or SAPK3 in these samples
(results not shown).
By Western blot analysis, it was shown that SAPK3 was expressed from at
least E12.5 in the heart. To further investigate the expression of SAPK3 during
development of other tissues, staining of embryos for SAPK3 expression was carried out.
Two different methods were used for staining embryos. The first method was paraffin
embedding, sectioning and staining of embryos. This method was required for embryos
at stage E12.5 or later due to the thicker outside layers of the embryo which are not able
to be penetrated by reagents. Therefore, E16.5, E13.5 and E12.5 embryos were stained
using this procedure. Staining of later-staged embryos was performed to determine the
spatial pattern of SAPK3 expression throughout the whole embryo during development.
77
A
46 kDa
neon
atal
adul
t
SAPK3α-SAPK3
B
Age: E12.5 E13.5 E14.5 E15.5 E16.5 E17.5 E18.5 New Ad Skm Neg
500bp400bp300bp
SAPK3
C
Embryonic Day: 12.5 13.5 14.5 15.5 16.5 17.5 18.5 New Ad
45 kDa SAPK3α-SAPK3
45 kDa
220 kDa
66 kDa
97 kDaCoomassie
Figure 4.6: SAPK3 is constantly expressed during cardiovascular development.(A) Whole hearts were isolated from neonatal and adult rats and crushed under liquid nitrogen. Protein lysates were prepared and then subjected to Western blotting using the anti-SAPK3 antibody.(B) Hearts were isolated from embryonic (E12.5 – E18.5), newborn (New) and adult (Ad) mice, and total RNA extracted. SAPK3-specific primers were then used to amplify a 414bp fragment by RT-PCR. RNA isolated from skeletal muscle (skm) was used as a positive control, and an identical reaction with template omitted was used as a negative control (Neg).(C) Hearts were isolated from embryonic (E12.5 – E18.5), newborn and adult mice,and crushed under liquid nitrogen. Protein lysates were prepared and then subjected to Western blotting using the anti-SAPK3 antibody (upper panel). Coomassie Blue staining confirmed comparable levels of protein loaded in all lanes (lower panel).
77a
Figure 4.7 shows the staining of E16.5, E13.5 and E12.5 mice with
haematoxylin and eosin to illustrate the anatomical organisation of the embryos. Figures
4.8 and 4.9 show the results of staining E16.5, E13.5 and E12.5 mice with the SAPK3
antibody. Western blotting analysis had already shown that SAPK3 was expressed in the
hearts of embryos at these stages (Figure 4.6C). In the E16.5 mouse, SAPK3 levels were
highest in the heart, diaphragm, bladder and patches of skeletal muscle including in the
limbs. Lower levels of staining could be detected in the lung, and very light staining
could also be detected in the brain and liver (Figure 4.8A). A closer examination of the
heart in these embryos showed staining throughout the ventricular and atrial walls, as
well as in the trabeculae (Figure 4.8B). No staining was detected in the control embryo,
where the primary SAPK3 antibody was omitted (Figure 4.8A, left panel). In the E13.5
mouse, staining was highest in the heart, brain, spinal cord, tongue, intestine and lung
(Figure 4.9A). In the E12.5 mouse, SAPK3 staining appeared to be particularly high in
the heart, lung, tongue, brain and spinal cord (Figure 4.9B). No staining was detected in
control embryos, where the primary SAPK3 antibody was omitted (Figure 4.9, left
panels).
Western blot analysis indicated that expression of SAPK3 in the heart was
constant from at least E12.5 (Figure 4.6C). Earlier embryos were too small to
specifically isolate their hearts for Western blot analysis. Therefore, E8.5 and E10.5
embryos were chosen for staining analysis to determine the time point at which SAPK3
expression was switched on. Wholemount staining could be used for these embryos
without sectioning. This staining showed SAPK3 to be expressed at its highest levels in
the telencephalon (forebrain) and along the dorsal edge of the E8.5 mouse, where the
somites are located (Fig 4.10A). Only very faint staining for SAPK3 was seen under
these conditions in the developing heart. However, SAPK3 expression could be detected
throughout the embryo if the staining protocol was lengthened (Fig 4.10A). Even with
this increased detection time, no staining was visualised in the control embryo, in which
the primary antibody had been omitted from the staining procedure (Fig 4.10A). This
suggested that SAPK3 was expressed in most regions of the embryo at this early stage,
albeit at lower levels. In the E10.5 mouse, SAPK3 staining was specifically detected in
78
A
diaphragm
E16.5
30X
heart
lung
liverbladder
vertebraeribs
forelimb
E13.5
40X
telocoelmyelencephalon
tongue
heart
lungliververtebrae
mesencephalon
myelencephalon
tongue
heart
lung
liver
spinal cord
tail
E12.5
55X
B
C
Figure 4.7: Haematoxylin and eosin staining of E16.5, E13.5 and E12.5 mice.Embryos were dissected from FVB wild-type mice at E16.5 (A), E13.5 (B) and E12.5 (C). Following fixation in paraformaldehyde overnight, embryos were embedded in paraffin wax and sectioned. Paraffin sections were then stained with haematoxylin and eosin to show the general histological features of the embryos.
78a
α-rat-alkaline phosphatase only (no SAPK3 antibody) α-SAPK3
30X
E16.5
heartlung
bladder
diaphragmvertebrae
muscle
30X
E16.5A
forelimb
hindlimb
B
120X
trabeculae
ventricular wall
atrial wall
Figure 4.8: SAPK3 is expressed in various tissues of the E16.5 mouse.(A) Embryos were dissected from FVB wild-type mice at E16.5. Following fixation in paraformaldehyde overnight, embryos were embedded in paraffin wax and sectioned. Paraffin sections were then stained with the SAPK3 antibody, followed by an anti-rat secondary antibody linked to alkaline phosphatase. Signal detection with alkaline phosphatase substrates was for 60 min to show patterns of SAPK3 expression.(B) Further examination of the hearts of these embryos showed specific staining for SAPK3 in the ventricular and atrial walls, and in the trabeculae of the heart.
78b
α-rat-alkaline phosphatase only (no SAPK3 antibody) α-SAPK3
A
40X
E13.5mesencephalonmyelencephalon
heart
tongue
lung
spinal cord
nasal chamber
intestine
40X
E13.5
E12.5
45X
B E12.5
45X
heart
tongue
mesencephalon
myelencephalon
spinal cord
lung
Figure 4.9: SAPK3 is expressed in various tissues of E13.5 and E12.5 mice.Embryos were dissected from FVB wild-type mice at E13.5 (A) and E12.5 (B). Following fixation in paraformaldehyde overnight, embryos were embedded in paraffin wax and sectioned. Paraffin sections were then stained with the SAPK3 antibody, followed by an anti-rat secondary antibody linked to alkaline phosphatase. Signal detection with alkaline phosphatase substrates was for 60 min to show patterns of SAPK3 expression.
78c
A
E 8.5 E 8.5
157x157x
hearttelencephalon
tailsomites
E 8.5
157x
ControlSignal detection: 45 min
Anti-SAPK3Signal detection: 15 min
Anti-SAPK3Signal detection: 45 min
B
heart
mesencephalon
telencephalon
hindlimb bud
E 10.5 E 10.5Non-specific stainingtail
70x 70x
forelimb bud
somitesAnti-SAPK3
Signal Detection: 15 minControl
Signal detection: 15 min
E 10.5
76x
E 10.5
76x
ControlSignal detection: 45 min
Anti-SAPK3Signal detection: 45 min
Figure 4.10: SAPK3 expression in E8.5 and E10.5 embryos using wholemount staining.Whole embryos were dissected from FVB wild-type mice at 8.5 (A) and 10.5 (B) days gestation. Following fixation in Dent’s fixative overnight, embryos were processed for staining with the SAPK3 antibody, and an anti-rat secondary antibody linked to alkaline phosphatase was used to detect staining. Signal detection with alkaline phosphatase substrates was for 15 min or 45 min to show areas of highest and lower SAPK3 expression, respectively.
78d
the heart, limb buds, telencephalon, somites and tail tip (Fig 4.10B). When colour
detection was allowed to continue for 45 min, the embryo changed to an intense
blue/purple colour when compared to the control embryo where the primary SAPK3
antibody had been omitted (Fig 4.10C). This suggested that SAPK3 is also expressed in
other tissues at lower levels in the E10.5 mouse.
4.3 Discussion
Several reports have suggested that MAPKs play important roles in the
development and disease of the heart (Lai and Pawson, 2000; Corson et al., 2003; Cook
et al., 1999). Due to the detection of SAPK3 in primary cultures of neonatal cardiac
myocytes (Chapter 3), it was of interest to determine the expression of SAPK3 in the
intact heart. The discovery of lower SAPK3 expression levels with increased culture
time of cardiac myocytes (Figure 4.2) highlighted the importance of performing these
studies in the whole heart as well as in isolated primary cardiac myocyte cultures. This
illustration of SAPK3 cardiac expression has important consequences when evaluating
studies that implicate the actions of SAPK2a in the heart. For example, the effects of the
p38 MAPK family upstream activators MKK3 and MKK6 in the heart cannot be solely
attributed to the downstream activation of SAPK2a (Liao et al., 2001) because it is now
possible that SAPK3 actions may also contribute to the final outcome.
It was shown in this Chapter that SAPK3 expression in the heart was
relatively high when compared with other tissues, and this cardiac expression was
conserved throughout a variety of mammalian species (Figure 4.3B). This, along with
the detection of SAPK3 in Xenopus and Zebrafish (Perdiguero et al., 2003; Fabre S et al.,
2000), suggests the evolutionary conservation and thus an important function of SAPK3
across this diversity of species. Indeed, it seems unlikely that the functions of SAPK3 are
redundant with those of SAPK2a due to its unique tissue distribution (Figure 4.4) and its
unique subcellular localisation (Figure 3.3). It is unknown why SAPK3 shows this
unique tissue distribution. Due to the localisation of SAPK3 at the mitochondria in
cardiac myocytes (Chapter 3), it was hypothesised that the tissues showing the highest
79
levels of SAPK3 expression may also contain higher numbers of mitochondria and thus
higher levels of mitochondrial proteins. However, parallel Western blotting with
antibodies against the mitochondrial proteins HSP60 and HSP70 did not show similar
patterns of tissue distribution to SAPK3 (results not shown). Clearly this correlative link
will require further evaluation. Avenues for further investigation include an assessment
of the promoter regions controlling SAPK3 expression.
Staining of transverse sections of adult mouse heart used alkaline
phosphatase-labelled secondary antibodies to detect the distribution of SAPK3 in the
heart (Figure 4.1B). The fluorescently-labelled secondary antibodies that were used in
Chapter 3 could not be used in these studies due to high cross-reactivity with
immunoglobulins in mouse tissue sections (results not shown). The co-localisation of
SAPK3 with the mitochondria could therefore not be confirmed in the whole heart
sections, since the SAPK3 staining in this case required viewing with a conventional light
microscope, which does not show the same level of resolution as the confocal microscope
(White et al., 1987). Although protein localisation in isolated cardiac myocytes can be
the same in the whole heart, as is the case for A-kinase anchoring protein 100
(AKAP100) (Yang et al., 1998a), further work will be required to confirm this for
SAPK3. In some cases proteins in isolated cardiac myocytes are not necessarily the same
in the whole heart. For example, while MKK6 and SAPK2a are diffusely localised
through the cytoplasm in cultured cardiac myocytes, they co-localise with t-tubular/z-disc
structures in the adult heart (Liang and Molkentin, 2003; Lemke et al., 2001).
This Chapter examined the expression and activation state of SAPK3 in the
failing heart to determine its possible role in this process. Whilst alterations were seen in
the phosphorylation state of SAPK2a in failing hearts, the analysis of human heart
samples did not show any changes in SAPK3 expression or phosphorylation state (Figure
4.5). However, as discussed in Chapter 3, this could be explained by the lower sensitivity
of the antibody for phosphorylated SAPK3. Alternatively, the lower expression of
SAPK3 in the heart compared to SAPK2a (Lemke et al., 2001) could limit detection.
The development of specific antibodies for phosphorylated SAPK3 should therefore
80
assist in the detection of activated SAPK3 in the heart. Furthermore, antibodies suitable
for immunoprecipitation of SAPK3 would facilitate studies to directly assess its activity
by in vitro kinase assays.
An analysis of SAPK3 expression in developing heart samples suggested
that SAPK3 protein expression remained unaltered from at least E12.5 into adulthood
(Figure 4.6). Staining of embryos at E12.5, E13.5 and E16.5 also showed that compared
to other tissues, SAPK3 expression was relatively high in the heart (Figures 4.8 and 4.9).
Similar to the later staged embryos, relatively high cardiac expression of SAPK3 was
detected at E10.5. However, when analysing the E8.5 mouse, SAPK3 appeared to be
expressed at its highest levels in the developing brain (the telencephalon) rather than the
heart (Figure 4.10). The lower expression of SAPK3 in the heart at this stage may be a
reflection of the earlier developmental stage of this tissue. For example, at E8.5, the
heart is at its initial stages of development, undergoing looping from a simple linear tube
and beginning to contract, whereas at E10.5, paired heart chambers have been formed and
the interventricular septum is being formed (Fishman and Chien, 1997; Rugh, 1968).
Quantitative analyses will be required to determine the levels of SAPK3 expression at the
early stages of heart development and whether SAPK3 is expressed in the heart region as
early as E7.0, when there is assembly of the myocardial plate (Fishman and Chien, 1997).
It is interesting to note that the general pattern of SAPK3 expression
changed in several tissues. For example, in the brain, high expression levels of SAPK3
were detected at E8.5 – E13.5, but only low levels of staining were detected in the brain
at E16.5. The pattern of staining seen in the E16.5 mouse (Figure 4.8) was similar to that
seen in the adult mouse, with higher levels of staining seen in skeletal muscle, heart and
lung, and lower levels in the liver and brain (Figure 4.4). This suggests that SAPK3
expression levels are altered in embryonic development of tissues such as the brain
before remaining constantly low in postnatal development. Quantitative analyses using
brain samples from mice at different stages of postnatal development would be required
to confirm these findings.
81
Further work will be required to determine the role of SAPK3 in the heart
and other tissues during development. It may be possible that SAPK3 plays a role in the
differentiation of heart progenitor cells to become terminally differentiated cardiac
myocytes. For example, the overexpression of SAPK3 has previously been shown to
drive differentiation of C2C12 myoblasts into myotubes (Lechner et al., 1996), and
although there are striking differences in the development of cardiac muscle cells and
skeletal muscle cells it remains possible that SAPK3 could play a similar role in the
heart. SAPK3 has also previously been shown to phosphorylate the Myocyte Enhancing
Factor (MEF) family of transcription factors in vitro (Marinissen et al., 1999). These
transcription factors have been shown to play critical roles in the development of the
heart, particularly in late-stage differentiation of this tissue (Lilly et al., 1995; Ross et al.,
1996; Goswami et al., 1994; Bour et al., 1995). Although SAPK3 has not been shown to
translocate to the nucleus in cardiac myocytes (Chapter 3), MEFs have been shown to
shuttle between the cytoplasm and the nucleus (De Angelis et al., 1998). Alternatively, a
specific stimulus may cause SAPK3 to translocate into the nuclear compartment. The use
of conditional knockouts of SAPK3 in the heart may help to resolve some of these issues.
A major challenge remains in the identification of the extracellular stimuli
that lead to the activation of SAPK3 as well as its downstream substrates. To address
these challenges requires further analysis of SAPK3 in a cellular and tissue context
together with screening strategies to identify SAPK3 substrates and interacting partners.
In the next chapter, the ability of SAPK3 to phosphorylate mitochondrial target proteins
is further explored.
82
Chapter 5
Investigation of the substrate specificity of SAPK3
5.1 Introduction
The activation of MAPKs following the exposure of cells to specific
extracellular stimuli leads to the phosphorylation of specific intracellular substrates.
This addition of phosphate groups to specific serine and/or threonine residues within
these substrate proteins can alter their conformation, and thus their activity or function.
These changes contribute to the cellular response and it therefore follows that
identifying the substrates of each MAPK can provide clues on the possible roles that a
MAPK plays within the cell (Cohen, 1997; Berwick and Tavare, 2004).
A variety of protein domains, such as the Src-homology domains 2 or 3
(SH3 or SH2 domains), Pleckstrin Homology domains (PH domains), Phosphotyrosine
Binding domains (PTB domains) and PSD-95/Discs-large/ZO-I domains (PDZ
domains), are important for the specificity of interactions between the proteins involved
in intracellular signaling pathways (Pawson and Nash, 2003). Furthermore, conserved
regions of several MAPK phosphatases, MAPKKs, scaffolds and substrates have been
identified and called “docking domains” or “Kinase Interaction Motifs” (KIMs). These
domains or motifs mediate interactions with specific MAPKs (Tanoue et al., 2000;
Sharrocks et al., 2000; Wiltshire et al., 2002). In the case of MAPK substrates, the
interaction via these docking domains or KIMs appears critical for their phosphorylation
(Yang et al., 1999; Livingstone et al., 1995; Yang et al., 1998b; Wiltshire et al., 2002).
Another determinant of substrate phosphorylation is the sequence
immediately surrounding the Ser/Thr to be phosphorylated. The consensus amino acid
sequence for substrate phosphorylation by the archetypical MAPK, Extracellular Signal-
Regulated Kinase (ERK), has been defined by the four amino acid linear sequence
(Pro/X)-X-(Ser/Thr)-Pro, where X is any amino acid and the amino acid phosphorylated
is indicated in italics (Clark-Lewis et al., 1991). As discussed in Chapter 1, the
phosphorylated tyrosine residue in the activation loop of MAPKs is thought to be
responsible for MAPK specific substrate recognition of serine or threonine residues that
are directly followed by a proline residue (Canagarajah et al., 1997; Alvarez et al., 1991;
83
Clark-Lewis et al., 1991). More recent work has evaluated how amino acids within the
active sites of serine/threonine kinases make contact with the substrate phosphorylation
site. This has allowed the definition of consensus sequences that are more specific for
each protein kinase (Brinkworth et al., 2003).
Although MAPKs were initially shown to mediate nuclear, transcriptional
events through the phosphorylation of their specific transcription factor substrates
(Boulton et al., 1991), increasingly MAPK substrates have been found in other cellular
compartments such as the cytoskeleton (Goedert et al., 1997b; Neidhart et al., 2001;
Lefebvre et al., 2002; Huang et al., 2003; Terret et al., 2003), the plasma membrane
(Hasegawa et al., 1999; Wu et al., 2003) or the mitochondria (Donovan et al., 2002;
Schroeter et al., 2003; Wiltshire et al., 2002). As discussed in Chapter 1, little is known
about the substrate specificity of SAPK3 within the cell or in vitro. Studies using
overexpressed SAPK3 have shown that this kinase is stress-activated and that it can
phosphorylate proteins such as Activating Transcription Factor 2 (ATF2) and Myelin
Basic Protein in vitro (Cuenda et al., 1997). Data presented in Chapter 4 showed the
expression of SAPK3 in a variety of tissues, with highest levels of expression in skeletal
muscle, heart, lung, thymus and testes. This suggested a role for SAPK3 in a number of
tissues. Possible substrates for SAPK3 include the dystrophin complex protein α1-
Syntrophin (Hasegawa et al., 1999) which was isolated in a two-hybrid screen for
SAPK3-interacting proteins, and the microtubule-associated protein Tau (Goedert et al.,
1997b) identified as a potential substrate using in vitro kinase assays. However, given
the larger number of substrates determined for other MAPKs, it remains likely that there
are many substrates of SAPK3 that are not yet defined.
In Chapter 3, SAPK3 was shown to colocalise with mitochondrial markers.
The exposure of cells to hyperosmolarity, a stress previously shown to activate SAPK3
when overexpressed in cells (Cuenda et al., 1997), did not alter this localisation (results
not shown). It therefore seems likely that substrates for SAPK3 will be identified at the
mitochondria. Proteins involved in the regulation of cell death, such as Bcl-2, Bim, and
Bad, can be found at the mitochondria, where they have been implicated in a number of
84
signalling pathways (Danial et al., 2003; Klumpp and Krieglstein, 2002). Furthermore,
several of these proteins are phosphorylated by members of the MAPK family, including
SAPKs such as JNK (Deng et al., 2001; Ley et al., 2003; Donovan et al., 2002). This
phosphorylation has been found to alter cell survival. For example, the phosphorylation
of Bad on Ser 112 and Ser 136 by survival-promoting kinases sequesters Bad in the
cytosol by its complex formation with 14-3-3 proteins, thus preventing Bad from
antagonising the activity of the anti-apoptotic Bcl-XL (Zha et al., 1996). However,
phosphorylation of Bad on Ser 128 by JNK (Donovan et al., 2002) or Cdc2 (Konishi et
al., 2002) inhibits the ability of 14-3-3 proteins to sequester Bad, and stimulates the pro-
apoptotic activity of Bad (Konishi et al., 2002). Thus, the phosphorylation of pro- and
anti-apoptotic proteins is a complex mechanism of regulating cell survival. It is
therefore likely that a number of different protein kinases are responsible for this
regulation.
It has been recently shown that JNK phosphorylates the protein Sab
(Wiltshire et al., 2002). This protein was previously identified as a binding partner and
negative regulator of Bruton’s Tyrosine Kinase (Btk) (Matsushita et al., 1998; Yamadori
et al., 1999). Active JNK and Sab were shown to co-localise at the mitochondria
(Wiltshire et al., 2002). Due to the localisation of SAPK3 at the mitochondria (Chapter
3) it was of interest to determine whether Sab could act as a substrate of SAPK3. The
aim of this Chapter was therefore to determine whether SAPK3 could phosphorylate
mitochondrial protein substrates such as Sab or Bcl-2 family members including Bcl-2
and Bad. This first involved optimising a protocol for activating recombinant SAPK3 in
vitro using a constitutively-active MKK6 mutant. A constitutively active mutant of
MKK6 has been previously reported, where the amino acids Ser207 and Thr211 within the
activation loop of this protein kinase have been mutated to Asp (D), to mimic
phosphorylation of these residues (Alonso et al., 2000). This constititutively active
MKK6 mutant, MKK6(DD), can be used in the activation of SAPK3 in vitro (Alonso et
al., 2000). Following activation of GST-SAPK3, protein kinase assays were performed
to determine its substrate preferences.
85
5.2 Results
5.2.1 The activation of SAPK3 in vitro
To identify SAPK3 substrates, activated SAPK3 was required for in vitro
kinase assays. As discussed in Chapter 1, the mutation of threonine and tyrosine
residues in the activation loop of MAPKs to glutamate does not confer activity as it does
for other kinases such as the MKKs (Mansour et al., 1994). A constitutively-active
mutant of the SAPK3 upstream activator, MKK6 (MKK6-DD) was therefore obtained.
Full-length MKK6(DD) had previously been cloned into the pMalc2 vector, creating a
fusion with the MalE gene. This allowed the expression in E. coli of protein of MKK6
and the Maltose Binding Protein (Alonso et al., 2000).
To confirm that MalE-MKK6(DD) was capable of phosphorylating GST-
SAPK3, kinase assays were performed with differing amounts of MalE-MKK6(DD) and
GST-SAPK3 in the presence of [γ-32P]-labelled ATP (Figure 5.1A). In this initial
experiment, it was determined that 10 µg of MalE-MKK6(DD) and 5 µg of GST-
SAPK3 was sufficient for MalE-MKK6(DD) phosphorylation of SAPK3, as determined
by the incorporation of 32P into SAPK3. To determine whether the phosphorylation of
GST-SAPK3 by MalE-MKK6(DD) increased with respect to time, 5 µg of GST-SAPK3
was incubated with [γ-32P]-labelled ATP alone, or with 10 µg MalE-MKK6(DD) and [γ-32P]-labelled ATP, for times ranging from 30 min to 8 hours. The reactions were then
stopped and reaction components separated by SDS-PAGE, as described in Chapter 2.
As shown in Figure 5.1B, the incorporation of 32P into the GST-SAPK3 protein
increased as GST-SAPK3 was incubated with MalE-MKK6(DD) for longer periods of
time. This phosphorylation was not due to autophosphorylation, since only very low
levels of phosphorylation were detected when GST-SAPK3 was incubated with [γ-32P]-
labelled ATP alone.
A protocol was required to test whether the phosphorylation of SAPK3
resulted in its activation. Thus, GST-SAPK3 that had previously been incubated with
86
A
MalE-MKK6(DD) (µg):GST-SAPK3 (µg):
0 0.5 1 2 10 10 10 0 0.5 0.5 0.5 0.5 0.5 0 5 5
45 kDa
66 kDa
97 kDaGST-SAPK3MalE-MKK6(DD)
Autoradiograph
GST-SAPK3MalE-MKK6(DD)
45 kDa
66 kDa
97 kDa
Coomassie
B
GST-SAPK3
GST-SAPK3MalE-MKK6(DD)
30 min 1 hour 4 hours 8 hours
Autoradiograph
Coomassie
66 kDa97 kDa
66 kDa97 kDa
MalE-MKK6(DD): - + - + - + - +GST-SAPK3: + + + + + + + +
Figure 5.1: Optimising a protocol for GST-SAPK3 activation.(A) GST-SAPK3 (0.5 µg or 5 µg as indicated) was incubated with different amounts (0.5, 1, 2 or 10 µg) of a constitutively active MKK6 mutant (MalE-MKK6DD) and 2µCi of [γ-32P]-ATP, or radiolabelled ATP only, at 30°C for 30 min. The reactions were then stopped with SDS sample buffer and proteins separated by SDS-PAGE. An autoradiograph of the gel is shown after 1 hour exposure time. The lower panel shows the Coomassie stained gel to illustrate even protein loading. (B) GST-SAPK3 (5 µg) was incubated with MalE-MKK6(DD) (10 µg) and 2µCi of [γ-32P]-ATP, or radiolabelled ATP only, at 30°C for 30 min to 8 hours. The reactions were then stopped with SDS sample buffer and proteins separated by SDS-PAGE. An autoradiograph of the gel is shown after 1 hour exposure time. The lower panel shows the Coomassie stained gel to illustrate even protein loading.
86a
MalE-MKK6(DD) or incubated alone, was immobilised on GSH-sepharose, washed
with Activation Buffer, and subjected to kinase assays with a known in vitro substrate
GST-ATF2 (Cuenda et al., 1997) and [γ-32P]-labelled ATP. As seen in Figure 5.2, when
GST-SAPK3 was incubated with MalE-MKK6(DD), this increased SAPK3 activity by
approximately 40-fold towards GST-ATF2, when compared to control reactions in
which SAPK3 was incubated in the absence of MKK6(DD).
5.2.2 Investigating the phosphorylation of mitochondrial proteins by SAPK3
To implicate SAPK3 in a role at the mitochondria, it was of interest to
determine whether SAPK3 could phosphorylate mitochondrial proteins. Members of the
MAPK family such as ERK and JNK have previously been found to phosphorylate
mitochondrial proteins involved in apoptosis (Ishikawa et al., 2003; Donovan et al.,
2002; Ley et al., 2003; Deng et al., 2001). Thus, mammalian expression constructs
encoding the anti-apoptotic proteins Bcl-2 and Bag-1, and the pro-apoptotic proteins
BimEL, Bad, Blk and Bid, were obtained. Bacterial expression constructs were not
chosen for these experiments due to the complications such as instability, insolubility,
and low protein yields when expressing these proteins in bacteria (D. Huang, personal
communication). Each mammalian expression construct allowed expression of the
protein of interest with the N-terminal fusion to either a Flag or HA epitope tag.
Specifically, the constructs encoding Bcl-2 and Bag-1 contained a Flag tag, whilst the
BimEL, Bad, Blk and Bid constructs contained a HA tag. In addition, a mammalian
expression construct encoding the caspase inhibitor p35 was obtained. This was co-
transfected into cells with the pro-apoptotic protein constructs, to prevent these cells
from undergoing apoptosis. As a control, anti-apoptotic proteins were co-transfected
with empty Bluescript vector DNA.
To confirm expression of these mitochondrial proteins following
transfection, lysates were made from the transfected cells and subjected to Western
blotting with HA or Flag antibodies. As seen in Figure 5.3, all proteins appeared to be
87
MalE-MKK6(DD) - + GST-SAPK3 + + GST-ATF2 + +
45 kDa
30 kDaGST-ATF2
GST-ATF2
45 kDa
30 kDa
66 kDa
66 kDa
GST-SAPK3
GST-SAPK3
Autoradiograph
Coomassie
MalE-MKK6(DD) - + GST-SAPK3 + + GST-ATF2 + +
05
1015202530354045
Fold
Act
ivat
ion
(Pho
spho
ryla
tion
of G
ST-A
TF2)
Figure 5.2: GST-SAPK3 pre-incubated with MalE-MKK6(DD) shows increased activity towards GST-ATF2.GST-SAPK3 (5 µg) was either incubated with MalE-MKK6(DD) (10 µg) and ATP, or ATP only, overnight at 30°C. GST-SAPK3 was separated from the other reaction components by incubation with GSH-sepharose, then incubated with GST-ATF2(19-96) and 2µCi of [γ-32P]-ATP at 30°C for 35 min. The reaction was stopped with the addition of SDS-PAGE sample buffer, and proteins separated by SDS-PAGE. An autoradiograph of the gel is shown after 7 hours exposure time. The middle panel shows the Coomassie stained gel to illustrate even protein loading, and the lower panel shows the quantitation of 3 independent assays as determined by Cerenkov counting of the GST-ATF2 bands. Results are expressed as fold activation of SAPK3 relative to assays conducted in the absence of MalE-MKK6(DD). The results are shown as means ± standard error (SE).
87a
A
Bcl-2 Bag-1 -Transfection:
30 kDa
20.1 kDa
45 kDa
14.3 kDa
Bcl-2Bag-1
****
α-Flag
*
B
Transfection: BimEL Bad Blk Bid -
30 kDa
20.1 kDa
45 kDa
14.3 kDa
Bid
Blk
BimEL/Bad
**α-HA
Figure 5.3: Expression of overexpressed mitochondrial proteins in HEK293 fibroblasts.HEK293 fibroblasts were transfected with 0.6 µg of the expression constructs Flag-Bcl-2 or Flag-Bag-1 (both in conjunction with 0.6 µg empty Bluescript vector) or 0.6 µg HA-Bim, HA-Bad, HA-Blk or HA-Bid (all in conjunction with 0.6 µg of the caspase inhibitor p35), or the controls (1.2 µg Bluescript only or p35 only; denoted “-”) and left for 40 hours to express the proteins. The cells were then lysed, sample buffer added, and Western blotting performed using Flag (A) or HA (B) antibodies. Arrows indicate the detected proteins. Asterisks indicate cross-reacting bands (identity unknown).
87b
expressed following transfection, since immunoreactive bands of approximately the
expected molecular weight were apparent when HEK293 fibroblasts were transfected
with the mitochondrial proteins but not when they were transfected with Bluescript or
p35 alone. Using protein insert sequence information, the molecular weights of the
mitochondrial protein products were calculated to be: Bcl-2, 21.9 kDa; Bag-1, 21.9 kDa;
BimEL, 19.2 kDa; Bad, 16.5 kDa; Blk, 15.5 kDa; Bid, 22 kDa. Comparing these
calculated molecular weights to the main band seen in each case on the Western blots,
most of the proteins appeared to migrate at approximately 5-10 kDa above the expected
size, with the exception of Blk and BimEL which appeared to migrate only slightly (1-2
kDa) above the expected size. When immunoblotting for Bcl-2 and Bag-1 several other
bands besides those representing Bcl-2 and Bag-1 were also present (Figure 5.3A, lanes
1 and 2). However, these were most likely due to the Flag antibody cross-reacting non-
specifically with other proteins in the lysates, since they were also present when
HEK293 fibroblasts were transfected with Bluescript alone (Figure 5.3A, lane 3).
Although Western blots with the HA antibody appeared to be cleaner (Figure 5.3B), an
extra band was detected in the case of Bad. This extra band, since it is only slightly
larger than the calculated molecular weight of Bad, and it did not appear in the p35-only
transfection, is most likely to be due to post-translational modifications of Bad. In
addition, an extra band was detected in the case of Blk transfection. Since this band
migrated at approximately double the calculated molecular weight of Blk, this was
unlikely to be due to post-translational modifications of Blk and the identity of this band
is unknown.
To confirm that the expressed proteins could be immunoprecipitated from
the cells, immunoprecipitations were performed from the HEK293 cell lysates using HA
or Flag antibodies. Western blotting was then performed on the pellets and supernatants
of these immunoprecipitations, as described in Chapter 2. As shown in Figure 5.4 by
asterisks, proteins were detected by Western blotting in the pellet fractions of the
immunoprecipitations for Bcl-2, Bag-1, BimEL and Blk. In addition Bag-1 and Bim
were also detected in the supernatant fractions of the immunoprecipitations, suggesting
that the immunoprecipitation was not 100% efficient in these cases. Protein bands for
88
AImmunoprecipitate Flag; Western Blot Flag
45 kDa
30 kDa
66 kDa
20.1 kDa
14.3 kDa
Blk Bid BimEL -Bad
IgG HC
IgG LC
IgG HC
IgG LC
P S P S
Bcl-2 Bag-1 -P S
45 kDa
30 kDa
66 kDa
20.1 kDa
**
BImmunoprecipitate HA; Western Blot HA
P S P SP S P S
****
P S
Figure 5.4: Immunoprecipitation of mitochondrial proteins from HEK293 fibroblast lysates.HEK293 fibroblasts (3 dishes of 1 x 105 cells per construct) were transfected with 1 µg of the expression constructs Flag-Bcl-2 or Flag-Bag-1 (both in conjunction with 1 µg empty Bluescript vector) or 1 µg HA-Bim, HA-Bad, HA-Blk or HA-Bid (all in conjunction with 1 µg of the caspase inhibitor p35), or the controls (2 µg Bluescript only or p35 only; denoted as “-”) and allowed to express the proteins for 40 hours. The cells were then lysed, and Flag (A) or HA (B) antibodies added. Protein G-Sepharose was then added to capture the antigen-antibody complex, and immunoprecipitates washed extensively. These immunoprecipitates and lysate supernatants were then diluted in SDS sample buffer and subjected to SDS-PAGE and Western blotting, probing with Flag (A) or HA (B) antibodies. Asterisks indicate proteins in pellet or supernatant fractions of immunoprecipitation as expected from the calculated molecular weight.P = Immunoprecipitation pellet fraction; S = Immunoprecipitation supernatant fraction; IgG HC = Immunoglobulin Heavy Chain; IgG LC = Immunoglobulin Light Chain.
88a
Bid and Bad could not be detected in the pellet fractions of the immunoprecipitations.
However, extra bands were present in the supernatant fractions of these
immunoprecipitations that were not present in the “p35 only” control. This suggested
that Bid and Bad were expressed, but were not immunoprecipitated efficiently.
To determine whether GST-SAPK3 was capable of phosphorylating these
pro- and anti-apoptotic proteins, HEK293 fibroblasts were transfected with the protein
constructs and allowed to express the proteins. The cells were then lysed, and
immunoprecipitations performed as described in Chapter 2. The immunoprecipitated
proteins were then subjected to kinase assays with activated GST-SAPK3 and 3µCi [γ-32P]-ATP. Figure 5.5 shows a representative autoradiograph from this experiment with
phosphorylated protein bands in the reactions where Bcl-2, Bag-1, BimEL and Bad were
immunoprecipitated. Only weak phosphorylation of Blk and no phosphorylation of Bid
was detected. No bands in the size range of 15 – 35 kDa as expected for the sizes of the
Bcl-2 family members were detected in the control reactions, where only empty
Bluescript vector or p35 DNA were transfected into cells. These results suggest that a
number of Bcl-2 family members can be phosphorylated by SAPK3, but clearly these
protocols are limited by the problems associated with expressing sufficient amounts of
these proteins to act as substrates. Therefore, as outlined in the following sections,
additional mitochondrial substrates for SAPK3 were evaluated.
5.2.3 Investigating the phosphorylation of the mitochondrial protein Sab by
SAPK3
JNK, a well-characterised SAPK, has been recently shown to localise to the
mitochondria and phosphorylate a mitochondrial protein, Sab (Wiltshire et al., 2002).
Due to the localisation of SAPK3 also at the mitochondria (Chapter 3), the ability of
SAPK3 to phosphorylate Sab was assessed. Using activated GST-SAPK3, in vitro
kinase assays were performed to compare the phosphorylation of GST-Sab with the
known in vitro SAPK3 substrates, GST-ATF2 and GST-α1-Syntrophin. GST-ATF2 has
been shown to be an in vitro substrate for both JNK and SAPK3 (Gupta et al., 1995;
89
BS Bcl-2 Bag-1 Bim Bad Blk Bid p35Transfection:
30 kDa
20.1 kDa
220 kDa
97.5 kDa66 kDa
45 kDa
Figure 5.5: SAPK3 can phosphorylate mitochondrial proteins involved in apoptosis.HEK293 fibroblasts (3 dishes of 1 x 105 cells per construct) were transfected with 1 µg of the expression constructs Flag-Bcl-2 or Flag-Bag-1 (both in conjunction with 1 µg empty Bluescript vector) or 1 µg HA-Bim, HA-Bad, HA-Blk or HA-Bid (all in conjunction with 1 µg of the caspase inhibitor p35) or controls (2 µg p35 or Bluescript DNA only) and allowed to express the proteins for 40 hours. The cells were then lysed, and HA or Flag tag antibodies added. Protein G-Sepharose was then added to capture the antigen-antibody complex, and immunoprecipitates washed extensively. These immunoprecipitates were then subjected to kinase assays with activated GST-SAPK3 and 3µCi [γ-32P]-ATP. The kinase assay components were then separated using SDS-PAGE and the gel exposed to film. A representative autoradiograph is shown from one of 3 identical experiments. The white arrows show the phosphorylated protein bands; little Blk and no Bid phosphorylation was detected.
89a
Cuenda et al., 1997). In addition, the phosphorylation of the protein c-Jun (a good JNK
substrate (Hibi et al., 1993)), by SAPK3 was determined.
As shown in Figure 5.6, Sab produced as a recombinant fusion protein in E.
coli was phosphorylated by SAPK3 in vitro. The incorporation of 32P was higher than
that of the incorporation of 32P into ATF2 and neared that of the incorporation into α1-
Syntrophin. It is possible that the higher level of 32P incorporation detected for α1-
Syntrophin was due to phosphorylation occurring on two sites (Ser193 and Ser201)
(Hasegawa et al., 1999). In contrast, c-Jun with at least two sites available for
phosphorylation by MAPKs or SAPKs (Ser63 and Ser73; (Smeal et al., 1991; Pulverer
et al., 1993; Hibi et al., 1993)), was a poor substrate for SAPK3.
To determine whether members of the JNK subfamily might share similar
substrate preferences, a second series of in vitro kinase assays was performed with
activated JNK2. In contrast to SAPK3, JNK2 phosphorylated c-Jun to the greatest
extent, followed by Sab. ATF2 was less favoured, and α1-Syntrophin was a poor
substrate (Figure 5.7). Again, due to the phosphorylation of c-Jun on two sites by JNK,
this could account for the higher incorporation of 32P (Hibi et al., 1993). These results
show that although SAPK3 and JNK share Sab as a substrate, they have differing
preferences for other substrates. In contrast, ERK2, a MAPK preferentially activated by
growth factors and other mitogenic stimuli, did not phosphorylate Sab, but demonstrated
high activity towards a previously characterised substrate, Elk-1 (Gille et al., 1995)
(Figure 5.8).
5.2.4 Loss of the first Kinase Interaction Motif (KIM) of Sab prevents its
phosphorylation by SAPK3
To determine the mechanism for interaction of SAPK3 with Sab, a peptide
representing the last 13 amino acids of the rat SAPK3 sequence, Arg-Gln-Leu-Gly-Ala-
Arg-Val-Pro-Lys-Glu-Thr-Ala-Leu-OH was used. This C-terminal tail of SAPK3 has
90
MalE-MKK6(DD) - + - + - + - + GST-SAPK3 + + + + + + + + GST-Substrate: ATF2 α1-Syn Sab c-Jun
Autoradiograph
97 kDa66 kDa
45 kDa
GST-ATF2
GST-Sab
GST-c-Jun
GST-α1-Syntrophin
GST-ATF2
GST-Sab
GST-c-Jun
GST-α1-Syntrophin97 kDa66 kDa
45 kDaCoomassie
- + - + - + - + + + + + + + + +
MalE-MKK6(DD):GST-SAPK3:
0
20
40
60
80
100
120
ATF2 α1-Syn Sab c-Jun
Subs
trat
e Ph
osph
oryl
atio
n by
SA
PK3
(% c
ompa
red
to α
1-Sy
ntro
phin
)
Figure 5.6: Sab is a substrate of SAPK3 in vitro.GST-SAPK3 was either incubated with MalE-MKK6(DD) and ATP, or ATP only, at 30°C overnight. GST-SAPK3 was separated from the other reaction components, and subjected to kinase assays with GST-ATF2(19-96), GST-α1-syntrophin, GST-Sab(219-425) or GST-c-Jun(1-135). An autoradiograph of the gel is shown after 2.5 hours exposure. The middle panel shows the Coomassie stained gel to illustrate even protein loading, and the lower panel shows the quantitation of 3 independent assays as determined by Cerenkov counting of the protein substrate bands. In the case of GST-α1-syntrophin, only the upper band showing 32P incorporation was quantitated. The results are shown as means ± SE.
90a
Autoradiograph
Coomassie
GST-ATF2
GST-Sab
GST-c-Jun
GST-α1-Syntrophin
GST-α1-Syntrophin
GST-MKK4(ED) + + + + GST-JNK2 + + + + GST-Substrate: ATF2 α1-Syn Sab c-Jun
97 kDa
66 kDa
45 kDa
97 kDa
66 kDa
45 kDaGST-Sab
GST-c-Jun
GST-ATF2
60
80
100
Phos
phor
ylat
ion
of s
ubst
rate
by
JN
K2
(% o
f c-J
un)
ATF2 α1-Syntrophin c-JunSab0
20
40
Figure 5.7: GST-JNK2 shows different substrate preferences to GST-SAPK3 in vitro.GST-JNK was activated by MKK4(ED) and subjected to kinase assays with GST-ATF2(19-96), GST-α1-Syntrophin, GST-Sab(219-425) or GST-c-Jun(1-135). An autoradiograph of the gel is shown after 3.75 hours exposure. The middle panel shows the Coomassie stained gel to illustrate even protein loading, and the lower panel shows the quantitation of 4 independent assays as determined by Cerenkov counting of the protein substrate bands. The results are shown as means ± SE.
90b
GST-Sab
GST-Elk
GST-Elk
45 kDa
GST-Sab
GST-MKK1(EE) + +GST-ERK2 + +GST-Sab + -GST-Elk - +
Autoradiograph
Coomassie
45 kDa
Figure 5.8: GST-ERK2 does not phosphorylate Sab in vitro.GST-ERK2 was activated by MKK1(EE) and subjected to kinase assays with GST-Sab(219-425) or GST-Elk1(307-428). An autoradiograph of the gel is shown after 3.75 hours exposure. The lower panel shows the Coomassie stained gel to illustrate even protein loading.
90c
previously been shown to be crucial for the interaction of SAPK3 with the PDZ domain
of the in vitro substrate, α1-Syntrophin (Hasegawa et al., 1999). Specifically, a C-
terminal truncation mutant of SAPK3 could not phosphorylate α1-Syntrophin
(Hasegawa et al., 1999). As shown in Figure 5.9, results consistent with this model were
seen when the C-terminal SAPK3 peptide blocked the phosphorylation of α1-Syntrophin
by SAPK3. However this peptide had no effect on the phosphorylation of Sab by
SAPK3. This suggests that SAPK3 uses different mechanisms to recognise Sab and α1-
Syntrophin as substrates, such that Sab recognition is independent of the C-terminal
motif of SAPK3. Although similar experiments were not performed with Bcl-2 family
members, it would be predicted that the phosphorylation of these proteins (Bcl-2, Bag-1,
Bim and Bad) would also be unaffected by this peptide because these proteins have no
recognisable PDZ domain sequence.
An alternative interaction motif, the KIM, can mediate interactions in the
MAPK pathway. The consensus sequence for a KIM is R/K(X)3-5LXL (Yang et al.,
1998b; Chang et al., 2002; Sharrocks et al., 2000). There are two KIMs in the human
Sab sequence, located at positions 313-319 (KIM1; sequence RPGSLDL), and 400-406
(KIM2; sequence RMKQLSL) (Wiltshire et al., 2002), where the residues in bold
conform to the KIM consensus sequence. Each KIM has been selectively mutated to
remove the hydrophobic residues that mediate the interaction with MAPKs (Wiltshire et
al., 2002). This strategy has shown that JNK interacts with Sab using the first of these
KIMs (i.e. KIM1 at positions 313-319) identified in the Sab sequence, so that the loss of
KIM1 prevents the phosphorylation of Sab by JNK (Wiltshire et al., 2002). These KIM
mutants are referred to as the –KIM1 mutant (where KIM1 is mutated), -KIM2 mutant
(where KIM2 is mutated) and the –KIM1/2 mutant (where both KIMs are mutated), and
are illustrated in Figure 5.10A.
To identify whether SAPK3 interacts with Sab using either of these KIMs,
the -KIM1, -KIM2 and -KIM1/2 mutants of Sab were subjected to in vitro kinase assays
with activated SAPK3. As shown in Figure 5.10B, phosphorylation of Sab by SAPK3
was greatly reduced when KIM1 was mutated, however there was a minimal effect on
91
GST-α1-SyntrophinGST-Sab
Peptide (µM): - 10 100 - 10 100
Autoradiograph
97 kDa
66 kDa
97 kDa
66 kDaGST-Sab
GST-α1-Syntrophin
GST-Sab
GST-α1-SyntrophinCoomassie
No Peptide 100µM10µM
(* p<0.01 compared to No Peptide)
0
20
40
60
80
100
120
Subs
trat
e Ph
osph
oryl
atio
n by
SA
PK3
(%)
Sabα1-Syntrophin
*
*
Figure 5.9: A C-terminal SAPK3 peptide inhibits the phosphorylation of α1-Syntrophin but not Sab, by SAPK3.GST-Sab(219-425) and GST-α1-Syntrophin were pre-incubated with various concentrations of SAPK3 C-terminal peptide at 30°C for 10 min, then subjected to kinase assays with activated GST-SAPK3 and radiolabelled ATP. An autoradiograph of the gel is shown after 2.5 hours exposure time. The middle panel shows the Coomassie stained gel to illustrate even protein loading, and the lower panel shows the quantitation of 3 independent assays as determined by Cerenkov counting of the GST-Sab and GST-α1-Syntrophin bands. The results are shown as means ± SE. Asterisks denote significant differences (p<0.01) compared to reactions where no peptide was added.
91a
AS391S346S301 S321
KIM1(313-319)
KIM2(400-406)
1 425
RPGSLDL RMKQLSL
RPGSADA RMKQASA
Modified from Wiltshire et al., Biochem J. 367: 577-585 (2002)
B MalE-MKK6(DD): + + + + + + + +GST-SAPK3:
-KIM2WT -KIM1 -KIM1/2GST-Sab:66 kDa
45 kDa
66 kDa
45 kDa
Coomassie
Autoradiograph GST-Sab
GST-Sab
- --0
20
40
60
80
100
120
wild-type KIM1 KIM2 KIM1/2
Phos
phor
ylat
ion
of S
ab
(% o
f wild
-type
)
**
*
(* p<0.01 compared to wild-type)
Figure 5.10: Loss of the first Kinase Interaction Motif of Sab prevents its phosphorylation by SAPK3.(A) A schematic diagram of the human Sab protein, showing the positions of the MAPK consensus sites and KIM-like sequences. The mutations of the essential hydrophobic residues in the KIM sequences to alanine residues created the –KIM1, -KIM2, and –KIM1/2 mutants. (B) GST-SAPK3 was activated by MalE-MKK6(DD), and subjected to kinase assays with wild-type GST-Sab(219-425), GST-Sab (-KIM1 mutant), GST-Sab (-KIM2 mutant) or GST-Sab (-KIM1/2 mutant). An autoradiograph of a representative gel is shown after 1.5 hours exposure. The middle panel shows the Coomassie stained gel to illustrate even protein loading, and the lower panel shows the quantitation of 3 independent assays as determined by Cerenkov counting of the GST-Sab bands. The results are shown as means ± SE. Asterisks denote significant difference (p<0.01) compared to wild-type GST-Sab.
91b
SAPK3 phosphorylation of Sab when KIM2 was mutated (approximately 5% decrease
compared to wild-type), indicating the requirement for KIM1 when Sab is
phosphorylated by SAPK3. Therefore KIM1 appears to be required when Sab is
phosphorylated by JNK or SAPK3.
5.2.5 Serine 321 in Sab is the major site of phosphorylation by SAPK3 and JNK2
Wild-type Sab has four possible MAPK phosphorylation sites as shown:
Site 1: Ser301 (298GPTSPSE304)
Site 2: Ser321 (318DLPSPVS324)
Site 3: Ser346 (343GASSPEC349)
Site 4: Ser391 (388SSTSPEG394).
The Predikin program (Brinkworth et al., 2003) was used to predict which
of these sites within the Sab sequence could be phosphorylated by SAPK3. Predikin uses
structural information on kinase-substrate interactions to more precisely define a
consensus site of phosphorylation by a serine/threonine protein kinase (Brinkworth et
al., 2003). According to Predikin analysis, the optimal consensus sequence for
phosphorylation of a substrate by SAPK3 is:
(X)-3 (P/V/A/L/S) -2 (F/M/L) -1 (S/T)0 P+1 (F/Xa) +2 (R/K/Q/S/L) +3,
where X is any amino acid and Xa is any aliphatic amino acid. The italicised amino
acids denote the phosphorylated amino acids, and all amino acids are thus numbered
from –3 to +3 relative to that position.
Using this approach, it was predicted that serine 321 in the sequence
318DLPSPVS324 was the most likely site for phosphorylation of Sab by SAPK3 with six
of the seven amino acids in the sequence agreeing with the Predikin prediction. The
serine residue at position 321 was therefore mutated to an alanine residue. In addition,
as a “control” mutation, serine 391 in the sequence 388SSTSPEG394 was mutated because
this was predicted to be a more unlikely site for phosphorylation with only four of the
seven amino acids agreeing with the Predikin prediction. It should be noted that the
92
sequences surrounding the other two possible MAPK sites (298GPTSPSE304 and
343GASSPEC349) also do not closely follow the Predikin consensus sequence. Most
notably these sites, like that of the serine 391 site, have negatively charged residues at
the +2 or +3 positions in the site when Predikin predicts that preferred SAPK3 substrates
will have aliphatic or basic residues in these positions.
As seen in Figure 5.11, when serine 321 was mutated to alanine (S321A),
this greatly reduced the phosphorylation of Sab by SAPK3, to approximately 15% of the
wild-type level. This would suggest that serine 321 is the major site of phosphorylation
of Sab by SAPK3. When serine 391 was mutated to alanine (S391A), there was only a
marginal (although significant) decrease in phosphorylation of Sab to approximately
85% of wild-type level. This would suggest that serine 391 can be phosphorylated by
SAPK3, but to a much lesser extent. When these Sab mutants were incubated with
activated JNK (Figure 5.12), similar results were seen however when Ser391 was
mutated to alanine the overall level of phosphorylation did not change, suggesting that
JNK2 did not phosphorylate Sab on this site. Therefore serine 321, which is only 1 of 4
putative MAPK consensus sites, appears to be the major phosphorylation site in Sab for
both SAPK3 and JNK.
5.2.6 Surrounding sequence composition and location dictate the favoring of Ser
321 in Sab
To determine how Ser321 phosphorylation was favoured by SAPK3, a
series of mutations was conducted around this site. First, to assess whether the position
of Ser321 within the Sab protein, or the sequence surrounding serine 321, was favoured
by SAPK3, mutations were introduced into wild-type Sab or the S321A Sab mutant, to
“swap” the sequences around Ser321 and Ser391. This created the 321/391 mutant (with
a site surrounding Ser321 changed to the sequence of the original Ser391) or the
391/321 mutant (with a site surrounding Ser391 changed to a sequence like that
surrounding the original Ser321). In the latter case of the 391/321 mutant, this was
created in a Sab S321A mutant so that SAPK3 would no longer be able to phosphorylate
93
MalE-MKK6(DD): + + ++ + +GST-SAPK3:
GST-Sab
GST-Sab
45 kDa
66 kDa
45 kDa
66 kDa
GST-Sab: S391AWT S321A
Autoradiograph
Coomassie
(* p<0.01 compared to wild-type)
*
*
0
20
40
60
80
100
120
WT S321A S391ASab
Phos
phor
ylat
ion
by S
APK
3 (%
)
Figure 5.11: A Ser321Ala mutant of Sab is not phosphorylated by SAPK3.GST-SAPK3 was activated by MalE-MKK6(DD) and subjected to kinase assays with wild-type GST-Sab(219-425) or mutants where serine has been changed to alanine at position 321 (S321A) or 391 (S391A). An autoradiograph of a representative gel is shown after 1.5 hours exposure. The middle panel shows the Coomassie stained gel to illustrate even protein loading, and the lower panel shows the quantitation of 4 independent assays as determined by Cerenkov counting of the GST-Sab bands. The results are shown as means ± SE. Asterisks denote a significant difference (p<0.01) compared to the phosphorylation of wild-type GST-Sab.
93a
GST-MKK4(ED): + + ++ + +GST-JNK2:
GST-Sab: S391AWT S321A
GST-Sab
GST-Sab
45 kDa
66 kDa
45 kDa
66 kDa
(* p<0.01 compared to wild-type)
*
0
20
40
60
80
100
120
WT S321A S391ASab
Phos
phor
ylat
ion
by J
NK
2 (%
)
Figure 5.12: A Ser321Ala mutant of Sab is not phosphorylated by JNK2.GST-JNK2 was activated by GST-MKK4(ED) and subjected to kinase assays with wild-type GST-Sab(219-425) or mutants where serine has been changed to alanine at position 321 (S321A) or 391 (S391A). An autoradiograph of a representative gel is shown after 4 hours exposure. The middle panel shows the Coomassie stained gel to illustrate even protein loading, and the lower panel shows the quantitation of 4 independent assays as determined by Cerenkov counting of the GST-Sab bands. The results are shown as means ± SE. Asterisks denote a significant difference (p<0.01) from the phosphorylation of wild-type GST-Sab.
93b
the S321 in its wild-type position, and therefore would not interfere with the
interpretation of the results of this analysis. These sequences have been described in
Appendix I of this thesis.
As shown in Figure 5.13, the 321/391 mutant (i.e. with the sequence around
Ser321 swapped to that usually surrounding Ser391, in the wild-type background)
reduced the phosphorylation of Ser321 to approximately 40% of the level of wild-type
phosphorylation. The 391/321 mutant (i.e. the sequence around Ser391 swapped to that
usually surrounding Ser321, in the Sab S321A mutant background) showed a similar
decrease although its phosphorylation did remain significantly higher than that of the
S321A Sab mutant. This result with the 391/321 mutant suggests that the position of the
phosphorylation site within the Sab sequence was a dominant contributor to its ability to
be phosphorylated by SAPK3. This conclusion was reached since altering the sequence
surrounding Ser391 did not bring the level of Ser391 phosphorylation to that normally
seen for Ser321. However, because altering the sequence composition around Ser391
still slightly improved Sab phosphorylation, the surrounding sequence was likely still of
importance at this site.
Whilst one interpretation of the data on the phosphorylation of the 321/391
mutant is that the Ser391 sequence context is not able to be phosphorylated even when
in the appropriate position in the Sab sequence, this is confounded by the close
proximity of the Ser321 phosphorylation site to KIM1 in the Sab sequence. Examination
of the sequence of Sab shows that the residue at the –2 position of the Ser321 site is
actually the second essential hydrophobic residue in KIM1 as shown in bold in the
following sequence 313RPGSLDLPSPVS324. Thus, the 321/391 mutant may no longer be
phosphorylated only because the integrity of KIM1 has been disrupted by the loss of 1 of
the 2 essential hydrophobic residues.
To more carefully examine the effects of changing the Ser321 site without
altering KIM1, mutations were introduced to only change amino acids 323 (i.e. +2
position in the phosphorylation sequence) and 324 (i.e. +3 position in the
94
45 kDa
66 kDa
45 kDa
66 kDa
GST-Sab
WT 321/ S321A 391/391 321
+ + + + + + + +
MalE-MKK6(DD):GST-SAPK3:GST-Sab:
GST-SabAutoradiograph
Coomassie
*
(* p<0.001 compared to wild-type; # p<0.001 compared to S321A)
#
0
20
40
60
80
100
120
WT 321/391 S321A 391/321
Phos
phor
ylat
ion
of S
ab
by S
APK
3 (%
of W
ild-T
ype)
Figure 5.13: The phosphorylation of Sab by SAPK3 is dependent onthe surrounding sequence and the position of the site within Sab.GST-SAPK3 was activated by MalE-MKK6(DD) and subjected to kinase assays with wild-type GST-Sab(219-425), Sab (321/391) mutant, S321A mutant, or Sab (391/321) mutant. An autoradiograph of a representative gel is shown after 1.5 hours exposure. The middle panel shows the Coomassie stained gel to illustrate even protein loading, and the lower panel shows the quantitation of 3 independent assays as determined by Cerenkov counting of the GST-Sab bands. The results are shown as means ± SE.
94a
phosphorylation sequence) in the Sab sequence. Normally, a Val residue is present at
position 323 in the Sab sequence, and a Ser residue at position 324. Site-directed
mutagenesis was used to change Val323 to Glu or Ala, or Ser324 to Glu or Ala. These
sequences have been described in Appendix I. Changing these amino acids to Glu more
closely resembled the sequences surrounding the other putative MAPK consensus sites
in the Sab sequence. The replacement with Ala further defined the sequence
requirements at the +2 and +3 position of this site in Sab.
As seen in Figure 5.14, the V323E mutant in which Glu was introduced
into the +2 position of the Ser321 site decreased phosphorylation of Sab by SAPK3 by
approximately 75%. Introduction of Ala at this position (V323A) also affected
phosphorylation, albeit to a lesser extent. The S324E mutant in which Glu was
introduced into the +3 position of the Ser321 site only decreased the phosphorylation of
Sab by SAPK3 by approximately 15%, and the introduction of Ala here (S324A) had no
detrimental effect on the ability of Sab to be phosphorylated by SAPK3, but rather
improved it by approximately 10%. Collectively, these results suggest that both the
position of the phosphorylation site within the target protein and the exact sequence
surrounding the phosphorylation site are important for the recognition of the Sab
phosphorylation site by SAPK3. It appears that the KIM sequence and the amino acid at
the +2 position of the phosphorylation site are crucial for phosphorylation of Sab at Ser
321 by SAPK3.
5.3 Discussion
When compared to the archetypical p38 MAPKs, SAPK2a and SAPK2b,
SAPK3 is a relatively poorly studied member of the p38 MAPK family. Little is known
about its activation, localisation, or substrate specificity, apart from studies in which
SAPK3 has been overexpressed in mammalian cells (Buee-Scherrer and Goedert, 2002;
Takahashi et al., 2003; Sakabe et al., 2002; Chiariello et al., 2000; Cuenda et al., 1997;
Kumar et al., 1997). In Chapter 3 SAPK3 was shown to co-localise with mitochondria.
95
45 kDa
66 kDa
45 kDa
66 kDa
MalE-MKK6(DD):GST-SAPK3:
GST-Sab:
+ + + + + + + + + +
Autoradiograph
GST-Sab
WTV32
3EV32
3AS32
4ES32
4A
GST-Sab
Coomassie
*
**
*
(* p<0.01 compared to wild-type)
0
20
40
60
80
100
120
140
WT V323E V323A S324E S324APhos
phor
ylat
ion
of S
ubst
rate
by
SA
PK3
(% o
f WT)
Figure 5.14: Analysis of sequence determinants for phosphorylation at the +2 and +3 positions of Ser321. GST-SAPK3 was activated by MalE-MKK6(DD) and subjected to kinase assays with wild-type GST-Sab (219-425), GST-Sab V323E mutant, GST-Sab V323A mutant, GST-Sab S324E mutant, or GST-Sab S324A mutant. An autoradiograph of a representative gel is shown after 3.5 hours exposure time. The middle panel shows the Coomassiestained gel to illustrate even protein loading, and the lower panel shows the quantitation of 3 independent assays as determined by Cerenkov counting of the GST-Sab bands. The results are shown as means ± SE.
95a
Importantly, mitochondrial co-localisation suggests that there will be mitochondrial
substrates for SAPK3. This Chapter therefore addressed the phosphorylation of
mitochondrial proteins by SAPK3.
Following the activation of recombinant SAPK3 in vitro, it was shown that
SAPK3 phosphorylated Bcl-2, Bag-1, BimEL and Bad (Figure 5.5). This potentially
implicates SAPK3 in a role at the mitochondria alongside other members of the MAPK
family such as ERK and JNK, which have previously been shown to phosphorylate
proteins localised at this organelle (Ishikawa et al., 2003; Donovan et al., 2002; Ley et
al., 2003; Deng et al., 2001). For example, JNK phosphorylates the anti-apoptotic
proteins Bcl-2 and Bclx(L) and the pro-apoptotic proteins Bad and Bim (Fan et al.,
2000; Basu and Haldar, 2003; Donovan et al., 2002; Lei and Davis, 2003). These
actions of JNK remain somewhat controversial, and JNK has been suggested to act in a
pro-and anti-apoptotic fashion in many cell types via its actions on proteins at the
mitochondria (Bhakar et al., 2003; Donovan et al., 2002; Basu and Haldar, 2003; Lei and
Davis, 2003; Lei et al., 2002; Yu et al., 2004). It remains possible that SAPK3 could
play similar roles in the regulation of mitochondrial proteins. One report has suggested
that SAPK3 could play a pro-apoptotic role in the ovarian carcinoma cell line OVCAR3
(Abdollahi et al., 2003). However, most studies to date using overexpressed SAPK3
have not implicated this kinase in apoptosis. Rather SAPK3 has been suggested to play
diverse roles such as regulation of gene transcription (Marinissen et al., 1999), γ-
radiation-induced cell cycle arrest (Wang et al., 2000), cell differentiation (Lechner et
al., 1996), meiotic G(2)/M progression of Xenopus oocytes (Perdiguero et al., 2003), and
the regulation of glucose uptake (Ho et al., 2004).
In this Chapter, SAPK3 was shown to phosphorylate the pro- and anti-
apoptotic mitochondrial proteins to different extents. This may be due to differences in
substrate preference, differences in expression levels of the substrate proteins, or
different numbers of phosphorylation sites within each substrate protein. It is also
possible that each of the proteins was immunoprecipitated to different extents. This
seems likely when examining the Western blot results, which showed that Bid and Bad
96
did not show high immunoreactivity in the pellet fraction of the immunoprecipitations
(Figure 5.4). It may be possible that the HA tag is obscured by the folding of these
particular proteins, resulting in lower recognition by the HA antibody. Furthermore, it
seems likely that some of the immunoprecipitated Bid and Bad would be difficult to
visualise since they migrate to approximately the same point on SDS-PAGE as light
chain immunoglobulin, and so would be obscured by this band on the Western blot
(Figure 5.4).
The migration of the mitochondrial proteins on SDS-PAGE largely did not
seem to agree with the calculated molecular weight of these proteins (Figures 5.3 and
5.4). It is unknown why this discrepancy occurs, but possible reasons include the
presence of a HA or Flag tag (both of which are approximately 1 kDa), or post-
translational modifications such as myristylation, palmitylation, farnesylation,
glycosylation or phosphorylation, although apart from phosphorylation these
modifications of this family of proteins has not been reported. The difficulties in
expression and analysis of these proteins in mammalian cells highlights that alternative
methods for substrate preparation are desirable. Expression of Bcl-2 family members in
bacterial systems has not been successful due to instability, insolubility, and low yields
of these proteins (D. Huang, personal communication). Future protocols could therefore
explore their expression in insect cell systems, yeast, or cell-free systems.
In addition to showing that SAPK3 could phosphorylate a variety of pro-
and anti-apoptotic proteins at the mitochondria, it was shown that SAPK3
phosphorylates the mitochondrial protein Sab (Figure 5.6). This protein first described as
a binding partner of Bruton’s Tyrosine Kinase (Btk) (Matsushita et al., 1998; Yamadori
et al., 1999), has more recently been shown to be an in vitro substrate of the JNK family
of SAPKs (Wiltshire et al., 2002). The advantage in the study of the phosphorylation of
Sab was the ability to express sufficient quantities of the recombinant protein as a GST-
fusion protein in E.coli. Furthermore, wild-type and mutants of GST-Sab could be
evaluated for their phosphorylation by SAPK3 in subsequent in vitro assays. In this
Chapter it has been shown that Sab is an in vitro substrate shared by SAPK3 and JNK2
97
(Figure 5.7). A survey of the literature shows that other substrates such as Elk-1 are also
phosphorylated by SAPK3 and JNK in vitro (Cavigelli et al., 1995; Cuenda et al., 1997),
but notably JNK has been found to phosphorylate substrates such as c-Jun (Hibi et al.,
1993) that are not phosphorylated by SAPK3 (Cuenda et al., 1997). Conversely the
substrate Tau is phosphorylated by SAPK3 but acts as a poor substrate for JNK (Buee-
Scherrer and Goedert, 2002).
The sharing of substrates by multiple closely-related but not identical
protein kinases such as the different SAPKs could provide a number of important levels
of control in these intracellular signaling pathways. When different stimuli preferentially
activate either SAPK3 or JNK2, it is possible that the phosphorylation of the same
substrates can result. This allows diverse stimuli to initiate the same intracellular action.
This is similar to the phosphorylation of Mnk1 and Mnk2 by both ERK and SAPK2a,
which stimulates the kinase activity of Mnk1/2 and results in the phosphorylation of the
eukaryotic initiation factor-4E (eIF-4E) (Waskiewicz et al., 1997). Alternatively,
substrate activation may require the phosphorylation of one site by SAPK3 and another
site by JNK2. A similar situation appears to occur in the phosphorylation of JNK by
MKK4 and MKK7, where JNK is preferentially phosphorylated on Thr183 by MKK7,
and on Tyr185 by MKK4, and thus the two MKKs can operate synergistically to activate
JNK (Lawler et al., 1998; Fleming et al., 2000). It also remains possible that SAPK3
and JNK2 each phosphorylate some common substrates but independently and at
different sites. This may have different functional consequences for the actions of the
phosphorylated protein and could lead to different cellular responses. For example, it has
been reported that JNK phosphorylation of c-Jun occurs on the N-terminal sites of Ser63
and Ser73, promoting the activity of c-Jun, whereas ERK phosphorylation of c-Jun
occurs at an inhibitory C-terminal site (Minden et al., 1994).
In the case of Sab, serine 321 was identified as the major site of
phosphorylation by SAPK3 and JNK2 (Figure 5.11 and 5.12). The identification of the
same phosphorylation site for both kinases was not surprising, given that SAPK3 and
JNK interact with Sab using the same KIM (Figure 5.10), and thus would be expected to
98
come into contact with a similar region of the Sab protein for phosphorylation.
Interestingly, SAPK3 was also shown to phosphorylate serine 391, albeit to a much
lesser extent than serine 321. However, mutation of serine 391 in Sab did not result in
any loss of phosphorylation by JNK2, showing that whilst SAPK3 can phosphorylate
both Ser321 and Ser391 in Sab, JNK2 appears unable to phosphorylate Ser391. Since
mutation of Ser321 to alanine did not completely abolish phosphorylation of Sab by
JNK2 however, it seems that besides Ser321, JNK2 can also phosphorylate another site
within Sab apart from Ser321 and Ser391. Therefore, JNK2 and SAPK3 appear to share
subtly different site preferences within the Sab protein. The phosphorylation of Sab by
SAPK3 or JNK2 may therefore result in different outcomes.
When analysing the possible phosphorylation sites within any one
substrate, consensus sequences for phosphorylation have been useful to help define
which serine or threonine residues might be phosphorylated by kinases such as the
MAPKs or SAPKs. As noted earlier, the consensus sequence for MAPKs has been
defined as (Pro/X)-X-(Ser/Thr)-Pro, where X is any amino acid and the amino acid
phosphorylated is indicated in italics (Clark-Lewis et al., 1991). The identification of
this consensus relied on the design of synthetic peptides based on the MAPK
phosphorylation site of myelin basic protein, with mutations at various positions (Clark-
Lewis et al., 1991). Kinetic studies were then used to determine the sequence which had
the optimal rate of phosphorylation (Clark-Lewis et al., 1991). Evaluating the sequences
surrounding the sites of phosphorylation by SAPK3 (eg α1-Syntrophin 190PPASPLQ196
and 198QPSSPGP204; tau 393VYKSPVV399 and 401GDTSPRH407) has suggested this loose
consensus also holds true for SAPK3. However this simple comparison with only a
limited number of SAPK3 substrates does not allow the more precise prediction of
SAPK3 substrate preferences. A recent advance in the prediction of substrate
phosphorylation sites comes with release of the Predikin program (Brinkworth et al.,
2003). This uses structural information derived from the interactions of Ser/Thr protein
kinases with their substrates to define more closely the preferred sites for
phosphorylation for any Ser/Thr protein kinase.
99
For SAPK3 the optimal consensus sequence is predicted to be:
X-3 (P/V/A/L/S) -2 (F/M/L) -1 (S/T)0 P+1 (F/Xa) +2 (R/K/Q/S/L) +3
where X is any amino acid, Xa is an aliphatic amino acid, and the italicised amino acid
(Ser or Thr) can be phosphorylated.
Similar analysis for JNK2 predicts its consensus sequence to be:
(L/I/M/F)-3 (E/D/S/R)-2 (F/M/L)-1 (S/T)0 P+1 (P/F/L/I/D/E)+2 (R/K/Q/S/L)+3.
This confirms the suggestion that these two SAPKs may not always share similar
preferences for substrate phosphorylation sites due to major differences in the residue
preferred at the –2 position, some differences in the +2 position, and a greater
requirement for specific residues in the –3 position when phosphorylation by JNK2 is
considered.
It is interesting to note that under some circumstances active ERK2 has
been found to localise to the mitochondria (Zhu et al., 2003). The Predikin consensus
site for phosphorylation by ERK2 is predicted to be:
(R/K/F)-3 (P/V/A/L/S)-2 (F/M/L)-1 (S/T)0 P+1 (F/XA)+2 (R/K/Q/S/L)+3.
This is very similar to the consensus site for SAPK3, with the only difference being a
more defined prediction for the –3 residue in the phosphorylation site. According to this
analysis, it was predicted that there would be more likelihood that a substrate would be
shared by ERK2 and SAPK3 than would be shared by JNK2 and SAPK3. In contrast it
was shown that Sab is phosphorylated by SAPK3 and JNK2, and that ERK2 was unable
to phosphorylate Sab (Figure 5.8). Therefore, it is likely that other differences in the
mechanisms of substrate recognition by ERK2 and SAPK3/JNK2 account for these
differences.
Other domain interactions in the recognition and phosphorylation of
substrates by SAPK3 will likely add these additional layers of complexity. It has
previously been shown than the C-terminal sequence of SAPK3, KETXL, is essential for
the interaction of SAPK3 with the PDZ domain of α1-Syntrophin, and the subsequent
phosphorylation of this protein (Hasegawa et al., 1999). In Chapter 6 it is shown that
SAPK3 can use this C-terminal tail to interact with the PDZ domains of other proteins
100
such as Scribble and OMP25. A cell-permeable version of this C-terminal peptide has
recently been used as an intracellular SAPK3 inhibitor (Sabio et al., 2004). However, in
this Chapter it was shown that SAPK3 phosphorylates Sab via a mechanism that uses
KIM1, located at position 313-319 in Sab (Figure 5.10). For Sab, the C-terminal peptide
does not inhibit phosphorylation by SAPK3 (Figure 5.9). Therefore, the use of the cell-
permeable C-terminal peptide will only inhibit a subset of SAPK3 substrate
phosphorylation. An analysis of the literature suggests that this is the first reported
confirmation of the phosphorylation of a substrate by SAPK3 using a KIM motif. As
described in more detail in the following paragraph, this implies that SAPK3 can, like
other kinases, use this mechanism for binding to its substrates.
When comparing the sequences of Sab to other substrates of SAPK3, such
as ATF2 (Cuenda et al., 1997) and Tau (Goedert et al., 1997b) KIM-like sequences
(R/K(X)3-5LXL) can be identified in both of these other substrates. Specifically,
47KKMPLDL53 in ATF2 has been previously implicated as a KIM (Livingstone et al.,
1995; Gupta et al., 1995) and 221REPKKVAV228 in Tau appears to resemble the KIM
sequence. When examining the sequences of some of the mitochondrial proteins found
to be phosphorylated by SAPK3 in Figure 5.5, Bcl-2, Bag-1 and Bim all have sequences
resembling KIMs (Bcl-2 218KTLLSLAL225; Bag-1 345RLQSTNLAL353; Bim
180RMVILRL186). α1-Syntrophin also contains two KIM-like sequences (9RTGLLEL15
and 497KVTRLGL503). As mentioned earlier, previous studies have found that SAPK3
interacts with α1-Syntrophin using its PDZ domain-binding motif (Hasegawa et al.,
1999). The data showing that the C-terminal SAPK3 peptide blocks the phosphorylation
of α1-Syntrophin supports the idea that the most significant interaction between SAPK3
and α1-Syntrophin is via the PDZ domain, and that this domain is required for
phosphorylation.
In conclusion, the results obtained in this Chapter suggest that SAPK3 is
able to phosphorylate mitochondrial substrates such as Bcl-2, Bag-1, BimEL, Bad and
Sab. Thus, SAPK3 and JNK may share common targets at the mitochondria. In
addition, some of the determinants responsible for phosphorylation site preference by
101
SAPK3 have been identified. The results presented here show that the sequence
surrounding the phosphorylation site of a substrate, as well as the position of that site
within the entire substrate protein is important for recognition by SAPK3. This
information should prove helpful in the future identification of other potential SAPK3
substrate proteins. The localisation of SAPK3 at the mitochondria, and its
phosphorylation of mitochondrial substrates suggest that SAPK3 may engage in a
variety of different interactions at this organelle. Therefore, the following Chapter uses
a yeast two-hybrid screening approach to identify some of the SAPK3 binding proteins
that may be responsible for anchoring it at the mitochondria and regulating its
interaction with substrate proteins.
102
Chapter 6
Identification of proteins that bind to SAPK3 by a PDZ domain-mediated interaction
6.1 Introduction
SAPK3 possesses a unique C-terminal tail with the sequence of Lys-Glu-
Thr-Xaa-Leu-COOH, which allows it to bind to PDZ domains (Hasegawa et al., 1999).
SAPK3 has previously been found to interact with the PDZ domains of α1-Syntrophin
and Post Synaptic Density-95 (PSD-95) (Hasegawa et al., 1999; Sabio et al., 2004). In
each case, the subsequent phosphorylation of these proteins was dependent on the
interaction of the C-terminal tail of SAPK3 with each PDZ domain (Hasegawa et al.,
1999; Sabio et al., 2004).
Although many PDZ-mediated interactions involve proteins at the plasma
membrane (Srivastava et al., 1998; Niethammer et al., 1996), proteins at intracellular
organelles such as the Golgi also can contain PDZ domains (Stricker and Huganir, 2003;
Liu et al., 2001; Kuo et al., 2000). A limited number of PDZ domain-containing
proteins have also been identified at the mitochondria. These include Protein that
Interacts with C-Kinase 1 (PICK1) (Wang et al., 2003a), High Temperature
Requirement A 2 (HtrA2/Omi) (Suzuki et al., 2001)and Outer Membrane Protein 25
(OMP25) (Nemoto and De Camilli, 1999). Other PDZ domain-containing proteins have
also been found in recent proteomic analysis of human heart mitochondria (Taylor et al.,
2003).
In Chapter 3, SAPK3 was shown to be co-localised with the mitochondria,
and this localisation did not change with hyperosmotic stress (results not shown).
Furthermore, in Chapter 4 several mitochondrial proteins were identified as in vitro
substrates of SAPK3. It is not yet clear how SAPK3 is localised at the mitochondria.
For example, an analysis of the SAPK3 sequence using prediction programs such as
PSORT (http://psort.nibb.ac.jp/) does not reveal a mitochondrial targeting sequence
(unpublished observations). Therefore a candidate mechanism for SAPK3 involves the
interaction of the C-terminal tail of SAPK3 with PDZ-containing anchor proteins in the
outer mitochondrial membrane. An approach to identify possible SAPK3 binding
partners that “anchor” SAPK3 at the mitochondria could therefore involve the screening
103
of a library using SAPK3 or the direct testing of SAPK3 interaction with mitochondrial
PDZ domain-containing proteins.
Yeast two-hybrid analysis is a screening technique now widely used to
identify protein-protein interactions within a eukaryotic cell context (Fields and Song,
1989). This method exploits the functional delineation of transcription factor proteins as
two separable and functionally essential domains: the DNA binding domain and
transactivation domain (Keegan et al., 1986; Hope and Struhl, 1986; Fields and Song,
1989). The DNA binding domain of a transcription factor which binds to specific DNA
sequences (“ABC”) can be fused to a protein, “X”, and the transactivation domain to
another protein, “Y”. Any interaction between X and Y brings the DNA binding domain
and the transactivation domain into close proximity and reconstitutes an active
transcription factor, thereby stimulating the transcription of a gene regulated by the ABC
sequence in the promoter (Fields and Song, 1989).
One of the major aims of this project (as outlined in Chapter 1) was to
identify SAPK3 binding partners that may be responsible for holding it to a particular
location within the cell. A yeast two-hybrid screening strategy employed in this Chapter
used full-length SAPK3 as a “bait” to search for binding partners in a cDNA library
derived from the mouse lymphohematopoietic progenitor cell line EML Clone.1 (Tsai et
al., 1994). Using this screening approach, SAPK3 binding proteins were identified
which contained PDZ domains. The identification of these proteins implies that SAPK3
interactions within the cell will be dominated by these domains. Furthermore this
suggests a mechanism for the anchoring of SAPK3 at the mitochondria. In the second
approach, the yeast two-hybrid system was used to evaluate the interaction between
SAPK3 and a mitochondrial PDZ domain-containing partner OMP25. This protein was
found not to be a substrate for SAPK3, and unlike previously identified PDZ domain-
containing partners, it inhibited the activity of SAPK3. These results suggest the
possibility of additional complexity in the control of MAPK pathways.
104
6.2 Results
6.2.1 Screening a yeast two-hybrid library with full-length SAPK3
Little is known about the binding partners of SAPK3 that allow its specific
localisation within the cell. A previous report, using yeast two-hybrid screening of
skeletal muscle, identified the PDZ domain-containing protein α1-Syntrophin as a
possible binding partner of SAPK3 (Hasegawa et al., 1999). It was shown that SAPK3
can bind to α1-Syntrophin using a C-terminal PDZ domain binding motif, and that this
allows the subsequent phosphorylation of α1-Syntrophin (Hasegawa et al., 1999). This
published screen for SAPK3 substrates was carried out in a library from skeletal muscle
presumably because this tissue has a high expression of SAPK3 (Mertens S et al., 1996;
Lechner C et al., 1996; Li Z et al., 1996) (Chapter 4). Several studies have examined the
role of SAPK3 in skeletal muscle tissue and in skeletal muscle myoblast and myotube
cells (Ho et al., 2004; Boppart et al., 2000; Tortorella et al., 2003; Hasegawa et al., 1999;
Lechner C et al., 1996). However, SAPK3 is also expressed in a range of other tissues
(Chapter 4), and little is known about the substrates and/or binding partners of SAPK3 in
any of these tissues.
Yeast two-hybrid analysis is generally useful as a screening and/or binding
assay for proteins that do not have any transcriptional activity themselves. Proteins that
do have transcriptional activity when fused to a DNA binding domain, (i.e. they are able
to activate transcription of the reporter genes HIS3 and lacZ without a binding partner
linked to a transactivation domain) are “autoactivators” and thus are inappropriate to use
for a yeast two-hybrid screen. To determine whether SAPK3 was an autoactivator of
transcription, full-length rat SAPK3 was sub-cloned into the LexA DNA binding protein
fusion vector pBTM116 (Vojtek et al., 1993), as an in-frame fusion to LexA. The
Saccharomyces cerevisiae L40 strain (MATa, his3∆200, trp1-901, leu2-3, 112, ade2,
LYS2::(lexAop)4-HIS3, URA3::(lexAop)8-lacZ, GAL4) was then transformed with this
construct. The yeast colonies resulting from this transformation were then assayed for
β-galactosidase activity, as described in Chapter 2. In a separate transformation, another
105
LexA DNA binding domain fusion protein, LexA-ARL6, was expressed from the
plasmid pBTM116. This was introduced into yeast in conjunction with the protein A21
that had been sub-cloned into the VP16 transactivation domain fusion vector pVP16,
thus producing a fusion to the VP16 transactivation domain. A21 and ARL6 have
previously been identified as interacting partners, and thus the co-transformation of
these two proteins into yeast would act as a positive control for lacZ and HIS3 reporter
activation (E. Ingley, personal communication). Following the transformations, the
resulting yeast colonies were assayed for β-galactosidase activity. Using this method, it
was shown that whilst the positive control activated the lacZ reporter, SAPK3 could not
activate transcription of this reporter gene alone, or in combination with pVP16-A21
(Figure 6.1). Furthermore, apart from the positive control, no growth of the yeast was
seen on media lacking histidine, suggesting no activation of the HIS3 reporter gene
(results not shown). Therefore, SAPK3 was not an autoactivator and could be used in
subsequent yeast two-hybrid screening protocols.
SAPK3 has previously been shown to be expressed in early hematopoietic
progenitor cells (Uddin et al., 2004), and thus it was thought that a library derived from
these cells would be appropriate for screening. Yeast two-hybrid screening of a cDNA
library derived from the mouse lymphohematopoietic progenitor cell line EML Clone.1
(Tsai et al., 1994) has been optimised by Dr Evan Ingley and colleagues at the Western
Australian Institute for Medical Research. Furthermore, several published studies have
arisen from the screening of this library, identifying binding partners of proteins such as
the oncoprotein Myeloid Leukemia Factor-1 (Lim et al., 2002) and Lyn Tyrosine Kinase
(Ingley et al., 2001; Ingley et al., 2000). Therefore, this library was chosen to screen for
potential SAPK3 binding partners.
The general scheme for screening the EML Clone.1 cDNA library is
outlined in Figure 6.2. The S. cerevisiae L40 strain, transformed with the LexA-SAPK3
pBTM116 construct, was subsequently transformed with the EML Clone.1 cDNA
library in which the library proteins were expressed as a VP16 transactivation domain
fusion. Positive interaction of SAPK3 with library proteins was then determined by the
106
ARL6 SAPK3pBTM116:pVP16: - -
Selective Media:Trp-
ARL6 SAPK3pBTM116:pVP16: A21 A21
Selective Media:Leu-, Trp-
Figure 6.1: pBTM116-SAPK3 is unable to activate transcription alone in the yeast two-hybrid system.The S. cerevisiae L40 strain was transformed with the pBTM116 vector encoding SAPK3 or ARL6, in combination with the protein A21 (cloned into pVP16), or alone. Yeast colonies were then streaked to a grid on the appropriate selective media and assayed for β-galactosidase activity.
106a
lacZ HIS3
lacZ HIS3
lacZ HIS3
A
B
C
LexA DNA Binding DomainFull-length SAPK3
Proteins represented in the cDNA libraryVP16 Transactivation Domain
lacZ and HIS3 reporter geneslacZ HIS3
Figure 6.2: Screening the yeast two-hybrid EML Clone.1 cDNA library using full-length SAPK3.(A) The S. cerevisiae L40 strain, containing the lacZ and HIS3 reporter genes, was transformed with the LexA fusion vector pBTM116, encoding full-length SAPK3 fused to the LexA DNA binding protein. (B) Yeast cells were subsequently transformed with the EML Clone.1 cDNA library, encoded in the pVP16 vector and fused to the transactivation domain of the VP16 protein.(C) When SAPK3 interacted with a protein from the library, the LexA DNA binding domain and VP16 transactivation domain were brought into close proximity to reconstitute an active transcription factor. This resulted in the activation of the lacZ and HIS3 reporter genes, thus the yeast turned blue with the addition of X-gal, and grew in the absence of the amino acid histidine.
106b
activation of the HIS3 and lacZ reporter genes. From this large-scale screen, 420 clones
were isolated which activated the lacZ and HIS3 reporter genes (Table 6.1). Yeast
colonies containing positively interacting library plasmids were rescued into Escherichia
coli and co-transformed into the L40 yeast strain with LexA-SAPK3. HIS3 and β-
galactosidase assays were then performed to confirm a positive interaction. Colonies
that showed a positive interaction with SAPK3 in this secondary confirmation procedure
were then sequenced. Using this secondary confirmation procedure, 148 clones were
found to be “true” positives, in that they activated the lacZ and HIS3 reporters in the
presence of a LexA-SAPK3, but not LexA-Lamin or LexA-ARL6 hybrid fusion protein
(Figure 6.3).
6.2.2 SAPK3 interacts with Scribble and Lin-7C by yeast two-hybrid analysis
By sequencing the library clones from the secondary screening, it was
determined that the SAPK3 interactors were the PDZ domain-containing proteins,
Scribble (NCBI Accession Number NP_598850) and Lin-7C (NCBI Accession Number
NP_035829). To determine whether the interaction of Lin-7C and Scribble was
dependent on the C-terminal tail of SAPK3, yeast were co-transformed with Lin-7C or
Scribble, and a truncation mutant of SAPK3, where the 5 most C-terminal amino acids
had been deleted (SAPK3∆5C). No interaction was detected between SAPK3∆5C and
Lin-7C or Scribble, suggesting that the interaction of SAPK3 with these proteins was
dependent on the C-terminal tail (Figure 6.3).
As verified by sequencing, at least two independent clones of each of the
PDZ domain-containing proteins, Scribble and Lin-7C were identified, and these are
illustrated in Figure 6.4. After sequencing 40 positives in the secondary screen, it was
clear that Scribble was being most frequently isolated. Due to this high percentage of
Scribble clones isolated in the screen, a colony screen PCR procedure was optimised
using Scribble-specific primers (Appendix I). Colony screen PCR was then carried out
on all clones isolated from yeast cells to identify Scribble clones and eliminate these
from subsequent lacZ and HIS3 reporter assays. This reduced the number of clones that
107
Table 6.1: Summary of SAPK3 interacting clones isolated using yeast two-hybrid analysis
Number of Primary Positive Clones Isolated (HIS3 and lacZ reporter activation)
420
Number of Secondary Positive Clones Isolated(HIS3 and lacZ reporter activation)
148
Number of Secondary Positive Clones Identified as Scribble (NP_598850)
131
Number of Secondary Positive Clones Identified as Lin-7C (NP_035829)
17
107a
A
HIS 3
Scribble
Lin 7C
“Bait”: SAPK3 ARL6 Lamin A SAPK3(∆5C)
B
“Bait”: SAPK3 ARL6 Lamin A SAPK3(∆5C)
Scribble
Lin 7C
Lac Z
Figure 6.3: The identification of Scribble and Lin7C as SAPK3-interacting proteins by yeast two-hybrid screening.Tentatively positive clones from large scale yeast two-hybrid screening were rescued into E.coli and transformed into the S. cerevisiae L40 strain. These were then tested for interaction with LexA-SAPK3, by assaying the activity of the lacZ (A) and HIS3 (B) reporter genes. As a control, the interaction of tentatively positive library clones with LexA-ARL6 and LexA-Lamin A was assessed. Proteins that showed activation of the reporter genes when tested against LexA-SAPK3, but not LexA-ARL6 and LexA-Lamin A, were considered to be “true positives”. To determine whether the interaction of SAPK3 with Lin7C and Scribble was dependent on the C-terminal tail of SAPK3, interaction was also measured against LexA-SAPK3 that was missing the last 5 C-terminal amino acids (SAPK3∆5C).
107b
A
(i)
(ii)
(iii)
B
(i)
800740
LRR
28 450 845 935 988 1061 117710841 1665
944267 LRR
712 898
1 197L27
13 68 91 173
PDZ1
PDZ1
PDZ1
PDZ2
PDZ2
PDZ2
PDZ3 PDZ4
107c
PDZ
1 194L27
13 68 91 173
PDZ(ii)
L277 1PDZ(iii) 86Figure 6.4: Scribble and Lin7C clones isolated in yeast two-hybrid screening.Schematic diagrams are shown to illustrate the full-length Scribble (A i) and Lin-7C (B i) proteins, as well as the different Scribble (A ii, iii) and Lin7C (B ii, iii) clones isolated from yeast two-hybrid screening. The identity of these clones was determined by DNA sequencing.
needed to be analysed for lacZ and HIS3 reporter gene activity, and allowed the potential
identification of other SAPK3 interacting proteins. Ultimately, Scribble clones isolated
comprised 89% of the total number of true positives, and Lin-7C made up the other
11%. No other proteins were identified.
Analysis of the full-length Scribble and Lin-7C protein sequences showed
that they both contained Class I PDZ domains. Scribble contained 4 PDZ domains and
Lin-7C contained only 1. The clones identified in the yeast two-hybrid screen each
contained at least one of these domains. This is consistent with a previous report
showing that SAPK3 interacts with Class I PDZ domains (Hasegawa et al., 1999). Class
I PDZ domains interact with the consensus sequence of (Ser/Thr)-Xaa-
(Val/Iso/Leu/Ala)-COOH at the C-terminus of their protein ligands (Songyang et al.,
1997; Kornau et al., 1995), and this is consistent with the C-terminal sequence of the rat
SAPK3 protein used: Thr-Ala-Leu-COOH.
Previous reports have shown Lin-7C to localise at cell-cell junctions (Irie et
al., 1999; Yamamoto et al., 2002). One study has also examined the expression of Lin-
7C within different tissues, finding that the mRNA is ubiquitously expressed, however
the protein is only expressed in a select number of tissues (Irie et al., 1999).
Specifically, Lin-7C was expressed at high levels in the brain, kidney and liver, low
levels of the protein were detected in spleen and lung, and no Lin-7C was detected in
heart, testis or skeletal muscle (Irie et al., 1999). Comparing the characteristics of Lin-
7C to that of SAPK3 expression and localisation presented in Chapters 3 and 4, it
appeared unlikely that these two proteins could be physiological binding partners.
A large proportion of clones isolated in the yeast two-hybrid screen were
identified as Scribble (Table 6.1). The Drosophila homologue of Scribble has been
relatively well-characterised in comparison to the mammalian protein. At the time of
commencing work on this part of the project, it was known that Scribble co-localised at
epithelial cell junctions in Drosophila (Bilder and Perrimon, 2000), however little was
known about the subcellular localisation or tissue distribution of mammalian Scribble.
108
The access to a specific anti-Scribble monoclonal antibody, as well as the relatively
limited knowledge on this protein meant that further investigation was required to
determine whether Scribble was a possible SAPK3 binding partner.
To determine whether Scribble was a potential physiological binding
partner of SAPK3, the expression of Scribble was examined in a variety of different
mouse tissues using a specific Scribble monoclonal antibody (Figure 6.5A). It was
shown in Chapter 4 that SAPK3 was expressed in a number of different tissues, with
highest expression levels in skeletal muscle, heart, lung and testes. This Western blot is
shown again for reference in Figure 6.5B. By immunoblotting these tissues with the
Scribble antibody, Scribble was found to be expressed at its highest levels in thymus.
Immunoreactivity was also found in spleen, kidney, liver and brain. However, very little
immunoreactivity was detectable in heart, skeletal muscle, or testes. Therefore, the
tissue distribution pattern of Scribble appeared to differ from that of SAPK3.
Scribble is expressed highly in epithelial cells, where it is involved in the
regulation of cell polarity (Bilder and Perrimon, 2000). Due to the high level of Scribble
expression in Madin-Darby canine kidney (MDCK) epithelial cells (P. Humbert,
personal communication), the subcellular localisation of Scribble in these cells was
determined. First, expression of Scribble in MDCK cells was confirmed with the
Scribble antibody, by immunoblotting lysates from MDCK cells prepared under the
conditions used previously for cell and tissue samples (Fig 6.6A). When these cells
were stained with the Scribble antibody and analysed with confocal microscopy,
Scribble staining appeared at the edges of these cells and was consistent with a plasma
membrane localisation (Figure 6.6Bii). This did not co-localise with SAPK3 staining
(Figure 6.6Biii). Indeed, it was shown in Chapter 3 that SAPK3 co-localised with
mitochondria in cardiac myocytes and in HEK293 fibroblasts. As seen in Figure 6.6B,
when using the SAPK3 antibody and Mitotracker, SAPK3 also demonstrated a
mitochondrial localisation pattern in MDCK cells (Figure 6.6Bvi). Thus, it appears that
Scribble and SAPK3 do not share the same tissue distribution (Figure 6.5) or localisation
in cells (Figure 6.6) and are unlikely to be physiological binding partners.
109
A α-Scribble
H Skm B Li Lu Th Te S K
Scribble220 kDa
B α-SAPK3
H Skm B Li Lu Th Te S K
SAPK346 kDa
CCoomassie
H Skm B Li Lu Th Te S K
220 kDa
97.5 kDa66 kDa
45 kDa
30 kDa
Figure 6.5: The expression of Scribble in adult mouse tissues.Mouse tissues were crushed under liquid nitrogen and lysed. Protein lysates (30 µg) were then subjected to Western blotting using the anti-Scribble antibody (A) or anti-SAPK3 antibody (B). A Coomassie stained gel is shown to illustrate relatively even loading of samples (C). Western blotting results are representative of at least 2 independent experiments.Abbreviations: H = Heart; Skm = Skeletal Muscle; B = Brain; Li = Liver; Lu = Lung; Th = Thymus; Te = Testes; S = Spleen; K = Kidney.
109a
A
220 kDa Scribbleα-Scribble
B
Anti-SAPK3 Anti-Scribble Overlayi ii iii
OverlayAnti-SAPK3 Mitotracker
Figure 6.6: Determining the localisation of SAPK3 and Scribble in MDCK cells.(A) MDCK cells were seeded into dishes and grown for 2 days before lysis. Protein (30 µg) was then separated by SDS-PAGE and subjected to Western blotting using a specific Scribble monoclonal antibody. (B) MDCK cells were seeded into dishes on coverslips and treated with Mitotrackerfor 45 min (v) or left untreated, then stained with the SAPK3 antibody (i, iv), or Scribble antibody (ii). Panels (iii) and (vi) show an overlay of panels (i) and (ii) or (iv) and (v), respectively, and Hoescht 33258 staining is also shown to visualise the cell nuclei. Arrows show Scribble staining at the cell edges. Yellow staining indicates where SAPK3 and Mitotracker co-localise. Results shown are representative of 2 independent experiments. Scale bar = 20 µm.
iv v vi
109b
6.2.3 SAPK3 interacts with the mitochondrial outer membrane protein, OMP25
An alternative use of the yeast two-hybrid system is to test directly the
interaction between two known proteins rather than use it as a library screening tool.
Due to the mitochondrial localisation of SAPK3, the literature was surveyed for PDZ
domain-containing proteins localised at the mitochondria. A protein was identified
called “Outer Mitochondrial Protein 25” (OMP25) (Nemoto and De Camilli, 1999);
Figure 6.7). OMP25 mRNA is expressed in a variety of tissues, with highest levels of
expression reported for skeletal muscle (Nemoto and De Camilli, 1999). The OMP25
protein is inserted into the outer mitochondrial membrane, with its PDZ domain facing
the intracellular environment, allowing its interaction with cytosolic proteins containing
PDZ domain-binding motifs (Nemoto and De Camilli, 1999). This suggests that
OMP25 can perform an “anchoring” function by holding specific proteins at the
mitochondria. Consistent with this role, OMP25 has previously been found to associate
with the inositol phosphatase Synaptojanin 2A, localising this protein to the
mitochondria (Nemoto and De Camilli, 1999).
A mammalian expression vector, encoding full-length OMP25 fused to a
HA tag at the N-terminus, was obtained (Nemoto and De Camilli, 1999) and used to
transfect into HEK293 fibroblasts. Cells were lysed following varying times of
transfection, and the lysates subjected to Western blotting with an antibody against the
HA tag. As seen in Figure 6.8A, the expression of HA-OMP25 could be detected 22, 30
or 46 hours following transfection. To determine the optimal amount of HA-OMP25
DNA for transfection, 0 – 1.2 µg DNA was transfected into HEK293 fibroblasts, and the
cells lysed after 40 hours. These lysates were then subjected to Western blotting with
the HA antibody. As shown in Figure 6.8B, the expression of HA-OMP25 could be
detected when as little as 0.4 µg DNA was introduced into the cells, and the expression
of HA-OMP25 increased following transfection with more DNA (0.6 or 1.2 µg).
110
Amphipathic helix PDZ domain TM1 73 160 178 200 206
Amino acid residue
2.64
-3.04
0
20 40 60 80 100 120 140 160 180 200
hydr
ophi
licity
From Nemoto and De Camilli; EMBO J; 18: 2991-3006 (1999)
Figure 6.7: Schematic diagram of Outer Membrane Protein 25 (OMP25).A schematic representation of the rat OMP25 domain structure, and a hydrophilicity plot are shown. OMP25 contains a transmembrane domain (aa 178-200) which allows the protein to be inserted into the outer mitochondrial membrane. OMP25 is orientated with the PDZ domain facing the intracellular environment (Nemoto and De Camilli, 1999).
110a
A
45 kDa
30 kDa
66 kDa97.5 kDa
20.1 kDa
HA-OMP25
HA-OMP25 Transfection: - + + + + -Time of expression (hours): 8 8 22 30 46 46
α-HA
B
Amount of HA-OMP25 DNA (µg): 0 0.1 0.2 0.4 0.6 1.2
45 kDa
30 kDa
66 kDa97.5 kDa
20.1 kDa
HA-OMP25
α-HA
Figure 6.8: Overexpression of HA-OMP25 in HEK293 fibroblasts.(A) HEK293 fibroblasts were transfected with 0.6 µg HA-OMP25 DNA and 0.6 µg Bluescript DNA, and allowed to express the protein for 8 – 46 hours. The cells were then lysed, and protein separated by SDS-PAGE. Western blotting was then performed using a HA antibody. (B) HEK293 fibroblasts were transfected with 0 – 1.2 µg HA-OMP25 DNA, in conjunction with Bluescript DNA or alone, and allowed to express the protein for 40 hours. The cells were then lysed, and protein separated by SDS-PAGE. Western blotting was then performed using a HA antibody.In both panels, high molecular weight proteins (indicated by open arrows) cross-reacted with the HA antibody.
110b
OMP25 has previously been shown to be localised at the outer
mitochondrial membrane, by immunofluorescence, proteinase K treatment and alkali
carbonate treatment (Nemoto and De Camilli, 1999). To confirm the co-localisation of
OMP25 with SAPK3 at the mitochondria, HEK293 fibroblasts were transfected with
HA-OMP25 and allowed to express the protein for 40 hours. Cells were then fixed,
permeabilised and stained with HA and SAPK3 antibodies. As shown in Figure 6.9,
non-transfected cells showed typical punctate staining for endogenous SAPK3 and no
staining for HA-OMP25. However, in cells overexpressing HA-OMP25, intense
staining with the HA antibody and coalescence of the mitochondria was observed, which
is consistent with a previous report (Nemoto and De Camilli, 1999). In these cells, co-
localisation of endogenous SAPK3 with the transfected, overexpressed HA-OMP25 was
visualised (Figure 6.9C).
To determine whether SAPK3 interacted with OMP25, yeast two-hybrid
analysis was used. The binding of these two proteins was assessed using a truncation
mutant of OMP25, consisting of amino acids 37 – 177 (OMP25(37-177)). This
truncation mutant allowed the assessment of SAPK3 binding to the OMP25 PDZ
domain, and also removed the outer mitochondrial transmembrane domain of OMP25, at
the C-terminal end of the protein. This has been previously shown to be required for
targeting of OMP25 to the mitochondria (Nemoto and De Camilli, 1999). Therefore the
presence of this targeting domain in OMP25 may compromise the yeast two-hybrid
system, where proteins must be nuclear for an interaction to be detected because the
reporter system is based on transcription which can only occur in the nucleus. It was
found that OMP25(37-177) interacted with SAPK3, by the activation of the HIS3 and
lacZ reporters, but did not interact with the negative control proteins ARL6 or Lamin A
(Figure 6.10). Deletion of the last five amino acids of SAPK3 in the SAPK3∆5C mutant
abolished the interaction between OMP25 and SAPK3 (Figure 6.10). This suggested
that the interaction was dependent on the C-terminal tail of SAPK3, consistent with an
interaction of this sequence with the PDZ domain of OMP25.
111
Anti-HA (OMP25)
A
Anti-SAPK3
B
Overlay
C
Figure 6.9: Confirmation of OMP25 and SAPK3 co-localisation.293 cells were transfected with HA-OMP25 and allowed to express the protein for 40 hours. Cells were then fixed, permeabilised and stained with HA (A) and SAPK3 (B) antibodies. Panel C shows an overlay of Panels A and B, and Hoescht 33258 staining is included to visualise the cell nuclei. Results shown are representative of 2 identical experiments. Scale bar = 18 µm.
111a
A“Bait”: SAPK3 ARL6 Lamin A SAPK3∆5C
OMP25(37-177)
HIS 3
B“Bait”: SAPK3 ARL6 Lamin A SAPK3∆5C
OMP25(37-177) lacZ
Figure 6.10: Interaction of SAPK3 with OMP25 detected by yeast two-hybrid analysis.VP16-OMP25 DNA was transformed into yeast and tested for interaction with LexA-SAPK3. This was assessed using the activation of the HIS3 (A) or lacZ (B) reporters as indicators. As negative controls, the interaction of VP16-OMP25 was determined towards LexA-ARL6 and LexA-lamin. VP16-OMP25 was also tested for interaction with the C-terminal truncation mutant of SAPK3 (SAPK3∆5C).
111b
To further investigate the interaction between these proteins, a co-
immunoprecipitation of HA-OMP25 and Myc-SAPK3 was performed. HEK293
fibroblasts were transfected with HA-OMP25 and Myc-SAPK3. The HA monoclonal
antibody was then used to immunoprecipitate HA-OMP25 from cell lysates, and
Western blotting was performed using the specific SAPK3 monoclonal antibody. As
seen in Figure 6.11, when HA antibody was added to the lysate, SAPK3 was isolated in
the immunoprecipitation. No SAPK3 was detected when HA antibody was omitted
from the procedure. This suggested that OMP25 and SAPK3 could interact in cells.
Due to the migration of OMP25 on SDS-PAGE at the same size as light chain
immunoglobulin, it was not possible to perform an immuoprecipitation with Myc
antibody and probe for HA-OMP25 using the HA antibody.
It was found that SAPK3 and OMP25 co-localise at the mitochondria using
immunofluorescence, and that these proteins can interact by co-immunoprecipitation and
yeast two-hybrid analysis. To determine whether OMP25 could alter the subcellular
localisation of SAPK3, a truncation mutant of HA-OMP25 was made, introducing a stop
codon immediately upstream of amino acid 178. OMP25 lacking the transmembrane
segment (amino acids 178-200) has previously been shown to be distributed throughout
the cytosol, rather than at the mitochondria (Nemoto and De Camilli, 1999). Following
this, using PCR, a nuclear localisation signal (Sequence: Pro-Pro-Lys-Lys-Lys-Arg-Lys-
Val-Ala) (Junqueira et al., 2003) was introduced immediately upstream of the OMP25
sequence (following the HA epitope tag), to direct the protein into the nucleus (HA-
OMP25(NLS)). It was proposed that HA-OMP25(NLS) would bind to SAPK3 and that
this protein complex could then localise to the nucleus.
To determine whether HA-OMP25(NLS) could alter the localisation of
overexpressed SAPK3, cells were transfected with HA-OMP25(NLS) and Myc-tagged
SAPK3, and allowed to express the proteins for 40 hours. Cells were then fixed,
permeabilised and stained with SAPK3 and HA antibodies. Myc antibody could not be
used to detect SAPK3-transfected cells because both the HA and Myc antibodies were
raised in mice, and so could not be detected simultaneously with immunostaining.
112
+α-HA
-α-HA
HA Abonly
45 kDa
30 kDa
Myc-SAPK3IgG HC
IgG LC
Figure 6.11: SAPK3 and OMP25 are co-immunoprecipitated from cells.HEK293 fibroblasts were transfected with myc-tagged SAPK3 and HA-tagged OMP25 and allowed to express the proteins for 24 hours. The cells were then lysed, and protein lysates incubated with HA antibody (right panel), or no antibody (left panel) overnight. The following day, immunoprecipitated proteins were captured on Protein G sepharose and subjected to Western blotting with the SAPK3 antibody. HA antibody (5 µg) was also subjected to Western blotting (middle panel) to show the position of the immunoglobulin heavy and light chains. Results shown are representative of at least 4 independent experiments.IgG HC = Immunoglobulin Heavy Chain; IgG LC = Immunoglobulin Light Chain.
112a
However, the limit of detection for overexpressed SAPK3 was much lower than that for
endogenous SAPK3 using the confocal microscope, and thus the staining represents the
overexpressed protein only. As shown in Figure 6.12A, when compared to cells
transfected with Myc-SAPK3 only, some cells expressing HA-OMP25 and Myc-SAPK3
showed increased nuclear accumulation of SAPK3. This suggested that HA-
OMP25(NLS) could be binding to SAPK3 and altering its subcellular localisation in
some instances. However, not all SAPK3 in HA-OMP25(NLS) overexpressing cells
was moved to the nucleus, with cytoplasmic staining of this overexpressed protein
remaining visible (Figure 6.12Aiii).
To determine whether OMP25(NLS) could alter the subcellular
localisation of endogenous SAPK3, cells were transfected with HA-OMP25(NLS),
allowed to express the protein for 40 hours, then fixed, permeablised and stained with
SAPK3 and HA antibodies. As shown in Figure 6.12B, no difference was seen in
endogenous SAPK3 distribution when cells were transfected with HA-OMP25(NLS)
(white arrows), compared to non-transfected cells. Nuclear localisation of HA-
OMP25(NLS) was confirmed by staining the cells with Hoescht 33258. This suggested
that HA-OMP25(NLS) could not alter the subcellular localisation of endogenous
SAPK3.
6.2.4 OMP25 can act as an inhibitor of SAPK3 in vitro
To further characterise the interaction of these proteins, OMP25 was cloned
into the pGEX-6P vector, to allow expression of the protein in bacteria. Full-length
OMP25 was poorly expressed in bacteria, as determined by Bradford protein assay and
SDS-PAGE (Figure 6.13). This was presumably due to the hydrophobicity of the
transmembrane segment, and therefore a truncation mutant of the OMP25 protein was
made by introducing a stop codon immediately upstream of amino acid 178 (GST-
OMP25(1-177)). This truncation mutant was expressed at a higher level in bacteria
(Figure 6.13). Examination of the OMP25 sequence showed that this protein contains
no serines or threonines that are directly followed by a proline (the minimum consensus
113
AOverlayAnti-SAPK3 Anti-HA
Anti-SAPK3 Anti-HA Overlay
Anti-HAHoescht 33258 Overlay
Figure 6.12: Using HA-OMP25(NLS) to alter the subcellular localisation of SAPK3.(A) HEK293 fibroblasts were transfected with 0.05 µg Myc-SAPK3 and 2 µg HA-OMP25(NLS) and allowed to express the proteins for 40 hours. Cells were then fixed, permeabilised and stained with SAPK3 (i) or HA (ii, v) antibodies. Cells were also stained with Hoescht 33258 to visualise the nuclei (iv). Panels (iii) and (vi) show an overlay of panels (i) and (ii) or (iv) and (v), respectively. White arrows indicate cells that are overexpressing SAPK3. Results shown are representative of 2 independent experiments. Scale bar = 20 µm.(B) HEK293 fibroblasts were transfected with 2 µg HA-OMP25(NLS) and allowed to express the protein for 40 hours. Cells were then fixed, permeabilised and stained with SAPK3 (i) or HA (ii, v) antibodies. Cells were also stained with Hoescht 33258 to visualise the nuclei (iv). Panels (iii) and (vi) show an overlay of panels (i) and (ii) or (iv) and (v), respectively. Results shown are representative of 2 independent experiments. Scale bar = 20 µm.
i
iv
B
v
ii
vi
iii
iiii ii
Hoescht 33258 Anti-HA Overlayviiv v
113a
A“OMP SDM Reverse”: 3’ CTG CCT CTC GGC ACT CCT CAA GGA CAT CGA C 5’
5’….CGA GGC GAC GGA GAG CCG AGT GGA GTT CCT GTA GCT GTG GTG……3’3’….GCT CCG CTG CCT CTC GGC TCA CCT CAA GGA CAT CGA CAC CAC……5’
“OMP SDM Forward”: 5’ GAC GGA GAG CCG TGA GGA GTT CCT GTA GCT G 3’
BGST-OMP25 GST-OMP25
(1-177) (wild-type)
GST-OMP25 (wild-type)GST-OMP25(1-177)45 kDa
66 kDa
Figure 6.13: The expression of GST-OMP25 in bacteria.(A) “OMP SDM Forward” and “OMP SDM Reverse” primers were used tointroduce a mutation into the OMP25 full-length sequence at the position coding for amino acid 178. This mutation (area shown in red) altered the wild-type amino acid sequence at position 178 from a Ser residue (AGT) to a “STOP” codon (TGA), therefore resulting in a truncated OMP25 product at amino acid 177.(B) Full-length OMP25 was subcloned into the pGEX-6P vector and expressed in BL21plyss cells, as described in Chapter 2. In addition, site-directed mutagenesis was used to introduce a stop codon at position 178 in the OMP25 protein (OMP25(1-177)). This truncated protein was also expressed in BL21plyss cells. The purified proteins were then run on SDS-PAGE, and the gel stained with Coomassie Brilliant Blue.
113b
sequence required for phosphorylation of a substrate by a member of the MAPK family
(Clark-Lewis et al., 1991)). However, to ascertain that OMP25 was not a substrate of
SAPK3, in vitro kinase assays were performed with activated GST-SAPK3 and GST-
OMP25. As seen in Figure 6.14, GST-OMP25 was not phosphorylated by active GST-
SAPK3, whereas GST-α1-Syntrophin was phosphorylated to a high extent under the
same conditions.
Since OMP25 contains a PDZ domain which appears to bind SAPK3 with
high affinity but that it cannot itself be phosphorylated, it was proposed that GST-
OMP25 may interact with SAPK3 and inhibit the interaction of GST-SAPK3 with its
PDZ domain-containing substrates. To investigate this, active GST-SAPK3 was pre-
incubated with GST-OMP25(1-177), then subjected to in vitro kinase assays with GST-
Sab and GST-α1-Syntrophin (Hasegawa et al., 1999). As shown in Figure 6.15, 1 µg
GST-OMP25 inhibited the phosphorylation of 5 µg GST-α1-Syntrophin and GST-Sab
by GST-SAPK3, by approximately 40%. This increased to approximately 60%
inhibition when 5 µg GST-OMP25 was used, and 90% when 10 µg was used. This
suggests that OMP25 can act as an inhibitor of SAPK3. Furthermore, this inhibition
appears to be independent of whether or not the SAPK3 substrate contains a PDZ
domain.
6.3 Discussion
Many kinase signalling pathways contain proteins that do not directly
signal themselves, but that have anchoring or scaffolding roles, thereby placing the
kinase or substrate in the correct location to enhance signalling events. These anchoring
or scaffolding interactions involve a variety of different protein domains, such as the
SH2 or SH3 domains, PDZ domains, or Phosphotyrosine domains (Pawson and Nash,
2003). An example of an anchoring role is seen in the effective signalling by Protein
Kinase C-alpha (PKCα) being dependent on an interaction with the PDZ domain of
PICK1 (Wang et al., 2003b). PKCα is targeted to the mitochondria in response to serum
stimulation and is anchored at this organelle through a PDZ domain-mediated interaction
114
45 kDa
66 kDa
97 kDa
30 kDa
MalE-MKK6(DD): + + + GST-SAPK3: + + + GST substrate: - α1-Syn OMP25
(1-177)
Autoradiograph
GST-α1-Syntrophin
GST-OMP25(1-177)
45 kDa
66 kDa
97 kDa
30 kDa
GST-α1-Syntrophin
GST-OMP25(1-177)
Coomassie
Figure 6.14: OMP25 is not a substrate of SAPK3 in vitro.GST-SAPK3 was activated by MalE-MKK6(DD) and subjected to kinase assays with GST-α1-Syntrophin or GST-OMP25(1-177). An autoradiograph of a representative gel from one of 2 identical experiments is shown after 1 hour exposure. The lower panel shows the Coomassie-stained gel to illustrate even loading of GST substrates.
114a
MalE-MKK6(DD): + + + + + + + +GST-SAPK3: + + + + + + + +GST substrate: Sab α1-SyntrophinGST-OMP25(1-177)(µg): 0 1 5 10 0 1 5 10
GST-α1-Syntrophin
GST-Sab
GST-OMP25(1-177)
GST-α1-Syntrophin
GST-Sab
45 kDa
66 kDa
97 kDa
45 kDa
66 kDa
97 kDa
Autoradiograph
Coomassie
GST-SabGST-α1-Syntrophin
Phos
phor
ylat
ion
of G
ST s
ubst
rate
(%
com
pare
d to
no
GST
-OM
P25)
(* p<0.01 compared to no GST-OMP25)
**
** * *
0
20
40
60
80
100
120
0 µg 1 µg 5 µg 10 µgGST-OMP25:
Figure 6.15: GST-OMP25 inhibits the phosphorylation of GST-Sab and GST-α1-Syntrophin by SAPK3 in vitro.GST-SAPK3 was activated by MalE-MKK6(DD) and pre-incubated with GST-OMP25(1-177) (0 – 10 µg) for 15 min, before being subjected to kinase assays with GST-Sab or GST-α1-Syntrophin. An autoradiograph of a representative gel is shown in the top panel, and the middle panel shows the Coomassie-stained gel to illustrate even loading of GST-Sab and GST-α1-Syntrophin, as well as the increasing amount of GST-OMP25 in each assay. The levels of GST-SAPK3 and MalE-MKK6(DD) are below the level of detection for Coomassie staining. The bottom panel shows the quantitation of 3 assays as determined by Cerenkov counting of the GST-Sab or GST α1-syntrophin bands. The open arrows indicate GST-α1-Syntrophin degradation products. The results are shown as means ± SE. * p<0.01 compared to samples where no GST-OMP25 was added.
114b
with PICK1 (Wang et al., 2003b). An example of a scaffolding protein involved in
signalling pathways is JNK Interacting Protein-1 (JIP-1), which specifically binds to
components of the JNK MAPK signalling cascade including JNK, MKK7, and mixed-
lineage kinase 3 (MLK3) (Whitmarsh et al., 1998). It has been suggested that JIP-1
mediates activation of the JNK pathway by bringing these proteins into close proximity
to each other (Whitmarsh et al., 1998).
The identification of SAPK3 mitochondrial localisation, and the ability of
SAPK3 to phosphorylate mitochondrial targets, prompted the search for binding partners
that may be responsible for “anchoring” SAPK3 at the mitochondria. In this Chapter,
the yeast two-hybrid system was used as a method to identify SAPK3 binding partners.
The PDZ domain proteins Lin-7C and Scribble were isolated as binding partners of
SAPK3 using this screen. The isolation of two PDZ domain-containing proteins as
binding partners in this screen suggests that SAPK3 interactions in the cell may be
dominated by these domains.
The high percentage of Scribble clones isolated in the yeast two-hybrid
screen (Table 6.1) implied that Scribble could be a physiologically relevant SAPK3
binding partner. However, it cannot be ruled out that Scribble is highly represented
within this particular cDNA library prepared from the lymphohematopoietic progenitor
cell line EML Clone.1, which would bias this screen. The apparently large proportion of
plasma membrane PDZ proteins compared to those located at intracellular organelles
(Fanning and Anderson, 1999) would also create a library bias. Further screening
attempts using different sources of libraries such as heart or skeletal muscle may be
required to identify other SAPK3 binding partners. However at this stage it cannot be
completely discounted that SAPK3 and Scribble interact with each other in certain
circumstances, such as following the exposure of cells to certain stimuli, or in cell types
in which SAPK3 has not yet been studied. It should be noted for example, that punctate
Scribble staining has been observed in Drosophila, which was thought to be reminiscent
of vesicles (Bilder and Perrimon, 2000). However, the localisation or translocation of
115
overexpressed or endogenous SAPK3 to the plasma membrane has not yet been
reported.
Because the library screen failed to isolate mitochondrial PDZ domain-
containing proteins, a direct assessment of binding between SAPK3 and OMP25 was
undertaken (Figure 6.10 and 6.11). Since OMP25 was shown to bind SAPK3, the
question arises as to why OMP25 was not isolated in the original yeast two-hybrid
screen. There are several possible reasons for this. Firstly, the expression of OMP25 in
the EML Clone.1 library has not been determined. Further screening attempts with a
skeletal muscle library, the tissue in which SAPK3 and OMP25 are most highly
expressed (Chapter 4) (Mertens et al., 1996; Nemoto and De Camilli, 1999), could
possibly isolate OMP25 as a SAPK3 binding protein. Another possible reason for not
originally isolating OMP25 in this screen could be that as mentioned earlier, most PDZ
domain-containing proteins are localised to the cell membrane (Fanning and Anderson,
1999), and therefore those localised to intracellular organelles such as the mitochondria
would be less prominent in the library. Thirdly, the mitochondrial targeting sequence of
OMP25 could prevent it from being transported into the nucleus to activate the
transcription of the reporter genes. Although the pVP16 vector contains a nuclear
localisation signal, it is not known whether this NLS could “out-compete” the
mitochondrial localisation signal of OMP25.
It may be useful to perform a yeast two-hybrid screen using mutants of
SAPK3 to isolate different binding partners or substrates. For example, SAPK3(1-363)
could be used to screen a library, in order to identify binding partners that do not contain
PDZ domains. In order to bias a screen towards finding binding partners of SAPK3
rather than substrates, a kinase-dead mutant could be used. Yeast two-hybrid screens
using kinase-dead mutants have previously been reported to search for binding partners
that are not dependent on the kinase domain (Ingley et al., 2000). For example, a yeast
two-hybrid screen performed with Lyn tyrosine kinase, in parallel with LynY397F,
identified hematopoietic lineage cell-specific protein (HS1) as binding the SH3 domain
116
of Lyn (Ingley et al., 2000). HS1 bound with higher affinity to LynY397F than to wild-
type Lyn (Ingley et al., 2000).
To identify weaker and possibly transient binding partners for SAPK3 such
as those with particular substrate proteins that do not rely on PDZ domain-mediated
interactions, it may be necessary to co-transform SAPK3 into a library with
constitutively active MKK6 (Alonso et al., 2000). This would allow SAPK3 to be
phosphorylated and thus adopt an active conformation. It has been proposed that
SAPK3, in its unphosphorylated form, binds ATP poorly (Fox et al., 1999).
Furthermore, the structure of phosphorylated SAPK3 has been solved, and it has been
proposed that phosphorylated Tyr185 interacts with Arg189 and Arg192 in the
activation loop of the kinase, which unblocks the substrate binding site (Bellon et al.,
1999). Therefore, it is possible that the use of active SAPK3 to screen yeast two-hybrid
libraries may increase the likelihood of finding substrate proteins.
The results presented in this Chapter imply that OMP25 may anchor
SAPK3 at the mitochondria, and suggest a mechanism by which SAPK3 could be
brought in close proximity to potential substrates in this location. Examination of the
data presented in Figure 6.12B suggests that HA-OMP25(NLS) was unable to alter the
subcellular localisation of endogenous SAPK3. It is possible that endogenous SAPK3,
already involved in a PDZ-mediated interaction with endogenous OMP25, was unable to
be released and thus remained at the mitochondria. Furthermore, when OMP25 is
overexpressed in conjunction with SAPK3 (Fig 6.12A), this may allow the newly-
translated SAPK3 to bind to OMP25.
Further studies will be required to investigate the possible interaction of
SAPK3 and OMP25 within the cell. For example, if these two proteins interact, an
OMP25 knockout would be expected to show disruptions in SAPK3 mitochondrial
localisation. For example, the proteins nNOS, CAPON and Synapsin I have previously
been found to co-localise in synaptic vesicles in the mouse brain, where they are thought
to form a ternary complex (Jaffrey et al., 2002). In Synapsin I/II double knockout mice,
117
alterations in nNOS and CAPON subcellular localisation are seen (Jaffrey et al., 2002).
As an alternative to gene knockout studies, RNA interference to knock down OMP25
protein production could also be useful.
OMP25 has previously been shown to anchor Synaptojanin 2A at the
mitochondria (Nemoto and De Camilli, 1999). Due to the presence of only one PDZ
domain in the OMP25 protein, binding of proteins to the OMP25 PDZ domain would be
mutually exclusive, since only one C-terminal tail can bind to one PDZ domain at any
time (Doyle et al., 1996). Therefore, if one isoform of OMP25 binds to Synaptojanin 2A
and SAPK3 in vivo, a 1:1 ratio of OMP25 to the cumulative total of binding partners
could exist in the cell. This would involve regulated expression of OMP25 and the
anchored proteins. Alternatively, it is possible that different isoforms of OMP25 anchor
different proteins. It has been suggested that several different isoforms of OMP25 exist
(Nemoto and De Camilli, 1999). The SAPK3 C-terminal tail has the sequence of: Lys-
Glu-Thr-Xaa-Leu-COOH, whereas Synaptojanin 2A has the C-terminal tail of: Ser-Gly-
Ser-Ser-Val-COOH (Nemoto and De Camilli, 1999). Only one OMP25 isoform has
been tested for binding to Synaptojanin 2A and SAPK3. However, it is possible that
different isoforms of OMP25 may bind with different affinities to Synaptojanin 2A and
SAPK3 based on their C-terminal tails.
Several different classes of PDZ domains have been defined, based on the
C-terminal or internal hairpin-forming PDZ domain recognition motifs of their binding
partners (Songyang et al., 1997; Hung and Sheng, 2002). Several reports have examined
the binding specificities of PDZ domains (Fuh et al., 2000; Doyle et al., 1996; Skelton et
al., 2003; Songyang et al., 1997). It has been found that adjustment of single amino
acids in PDZ domain binding motifs can greatly alter binding affinities (Gee et al., 2000;
Skelton et al., 2003). Further characterisation of the binding specificity of PDZ domains
for their ligands may help to distinguish physiological versus artefactual binding
partners in the cell.
118
In this Chapter, it was found that OMP25 can act as an inhibitor of SAPK3
in vitro (Figure 6.15). This suggests that within the cell, if OMP25 anchors SAPK3 to
the cell mitochondria, it may act as a mechanism for keeping SAPK3 “inactive”, thus
preventing unwanted signalling events. Further studies will be required to identify
whether these proteins associate in vivo, and if so, to determine the mechanism by which
SAPK3 is released from the PDZ domain-mediated interaction. The identification of a
PDZ domain having a negative effect on substrate phosphorylation by SAPK3 suggests
that the structure of these domains could be used as a basis to design inhibitors
specifically targeting this kinase. The development of such inhibitors would go a long
way in assisting the search for in vivo SAPK3 substrates.
119
Chapter 7
General Discussion
7.1 General Discussion
The p38 MAPK family has four members – SAPK2a, SAPK2b, SAPK3
and SAPK4. Although studies evaluating the function of SAPK2a and SAPK2b have
been facilitated by the use of ATP-competitive inhibitors such as SB203580 (Cuenda et
al., 1995), no specific small molecule inhibitors of SAPK3 and SAPK4 have been
described. Thus, elucidating the functions of SAPK3 and SAPK4 has proved to be a
more challenging task (Cohen, 1997). At the commencement of this project, little was
known about the role of SAPK3 in any tissues. Specifically, most studies had used
overexpression of the protein kinase in cultured cell lines to evaluate its activation,
substrate specificity and subcellular localisation (Cuenda et al., 1997; Marinissen et al.,
2001). However, the overexpression of protein kinases can lead to spurious effects
(Liang and Molkentin, 2003; Cohen, 1997), and therefore it remains important to
investigate the features of endogenously-expressed protein kinases. The aims of this
study therefore, were to investigate the subcellular localisation, expression patterns,
substrate specificity and binding partners of SAPK3. In this way a better understanding
of the function that this protein kinase plays within the cell could be achieved.
7.1.1 Evaluating the expression and subcellular localisation of SAPK3 in cultured
cells
In Chapter 3, a SAPK3 monoclonal antibody was used to show that SAPK3
was expressed in the HEK293 cell line, as well as primary cultures of rat cardiac
myocytes. Using this antibody in immunostaining showed SAPK3 colocalisation with
the mitochondria (Chapter 3). Although the specificity of this antibody was assessed by
several means including Western blotting, screening a cDNA library for SAPK3 clones,
and pre-adsorption with recombinant SAPK3 before immunostaining to show a
reduction in staining, further studies will be required to show unequivocally that this
antibody only recognises SAPK3 in all protocols. For example, tissues from a SAPK3
knockout mouse could be analysed by Western blotting and immunostaining to show
that immunoreactivity is no longer seen. It may be possible to perform these
120
experiments in the near future, since a SAPK3 knockout mouse has been developed (P.
Cohen and A. Cuenda, personal communication). Alternatively, RNA interference
studies to knock down SAPK3 expression in cultured cells such as those used in Chapter
3 could be employed to confirm the antibody specificity.
The co-localisation of SAPK3 with the mitochondria suggested that its
substrates may reside at this organelle. This was further supported by the observation
that the treatment of HEK293 fibroblasts with hyperosmolarity in the form of high
concentrations of sorbitol, which has previously been shown to activate overexpressed
SAPK3 in these cells (Cuenda et al., 1997), did not alter the localisation of this protein
kinase (results not shown). In future work, the expression of a constitutively-active
MKK6 mutant (Alonso et al., 2000) could be used as an alternative method to activate
SAPK3. It would then be possible to evaluate the localisation patterns of activated
SAPK3 in this situation. Alternatively, the localisation of SAPK3 substrates may be
altered in response to specific stimuli. Thus SAPK3 substrates that are predominantly in
locations such as the cell cytosol could be re-localised to the mitochondria. Once at the
mitochondria, these proteins might then be phosphorylated by SAPK3, also at this
location. An example of this movement of a protein kinase substrate rather than a
protein kinase itself comes with sorbitol treatment and the localisation of Tau that
changes from cytoskeletal to the soluble fractions of the cell (Jenkins et al., 2000). If
such changes occurred in the SAPK3 signalling pathway, these would need to be
confirmed with antibodies directed against protein substrates of SAPK3 rather than
SAPK3 itself.
The treatment of cells with the nuclear export inhibitor Leptomycin B did
not alter the localisation of SAPK3, unlike SAPK2a that was retained in the nucleus
(Figure 3.4). However, Leptomycin B only inhibits Crm-1 receptor-dependent nuclear
transport (Fukuda et al., 1997c; Fornerod et al., 1997; Ossareh-Nazari et al., 1997) and
therefore it is possible that SAPK3 could translocate between the nucleus and cytosol by
a Crm-1 receptor-independent mechanism. For example, the 45kDa form of T-cell
Protein Tyrosine Phosphatase (TCPTP), TC45, appears to be exported from the nucleus
121
via passive diffusion (Lam et al., 2001). However further evidence supports that it is
unlikely that SAPK3 translocates to the nucleus. Specifically, active SAPK3 does not
homodimerise (Bellon et al., 1999), but dimerisation is thought to be essential for
nuclear translocation of ERK (Khokhlatchev et al., 1998). If SAPK3 is to move to the
nucleus under stress conditions, it would therefore require a mechanism distinct from
that used by ERK MAPKs and likely to be Crm-1 independent.
7.1.2 SAPK3 expression in the intact heart and evaluation of its role in cardiac
development and disease
In Chapter 4, SAPK3 was shown to be expressed in the heart. This
expression was not altered during ischemic heart disease or dilated cardiomyopathy, or
during pre- and post-natal cardiac development. In addition, the activation of SAPK3 in
these samples could not be detected (Figure 4.5 and results not shown). As discussed in
previous Chapters, there are a number of possible explanations for these observations.
First this lack of detection of phospho-SAPK3 could be due to the lower expression of
SAPK3 in the heart compared to SAPK2a (Lemke et al., 2001). Therefore
phosphorylation of SAPK2a would be most easily detected under the conditions
employed in Western blotting. However it is also possible that sequence differences
between SAPK2a and SAPK3 could result in the phospho-p38 MAPK antibody showing
higher immunoreactivity with SAPK2a. The activation loop sequences of human
SAPK2a and SAPK3 are given below:
SAPK2a: GLARHTDDEMTGYVATRWYRAPE |||| | |||||| |||||||| SAPK3: GLARQADSEMTGYVVTRWYRAPE
Therefore in the 20 amino acids shown here surrounding the TGY motif in subdomain
VIII, 20% of these amino acids are not identical in both SAPK2a and SAPK3. It would
therefore be an advantage to develop an antibody that specifically recognises the
phosphorylated form of SAPK3 whilst not reacting with other p38 MAPKs. This would
entail the use of a dual-phosphorylated 23-mer peptide based specifically on the SAPK3
122
sequence with subsequent affinity purification to select for the phospho-SAPK3
sequence and to also select against the phospho-SAPK2a sequence. This antibody could
then be potentially used, for example, in samples of stressed cultured cells or heart
failure samples, or to analyse patterns of SAPK3 phosphorylation in the embryonic
mouse. These experiments would thus pinpoint the in vitro stimuli that could activate
SAPK3, whether SAPK3 activation accompanies the development of cardiovascular
disease and progression to failure, and in the case of the embryonic samples, tissues in
which SAPK3 may play a crucial signalling role in development. This latter approach
has recently been used with phospho-ERK antibodies to determine the patterns of
fibroblast growth factor (FGF)-dependent and FGF-non-dependent ERK signalling
during embryonic development (Corson et al., 2003). These immunostaining
experiments for active SAPK3 would ideally also include the use of a secondary
antibody conjugated to a fluorophore that does not show cross-reactivity with
immunoglobulins in the mouse tissues. Although colourimetric staining reactions like
that used in Figures 4.8, 4.9 and 4.10 with alkaline phosphatase are useful for
determining the overall pattern of SAPK3 distribution, they are not appropriate for
determining the subcellular localisation of proteins. This is because the coloured
precipitate formed during signal detection can diffuse away from the position of the
primary antibody and thus does not give an accurate representation of the position of the
antigen (Corson et al., 2003).
7.1.3 Determining the substrate specificity of SAPK3
The identification of protein kinase substrates remains one of the biggest
challenges in the field of cell signalling. It is essential to determine the role of each
substrate because these will be the mediators of the actions of each protein kinase within
the cell (Berwick and Tavare, 2004; Cohen, 1997). In Chapter 5, the ability of SAPK3
to phosphorylate a series of mitochondrial proteins was assessed. By using activated
SAPK3 in in vitro kinase assays, it was found that SAPK3 could phosphorylate the
mitochondrial proteins Bcl-2, Bag-1, Bim, Bad and Sab. Interestingly, all of these
proteins have been implicated in the process of apoptosis. Specifically, Bcl-2 and Bag-1
123
are anti-apoptotic proteins, whilst Bim and Bad are pro-apoptotic (Hockenbery et al.,
1990; Takayama et al., 1995; O'Connor et al., 1998; Yang et al., 1995). One report has
suggested that Sab plays an anti-apoptotic role, since the overexpression of this protein
in the DT40 chicken B lymphoma cell line slowed B cell antigen receptor apoptosis
(Yamadori et al., 1999). It remains to be determined whether this anti-apoptotic role of
Sab is modulated by its phosphorylation. Furthermore it will be important to map the
phosphorylation sites on proteins such as Bcl-2, Bag-1, Bim and Bad, and ascertain how
phosphorylation at these sites alters their functions when these proteins are
endogenously expressed.
It is interesting to note that both SAPK3 and JNK phosphorylate Sab, as
well as members of the Bcl-2 family (Chapter 5) (Wiltshire et al., 2002; Donovan et al.,
2002; Deng et al., 2001; Lei and Davis, 2003). The mitochondrial localisation of both of
these kinases suggests that they may share common targets in vivo. Indeed, several
reports have shown specific activation of SAPK3 and JNK without activation of other
MAPKs. For example, the MKKK, MRK, preferentially activates SAPK3 and JNK via
MKK3/6 and MKK4/7 respectively (Gross et al., 2002). Also, the transfection of cells
with the MKKKK, PAPK, in conjunction with members of the MAPK family leads to
the activation of SAPK3 and JNK, but not other MAPKs (Nishigaki et al., 2003).
Furthermore, marathon running transiently increased JNK and SAPK3 activity in human
skeletal muscle (Boppart et al., 2000). This suggests that JNK and SAPK3 may be
coordinately activated despite their apparent lack of common upstream activators.
Specifically JNK activation relies on activation of MKK4 and MKK7 (Derijard et al.,
1995; Yao et al., 1997), whereas SAPK3 activation relies on MKK6 and to a lesser
extent MKK3 (Cuenda et al., 1997; Enslen et al., 1998).
One future challenge will be to determine whether any of the proteins
identified in Chapter 5 are physiological substrates of SAPK3 and if so, the consequence
of this phosphorylation. As discussed in Chapter 5, the phosphorylation of Bcl-2 family
members such as Bad is complex, with phosphorylation on some sites promoting
apoptotis (Donovan et al., 2002; Konishi et al., 2002), and on others leading to an anti-
124
apoptotic response (Zha et al., 1996). Therefore, the identification of these proteins as
substrates of SAPK3 is not sufficient to implicate SAPK3 in a role for cell survival or
cell apoptosis and needs to be expanded in the future with functional studies using
phosphorylation site mutants of these proteins.
To determine whether SAPK3 is able to phosphorylate any of these
substrates in the intact cell, one approach would be to transfect cells with MKK6(DD)
and determine the effects from SAPK3 activation. The use of the SB203580 inhibitor
could then be used to prevent the subsequent activities of SAPK2a/b. However, it is still
possible that the effects seen are mediated by MKK6-activated kinases other than
SAPK3, such as SAPK4. One way to circumvent this would be to develop a specific
SAPK3 inhibitor. Alternatively, there is the possible development of a constitutively
active SAPK3 mutant. It has previously been found that mutation of Thr183 to alanine
or Tyr185 to phenylalanine in the activation loop of ERK2 abolishes kinase activity
(Robbins et al., 1993). Furthermore, mutation of these amino acids to glutamate, which
can mimic phosphorylation and thus activates some kinases, does not confer activity
(Robbins et al., 1993; Canagarajah et al., 1997; Mansour et al., 1994). However, a
genetic screen of S. cerevisiae mutants has identified a number of hyperactive mutants of
the SAPK2a homologue, Hog1 (Bell et al., 2001). Most of the mutations were found in
a domain at the C-terminal extension of the kinase known as L16 (see Figure 1.3) (Bell
et al., 2001). Furthermore, combinations of these mutations resulted in even higher
catalytic activity of Hog1 (Yaakov et al., 2003). Therefore, it is possible that similar
mutations may be able to activate other members of the MAPK family such as SAPK3.
This will require the creation of SAPK3 mutants based on these results with Hog1,
followed by extensive evaluation of their activity. Initial studies would require
assessment of their activity in vitro towards substrates such as Sab and α1-Syntrophin.
These constitutively active mutants could then be used in experiments in cells or in vivo.
An additional way to identify SAPK3 substrates would be to further define
its phosphorylation site preferences. The results presented in Chapter 5 showed that
amino acids at the +2 and +3 position of the Ser321 phosphorylation site in Sab were
125
important for recognition by SAPK3. The reduction of the Sab protein to a short peptide
encompassing this site and sequential replacement of each amino acid in this peptide
may help to further define SAPK3 substrate specificity. In several cases, peptide
substrates of MAPKs have not shown to be effective (Jacobs et al., 1999; Gavin and
Nebreda, 1999). This is thought to be a result of the lack of appropriate targeting
domains (Holland and Cooper, 1999). The sequences in Sab however may overcome
this with a short linear sequence containing both a targeting domain (KIM1) and the
phosphorylation sequence (Ser321).
Alternatively, oriented peptide libraries may be used to identify the optimal
consensus site for SAPK3 phosphorylation. This approach has been used extensively to
define the substrate specificity of kinases such as Protein Kinase A and Akt (Songyang
et al., 1994; Obata et al., 2000). However, these results must always be put into the
context of the whole protein. For example, as shown in Chapter 5, the mutation of
amino acids surrounding Ser391 in the Sab protein to those normally surrounding
Ser321 did not result in the same degree of phosphorylation as that seen with Ser321,
showing that the position of Ser321 within the Sab protein was important (Figure 5.13).
In addition, there was a requirement for the KIM1 of Sab for phosphorylation by SAPK3
(Figure 5.10).
In Chapter 5, activated SAPK3 was used in in vitro kinase assays to
directly test its phosphorylation of potential substrate proteins. Other possible in vitro
approaches also exist to identify substrates of SAPK3. For example, one group
incubated subfractionated cell extracts with [γ-32P]-ATP of high specific radioactivity,
together with activated, GST-tagged versions of SAPK2a, SAPK3 or SAPK4 (Knebel et
al., 2001). The resultant phosphorylated proteins were then identified by purification
and tryptic mass fingerprinting. This method was used to identify eukaryotic elongation
factor 2 kinase as a substrate of SAPK4 (Knebel et al., 2001). Although approaches
such as this can be used to identify MAPK substrates, eventually in vivo approaches
need to be used to confirm that these are physiological substrates. For example, within
the cell, subcellular compartmentalisation, protein phosphatases and binding proteins
126
may normally prevent certain kinase-substrate interactions from occurring (Berwick and
Tavare, 2004). One recent approach which partially overcomes this has involved
mutating a conserved bulky residue in the ATP-binding site of ERK2 to small amino
acids such as glycine and alanine, to enlarge the ATP binding pocket (Eblen et al.,
2003). This mutant was then transfected into cells, activated by EGF-stimulation, and
immunoprecipitated under non-stringent conditions to isolate any associated binding
proteins. These immunoprecipitates were then incubated with an ATP analogue with a
bulky side chain attached that could only be used by the mutant protein kinase (Eblen et
al., 2003). Proteins specifically phosphorylated by the mutant kinase could then be
identified by mass spectrometry (Eblen et al., 2003).
7.1.4 Searching for binding partners of SAPK3
In Chapter 6, it was shown that SAPK3 could bind to the PDZ domain-
containing protein OMP25, and that OMP25 could act as an inhibitor of SAPK3 activity.
Future experiments will be required with OMP25 antibodies and knockout models of
OMP25 and SAPK3 to determine whether these proteins interact in vivo. For example,
as discussed in Chapter 6, the knockdown of OMP25 would be predicted to result in the
loss of mitochondrial co-localisation of SAPK3 if OMP25 is a dominant binding partner
for SAPK3. To gain a better understanding of the interaction that occurs between
OMP25 and SAPK3, it would also be informative to co-crystallise these proteins.
Previous reports have only shown crystallisation of PDZ domains with peptide ligands,
rather than full-length proteins (Figure 1.7) (Doyle et al., 1996; Daniels et al., 1998).
This will help to decipher whether the inhibition of SAPK3 activity arises from OMP25
not only occupying the C-terminal PDZ domain binding motif (to inhibit SAPK3
phosphorylation of PDZ domain-containing substrates), but also potentially covering the
C-terminal substrate binding groove that is crucial for the binding of MAPKs to the
KIMs of their substrates (Tanoue et al., 2000).
The interaction of SAPK3 with OMP25 does raise the question: how does
SAPK3 signal within the cell if it is being kept inactive by OMP25? It would appear
127
that the release of SAPK3 from this interaction would be needed. A possible release
mechanism might include the phosphorylation of the SAPK3 C-terminal tail by another
protein kinase, to release the PDZ interaction. For example, the phosphorylation of the
-2 serine of the inward rectifier K+ channel Kir 2.3 by Protein Kinase A (PKA) prevents
its association with the PDZ domain of PSD-95 (Cohen et al., 1996). In another
example, phosphorylation of the -2 serine of the β2-adrenergic receptor by G-protein
coupled receptor kinase-5 disrupts interaction with the PDZ domain of NHERF (Cao et
al., 1999). The C-terminal sequence of SAPK3 is Lys-Glu-Thr-Xaa-Leu-COOH, where
Xaa is Ala in mouse and rat, or Pro in human. It is possible that the threonine residue at
the -2 position (Thr365) is phosphorylated and that this could release SAPK3 from a
PDZ-mediated interaction. Therefore, future work could involve mutation of this
threonine to a glutamic or aspartic acid residue, to mimic phosphorylation. The SAPK3
mutant would then not be expected to bind OMP25. Although this mutation would also
likely affect the interaction of SAPK3 with PDZ domain-containing proteins such as α1-
Syntrophin, it would still be expected to show activity towards non-PDZ domain-
containing substrate proteins such as Sab. Examination of the sequence surrounding
Thr365 shows similarity to the cyclic GMP-dependent protein kinase consensus site for
phosphorylation (Pearson and Kemp, 1991). Further studies will be required to
determine whether this site is phosphorylated by cyclic GMP-dependent protein kinase
or another protein kinase.
7.2 Conclusions
At the commencement of these studies, little was known about the role that
SAPK3 may play in the cell. The aim of this project, therefore, was to characterise some
of the features of SAPK3, including its tissue expression, localisation, substrate
specificity, and binding partners. Collectively, the results presented in this thesis
together with the published literature in the last 4 years suggest that SAPK3 is a unique
member of the p38 MAPK family. This is supported by its unique tissue distribution,
subcellular localisation, and binding to PDZ domain-containing proteins. These results
in combination with further studies utilising SAPK3 knockout models and specific
128
SAPK3 inhibitors should allow the ultimate function of this protein kinase to be
determined.
129
Chapter 8
References
References
Abdollahi,T., Robertson,N.M., Abdollahi,A., and Litwack,G. (2003). Identification of interleukin 8 as an inhibitor of tumor necrosis factor-related apoptosis-inducing ligand-induced apoptosis in the ovarian carcinoma cell line OVCAR3. Cancer Res 63, 4521-4526.
Adachi,M., Fukuda,M., and Nishida,E. (2000). Nuclear export of MAP kinase (ERK) involves a MAP kinase kinase (MEK)-dependent active transport mechanism. J Cell Biol 148, 849-856.
Adams,J.W., Sakata,Y., Davis,M.G., Sah,V.P., Wang,Y., Liggett,S.B., Chien,K.R., Brown,J.H., and Dorn,G.W. (1998). Enhanced Galphaq signaling: a common pathway mediates cardiac hypertrophy and apoptotic heart failure. Proc Natl Acad Sci U S A 95, 10140-10145.
Ahn,N.G., Seger,R., Bratlien,R.L., Diltz,C.D., Tonks,N.K., and Krebs,E.G. (1991). Multiple components in an epidermal growth factor-stimulated protein kinase cascade. In vitro activation of a myelin basic protein/microtubule-associated protein 2 kinase. J Biol Chem. 266, 4220-4227.
Alessandrini,A., Namura,S., Moskowitz,M.A., and Bonventre,J.V. (1999). MEK1 protein kinase inhibition protects against damage resulting from focal cerebral ischemia. Proc Natl Acad Sci U S A 96, 12866-12869.
Alonso,G., Ambrosino,C., Jones,M., and Nebreda,A.R. (2000). Differential activation of p38 mitogen-activated protein kinase isoforms depending on signal strength. J Biol Chem. 275, 40641-40648.
Alvarez,E., Northwood,I.C., Gonzalez,F.A., Latour,D.A., Seth,A., Abate,C., Curran,T., and Davis,R.J. (1991). Pro-Leu-Ser/Thr-Pro is a consensus primary sequence for substrate protein phosphorylation. Characterization of the phosphorylation of c-myc and c-jun proteins by an epidermal growth factor receptor threonine 669 protein kinase. J Biol Chem. 266, 15277-15285.
Anderson,J.M., Stevenson,B.R., Jesaitis,L.A., Goodenough,D.A., and Mooseker,M.S. (1988). Characterization of ZO-1, a protein component of the tight junction from mouse liver and Madin-Darby canine kidney cells. J Cell Biol 106, 1141-1149.
Anguita,J., Barthold,S.W., Persinski,R., Hedrick,M.N., Huy,C.A., Davis,R.J., Flavell,R.A., and Fikrig,E. (2002). Murine Lyme arthritis development mediated by p38 mitogen-activated protein kinase activity. J Immunol. 168, 6352-6357.
130
Aoki,H., Kang,P.M., Hampe,J., Yoshimura,K., Noma,T., Matsuzaki,M., and Izumo,S. (2002). Direct activation of mitochondrial apoptosis machinery by c-Jun N-terminal kinase in adult cardiac myocytes. J Biol Chem. 277, 10244-10250.
Assoian,R.K. (2002). Common sense signalling. Nat. Cell Biol 4, E187-E188.
Barr,R.K. and Bogoyevitch,M.A. (2001). The c-Jun N-terminal protein kinase family of mitogen-activated protein kinases (JNK MAPKs). Int. J Biochem Cell Biol 33, 1047-1063.
Barros,L.F., Young,M., Saklatvala,J., and Baldwin,S.A. (1997). Evidence of two mechanisms for the activation of the glucose transporter GLUT1 by anisomycin: p38(MAP kinase) activation and protein synthesis inhibition in mammalian cells. J Physiol 504 ( Pt 3), 517-525.
Basu,A. and Haldar,S. (2003). Identification of a novel Bcl-xL phosphorylation site regulating the sensitivity of taxol- or 2-methoxyestradiol-induced apoptosis. FEBS Lett 538, 41-47.
Behr,T.M., Nerurkar,S.S., Nelson,A.H., Coatney,R.W., Woods,T.N., Sulpizio,A., Chandra,S., Brooks,D.P., Kumar,S., Lee,J.C., Ohlstein,E.H., Angermann,C.E., Adams,J.L., Sisko,J., Sackner-Bernstein,J.D., and Willette,R.N. (2001). Hypertensive end-organ damage and premature mortality are p38 mitogen-activated protein kinase-dependent in a rat model of cardiac hypertrophy and dysfunction. Circulation 104, 1292-1298.
Bell,M., Capone,R., Pashtan,I., Levitzki,A., and Engelberg,D. (2001). Isolation of hyperactive mutants of the MAPK p38/Hog1 that are independent of MAPK kinase activation. J Biol Chem. 276, 25351-25358.
Bellon,S., Fitzgibbon,M.J., Fox,T., Hsiao,H.M., and Wilson,K.P. (1999). The structure of phosphorylated p38gamma is monomeric and reveals a conserved activation-loop conformation. Structure. Fold. Des 7, 1057-1065.
Ben Levy,R., Hooper,S., Wilson,R., Paterson,H.F., and Marshall,C.J. (1998). Nuclear export of the stress-activated protein kinase p38 mediated by its substrate MAPKAP kinase-2. Curr. Biol 8, 1049-1057.
Berwick,D.C. and Tavare,J.M. (2004). Identifying protein kinase substrates: hunting for the organ-grinder's monkeys. Trends Biochem Sci 29, 227-232.
Bhakar,A.L., Howell,J.L., Paul,C.E., Salehi,A.H., Becker,E.B., Said,F., Bonni,A., and Barker,P.A. (2003). Apoptosis induced by p75NTR overexpression requires Jun kinase-dependent phosphorylation of Bad. J Neurosci. 23, 11373-11381.
Bilder,D. and Perrimon,N. (2000). Localization of apical epithelial determinants by the basolateral PDZ protein Scribble. Nature 403, 676-680.
131
Boglari,G., Erhardt,P., Cooper,G.M., and Szeberenyi,J. (1998). Intact Ras function is required for sustained activation and nuclear translocation of extracellular signal-regulated kinases in nerve growth factor-stimulated PC12 cells. Eur. J Cell Biol 75, 54-58.
Bogoyevitch MA and Court NW (2004). Counting on Mitogen-activated protein kinases - ERKs 3, 4, 5, 6, 7 and 8. Cell Signal. In Press.
Bogoyevitch,M.A., Gillespie-Brown,J., Ketterman,A.J., Fuller,S.J., Ben Levy,R., Ashworth,A., Marshall,C.J., and Sugden,P.H. (1996). Stimulation of the stress-activated mitogen-activated protein kinase subfamilies in perfused heart. p38/RK mitogen-activated protein kinases and c-Jun N-terminal kinases are activated by ischemia/reperfusion. Circ. Res 79, 162-173.
Bogoyevitch,M.A., Glennon,P.E., Andersson,M.B., Clerk,A., Lazou,A., Marshall,C.J., Parker,P.J., and Sugden,P.H. (1994). Endothelin-1 and fibroblast growth factors stimulate the mitogen-activated protein kinase signaling cascade in cardiac myocytes. The potential role of the cascade in the integration of two signaling pathways leading to myocyte hypertrophy. J Biol Chem. 269, 1110-1119.
Bogoyevitch,M.A., Glennon,P.E., and Sugden,P.H. (1993). Endothelin-1, phorbol esters and phenylephrine stimulate MAP kinase activities in ventricular cardiomyocytes. FEBS Lett 317, 271-275.
Boppart,M.D., Asp,S., Wojtaszewski,J.F., Fielding,R.A., Mohr,T., and Goodyear,L.J. (2000). Marathon running transiently increases c-Jun NH2-terminal kinase and p38 activities in human skeletal muscle. J Physiol 526 Pt 3, 663-669.
Boulton TG, Nye SH, Robbins DJ, Ip NY, Radziejewska E, Morgenbesser SD, DePinho RA, Panayotatos N, Cobb MH, and Yancopoulos GD. (1991). ERKs: a family of protein-serine/threonine kinases that are activated and tyrosine phosphorylated in response to insulin and NGF. Cell 65, 663-675.
Boulton,T.G., Yancopoulos,G.D., Gregory,J.S., Slaughter,C., Moomaw,C., Hsu,J., and Cobb,M.H. (1990). An insulin-stimulated protein kinase similar to yeast kinases involved in cell cycle control. Science 249, 64-67.
Bour,B.A., O'Brien,M.A., Lockwood,W.L., Goldstein,E.S., Bodmer,R., Taghert,P.H., Abmayr,S.M., and Nguyen,H.T. (1995). Drosophila MEF2, a transcription factor that is essential for myogenesis. Genes Dev. 9 , 730-741.
Braz,J.C., Bueno,O.F., De Windt,L.J., and Molkentin,J.D. (2002). PKC alpha regulates the hypertrophic growth of cardiomyocytes through extracellular signal-regulated kinase1/2 (ERK1/2). J Cell Biol 156, 905-919.
Braz,J.C., Bueno,O.F., Liang,Q., Wilkins,B.J., Dai,Y.S., Parsons,S., Braunwart,J., Glascock,B.J., Klevitsky,R., Kimball,T.F., Hewett,T.E., and Molkentin,J.D. (2003).
132
Targeted inhibition of p38 MAPK promotes hypertrophic cardiomyopathy through upregulation of calcineurin-NFAT signaling. J Clin. Invest 111, 1475-1486.
Brinkworth,R.I., Breinl,R.A., and Kobe,B. (2003). Structural basis and prediction of substrate specificity in protein serine/threonine kinases. Proc Natl Acad Sci U S A 100, 74-79.
Buday,L. and Downward,J. (1993). Epidermal growth factor regulates p21ras through the formation of a complex of receptor, Grb2 adapter protein, and Sos nucleotide exchange factor. Cell 73, 611-620.
Buee-Scherrer and Goedert M. (2002). Phosphorylation of microtubule-associated protein tau by stress-activated protein kinases in intact cells. FEBS Lett. 515, 151-154.
Bueno,O.F., De Windt,L.J., Tymitz,K.M., Witt,S.A., Kimball,T.R., Klevitsky,R., Hewett,T.E., Jones,S.P., Lefer,D.J., Peng,C.F., Kitsis,R.N., and Molkentin,J.D. (2000). The MEK1-ERK1/2 signaling pathway promotes compensated cardiac hypertrophy in transgenic mice. EMBO J 19, 6341-6350.
Bueno,O.F. and Molkentin,J.D. (2002). Involvement of extracellular signal-regulated kinases 1/2 in cardiac hypertrophy and cell death. Circ. Res 91, 776-781.
Camps,M., Nichols,A., and Arkinstall,S. (2000). Dual specificity phosphatases: a gene family for control of MAP kinase function. FASEB J 14, 6-16.
Canagarajah,B.J., Khokhlatchev,A., Cobb,M.H., and Goldsmith,E.J. (1997). Activation mechanism of the MAP kinase ERK2 by dual phosphorylation. Cell 90, 859-869.
Cao,T.T., Deacon,H.W., Reczek,D., Bretscher,A., and von Zastrow,M. (1999). A kinase-regulated PDZ-domain interaction controls endocytic sorting of the beta2-adrenergic receptor. Nature 401, 286-290.
Casey,P.J., Solski,P.A., Der,C.J., and Buss,J.E. (1989). p21ras is modified by a farnesyl isoprenoid. Proc Natl Acad Sci U S A 86, 8323-8327.
Cavigelli,M., Dolfi,F., Claret,F.X., and Karin,M. (1995). Induction of c-fos expression through JNK-mediated TCF/Elk-1 phosphorylation. EMBO J 14, 5957-5964.
Chang,C.I., Xu,B.E., Akella,R., Cobb,M.H., and Goldsmith,E.J. (2002). Crystal structures of MAP kinase p38 complexed to the docking sites on its nuclear substrate MEF2A and activator MKK3b. Mol Cell 9, 1241-1249.
Chardin,P., Camonis,J.H., Gale,N.W., van Aelst,L., Schlessinger,J., Wigler,M.H., and Bar-Sagi,D. (1993). Human Sos1: a guanine nucleotide exchange factor for Ras that binds to GRB2. Science 260, 1338-1343.
Chen,R.H., Sarnecki,C., and Blenis,J. (1992). Nuclear localization and regulation of erk- and rsk-encoded protein kinases. Mol Cell Biol 12, 915-927.
133
Chen,Y.W., Zhao,P., Borup,R., and Hoffman,E.P. (2000). Expression profiling in the muscular dystrophies: identification of novel aspects of molecular pathophysiology. J Cell Biol 151, 1321-1336.
Chiariello,M., Marinissen,M.J., and Gutkind,J.S. (2000). Multiple mitogen-activated protein kinase signaling pathways connect the cot oncoprotein to the c-jun promoter and to cellular transformation. Mol Cell Biol 20, 1747-1758.
Chien,K.R. (1999). Stress pathways and heart failure. Cell 98, 555-558.
Chien,K.R., Knowlton,K.U., Zhu,H., and Chien,S. (1991). Regulation of cardiac gene expression during myocardial growth and hypertrophy: molecular studies of an adaptive physiologic response. FASEB J 5, 3037-3046.
Chihab,R., Bossenmeyer,C., Oillet,J., and Daval,J.L. (1998). Lack of correlation between the effects of transient exposure to glutamate and those of hypoxia/reoxygenation in immature neurons in vitro. J Neurochem. 71, 1177-1186.
Cho,K.O., Hunt,C.A., and Kennedy,M.B. (1992). The rat brain postsynaptic density fraction contains a homolog of the Drosophila discs-large tumor suppressor protein. Neuron 9, 929-942.
Clark-Lewis,I., Sanghera,J.S., and Pelech,S.L. (1991). Definition of a consensus sequence for peptide substrate recognition by p44mpk, the meiosis-activated myelin basic protein kinase. J Biol Chem. 266, 15180-15184.
Clerk,A., Harrison,J.G., Long,C.S., and Sugden,P.H. (1999). Pro-inflammatory cytokines stimulate mitogen-activated protein kinase subfamilies, increase phosphorylation of c-Jun and ATF2 and upregulate c-Jun protein in neonatal rat ventricular myocytes. J Mol Cell Cardiol. 31, 2087-2099.
Clerk,A., Michael,A., and Sugden,P.H. (1998a). Stimulation of multiple mitogen-activated protein kinase sub-families by oxidative stress and phosphorylation of the small heat shock protein, HSP25/27, in neonatal ventricular myocytes. Biochem J 333 (Pt 3), 581-589.
Clerk,A., Michael,A., and Sugden,P.H. (1998b). Stimulation of the p38 mitogen-activated protein kinase pathway in neonatal rat ventricular myocytes by the G protein-coupled receptor agonists, endothelin-1 and phenylephrine: a role in cardiac myocyte hypertrophy? J Cell Biol 142, 523-535.
Clerk,A. and Sugden,P.H. (1999). Activation of protein kinase cascades in the heart by hypertrophic G protein-coupled receptor agonists. Am. J Cardiol. 83, 64H-69H.
Cobb,M.H., Hepler,J.E., Cheng,M., and Robbins,D. (1994). The mitogen-activated protein kinases, ERK1 and ERK2. Semin. Cancer Biol 5, 261-268.
134
Cohen,N.A., Brenman,J.E., Snyder,S.H., and Bredt,D.S. (1996). Binding of the inward rectifier K+ channel Kir 2.3 to PSD-95 is regulated by protein kinase A phosphorylation. Neuron 17, 759-767.
Cohen, P. (1997). The search for physiological substrates of MAP and SAP kinases in mammalian cells. Trends Cell Biol. 7, 353-361.
Cohen,P. (2002). Protein kinases--the major drug targets of the twenty-first century? Nat. Rev. Drug Discov. 1, 309-315.
Conrad,P.W., Millhorn,D.E., and Beitner-Johnson,D. (2000). Novel regulation of p38gamma by dopamine D2 receptors during hypoxia. Cell Signal. 12, 463-467.
Conrad,P.W., Rust,R.T., Han,J., Millhorn,D.E., and Beitner-Johnson,D. (1999). Selective activation of p38alpha and p38gamma by hypoxia. Role in regulation of cyclin D1 by hypoxia in PC12 cells. J Biol Chem. 274, 23570-23576.
Cook,S.A., Sugden,P.H., and Clerk,A. (1999). Activation of c-Jun N-terminal kinases and p38-mitogen-activated protein kinases in human heart failure secondary to ischaemic heart disease. J Mol Cell Cardiol. 31, 1429-1434.
Corson,L.B., Yamanaka,Y., Lai,K.M., and Rossant,J. (2003). Spatial and temporal patterns of ERK signaling during mouse embryogenesis. Development 130, 4527-4537.
Court NW, dos Remedios CG, Cordell J, and Bogoyevitch MA. (2002). Cardiac expression and subcellular localization of the p38 mitogen-activated protein kinase member, stress-activated protein kinase-3 (SAPK3). J Mol Cell Cardiol. 34, 413-426.
Cowley,S., Paterson,H., Kemp,P., and Marshall,C.J. (1994). Activation of MAP kinase kinase is necessary and sufficient for PC12 differentiation and for transformation of NIH 3T3 cells. Cell 77, 841-852.
Cuenda,A., Cohen,P. (1999). Stress-activated protein kinase-2/p38 and a rapamycin-sensitive pathway are required for C2C12 myogenesis. J Biol Chem 274, 4341-4346.
Cuenda,A., Cohen,P., Buee-Scherrer,V., and Goedert,M. (1997). Activation of stress-activated protein kinase-3 (SAPK3) by cytokines and cellular stresses is mediated via SAPKK3 (MKK6); comparison of the specificities of SAPK3 and SAPK2 (RK/p38). EMBO J 16, 295-305.
Cuenda,A., Rouse,J., Doza,Y.N., Meier,R., Cohen,P., Gallagher,T.F., Young,P.R., and Lee,J.C. (1995). SB 203580 is a specific inhibitor of a MAP kinase homologue which is stimulated by cellular stresses and interleukin-1. FEBS Lett 364, 229-233.
Danial,N.N., Gramm,C.F., Scorrano,L., Zhang,C.Y., Krauss,S., Ranger,A.M., Datta,S.R., Greenberg,M.E., Licklider,L.J., Lowell,B.B., Gygi,S.P., and Korsmeyer,S.J. (2003). BAD and glucokinase reside in a mitochondrial complex that integrates glycolysis and apoptosis. Nature 424, 952-956.
135
Daniels,D.L., Cohen,A.R., Anderson,J.M., and Brunger,A.T. (1998). Crystal structure of the hCASK PDZ domain reveals the structural basis of class II PDZ domain target recognition. Nat. Struct. Biol 5, 317-325.
Dash,R., Schmidt,A.G., Pathak,A., Gerst,M.J., Biniakiewicz,D., Kadambi,V.J., Hoit,B.D., Abraham,W.T., and Kranias,E.G. (2003). Differential regulation of p38 mitogen-activated protein kinase mediates gender-dependent catecholamine-induced hypertrophy. Cardiovasc. Res 57, 704-714.
Davidson,S.M. and Morange,M. (2000). Hsp25 and the p38 MAPK pathway are involved in differentiation of cardiomyocytes. Dev. Biol 218, 146-160.
Davis,S., Vanhoutte,P., Pages,C., Caboche,J., and Laroche,S. (2000). The MAPK/ERK cascade targets both Elk-1 and cAMP response element-binding protein to control long-term potentiation-dependent gene expression in the dentate gyrus in vivo. J Neurosci. 20, 4563-4572.
De Angelis,L., Borghi,S., Melchionna,R., Berghella,L., Baccarani-Contri,M., Parise,F., Ferrari,S., and Cossu,G. (1998). Inhibition of myogenesis by transforming growth factor beta is density-dependent and related to the translocation of transcription factor MEF2 to the cytoplasm. Proc Natl Acad Sci U S A 95, 12358-12363.
De Windt,L.J., Lim,H.W., Haq,S., Force,T., and Molkentin,J.D. (2000). Calcineurin promotes protein kinase C and c-Jun NH2-terminal kinase activation in the heart. Cross-talk between cardiac hypertrophic signaling pathways. J Biol Chem. 275, 13571-13579.
Deng,X., Xiao,L., Lang,W., Gao,F., Ruvolo,P., and May,W.S., Jr. (2001). Novel role for JNK as a stress-activated Bcl2 kinase. J Biol Chem. 276, 23681-23688.
Deng,Y., Ren,X., Yang,L., Lin,Y., and Wu,X. (2003). A JNK-dependent pathway is required for TNFalpha-induced apoptosis. Cell 115, 61-70.
Denhardt,D.T. (1996). Signal-transducing protein phosphorylation cascades mediated by Ras/Rho proteins in the mammalian cell: the potential for multiplex signalling. Biochem J 318 (Pt 3), 729-747.
Derijard,B., Hibi,M., Wu,I.H., Barrett,T., Su,B., Deng,T., Karin,M., and Davis,R.J. (1994). JNK1: a protein kinase stimulated by UV light and Ha-Ras that binds and phosphorylates the c-Jun activation domain. Cell 76, 1025-1037.
Derijard,B., Raingeaud,J., Barrett,T., Wu,I.H., Han,J., Ulevitch,R.J., and Davis,R.J. (1995). Independent human MAP-kinase signal transduction pathways defined by MEK and MKK isoforms. Science 267, 682-685.
Dhanasekaran,N. and Premkumar,R.E. (1998). Signaling by dual specificity kinases. Oncogene 17, 1447-1455.
136
Donovan,N., Becker,E.B., Konishi,Y., and Bonni,A. (2002). JNK phosphorylation and activation of BAD couples the stress-activated signaling pathway to the cell death machinery. J Biol Chem. 277, 40944-40949.
Doyle,D.A., Lee,A., Lewis,J., Kim,E., Sheng,M., and MacKinnon,R. (1996). Crystal structures of a complexed and peptide-free membrane protein-binding domain: molecular basis of peptide recognition by PDZ. Cell 85, 1067-1076.
Du,L., Lyle,C.S., Obey,T.B., Gaarde,W.A., Muir,J.A., Bennett,B.L., and Chambers,T.C. (2004). Inhibition of cell proliferation and cell cycle progression by specific inhibition of basal JNK activity: evidence that mitotic Bcl-2 phosphorylation is JNK-independent. J Biol Chem. 279, 11957-11966.
Eblen,S.T., Kumar,N.V., Shah,K., Henderson,M.J., Watts,C.K., Shokat,K.M., and Weber,M.J. (2003). Identification of novel ERK2 substrates through use of an engineered kinase and ATP analogs. J Biol Chem. 278, 14926-14935.
Enslen,H., Raingeaud,J., and Davis,R.J. (1998). Selective activation of p38 mitogen-activated protein (MAP) kinase isoforms by the MAP kinase kinases MKK3 and MKK6. J Biol Chem. 273, 1741-1748.
Eyers,P.A., Craxton,M., Morrice,N., Cohen,P., and Goedert,M. (1998). Conversion of SB 203580-insensitive MAP kinase family members to drug-sensitive forms by a single amino-acid substitution. Chem. Biol 5 , 321-328.
Fabre S, Reynaud C, and Jalinot P. (2000). Identification of functional PDZ domain binding sites in several human proteins. Mol Biol Rep. 27, 217-224.
Fan,M., Goodwin,M., Vu,T., Brantley-Finley,C., Gaarde,W.A., and Chambers,T.C. (2000). Vinblastine-induced phosphorylation of Bcl-2 and Bcl-XL is mediated by JNK and occurs in parallel with inactivation of the Raf-1/MEK/ERK cascade. J Biol Chem. 275, 29980-29985.
Fanning,A.S. and Anderson,J.M. (1999). PDZ domains: fundamental building blocks in the organization of protein complexes at the plasma membrane. J Clin. Invest 103, 767-772.
Fearns,C., Kline,L., Gram,H., Di Padova,F., Zurini,M., Han,J., and Ulevitch,R.J. (2000). Coordinate activation of endogenous p38alpha, beta, gamma, and delta by inflammatory stimuli. J Leukoc. Biol 67, 705-711.
Fields,S. and Song,O. (1989). A novel genetic system to detect protein-protein interactions. Nature 340, 245-246.
Fishman,M.C. and Chien,K.R. (1997). Fashioning the vertebrate heart: earliest embryonic decisions. Development 124, 2099-2117.
137
Fleming,Y., Armstrong,C.G., Morrice,N., Paterson,A., Goedert,M., and Cohen,P. (2000). Synergistic activation of stress-activated protein kinase 1/c-Jun N-terminal kinase (SAPK1/JNK) isoforms by mitogen-activated protein kinase kinase 4 (MKK4) and MKK7. Biochem J 352 Pt 1, 145-154.
Fornerod,M., Ohno,M., Yoshida,M., and Mattaj,I.W. (1997). CRM1 is an export receptor for leucine-rich nuclear export signals. Cell 90, 1051-1060.
Fox,T., Fitzgibbon,M.J., Fleming,M.A., Hsiao,H.M., Brummel,C.L., and Su,M.S. (1999). Kinetic mechanism and ATP-binding site reactivity of p38gamma MAP kinase. FEBS Lett 461, 323-328.
Fuh,G., Pisabarro,M.T., Li,Y., Quan,C., Lasky,L.A., and Sidhu,S.S. (2000). Analysis of PDZ domain-ligand interactions using carboxyl-terminal phage display. J Biol Chem. 275, 21486-21491.
Fukuda,M., Gotoh,Y., and Nishida,E. (1997a). Interaction of MAP kinase with MAP kinase kinase: its possible role in the control of nucleocytoplasmic transport of MAP kinase. EMBO J 16, 1901-1908.
Fukuda,M., Gotoh,I., Adachi,M., Gotoh,Y., and Nishida,E. (1997b). A novel regulatory mechanism in the mitogen-activated protein (MAP) kinase cascade. Role of nuclear export signal of MAP kinase kinase. J Biol Chem. 272, 32642-32648.
Fukuda,M., Asano,S., Nakamura,T., Adachi,M., Yoshida,M., Yanagida,M., and Nishida,E. (1997c). CRM1 is responsible for intracellular transport mediated by the nuclear export signal. Nature 390, 308-311.
Fukuda,M., Gotoh,I., Gotoh,Y., and Nishida,E. (1996). Cytoplasmic localization of mitogen-activated protein kinase kinase directed by its NH2-terminal, leucine-rich short amino acid sequence, which acts as a nuclear export signal. J Biol Chem. 271, 20024-20028.
Gavin,A.C. and Nebreda,A.R. (1999). A MAP kinase docking site is required for phosphorylation and activation of p90(rsk)/MAPKAP kinase-1. Curr. Biol 9, 281-284.
Ge,B., Gram,H., Di Padova,F., Huang,B., New,L., Ulevitch,R.J., Luo,Y., and Han,J. (2002). MAPKK-independent activation of p38alpha mediated by TAB1-dependent autophosphorylation of p38alpha. Science 295, 1291-1294.
Gee,S.H., Quenneville,S., Lombardo,C.R., and Chabot,J. (2000). Single-amino acid substitutions alter the specificity and affinity of PDZ domains for their ligands. Biochemistry 39, 14638-14646.
Gille,H., Kortenjann,M., Thomae,O., Moomaw,C., Slaughter,C., Cobb,M.H., and Shaw,P.E. (1995). ERK phosphorylation potentiates Elk-1-mediated ternary complex formation and transactivation. EMBO J 14, 951-962.
138
Goedert,M., Cuenda,A., Craxton,M., Jakes,R., and Cohen,P. (1997a). Activation of the novel stress-activated protein kinase SAPK4 by cytokines and cellular stresses is mediated by SKK3 (MKK6); comparison of its substrate specificity with that of other SAP kinases. EMBO J 16, 3563-3571.
Goedert,M., Hasegawa,M., Jakes,R., Lawler,S., Cuenda,A., and Cohen,P. (1997b). Phosphorylation of microtubule-associated protein tau by stress-activated protein kinases. FEBS Lett 409, 57-62.
Goswami,S., Qasba,P., Ghatpande,S., Carleton,S., Deshpande,A.K., Baig,M., and Siddiqui,M.A. (1994). Differential expression of the myocyte enhancer factor 2 family of transcription factors in development: the cardiac factor BBF-1 is an early marker for cardiogenesis. Mol Cell Biol 14 , 5130-5138.
Graves,J.D., Campbell,J.S., and Krebs,E.G. (1995). Protein serine/threonine kinases of the MAPK cascade. Ann N Y Acad Sci 766, 320-343.
Gross E.A., Callow M.G., Waldbaum L., Thomas S., and Ruggieri R. (2002). MRK, a mixed lineage kinase-related molecule that plays a role in gamma-radiation-induced cell cycle arrest. J Biol Chem. 277, 13873-13882.
Gupta,S., Campbell,D., Derijard,B., and Davis,R.J. (1995). Transcription factor ATF2 regulation by the JNK signal transduction pathway. Science 267, 389-393.
Guyton,K.Z., Liu,Y., Gorospe,M., Xu,Q., and Holbrook,N.J. (1996). Activation of mitogen-activated protein kinase by H2O2. Role in cell survival following oxidant injury. J Biol Chem. 271, 4138-4142.
Hale,K.K., Trollinger,D., Rihanek,M., and Manthey,C.L. Differential expression and activation of p38 mitogen-activated protein kinase alpha, beta, gamma, and delta in inflammatory cell lineages. J Immunol 162, 4246-4252.
Han J, Lee JD, Bibbs L, and Ulevitch RJ. (1994). A MAP kinase targeted by endotoxin and hyperosmolarity in mammalian cells. Science 265, 808-811.
Hanks,S.K. (2003). Genomic analysis of the eukaryotic protein kinase superfamily: a perspective. Genome Biol 4, 111.
Hanks,S.K. and Hunter,T. (1995). Protein kinases 6. The eukaryotic protein kinase superfamily: kinase (catalytic) domain structure and classification. FASEB J 9, 576-596.
Hasegawa,M., Cuenda,A., Spillantini,M.G., Thomas,G.M., Buee-Scherrer,V., Cohen,P., and Goedert,M. (1999). Stress-activated protein kinase-3 interacts with the PDZ domain of alpha1-syntrophin. A mechanism for specific substrate recognition. J Biol Chem. 274, 12626-12631.
139
Hibi,M., Lin,A., Smeal,T., Minden,A., and Karin,M. (1993). Identification of an oncoprotein- and UV-responsive protein kinase that binds and potentiates the c-Jun activation domain. Genes Dev. 7, 2135-2148.
Hines W.A., Thorburn J., and Thorburn A. (1999). Cell density and contraction regulate p38 MAP kinase-dependent responses in neonatal rat cardiac myocytes. Am J Physiol. 277, H331-H341.
Ho,R.C., Alcazar,O., Fujii,N., Hirshman,M.F., and Goodyear,L.J. (2004). p38gamma MAPK regulation of glucose transporter expression and glucose uptake in L6 myotubes and mouse skeletal muscle. Am. J Physiol Regul. Integr. Comp Physiol 286, R342-R349.
Hockenbery,D., Nunez,G., Milliman,C., Schreiber,R.D., and Korsmeyer,S.J. (1990). Bcl-2 is an inner mitochondrial membrane protein that blocks programmed cell death. Nature 348, 334-336.
Holland,P.M. and Cooper,J.A. (1999). Protein modification: docking sites for kinases. Curr. Biol 9, R329-R331.
Hoover,H.E., Thuerauf,D.J., Martindale,J.J., and Glembotski,C.C. (2000). alpha B-crystallin gene induction and phosphorylation by MKK6-activated p38. A potential role for alpha B-crystallin as a target of the p38 branch of the cardiac stress response. J Biol Chem. 275, 23825-23833.
Hope,I.A. and Struhl,K. (1986). Functional dissection of a eukaryotic transcriptional activator protein, GCN4 of yeast. Cell 46, 885-894.
Huang,C., Rajfur,Z., Borchers,C., Schaller,M.D., and Jacobson,K. (2003). JNK phosphorylates paxillin and regulates cell migration. Nature 424, 219-223.
Hung,A.Y. and Sheng,M. (2002). PDZ domains: structural modules for protein complex assembly. J Biol Chem. 277, 5699-5702.
Hunot,S., Vila,M., Teismann,P., Davis,R.J., Hirsch,E.C., Przedborski,S., Rakic,P., and Flavell,R.A. (2004). JNK-mediated induction of cyclooxygenase 2 is required for neurodegeneration in a mouse model of Parkinson's disease. Proc Natl Acad Sci U S A 101, 665-670.
Ingley,E., Chappell,D., Poon,S.Y., Sarna,M.K., Beaumont,J.G., Williams,J.H., Stillitano,J.P., Tsai,S., Leedman,P.J., Tilbrook,P.A., and Klinken,S.P. (2001). Thyroid hormone receptor-interacting protein 1 modulates cytokine and nuclear hormone signaling in erythroid cells. J Biol Chem. 276, 43428-43434.
Ingley,E., Sarna,M.K., Beaumont,J.G., Tilbrook,P.A., Tsai,S., Takemoto,Y., Williams,J.H., and Klinken,S.P. (2000). HS1 interacts with Lyn and is critical for erythropoietin-induced differentiation of erythroid cells. J Biol Chem. 275, 7887-7893.
140
Irie,M., Hata,Y., Deguchi,M., Ide,N., Hirao,K., Yao,I., Nishioka,H., and Takai,Y. (1999). Isolation and characterization of mammalian homologues of Caenorhabditis elegans lin-7: localization at cell-cell junctions. Oncogene 18, 2811-2817.
Ishikawa,Y., Kusaka,E., Enokido,Y., Ikeuchi,T., and Hatanaka,H. (2003). Regulation of Bax translocation through phosphorylation at Ser-70 of Bcl-2 by MAP kinase in NO-induced neuronal apoptosis. Mol Cell Neurosci. 24, 451-459.
Iwai-Kanai,E., Hasegawa,K., Sawamura,T., Fujita,M., Yanazume,T., Toyokuni,S., Adachi,S., Kihara,Y., and Sasayama,S. (2001). Activation of lectin-like oxidized low-density lipoprotein receptor-1 induces apoptosis in cultured neonatal rat cardiac myocytes. Circulation 104, 2948-2954.
Iwakura,A., Fujita,M., Hasegawa,K., Toyokuni,S., Sawamura,T., Nohara,R., Sasayama,S., and Komeda,M. (2001). Pericardial fluid from patients with ischemic heart disease induces myocardial cell apoptotis via an oxidant stress-sensitive p38 mitogen-activated protein kinase pathway. J Mol Cell Cardiol. 33, 419-430.
Izumiya,Y., Kim,S., Izumi,Y., Yoshida,K., Yoshiyama,M., Matsuzawa,A., Ichijo,H., and Iwao,H. (2003). Apoptosis signal-regulating kinase 1 plays a pivotal role in angiotensin II-induced cardiac hypertrophy and remodeling. Circ. Res 93, 874-883.
Jacobs,D., Glossip,D., Xing,H., Muslin,A.J., and Kornfeld,K. (1999). Multiple docking sites on substrate proteins form a modular system that mediates recognition by ERK MAP kinase. Genes Dev. 13, 163-175.
Jaffrey,S.R., Benfenati,F., Snowman,A.M., Czernik,A.J., and Snyder,S.H. (2002). Neuronal nitric-oxide synthase localization mediated by a ternary complex with synapsin and CAPON. Proc Natl Acad Sci U S A 99, 3199-3204.
Jenkins,S.M., Zinnerman,M., Garner,C., and Johnson,G.V. (2000). Modulation of tau phosphorylation and intracellular localization by cellular stress. Biochem J 345 Pt 2, 263-270.
Jiang,Y., Chen,C., Li,Z., Guo,W., Gegner,J.A., Lin,S., and Han,J. (1996). Characterization of the structure and function of a new mitogen-activated protein kinase (p38beta). J Biol Chem. 271, 17920-17926.
Jiang,Y., Gram,H., Zhao,M., New,L., Gu,J., Feng,L., Di Padova,F., Ulevitch,R.J., and Han,J. (1997). Characterization of the structure and function of the fourth member of p38 group mitogen-activated protein kinases, p38delta. J Biol Chem. 272, 30122-30128.
Junqueira,D., Cilenti,L., Musumeci,L., Sedivy,J.M., and Zervos,A.S. (2003). Random mutagenesis of PDZ(Omi) domain and selection of mutants that specifically bind the Myc proto-oncogene and induce apoptosis. Oncogene 22, 2772-2781.
Kaiser,R.A., Bueno,O.F., Lips,D.J., Doevendans,P.A., Jones,F., Kimball,T.F., and Molkentin,J.D. (2004). Targeted inhibition of p38 mitogen-activated protein kinase
141
antagonizes cardiac injury and cell death following ischemia-reperfusion in vivo. J Biol Chem. 279, 15524-15530.
Kallunki,T., Su,B., Tsigelny,I., Sluss,H.K., Derijard,B., Moore,G., Davis,R., and Karin,M. (1994). JNK2 contains a specificity-determining region responsible for efficient c-Jun binding and phosphorylation. Genes Dev. 8, 2996-3007.
Keegan,L., Gill,G., and Ptashne,M. (1986). Separation of DNA binding from the transcription-activating function of a eukaryotic regulatory protein. Science 231, 699-704.
Keyse,S.M. (2000). Protein phosphatases and the regulation of mitogen-activated protein kinase signalling. Curr. Opin. Cell Biol 12, 186-192.
Khokhlatchev,A.V., Canagarajah,B., Wilsbacher,J., Robinson,M., Atkinson,M., Goldsmith,E., and Cobb,M.H. (1998). Phosphorylation of the MAP kinase ERK2 promotes its homodimerization and nuclear translocation. Cell 93, 605-615.
Kim,J. and Freeman,M.R. (2003). JNK/SAPK mediates doxorubicin-induced differentiation and apoptosis in MCF-7 breast cancer cells. Breast Cancer Res Treat. 79, 321-328.
Kim,S.O., Irwin,P., Katz,S., and Pelech,S.L. (1998). Expression of mitogen-activated protein kinase pathways during postnatal development of rat heart. J Cell Biochem 71, 286-301.
Kimonides,V.G., Spillantini,M.G., Sofroniew,M.V., Fawcett,J.W., and Herbert,J. (1999). Dehydroepiandrosterone antagonizes the neurotoxic effects of corticosterone and translocation of stress-activated protein kinase 3 in hippocampal primary cultures. Neuroscience 89, 429-436.
Klauck,T.M., Faux,M.C., Labudda,K., Langeberg,L.K., Jaken,S., and Scott,J.D. (1996). Coordination of three signaling enzymes by AKAP79, a mammalian scaffold protein. Science 271, 1589-1592.
Klumpp,S. and Krieglstein,J. (2002). Serine/threonine protein phosphatases in apoptosis. Curr. Opin. Pharmacol. 2, 458-462.
Knebel A, Morrice N, and Cohen P. (2001). A novel method to identify protein kinase substrates: eEF2 kinase is phosphorylated and inhibited by SAPK4/p38delta. EMBO J. 20, 4360-4369.
Kolodziejczyk,S.M., Walsh,G.S., Balazsi,K., Seale,P., Sandoz,J., Hierlihy,A.M., Rudnicki,M.A., Chamberlain,J.S., Miller,F.D., and Megeney,L.A. (2001). Activation of JNK1 contributes to dystrophic muscle pathogenesis. Curr. Biol 11, 1278-1282.
Konishi,Y., Lehtinen,M., Donovan,N., and Bonni,A. (2002). Cdc2 phosphorylation of BAD links the cell cycle to the cell death machinery. Mol Cell 9, 1005-1016.
142
Kornau,H.C., Schenker,L.T., Kennedy,M.B., and Seeburg,P.H. (1995). Domain interaction between NMDA receptor subunits and the postsynaptic density protein PSD-95. Science 269, 1737-1740.
Kuan,C.Y., Yang,D.D., Samanta Roy,D.R., Davis,R.J., Rakic,P., and Flavell,R.A. (1999). The Jnk1 and Jnk2 protein kinases are required for regional specific apoptosis during early brain development. Neuron 22, 667-676.
Kudoh,S., Komuro,I., Hiroi,Y., Zou,Y., Harada,K., Sugaya,T., Takekoshi,N., Murakami,K., Kadowaki,T., and Yazaki,Y. (1998). Mechanical stretch induces hypertrophic responses in cardiac myocytes of angiotensin II type 1a receptor knockout mice. J Biol Chem. 273, 24037-24043.
Kumar,S., McDonnell,P.C., Gum,R.J., Hand,A.T., Lee,J.C., and Young,P.R. (1997). Novel homologues of CSBP/p38 MAP kinase: activation, substrate specificity and sensitivity to inhibition by pyridinyl imidazoles. Biochem Biophys Res Commun. 235, 533-538.
Kuo,A., Zhong,C., Lane,W.S., and Derynck,R. (2000). Transmembrane transforming growth factor-alpha tethers to the PDZ domain-containing, Golgi membrane-associated protein p59/GRASP55. EMBO J 19, 6427-6439.
Kuriyan,J. and Cowburn,D. (1997). Modular peptide recognition domains in eukaryotic signaling. Annu. Rev. Biophys Biomol. Struct. 26, 259-288.
Kyriakis,J.M. and Avruch,J. (2001). Mammalian mitogen-activated protein kinase signal transduction pathways activated by stress and inflammation. Physiol Rev. 81, 807-869.
Lai,K.M. and Pawson,T. (2000). The ShcA phosphotyrosine docking protein sensitizes cardiovascular signaling in the mouse embryo. Genes Dev. 14, 1132-1145.
Lam,M.H., Michell,B.J., Fodero-Tavoletti,M.T., Kemp,B.E., Tonks,N.K., and Tiganis,T. (2001). Cellular stress regulates the nucleocytoplasmic distribution of the protein-tyrosine phosphatase TCPTP. J Biol Chem. 276, 37700-37707.
Lamb,J.A., Ventura,J.J., Hess,P., Flavell,R.A., and Davis,R.J. (2003). JunD mediates survival signaling by the JNK signal transduction pathway. Mol Cell 11, 1479-1489.
Lavoie,J.N., L'Allemain,G., Brunet,A., Muller,R., and Pouyssegur,J. (1996). Cyclin D1 expression is regulated positively by the p42/p44MAPK and negatively by the p38/HOGMAPK pathway. J Biol Chem. 271, 20608-20616.
Lawler,S., Fleming,Y., Goedert,M., and Cohen,P. (1998). Synergistic activation of SAPK1/JNK1 by two MAP kinase kinases in vitro. Curr. Biol 8, 1387-1390.
Lechner C, Zahalka MA, Giot JF, Moller NP, and Ullrich A. (1996). ERK6, a mitogen-activated protein kinase involved in C2C12 myoblast differentiation. Proc Natl Acad Sci U S A. 93, 4355-4359.
143
Lee,S.H., Park,J., Che,Y., Han,P.L., and Lee,J.K. (2000). Constitutive activity and differential localization of p38alpha and p38beta MAPKs in adult mouse brain. J Neurosci. Res 60, 623-631.
Lefebvre,C., Terret,M.E., Djiane,A., Rassinier,P., Maro,B., and Verlhac,M.H. (2002). Meiotic spindle stability depends on MAPK-interacting and spindle-stabilizing protein (MISS), a new MAPK substrate. J Cell Biol 157, 603-613.
Lei,K. and Davis,R.J. (2003). JNK phosphorylation of Bim-related members of the Bcl2 family induces Bax-dependent apoptosis. Proc Natl Acad Sci U S A 100, 2432-2437.
Lei,K., Nimnual,A., Zong,W.X., Kennedy,N.J., Flavell,R.A., Thompson,C.B., Bar-Sagi,D., and Davis,R.J. (2002). The Bax subfamily of Bcl2-related proteins is essential for apoptotic signal transduction by c-Jun NH(2)-terminal kinase. Mol Cell Biol 22, 4929-4942.
Lemke,L.E., Bloem,L.J., Fouts,R., Esterman,M., Sandusky,G., and Vlahos,C.J. (2001). Decreased p38 MAPK activity in end-stage failing human myocardium: p38 MAPK alpha is the predominant isoform expressed in human heart. J Mol Cell Cardiol. 33, 1527-1540.
Levinthal,D.J. and DeFranco,D.B. (2004). Transient phosphatidylinositol 3-kinase inhibition protects immature primary cortical neurons from oxidative toxicity via suppression of extracellular signal-regulated kinase activation. J Biol Chem. 279, 11206-11213.
Ley,R., Balmanno,K., Hadfield,K., Weston,C., and Cook,S.J. (2003). Activation of the ERK1/2 signaling pathway promotes phosphorylation and proteasome-dependent degradation of the BH3-only protein, Bim. J Biol Chem. 278, 18811-18816.
Li Z, Jiang Y, Ulevitch RJ, and Han J. (1996). The primary structure of p38 gamma: a new member of p38 group of MAP kinases. Biochem Biophys Res Commun. 228, 334-340.
Liang,Q. and Molkentin,J.D. (2003). Redefining the roles of p38 and JNK signaling in cardiac hypertrophy: dichotomy between cultured myocytes and animal models. J Mol Cell Cardiol. 35, 1385-1394.
Liao,P., Georgakopoulos,D., Kovacs,A., Zheng,M., Lerner,D., Pu,H., Saffitz,J., Chien,K., Xiao,R.P., Kass,D.A., and Wang,Y. (2001). The in vivo role of p38 MAP kinases in cardiac remodeling and restrictive cardiomyopathy. Proc Natl Acad Sci U S A 98, 12283-12288.
Liao,P., Wang,S.Q., Wang,S., Zheng,M., Zheng,M., Zhang,S.J., Cheng,H., Wang,Y., and Xiao,R.P. (2002). p38 Mitogen-activated protein kinase mediates a negative inotropic effect in cardiac myocytes. Circ. Res 90, 190-196.
144
Lilly,B., Zhao,B., Ranganayakulu,G., Paterson,B.M., Schulz,R.A., and Olson,E.N. (1995). Requirement of MADS domain transcription factor D-MEF2 for muscle formation in Drosophila. Science 267, 688-693.
Lim,R., Winteringham,L.N., Williams,J.H., McCulloch,R.K., Ingley,E., Tiao,J.Y., Lalonde,J.P., Tsai,S., Tilbrook,P.A., Sun,Y., Wu,X., Morris,S.W., and Klinken,S.P. (2002). MADM, a novel adaptor protein that mediates phosphorylation of the 14-3-3 binding site of myeloid leukemia factor 1. J Biol Chem. 277, 40997-41008.
Lin,A., Minden,A., Martinetto,H., Claret,F.X., Lange-Carter,C., Mercurio,F., Johnson,G.L., and Karin,M. (1995). Identification of a dual specificity kinase that activates the Jun kinases and p38-Mpk2. Science 268, 286-290.
Lips,D.J., Bueno,O.F., Wilkins,B.J., Purcell,N.H., Kaiser,R.A., Lorenz,J.N., Voisin,L., Saba-El-Leil,M.K., Meloche,S., Pouyssegur,J., Pages,G., De Windt,L.J., Doevendans,P.A., and Molkentin,J.D. (2004). MEK1-ERK2 Signaling Pathway Protects Myocardium From Ischemic Injury In Vivo. Circulation.
Liu,L.X., Liu,Z.H., Jiang,H.C., Zhang,W.H., Qi,S.Y., Hu,J., Wang,X.Q., and Wu,M. (2003). Gene expression profiles of hepatoma cell line HLE. World J Gastroenterol. 9, 683-687.
Liu,T.F., Kandala,G., and Setaluri,V. (2001). PDZ domain protein GIPC interacts with the cytoplasmic tail of melanosomal membrane protein gp75 (tyrosinase-related protein-1). J Biol Chem. 276, 35768-35777.
Livingstone,C., Patel,G., and Jones,N. (1995). ATF-2 contains a phosphorylation-dependent transcriptional activation domain. EMBO J 14, 1785-1797.
Losa,J.H., Cobo,C.P., Viniegra,J.G., Sanchez-Arevalo,L., V, Cajal,S., and Sanchez-Prieto,R. (2003). Role of the p38 MAPK pathway in cisplatin-based therapy. Oncogene 22, 3998-4006.
MacDonald,T.J., Brown,K.M., LaFleur,B., Peterson,K., Lawlor,C., Chen,Y., Packer,R.J., Cogen,P., and Stephan,D.A. (2001). Expression profiling of medulloblastoma: PDGFRA and the RAS/MAPK pathway as therapeutic targets for metastatic disease. Nat. Genet. 29, 143-152.
Mackay,K. and Mochly-Rosen,D. (1999). An inhibitor of p38 mitogen-activated protein kinase protects neonatal cardiac myocytes from ischemia. J Biol Chem. 274, 6272-6279.
Maltese,W.A., Sheridan,K.M., Repko,E.M., and Erdman,R.A. (1990). Post-translational modification of low molecular mass GTP-binding proteins by isoprenoid. J Biol Chem. 265, 2148-2155.
Manning,G., Plowman,G.D., Hunter,T., and Sudarsanam,S. (2002a). Evolution of protein kinase signaling from yeast to man. Trends Biochem Sci 27, 514-520.
145
Manning,G., Whyte,D.B., Martinez,R., Hunter,T., and Sudarsanam,S. (2002b). The protein kinase complement of the human genome. Science 298, 1912-1934.
Mansour,S.J., Matten,W.T., Hermann,A.S., Candia,J.M., Rong,S., Fukasawa,K., Vande Woude,G.F., and Ahn,N.G. (1994). Transformation of mammalian cells by constitutively active MAP kinase kinase. Science 265 , 966-970.
Margolis,B. and Skolnik,E.Y. (1994). Activation of Ras by receptor tyrosine kinases. J Am. Soc. Nephrol. 5, 1288-1299.
Marinissen MJ, Chiariello M, and Gutkind JS. (2001). Regulation of gene expression by the small GTPase Rho through the ERK6 (p38 gamma) MAP kinase pathway. Genes Dev. 15, 535-553.
Marinissen,M.J., Chiariello,M., Pallante,M., and Gutkind,J.S. (1999). A network of mitogen-activated protein kinases links G protein-coupled receptors to the c-jun promoter: a role for c-Jun NH2-terminal kinase, p38s, and extracellular signal-regulated kinase 5. Mol Cell Biol 19, 4289-4301.
Marshall,C. (2000). Signal transduction takes centre stage. Nat. Cell Biol 2, E185-E187.
Martin,J.L., Avkiran,M., Quinlan,R.A., Cohen,P., and Marber,M.S. (2001). Antiischemic effects of SB203580 are mediated through the inhibition of p38alpha mitogen-activated protein kinase: Evidence from ectopic expression of an inhibition-resistant kinase. Circ. Res 89, 750-752.
Matsushita,M., Yamadori,T., Kato,S., Takemoto,Y., Inazawa,J., Baba,Y., Hashimoto,S., Sekine,S., Arai,S., Kunikata,T., Kurimoto,M., Kishimoto,T., and Tsukada,S. (1998). Identification and characterization of a novel SH3-domain binding protein, Sab, which preferentially associates with Bruton's tyrosine kinase (BtK). Biochem Biophys Res Commun. 245, 337-343.
Mertens S, Craxton M, and Goedert M. (1996). SAP kinase-3, a new member of the family of mammalian stress-activated protein kinases. FEBS Lett. 383, 273-276.
Michel,J.J. and Scott,J.D. (2002). AKAP mediated signal transduction. Annu. Rev. Pharmacol. Toxicol. 42, 235-257.
Minden,A., Lin,A., Smeal,T., Derijard,B., Cobb,M., Davis,R., and Karin,M. (1994). c-Jun N-terminal phosphorylation correlates with activation of the JNK subgroup but not the ERK subgroup of mitogen-activated protein kinases. Mol Cell Biol 14, 6683-6688.
Moriguchi,T., Kawasaki,H., Matsuda,S., Gotoh,Y., and Nishida,E. (1995). Evidence for multiple activators for stress-activated protein kinase/c-Jun amino-terminal kinases. Existence of novel activators. J Biol Chem. 270, 12969-12972.
Morrison,D.K. and Davis,R.J. (2003). Regulation of MAP kinase signaling modules by scaffold proteins in mammals. Annu. Rev. Cell Dev. Biol 19, 91-118.
146
Murray,B., Alessandrini,A., Cole,A.J., Yee,A.G., and Furshpan,E.J. (1998). Inhibition of the p44/42 MAP kinase pathway protects hippocampal neurons in a cell-culture model of seizure activity. Proc Natl Acad Sci U S A 95, 11975-11980.
Nagata,Y., Takahashi,N., Davis,R.J., and Todokoro,K. (1998). Activation of p38 MAP kinase and JNK but not ERK is required for erythropoietin-induced erythroid differentiation. Blood 92, 1859-1869.
Nakamura,A., Harrod,G.V., and Davies,K.E. (2001). Activation of calcineurin and stress activated protein kinase/p38-mitogen activated protein kinase in hearts of utrophin-dystrophin knockout mice. Neuromuscul. Disord. 11, 251-259.
Nakano,A., Baines,C.P., Kim,S.O., Pelech,S.L., Downey,J.M., Cohen,M.V., and Critz,S.D. (2000). Ischemic preconditioning activates MAPKAPK2 in the isolated rabbit heart: evidence for involvement of p38 MAPK. Circ. Res 86, 144-151.
National Heart Foundation of Australia. (2004). Statistics. Canberra, Australia. www.heartfoundation.com.au.
Neidhart,S., Antonsson,B., Gillieron,C., Vilbois,F., Grenningloh,G., and Arkinstall,S. (2001). c-Jun N-terminal kinase-3 (JNK3)/stress-activated protein kinase-beta (SAPKbeta) binds and phosphorylates the neuronal microtubule regulator SCG10. FEBS Lett 508, 259-264.
Nemoto,Y. and De Camilli,P. (1999). Recruitment of an alternatively spliced form of synaptojanin 2 to mitochondria by the interaction with the PDZ domain of a mitochondrial outer membrane protein. EMBO J 18, 2991-3006.
Ng,D.C., Court,N.W., dos Remedios,C.G., and Bogoyevitch,M.A. (2003). Activation of signal transducer and activator of transcription (STAT) pathways in failing human hearts. Cardiovasc. Res 57, 333-346.
Nguyen,T.T., Scimeca,J.C., Filloux,C., Peraldi,P., Carpentier,J.L., and Van Obberghen,E. (1993). Co-regulation of the mitogen-activated protein kinase, extracellular signal-regulated kinase 1, and the 90-kDa ribosomal S6 kinase in PC12 cells. Distinct effects of the neurotrophic factor, nerve growth factor, and the mitogenic factor, epidermal growth factor. J Biol Chem. 268, 9803-9810.
Niethammer,M., Kim,E., and Sheng,M. (1996). Interaction between the C terminus of NMDA receptor subunits and multiple members of the PSD-95 family of membrane-associated guanylate kinases. J Neurosci. 16, 2157-2163.
Nishigaki,K., Thompson,D., Yugawa,T., Rulli,K., Hanson,C., Cmarik,J., Gutkind,J.S., Teramoto,H., and Ruscetti,S. (2003). Identification and characterization of a novel Ste20/germinal center kinase-related kinase, polyploidy-associated protein kinase. J Biol Chem. 278, 13520-13530.
147
O'Connor,L., Strasser,A., O'Reilly,L.A., Hausmann,G., Adams,J.M., Cory,S., and Huang,D.C. (1998). Bim: a novel member of the Bcl-2 family that promotes apoptosis. EMBO J 17, 384-395.
Obata,T., Yaffe,M.B., Leparc,G.G., Piro,E.T., Maegawa,H., Kashiwagi,A., Kikkawa,R., and Cantley,L.C. (2000). Peptide and protein library screening defines optimal substrate motifs for AKT/PKB. J Biol Chem. 275, 36108-36115.
Okuda,K., Sanghera,J.S., Pelech,S.L., Kanakura,Y., Hallek,M., Griffin,J.D., and Druker,B.J. (1992). Granulocyte-macrophage colony-stimulating factor, interleukin-3, and steel factor induce rapid tyrosine phosphorylation of p42 and p44 MAP kinase. Blood 79, 2880-2887.
Ossareh-Nazari,B., Bachelerie,F., and Dargemont,C. (1997). Evidence for a role of CRM1 in signal-mediated nuclear protein export. Science 278, 141-144.
Pawson,T. and Nash,P. (2003). Assembly of cell regulatory systems through protein interaction domains. Science 300, 445-452.
Pawson,T. and Scott,J.D. (1997). Signaling through scaffold, anchoring, and adaptor proteins. Science 278, 2075-2080.
Payne,D.M., Rossomando,A.J., Martino,P., Erickson,A.K., Her,J.H., Shabanowitz,J., Hunt,D.F., Weber,M.J., and Sturgill,T.W. (1991). Identification of the regulatory phosphorylation sites in pp42/mitogen-activated protein kinase (MAP kinase). EMBO J 10, 885-892.
Pearson,R.B. and Kemp,B.E. (1991). Protein kinase phosphorylation site sequences and consensus specificity motifs: tabulations. Methods Enzymol. 200, 62-81.
Pellieux,C., Sauthier,T., Aubert,J.F., Brunner,H.R., and Pedrazzini,T. (2000). Angiotensin II-induced cardiac hypertrophy is associated with different mitogen-activated protein kinase activation in normotensive and hypertensive mice. J Hypertens. 18, 1307-1317.
Perdiguero,E., Pillaire,M.J., Bodart,J.F., Hennersdorf,F., Frodin,M., Duesbery,N.S., Alonso,G., and Nebreda,A.R. (2003). Xp38gamma/SAPK3 promotes meiotic G(2)/M transition in Xenopus oocytes and activates Cdc25C. EMBO J 22, 5746-5756.
Petrich,B.G., Eloff,B.C., Lerner,D.L., Kovacs,A., Saffitz,J.E., Rosenbaum,D.S., and Wang,Y. (2004). Targeted activation of c-Jun N-terminal kinase in vivo induces restrictive cardiomyopathy and conduction defects. J Biol Chem. 279, 15330-15338.
Petrich,B.G., Liao,P., and Wang,Y. (2002). Using a gene-switch transgenic approach to dissect distinct roles of MAP kinases in heart failure. Cold Spring Harb. Symp. Quant. Biol 67, 429-437.
148
Pillaire MJ, Nebreda AR, and Darbon JM. (2000). Cisplatin and UV radiation induce activation of the stress-activated protein kinase p38gamma in human melanoma cells. Biochem Biophys Res Commun. 278, 724-728.
Pulverer,B.J., Hughes,K., Franklin,C.C., Kraft,A.S., Leevers,S.J., and Woodgett,J.R. (1993). Co-purification of mitogen-activated protein kinases with phorbol ester-induced c-Jun kinase activity in U937 leukaemic cells. Oncogene 8, 407-415.
Qui,M.S. and Green,S.H. (1992). PC12 cell neuronal differentiation is associated with prolonged p21ras activity and consequent prolonged ERK activity. Neuron 9, 705-717.
Raingeaud,J., Gupta,S., Rogers,J.S., Dickens,M., Han,J., Ulevitch,R.J., and Davis,R.J. (1995). Pro-inflammatory cytokines and environmental stress cause p38 mitogen-activated protein kinase activation by dual phosphorylation on tyrosine and threonine. J Biol Chem. 270, 7420-7426.
Ramirez,M.T., Sah,V.P., Zhao,X.L., Hunter,J.J., Chien,K.R., and Brown,J.H. (1997). The MEKK-JNK pathway is stimulated by alpha1-adrenergic receptor and ras activation and is associated with in vitro and in vivo cardiac hypertrophy. J Biol Chem. 272, 14057-14061.
Regan,C.P., Li,W., Boucher,D.M., Spatz,S., Su,M.S., and Kuida,K. (2002). Erk5 null mice display multiple extraembryonic vascular and embryonic cardiovascular defects. Proc Natl Acad Sci U S A 99, 9248-9253.
Reiss,Y., Goldstein,J.L., Seabra,M.C., Casey,P.J., and Brown,M.S. (1990). Inhibition of purified p21ras farnesyl:protein transferase by Cys-AAX tetrapeptides. Cell 62, 81-88.
Remondino,A., Kwon,S.H., Communal,C., Pimentel,D.R., Sawyer,D.B., Singh,K., and Colucci,W.S. (2003). Beta-adrenergic receptor-stimulated apoptosis in cardiac myocytes is mediated by reactive oxygen species/c-Jun NH2-terminal kinase-dependent activation of the mitochondrial pathway. Circ. Res 92, 136-138.
Robbins,D.J., Zhen,E., Owaki,H., Vanderbilt,C.A., Ebert,D., Geppert,T.D., and Cobb,M.H. (1993). Regulation and properties of extracellular signal-regulated protein kinases 1 and 2 in vitro. J Biol Chem. 268, 5097-5106.
Ross,R.S., Navankasattusas,S., Harvey,R.P., and Chien,K.R. (1996). An HF-1a/HF-1b/MEF-2 combinatorial element confers cardiac ventricular specificity and established an anterior-posterior gradient of expression. Development 122, 1799-1809.
Rozakis-Adcock,M., Fernley,R., Wade,J., Pawson,T., and Bowtell,D. (1993). The SH2 and SH3 domains of mammalian Grb2 couple the EGF receptor to the Ras activator mSos1. Nature 363, 83-85.
Rugh, R. (1968). The Mouse: Its Reproduction and Development. (Minneapolis: Burgess Publishing Company).
149
Sabio,G., Reuver,S., Feijoo,C., Hasegawa,M., Thomas,G.M., Centeno,F., Kuhlendahl,S., Leal-Ortiz,S., Goedert,M., Garner,C., and Cuenda,A. (2004). Stress- and mitogen-induced phosphorylation of the synapse-associated protein SAP90/PSD95 by activation of SAPK3/p38gamma and ERK1/ERK2. Biochem J 380 (Pt1), 19-30.
Sadoshima,J., Montagne,O., Wang,Q., Yang,G., Warden,J., Liu,J., Takagi,G., Karoor,V., Hong,C., Johnson,G.L., Vatner,D.E., and Vatner,S.F. (2002). The MEKK1-JNK pathway plays a protective role in pressure overload but does not mediate cardiac hypertrophy. J Clin. Invest 110, 271-279.
Sakabe,K., Teramoto,H., Zohar,M., Behbahani,B., Miyazaki,H., Chikumi,H., and Gutkind,J.S. (2002). Potent transforming activity of the small GTP-binding protein Rit in NIH 3T3 cells: evidence for a role of a p38gamma-dependent signaling pathway. FEBS Lett 511, 15-20.
Sanger,F. (1981). Determination of nucleotide sequences in DNA. Science 214, 1205-1210.
Schaeffer,H.J., Catling,A.D., Eblen,S.T., Collier,L.S., Krauss,A., and Weber,M.J. (1998). MP1: a MEK binding partner that enhances enzymatic activation of the MAP kinase cascade. Science 281, 1668-1671.
Schaeffer,H.J. and Weber,M.J. (1999). Mitogen-activated protein kinases: specific messages from ubiquitous messengers. Mol Cell Biol 19, 2435-2444.
Schroeter,H., Boyd,C.S., Ahmed,R., Spencer,J.P., Duncan,R.F., Rice-Evans,C., and Cadenas,E. (2003). c-Jun N-terminal kinase (JNK)-mediated modulation of brain mitochondria function: new target proteins for JNK signalling in mitochondrion-dependent apoptosis. Biochem J 372, 359-369.
Seger,R. and Krebs,E.G. (1995). The MAPK signaling cascade. FASEB J 9, 726-735.
Seta K and Sadoshima J. (2002). What is the unique function of SAPK3/p38gamma in cardiac myocytes? J Mol Cell Cardiol. 34, 597-600.
Sharrocks,A.D., Yang,S.H., and Galanis,A. (2000). Docking domains and substrate-specificity determination for MAP kinases. Trends Biochem Sci 25, 448-453.
Sheng,M. (1996). PDZs and receptor/channel clustering: rounding up the latest suspects. Neuron 17, 575-578.
Shih,T.Y., Hattori,S., Clanton,D.J., Ulsh,L.S., Chen,Z.Q., Lautenberger,J.A., and Papas,T.S. (1986). Structure and function of p21 ras proteins. Gene Amplif. Anal. 4, 53-72.
Singh,U.S., Pan,J., Kao,Y.L., Joshi,S., Young,K.L., and Baker,K.M. (2003). Tissue transglutaminase mediates activation of RhoA and MAP kinase pathways during retinoic acid-induced neuronal differentiation of SH-SY5Y cells. J Biol Chem. 278, 391-399.
150
Skelton,N.J., Koehler,M.F., Zobel,K., Wong,W.L., Yeh,S., Pisabarro,M.T., Yin,J.P., Lasky,L.A., and Sidhu,S.S. (2003). Origins of PDZ domain ligand specificity. Structure determination and mutagenesis of the Erbin PDZ domain. J Biol Chem. 278, 7645-7654.
Smeal,T., Binetruy,B., Mercola,D.A., Birrer,M., and Karin,M. (1991). Oncogenic and transcriptional cooperation with Ha-Ras requires phosphorylation of c-Jun on serines 63 and 73. Nature 354, 494-496.
Smith,J.A., Poteet-Smith,C.E., Malarkey,K., and Sturgill,T.W. (1999). Identification of an extracellular signal-regulated kinase (ERK) docking site in ribosomal S6 kinase, a sequence critical for activation by ERK in vivo. J Biol Chem. 274, 2893-2898.
Songyang,Z., Blechner,S., Hoagland,N., Hoekstra,M.F., Piwnica-Worms,H., and Cantley,L.C. (1994). Use of an oriented peptide library to determine the optimal substrates of protein kinases. Curr. Biol 4, 973-982.
Songyang,Z., Fanning,A.S., Fu,C., Xu,J., Marfatia,S.M., Chishti,A.H., Crompton,A., Chan,A.C., Anderson,J.M., and Cantley,L.C. (1997). Recognition of unique carboxyl-terminal motifs by distinct PDZ domains. Science 275, 73-77.
Spence,H.J., Dhillon,A.S., James,M., and Winder,S.J. (2004). Dystroglycan, a scaffold for the ERK-MAP kinase cascade. EMBO Rep. 5, 484-489.
Srivastava,S., Osten,P., Vilim,F.S., Khatri,L., Inman,G., States,B., Daly,C., DeSouza,S., Abagyan,R., Valtschanoff,J.G., Weinberg,R.J., and Ziff,E.B. (1998). Novel anchorage of GluR2/3 to the postsynaptic density by the AMPA receptor-binding protein ABP. Neuron 21, 581-591.
Stanciu,M. and DeFranco,D.B. (2002). Prolonged nuclear retention of activated extracellular signal-regulated protein kinase promotes cell death generated by oxidative toxicity or proteasome inhibition in a neuronal cell line. J Biol Chem. 277, 4010-4017.
Stanciu,M., Wang,Y., Kentor,R., Burke,N., Watkins,S., Kress,G., Reynolds,I., Klann,E., Angiolieri,M.R., Johnson,J.W., and DeFranco,D.B. (2000). Persistent activation of ERK contributes to glutamate-induced oxidative toxicity in a neuronal cell line and primary cortical neuron cultures. J Biol Chem. 275, 12200-12206.
Steeg,P.S., Palmieri,D., Ouatas,T., and Salerno,M. (2003). Histidine kinases and histidine phosphorylated proteins in mammalian cell biology, signal transduction and cancer. Cancer Lett 190, 1-12.
Stein,B., Yang,M.X., Young,D.B., Janknecht,R., Hunter,T., Murray,B.W., and Barbosa,M.S. (1997). p38-2, a novel mitogen-activated protein kinase with distinct properties. J Biol Chem. 272, 19509-19517.
Stricker,N.L. and Huganir,R.L. (2003). The PDZ domains of mLin-10 regulate its trans-Golgi network targeting and the surface expression of AMPA receptors. Neuropharmacology 45, 837-848.
151
Suzuki,Y., Imai,Y., Nakayama,H., Takahashi,K., Takio,K., and Takahashi,R. (2001). A serine protease, HtrA2, is released from the mitochondria and interacts with XIAP, inducing cell death. Mol Cell 8, 613-621.
Takahashi,M., Gotoh,Y., Isagawa,T., Nishimura,T., Goyama,E., Kim,H.S., Mukai,H., and Ono,Y. (2003). Regulation of a mitogen-activated protein kinase kinase kinase, MLTK by PKN. J Biochem (Tokyo) 133, 181-187.
Takano,H., Komuro,I., Oka,T., Shiojima,I., Hiroi,Y., Mizuno,T., and Yazaki,Y. (1998). The Rho family G proteins play a critical role in muscle differentiation. Mol Cell Biol 18, 1580-1589.
Takayama,S., Sato,T., Krajewski,S., Kochel,K., Irie,S., Millan,J.A., and Reed,J.C. (1995). Cloning and functional analysis of BAG-1: a novel Bcl-2-binding protein with anti-cell death activity. Cell 80, 279-284.
Tanoue,T., Adachi,M., Moriguchi,T., and Nishida,E. (2000). A conserved docking motif in MAP kinases common to substrates, activators and regulators. Nat. Cell Biol 2, 110-116.
Taylor SW, Fahy E, Zhang B, Glenn GM, Warnock DE, Wiley S, Murphy AN, Gaucher SP, Capaldi RA, Gibson BW, and Ghosh SS. (2003). Characterization of the human heart mitochondrial proteome. Nat. Biotechnol. 21, 281-286.
Terret,M.E., Lefebvre,C., Djiane,A., Rassinier,P., Moreau,J., Maro,B., and Verlhac,M.H. (2003). DOC1R: a MAP kinase substrate that control microtubule organization of metaphase II mouse oocytes. Development 130, 5169-5177.
Theodosiou,A. and Ashworth,A. (2002). MAP kinase phosphatases. Genome Biol 3, REVIEWS3009.
Tibbles,L.A. and Woodgett,J.R. (1999). The stress-activated protein kinase pathways. Cell Mol Life Sci 55, 1230-1254.
Tortorella,L.L., Lin,C.B., and Pilch,P.F. (2003). ERK6 is expressed in a developmentally regulated manner in rodent skeletal muscle. Biochem Biophys Res Commun. 306, 163-168.
Tsai,S., Bartelmez,S., Sitnicka,E., and Collins,S. (1994). Lymphohematopoietic progenitors immortalized by a retroviral vector harboring a dominant-negative retinoic acid receptor can recapitulate lymphoid, myeloid, and erythroid development. Genes Dev. 8, 2831-2841.
Tsygankov,A.Y. (2003). Non-receptor protein tyrosine kinases. Front Biosci. 8, s595-s635.
Turner,C.E., Glenney,J.R., Jr., and Burridge,K. (1990). Paxillin: a new vinculin-binding protein present in focal adhesions. J Cell Biol 111, 1059-1068.
152
Uddin,S., Ah-Kang,J., Ulaszek,J., Mahmud,D., and Wickrema,A. (2004). Differentiation stage-specific activation of p38 mitogen-activated protein kinase isoforms in primary human erythroid cells. Proc Natl Acad Sci U S A 101, 147-152.
Ueyama,T., Kawashima,S., Sakoda,T., Rikitake,Y., Ishida,T., Kawai,M., Yamashita,T., Ishido,S., Hotta,H., and Yokoyama,M. (2000). Requirement of activation of the extracellular signal-regulated kinase cascade in myocardial cell hypertrophy. J Mol Cell Cardiol. 32, 947-960.
van Bilsen,M. and Chien,K.R. (1993). Growth and hypertrophy of the heart: towards an understanding of cardiac specific and inducible gene expression. Cardiovasc. Res 27, 1140-1149.
Vlahos,C.J., McDowell,S.A., and Clerk,A. (2003). Kinases as therapeutic targets for heart failure. Nat. Rev. Drug Discov. 2, 99-113.
Vojtek,A.B., Hollenberg,S.M., and Cooper,J.A. (1993). Mammalian Ras interacts directly with the serine/threonine kinase Raf. Cell 74, 205-214.
Vomastek,T., Schaeffer,H.J., Tarcsafalvi,A., Smolkin,M.E., Bissonette,E.A., and Weber,M.J. (2004). Modular construction of a signaling scaffold: MORG1 interacts with components of the ERK cascade and links ERK signaling to specific agonists. Proc Natl Acad Sci U S A 101, 6981-6986.
Walker,A.R., Walker,B.F., and Segal,I. (2004). Some puzzling situations in the onset, occurrence and future of coronary heart disease in developed and developing populations, particularly such in sub-Saharan Africa. J R. Soc. Health 124, 40-46.
Wang,W.L., Yeh,S.F., Chang,Y.I., Hsiao,S.F., Lian,W.N., Lin,C.H., Huang,C.Y., and Lin,W.J. (2003a). PICK1, an anchoring protein that specifically targets protein kinase Calpha to mitochondria selectively upon serum stimulation in NIH 3T3 cells. J Biol Chem. 278, 37705-37712.
Wang,W.L., Yeh,S.F., Chang,Y.I., Hsiao,S.F., Lian,W.N., Lin,C.H., Huang,C.Y., and Lin,W.J. (2003b). PICK1, an anchoring protein that specifically targets protein kinase Calpha to mitochondria selectively upon serum stimulation in NIH 3T3 cells. J Biol Chem. 278, 37705-37712.
Wang,X., McGowan,C.H., Zhao,M., He,L., Downey,J.S., Fearns,C., Wang,Y., Huang,S., and Han,J. (2000). Involvement of the MKK6-p38gamma cascade in gamma-radiation-induced cell cycle arrest. Mol Cell Biol 20 , 4543-4552.
Wang,X. and Proud,C.G. (1997). p70 S6 kinase is activated by sodium arsenite in adult rat cardiomyocytes: roles for phosphatidylinositol 3-kinase and p38 MAP kinase. Biochem Biophys Res Commun. 238, 207-212.
153
Wang,Y., Huang,S., Sah,V.P., Ross,J., Jr., Brown,J.H., Han,J., and Chien,K.R. (1998a). Cardiac muscle cell hypertrophy and apoptosis induced by distinct members of the p38 mitogen-activated protein kinase family. J Biol Chem. 273, 2161-2168.
Wang,Y., Su,B., Sah,V.P., Brown,J.H., Han,J., and Chien,K.R. (1998b). Cardiac hypertrophy induced by mitogen-activated protein kinase kinase 7, a specific activator for c-Jun NH2-terminal kinase in ventricular muscle cells. J Biol Chem. 273, 5423-5426.
Waskiewicz,A.J., Flynn,A., Proud,C.G., and Cooper,J.A. (1997). Mitogen-activated protein kinases activate the serine/threonine kinases Mnk1 and Mnk2. EMBO J 16, 1909-1920.
Westwick,J.K., Cox,A.D., Der,C.J., Cobb,M.H., Hibi,M., Karin,M., and Brenner,D.A. (1994). Oncogenic Ras activates c-Jun via a separate pathway from the activation of extracellular signal-regulated kinases. Proc Natl Acad Sci U S A 91, 6030-6034.
White,J.G., Amos,W.B., and Fordham,M. (1987). An evaluation of confocal versus conventional imaging of biological structures by fluorescence light microscopy. J Cell Biol 105, 41-48.
Whitmarsh,A.J., Cavanagh,J., Tournier,C., Yasuda,J., and Davis,R.J. (1998). A mammalian scaffold complex that selectively mediates MAP kinase activation. Science 281, 1671-1674.
Widmann,C., Gibson,S., Jarpe,M.B., and Johnson,G.L. (1999). Mitogen-activated protein kinase: conservation of a three-kinase module from yeast to human. Physiol Rev. 79, 143-180.
Wiltshire,C., Matsushita,M., Tsukada,S., Gillespie,D.A., and May,G.H. (2002). A new c-Jun N-terminal kinase (JNK)-interacting protein, Sab (SH3BP5), associates with mitochondria. Biochem J 367, 577-585.
Wolff,B., Sanglier,J.J., and Wang,Y. (1997). Leptomycin B is an inhibitor of nuclear export: inhibition of nucleo-cytoplasmic translocation of the human immunodeficiency virus type 1 (HIV-1) Rev protein and Rev-dependent mRNA. Chem. Biol 4, 139-147.
Woods,D.F. and Bryant,P.J. (1989). Molecular cloning of the lethal(1)discs large-1 oncogene of Drosophila. Dev. Biol 134, 222-235.
Wu,Y., Chen,Z., and Ullrich,A. (2003). EGFR and FGFR signaling through FRS2 is subject to negative feedback control by ERK1/2. Biol Chem. 384, 1215-1226.
Yaakov,G., Bell,M., Hohmann,S., and Engelberg,D. (2003). Combination of two activating mutations in one HOG1 gene forms hyperactive enzymes that induce growth arrest. Mol Cell Biol 23, 4826-4840.
Yamadori,T., Baba,Y., Matsushita,M., Hashimoto,S., Kurosaki,M., Kurosaki,T., Kishimoto,T., and Tsukada,S. (1999). Bruton's tyrosine kinase activity is negatively
154
regulated by Sab, the Btk-SH3 domain-binding protein. Proc Natl Acad Sci U S A 96, 6341-6346.
Yamamoto,Y., Mandai,K., Okabe,N., Hoshino,T., Nakanishi,H., and Takai,Y. (2002). Localization of mLin-7 at nectin-based cell-cell junctions. Oncogene 21, 2545-2554.
Yang,E., Zha,J., Jockel,J., Boise,L.H., Thompson,C.B., and Korsmeyer,S.J. (1995). Bad, a heterodimeric partner for Bcl-XL and Bcl-2, displaces Bax and promotes cell death. Cell 80, 285-291.
Yang,J., Drazba,J.A., Ferguson,D.G., and Bond,M. (1998a). A-kinase anchoring protein 100 (AKAP100) is localized in multiple subcellular compartments in the adult rat heart. J Cell Biol 142, 511-522.
Yang,S.H., Galanis,A., and Sharrocks,A.D. (1999). Targeting of p38 mitogen-activated protein kinases to MEF2 transcription factors. Mol Cell Biol 19, 4028-4038.
Yang,S.H., Yates,P.R., Whitmarsh,A.J., Davis,R.J., and Sharrocks,A.D. (1998b). The Elk-1 ETS-domain transcription factor contains a mitogen-activated protein kinase targeting motif. Mol Cell Biol 18, 710-720.
Yao,Z., Diener,K., Wang,X.S., Zukowski,M., Matsumoto,G., Zhou,G., Mo,R., Sasaki,T., Nishina,H., Hui,C.C., Tan,T.H., Woodgett,J.P., and Penninger,J.M. (1997). Activation of stress-activated protein kinases/c-Jun N-terminal protein kinases (SAPKs/JNKs) by a novel mitogen-activated protein kinase kinase. J Biol Chem. 272, 32378-32383.
Yu,C., Minemoto,Y., Zhang,J., Liu,J., Tang,F., Bui,T.N., Xiang,J., and Lin,A. (2004). JNK suppresses apoptosis via phosphorylation of the proapoptotic Bcl-2 family protein BAD. Mol Cell 13, 329-340.
Yue,T.L., Gu,J.L., Wang,C., Reith,A.D., Lee,J.C., Mirabile,R.C., Kreutz,R., Wang,Y., Maleeff,B., Parsons,A.A., and Ohlstein,E.H. (2000). Extracellular signal-regulated kinase plays an essential role in hypertrophic agonists, endothelin-1 and phenylephrine-induced cardiomyocyte hypertrophy. J Biol Chem. 275, 37895-37901.
Yusuf,S. (1998). The global problem of cardiovascular disease. Int. J Clin. Pract. Suppl 94, 3-6.
Zechner,D., Thuerauf,D.J., Hanford,D.S., McDonough,P.M., and Glembotski,C.C. (1997). A role for the p38 mitogen-activated protein kinase pathway in myocardial cell growth, sarcomeric organization, and cardiac-specific gene expression. J Cell Biol 139, 115-127.
Zha,J., Harada,H., Yang,E., Jockel,J., and Korsmeyer,S.J. (1996). Serine phosphorylation of death agonist BAD in response to survival factor results in binding to 14-3-3 not BCL-X(L). Cell 87, 619-628.
155
Zhu,J.H., Guo,F., Shelburne,J., Watkins,S., and Chu,C.T. (2003). Localization of phosphorylated ERK/MAP kinases to mitochondria and autophagosomes in Lewy body diseases. Brain Pathol. 13, 473-481.
156
Appendix I
Primer Name Sequence (5’ to 3’) Annealing Temp Used
Purpose
Lambda gt11 forward sequencing primer
GGT GGC GAC GAC TCC TGG AGC C 50°C Sequencing of library clones from SAPK3 antibody library screening
Lambda gt11 reverse sequencing primer
GAC ACC AGA CCA ACT GGT AAT G 50°C Sequencing of library clones from SAPK3 antibody library screening
SAPK3 Begin GCG CTT GGC AAA CAG CTC CGA 50°C Confirmation of SAPK3 insertion into the pBTM116 yeast vector by sequencing
SAPK3 End GCC CAC CCA TAC TTT GAG TCC 50°C Confirmation of SAPK3 insertion into the pBTM116 yeast vector by sequencing
SAPK3 SDM Forward GCC AGA GTT CCA TAG GAG ACA GCT CTG TGA AG
55°C Inserting a STOP codon into the SAPK3 insert to truncate the protein at amino acid 363 in the pBTM116 vector
pBTM116 Forward CAG CAG AGC TTC ACC ATT G 50°C Confirmation of SAPK3 site-directed mutagenesis in pBTM116 by sequencing
SAPK3 SDM Reverse CTT CAC AGA GCT GTC TCC TAT GGA ACT CTG GC
55°C Inserting a STOP codon into the SAPK3 insert to truncate the protein at amino acid 363 in the pBTM116 vector
Appendix I: List of Primers Used During the Course of this PhD Project
Primer Name Sequence (5’ to 3’) Annealing Temp Used
Purpose
pBTM116 Reverse ATC ATA AGA AAT TCG CCC G 50°C Confirmation of SAPK3 site-directed mutagenesis in pBTM116 by sequencing
M13-F Primer GTA AAA CGA CGG CCA GT 50°C Sequencing of pVP16 library clones from Yeast 2-hybrid screening
VP16-2 Primer GAG TTT GAG CAG ATG TTT ACC G 50°C Sequencing of pVP16 library clones from Yeast 2-hybrid screening
SAPK3 Forward GAA GAT CAC AGG GAC GCC CCC TCC
60°C RT-PCR of SAPK3 from mouse embryonic hearts
SAPK3 Reverse ACC CCC CAA ACC ACC CAG AGG TCG
60°C RT-PCR of SAPK3 from mouse embryonic hearts
OMPT7 Forward ATA CGA CTC ACT ATA GGG AGA CC 50°C Confirmation of the rat OMP25 sequence in pcDNA3(HA)
ScribF GTG CTG GAG TCC GAG TTG GTG ACA 56°C Colony screens of suspected Scribble clones from yeast two-hybrid screening
ScribR TCA GCA GGG AGA CAG CAT GGT CGT
56°C Colony screens of suspected Scribble clones from yeast two-hybrid screening
Appendix I continued: List of Primers Used During the Course of this PhD Project
Primer Name Sequence (5’ to 3’) Annealing Temp Used
Purpose
OMPSP6 Reverse GCT CTA GCA TTT AGG TGA CAC 50°C Confirmation of the rat OMP25 sequence in pcDNA3(HA)
OMP SDM Forward GAC GGA GAG CCG TGA GGA GTT CCT GTA GCT G
55°C Inserting a STOP codon into the OMP25 insert to truncate the protein at amino acid 177 in the pcDNA3 and pGEX-6P vector
OMP SDM Reverse CAG CTA CAG GAA CTC CTC ACG GCT CTC CGT C
55°C Inserting a STOP codon into the OMP25 insert to truncate the protein at amino acid 177 in the pcDNA3 and pGEX-6P vector
OMP GST Forward CTA GGA TCC ATG TTC CTG AGG GGG TAT AAG
50°C Subcloning full-length OMP25 from pcDNA3 vector into pGEX-6P vector
OMP GST Reverse GAG GAA TTC TCA GAG CTG CTT TCG GTA TCT CAC
50°C Subcloning full-length OMP25 from pcDNA3 vector into pGEX-6P vector
OMP NLS Forward CTC GGA TCC CCT CCA AAA AAG AAG AGA AAG GTA GCT ATG TTC CTG AGG GGG TAT AAG AGA GAG
40°C Inserting a Nuclear Localisation Signal (NLS) into the truncated OMP25 insert (1-177) at the N-terminus of the protein
OMP NLS Reverse GAA TCT AGA TCA CGG CTC TCC GTC 40°C Inserting a Nuclear Localisation Signal (NLS) into the truncated OMP25 insert (1-177) at the N-terminus of the protein
Appendix I continued: List of Primers Used During the Course of this PhD Project
Primer Name Sequence (5’ to 3’) Annealing Temp Used
Purpose
Sab 1 Forward SDM GCC TGG ATC TGC CCG CCC CTG TGT CCC TGT C
55°C To mutate serine 321 in the Sab protein to an alanine residue
Sab 2 Reverse SDM CCC TCA GCC GCG GTG CTG CTT TGG CTC TTA C
55°C To mutate serine 391 in the Sab protein to an alanine residue
Sab Site 1 Mut Forward GAG GCC TGG CAG CCT GAG TTC GAC CAG CCC TGA GGG CCT GTC AGA G
55°C To mutate the sequence surrounding Ser321 to that surrounding Ser391 (321/391 mutant)
Sab Site 1 Mut Reverse CTC TGA CAG GCC CTC AGG GCT GGT CGA ACT CAG GCT GCC AGG CCT C
55°C To mutate the sequence surrounding Ser321 to that surrounding Ser391 (321/391 mutant)
Sab Site 2 Mut Forward GCA GTA AGA GCC AAG ACC TCC CCT CCC CTG TGA GCC AGG CCT TGG
55°C To mutate the sequence surrounding Ser391 to that surrounding Ser321 (391/321 mutant)
Sab Site 2 Mut Reverse CCA AGG CCT GGC TCA CAG GGG AGG GGA GGT CTT GGC TCT TAC TGC
55°C To mutate the sequence surrounding Ser391 to that surrounding Ser321 (391/321 mutant)
Sab 1 Reverse SDM GAC AGG GAC ACA GGG GCG GGC AGA TCC AGG C
55°C To mutate serine 321 in the Sab protein to an alanine residue
Sab 2 Forward SDM GTA AGA GCC AAA GCA GCA CCG CCC CTG AGG G
55°C To mutate serine 391 in the Sab protein to an alanine residue
Appendix I continued: List of Primers Used During the Course of this PhD Project
Appendix I continued: List of Primers Used During the Course of this PhD Project
Primer Name Sequence (5’ to 3’) Annealing Temp Used
Purpose
323 Glu Forward GGA TCT GCC CAG CCC TGA GTC CCT GTC AGA G
55°C To mutate amino acid residue Val323 in the human Sab protein to a glutamic acid residue
323 Glu Reverse CTC TGA CAG GGA CTC AGG GCT GGG CAG ATC C
55°C To mutate amino acid residue Val323 in the human Sab protein to a glutamic acid residue
323 Ala Forward GGA TCT GCC CAG CCC TGC GTC CCT GTC AGA G
55°C To mutate amino acid residue Val323 in the human Sab protein to an alanine residue
323 Ala Reverse CTC TGA CAG GGA CGC AGG GCT GGG CAG ATC C
55°C To mutate amino acid residue Val323 in the human Sab protein to an alanine residue
324 Glu Forward GCC TGG ATC TGC CCA GCC CTG TGG AAC TGT CAG AG
55°C To mutate amino acid residue Ser324 in the human Sab protein to a glutamic acid residue
324 Glu Reverse CTC TGA CAG TTC CAC AGG GCT GGG CAG ATC CAG GC
55°C To mutate amino acid residue Ser324 in the human Sab protein to a glutamic acid residue
324 Ala Forward GGA TCT GCC CAG CCC TGT GGC CCT GTC AGA G
55°C To mutate amino acid residue Ser324 in the human Sab protein to an alanine residue
324 Ala Reverse CTC TGA CAG GGC CAC AGG GCT GGG CAG ATC C
55°C To mutate amino acid residue Ser324 in the human Sab protein to an alanine residue
Appendix III
Appendix III: Screening a rat heart cDNA library for SAPK3 with a SAPK3-specific monoclonal antibody
1° Screen 2° Screen-a screen of~1.6 x 105 clones producedone positive
-the positive clone was re-screened to further purify it to 5% of the population
3° Screen4° Screen-a final round of screening ensured the positive clonemade up 100% of the population
-re-screening again brought the percentage of positives to ~25%
Isolated DNA,sequencing results showed positive clone to be SAPK3