Download - The Promoter and 5' Flanking Sequences Controlling Human B29

The Promoter and 5’ Flanking Sequences Controlling Human B29 Gene Expression

By Alexis A. Thompson, William J. Wood Jr, Michael J. Gilly, Michael A. Damore, Sidne A. Omori, and Randolph Wall

The product of the B-cell-specific -gene (B29, Igp, CD79b) is essential for Ig-mediated B-cell activation via the B-cell antigen receptor complex (BCR) on human and murine B lymphocytes. To better understand the regulation of this pivotal gene, we have analyzed the human genomic DNA sequence upstream of the B29ATG start codon for transcriptional control activity. The human B29 gene lacks either a TATA or a CAAT box and transcription is initiated at multiple sites. The minimal promoter of the human 629 gene is contained within a 193-bp region 5‘ of these multiple start sites. This minimal promoter exhibits B-cell-specific activity and contains SPI, ETS, OCT. and IKAROS/LYF-1 transcription factor motifs. All these motifs are strikingly conserved in sequence and placement relative to the previously charac-

HE STRUCTURE AND function of Igs in normal and neoplastic B-cell development has been studied exten-

sively, but the nature of the B-cell antigen receptor complex has been only recently elucidated.’.’ All Ig isotypes on the surface of murine and human B lymphocytes are associated with heterodimeric complexes of two transmembrane proteins, designated mb-l (Iga, CD79a) and B29 (Igp, CD79b), which are encoded by the mb-l and B29 genes, respec- t i ~ e l y . ~ . ~ Membrane-bound Igs and mb-I-B29 heterodimers comprise the B-cell antigen receptor complex (BCR). The mb-l and B29 proteins are critical for the intracellular as- sembly, translocation, and cell surface display of the BCR complex on B lymphocytes?”’ Antigen binding to Ig in the BCR signals B-cell activation through the mb-l-B29 complexes in a manner analogous to that of the T-cell receptor and associated CD3 sub unit^.^.".'^ The cytoplasmic tails of B29 and mb-l contain highly conserved amino acid elements present in other signal transducing proteins in membrane receptor complexes (eg, CD3 c, 7, y , 6 chains, CD22, and Fc, receptor p and y chain^).'^.'^ These antigen receptor

T

From the Department of Pediatrics, Division of Hematology/On- cology, Gwynne Hazen Cherry Memorial Laboratories; and the De- partment of Microbiology and Immunology, UCLA School of Medi- cine and The Molecular Biology Institute, UCLA. Los Angeles, CA.

Submitted March 22, 1995; accepted August 21, 1995. Supported by Grants No. CAI2800 and GM40185 from the Na-

tional Institutes of Health (NIH; to R. W. ) and by a Minority Medical Faculty Development Award from the Robert Wood Johnson Foun- dation {A.A.T.). W.J.W. was supported by Institutional Training Grant No. CA09120. M.J.G. was supported by NIH National Institu- tional Research Service Awards No. CA09056 and CAO9120. S.A.O. was supported by National Science Foundation Fellowship RCD 8954888 and by Public Health Service Award No. NRSA GM07104.

Address reprint requests to Alexis A. Thompson, MD, Department of Pediatrics, UCLA School of Medicine, 10833 LeConte Ave, LOS Angeles, CA 90095.

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. section 1734 solely to indicate this fact. 0 1996 by The American Society of Hematology. 0006-4971/96/8702-0037$3.00/0

666

terired murine B29promoter. Additional upstream gene segments dramatically affected B29 minimal promoter activity. A newly identified motif called the B29 conserved sequence (BCS), found upstream of both human and murine B29 promoters, appears to stimulate 829 transcription through a novel mechanism. A single BCS had little effect either on the minimal B29 promoter or on a heterologous promoter. Instead, the BCS stimulated transcription by counteracting 5‘ negative regulatory DNA sequences that block the activity of the B29 minimal promoter in its absence. These findings indicate that B29 gene expression is controlled by the complex interplay of positive and negative regulatory elements. 0 1996 by The American Society of Hematology.

homology sequences (ARH1) associate with src kinase family members and other kinases to activate effector pathways that control B-lymphocyte growth and differentiation.l5.l6

Commitment to the B-cell lineage is marked in part by B29 gene expression in pro-B B29 gene expression is initiated before heavy chain rearrangement in both human and murine pro-B cells.’8s19 B29 mRNA is expressed throughout all stages of B-cell development, including terminally differentiated plasma cells, and provides a definitive marker for human B-cell leukemias and lymphomas. B29 is consis- tently found in association with cytoplasmic Ig F heavy chain in human pre-B-cell acute lymphoblastic leukemiam and B29 expression in the lymphocyte predominant subtype of Hodgkin’s disease has been used to confirm the B-cell origin of these neoplastic cells.’’

We recently reported the functional characterization of the murine B29 promoter.22.23 The murine B29 minimal promoter exhibiting high activity and B-cell specificity is 167-bp long. It lacks a TATA box or other unique transcription initiator element and exhibits multiple transcription initiation sites. The murine promoter contains a critical octamer motif (OCT), identical to the motifs in Ig light and heavy chain promoters and in the heavy chain intron enhancer, which controls its tissue-specific activity. DNA motifs binding members of the ETS, SP1, and IKAROSLYF-l families of transcription factors also contribute to the maximum activity of the murine B29 promoter.23

We previously isolated the human B29 gene and found a remarkable degree of sequence homology with the coding sequence of the murine gene, particularly in the transmembrane and cytoplasmic segments.” The exodintron organization of the human B29 gene is identical to that of the murine B29 gene.’8.25 The human B29 gene is a single copy gene located at human chromosome locus, 17q23.24 In the present report, we have isolated the region upstream of the human B29 gene and analyzed it for transcriptional control activity. Through a series of deletions and functional expression studies, we have delineated the minimal human B-cell-specific promoter. This promoter is virtually identical to its murine counterpart and contains the same array of DNA motifs shown to be transcription factor binding sites in the murine

Blood, Vol 87, No 2 (January 15). 1996: pp 666-673

For personal use only.on April 9, 2018. by guest www.bloodjournal.orgFrom

http://www.bloodjournal.org/

http://www.bloodjournal.org/site/subscriptions/ToS.xhtml

HUMAN 829 PROMOTER AND 5’ FLANKING SEQUENCES 667

B29 promoter. We find that the activity of the B29 minimal promoter is controlled by upstream negative and positive regulatory sequences. We have identified a new transcription control motif in this upstream region called the B29 conserved sequence (BCS) that is highly conserved in human and murine B29 genes. The BCS apparently functions as a positive transcription control element by counteracting the inhibitory activity of nearby DNA sequences on the minimal B29 promoter.

MATERIALS AND METHODS

Genomic clone isolation. A 6-kb EcoRI human genomic DNA fragment hybridizing with B29 5’ cDNA restriction fragments and synthetic oligonucleotides was cloned in both orientation^.'^ This plasmid (pBS27-I) was further digested with Kpn I creating a 2.7- kb EcoRI-Kpn I subclone (pBS27-IBIKpn I) containing the region upstream of the B29 coding region. Sequencing was performed by the dideoxy method of Sanger using,Sequenase (US Biochemical, Cleveland, OH). The nucleotide sequence has been submitted to GenBank (accession no. U22954).

Cell lines and culture conditions. The human cell lines used in these studies (729 B-lymphoblastoid, Namalwa B-cell, 697 pre-B- cell, H929 and RPM18226 myeloma cells, Jurkat T-cell leukemia, HL-60 promyelocytic leukemia cells, and HeLa cells) were maintained in RPMI 1640 medium supplemented with 2 mmol/L gluta- mine,and 10% fetal calf serum (Hyclone, Logan, UT). Nalm-6, a human pre-B leukemia, was grown in RPMI 1640 and 10% defined- iron supplemented newborn calf serum (Hyclone). All cells were grown at 37°C and 5% CO2 and were maintained at a maximum cell density of 2 X 106/mL.

RNAse protection assays. A 700-bp Apa I fragment of pBS27- 1BIKpn I containing the first exon of the B29 gene was subcloned into the pGEMSZf(-) vector (Promega, Madison, WI) and used as the template for in vitro transcription. Using 1 pg of Age I-linearized plasmid, a3’P-CTP (650 Cilmmol; ICN, Costa Mesa, CA), and SP6 RNA polymerase (20 U; Promega), a 450-bp RNA probe with high specific activity was synthesized. After DNAse treatment to remove the template, the probe was purified over a G-50 Sephadex spin column and 8 X IO4 cpm of the probe was ethanol precipitated with 20 pg of RNA and then hybridized at 48°C overnight. Unannealed probe was digested with a 1:lOO dilution of RNAse A / T 1 (Ambion, Austin, TX), and the protected fragments were separated on a 6% denaturing polyacrylamide gel. Gels were fixed and dried before autoradiography.

Reporter gene assays. Transient gene expression was performed by electroporation using vectors containing the bacterial gene, chloramphenicol acetyl transferase (CAT), as the reporter gene. An 800- bp Pst I fragment from pBS27-IBlKpn I encompassing the B29 transcription start site cluster was subcloned into the polylinker of the promoterless pCAT Basic vector (Promega) in the 5’ to 3’ orientation. The same fragment was cloned in reverse orientation into a pCAT Basic vector that has been modified to incorporate the multiple cloning site of pGEM5Zf(-) vector (Promega). A series of 5’ deletion mutants of both clones were prepared by exonuclease IIV mung bean nuclease treatment (Stratagene, La Jolla, CA). Sequencing was performed to delineate the 5’ ends.

A double-stranded synthetic oligomer, 5’ CCAAGAGGCTCT- GCTCTGGGCCCCTCCAGA 3’, corresponding to the BCS at -507 to -477 was inserted by blunt ligation in both orientations into the BamHl site downstream of the CAT gene in selected deletion constructs. This same oligomer was also cloned into a HindIII site in the 521 vector that contains the minimal c-fos promoter 5’ to the CAT gene.z6 A 133-bp HindIII-HincII genomic fragment that

included the BCS was isolated from the end of a reverse deletion mutant and also subcloned into 521.

Plasmids were transiently transfected into cell lines in culture by electroporation (BRL, Bethesda, MD). Samples of approximately 1 X lo7 cells suspended in RPMI 1 6 4 0 and 20% fetal calf serum were incubated on ice for 10 minutes, with 25 pg of test plasmid then electroporated at 1,180 pF and 625 VIcm. After being kept on ice for an additional 10 minutes, the samples were transferred to 10 mL of warm media and placed in a 37°C incubator. After 2 days, cells were harvested in 200 mmoVL K3P04, pH 7.8,2 mmol/L dithiothrei- tol, 30 mmol/L MgSO,,, and 10 mmol/L ATP. Cell extracts were analyzed for CAT reporter gene activity by acetylation of I4C-labeled chloramphenicol and thin-layer chromatography separation. All studies were normalized with 5 pg of cotransfected pRSV-luciferase plasmid to correct for differences in transfection efficiency. Measure- ments of luciferase enzyme activity from 30 pL of each cell extract in the presence of 100 pL of 1 mmoVL luciferin were performed on an automated injection luminometer.

Electrophoretic mobiliry shift assays. Crude nuclear extracts from the 697,729,8226, Jurkat, and HL-60 cell lines were prepared using the method previously described by Dignam et al,27 with some modifications. Tris-HC1 (pH 8) was used in place of HEPES in the extraction buffers and dialysate, and the optimized concentration of salt in the final extraction buffer was 0.4 m o m KCI. Binding reac- tions were performed with 10 pg of extract, 2 pg poly(d1-dC) (Phar- macia, Piscataway, NJ), and 10,000 cpm of gel purified yP3* end- labeled oligonucleotide or DNA fragment. Competition experiments were performed with 50-, 125-, and 500-fold excess of unlabeled probe. A double-stranded unrelated oligonucleotide with the following sequence was used as the nonspecific competitor: 5’TGCGAT- TTGCATATTA3’. Reaction products were analyzed on 5% nonde- naturing polyacrylamide gels (acrylamide: bisacrylamide 80: 1) in 0.5X TBE buffer.

RESULTS

5’ Sequence and transcription initiation sites in the human B29 gene. A 2.7-kb human genomic DNA fragment containing the first exon of the B29 gene was cloned using probes from the 5’ end of the human B29 cDNA ~equence.’~ The DNA sequence extending 1.3 kb upstream from the human B29 translation initiation codon is shown in Fig 1. The nucleotide sequence coding for the human B29 leader sequence is 76% identical to murine B29 leader sequence and exon 1 ends at the same 5’ splice junction as the murine B29 gene.“ As is the case for the murine B29 gene, the human B29 5’ sequence does not contain any sequence re- sembling a TATA or a CAAT box for several hundred nucleotides upstream of the coding sequence of exon 1 . The B29 gene, like many genes lacking a TATA box, has multiple transcription start sites.

RNAse protection assays were performed on RNA samples from human cell lines to identify the termini of B29 gene transcripts. The synthetic RNA probe used in these assays spanned exon 1 and extended 325 nucleotides 5’ of the ATG translation start codon. The results of these assays using RNA samples from B-lineage cell lines and a T-cell line are shown in Fig 2. Five protected RNA probe fragments were seen with RNA from two B-cell lines (Ramos and Namalwa, lanes 1 and 2, respectively), a pre-B-cell line (Nalm 6, lane 3), and a myeloma cell line (H929, lane 4). The absence of any protected fragments with RNA from the T-cell line (Jurkat, lane 5) is consistent with the B-cell




-977

-917

-857

- 797

-737

-677

-617

-557

-497

-437

-377

-317

-257

- 197

-137

-77

- 17

+44

+l04

+l64

GAGGTCGACA TAGGACGGAC AGGAGTCTCA CGACCTACCT CGGTGTCACG AGTCCTTGAC 126

TATATITGAG TGGAAACGCG GGGACGGGGA CCCAGGllAC GTCGGGGAAG TCTCTACGGG 180

AACACGTCCC GTGTTGTACG TGTTCACATG TGTCGTACGA ACGTCTGGAG TCAGAGCTGC 240

AGACAACAAT TCAACGCACT CAGAGTCCCA CAGTTAAGAA CTCCCTGAAG AAGCCCCCAG 300

TGGCTGCGTG GTGGATl lTC GCAAAGCTGT CTCCACCTAC ATCCACCCTG TITGGCAGCC 360

CCTACATACT CllTCACAGC ATGAGGAAGG GAGGCCTCTC ACCAAGACCT GGACTGAATC 420

v

v

TTCTCCCAGT GGCTGCCACA

CTCCACAGGG TCAACTTCCA

GCCCCTCCAG ATGCCTGACC

CCCGCTGGGT GAGGAATAGT

GGTGCCTATT TCGCTCACGG

CTGGCAGACG GCAGAGGGGA

CAGACAGAGG GGAGCACAGG

AGAGGACCCC AGCTGTGCTG

CAAAAGCCTG CCCTCCCCCA ETS

ZIZ$IGGCAGG AAGGGGCCTG

AGTTACACGT T C C T C C A A

@CS)

v

v

IKAROS/Lyf-l

+l

M A R

CCTGACCTGC TCTTGCTCCA GAACCTCTGT GGCTCCCATA v B29 CONSERVED SEQUENCE

ACATGGCTGC CTGCACTCCA G UAAUGC TCTGCTCTGG

TGGGTCTGTG GCTGCCCTGT CCTTCTTCAG TGCTCCTCTT

TCAGGACAGA GGAGCTAAGT TCAGGTTCAT TCATAGGACA

CCCAGGAATA GAGACTTGCC GGGCTCGGCC CTTCGGGGAG

GGCTGGCTGG CCCAGGGGAT GACCACCGGT GGGGTAAGCA

ClTCCCCCAG AAGACTGAGA GGCCCCCCAG AGGCATCCAC

CCCAAGCTGG GCGACCGCCA AACCTTAGCG GCCCAGCTGA OCT

GGGTCCCCGG AGAGCTGGTG CCTCCCCTGG GTCCCA

GT-GA @XG@iAGG GGACAGGCTG CAGCCGGTGC

GGAGCCTCGG ACGTTGTCAC GGGTITGGGG TCGGGGACAG

v

ETS SPl

0 0.

480

540

600

660

720

780

848

900

960

1020

1080

T H O M P S O N ET AL

Fig 1. Nucleotide sequence of the 5' flanking region of the human B29 gene. A 1.2-kb genomic fragment containing the first intron and exon and the B29 promoter is shown. The multiple transcription start sites IO1 are marked. The most 5' of these sites is designated +l. Consen- sus binding sites for octamer, ETS, Spl, and IKAROSlLyf-1

. . . . . . L A L S P V P S H W M V A L within the B29 promoter region are labeled. Arrows (7) indicate the 5' ends of deletion con- AGCAGTGACC . .

L L L L 5 intron 1 TA CAGAACCCAC GACGAGGCCT GTGGGGllTG CTCTCATCTC 1200

structs used in reporter gene assays. Nucleotide sequence of the first coding exon is in the

CAGCTGTCTG GC

specificity of this gene. RPM1 8226, a myeloma cell line that secretes A light chains (but not heavy chains), had no detectable B29 mRNA in Northern blots, and did not show any protected fragments in the RNAse protection assay (results not shown). These results indicate that transcription of the human B29 gene is initiated from a cluster of 5 start sites located 4 4 to 54 nucleotides upstream of the ATG codon (Fig 1). These data also confirm that human B29 gene transcripts are expressed throughout B-cell development and that the same dominant transcription start sites are used at all stages.'8*19.28

5' Sequences controlling human B29 gene transcription. DNA fragments produced by successive 5' deletions of the sequenced upstream region of the human B29 gene were inserted into the promoterless pCATBasic reporter vector and analyzed in transient transfection assays to identify regions with transcriptional activity. The ends of the DNA fragments resulting from these 5' deletions are noted in Fig 1. Figure 3 shows the mean stimulation of reporter CAT gene expression by different deletion constructs relative to

shaded area with the corresponding amino acid sequence directly above.

the promoterless pCATBasic vector. The -796-bp B29 5' DNA fragment produced a 17-fold induction in CAT activity in the human B-cell line, 729. Similar results were obtained when this plasmid was transfected into another human B- cell line, Namalwa; into the human pre-B-cell lines, Nalm- 6 and 697; and into the murine B-cell line, M12 (results not shown). This pCAT/-796 construct exhibited B-cell-specific activity as it failed to stimulate CAT activity in either HeLa cells or in Jurkat T cells (Table 1).

Further 5' deletions, producing DNA fragments ending at -643, -532, and -464 bp, successively decreased transcriptional activity. The CAT activity obtained with the -464 deletion fragment was reduced 90% from the activity of the -796 fragment (ie, -464 exhibited only 2-fold stimulation over the background expression with the promoterless pCATBasic vector; Fig 3). Transcription-stimulating activity then increased with further 5' deletion to -304 and reached a maximum with DNA fragment - 193 (Fig 3). The stimulatory activity of the -193 construct (ie, 16-fold) is equivalent to that of the -796 construct. The 193-bp fragment is the




HUMAN B29 PROMOTER AND 5' FLANKING SEQUENCES 669

A G C T 1 2 3 4 5 Fig 2. Ribonuclease protection assay. A genomic fragment ex-

tending 5 from the first intron was used t o prepare a 450-bp = P- labeled riboprobe that was hybridized t o 20 p g of Ramos B-cell (lane l), Namalwa B-cell (lane 2). Nalm 6 pre-B-cell (lane 3). H929 plasma cell (lane 4). and Jurkat T-cell (lane 51 total cellular RNA and treated with RNAse A and T1. Multiple protected fragments visible by autoradiography of a 6% polyacrylamide gel electrophoresis-urea gel are consistent with multiple transcription initiation sites noted in most TATA-less genes. The sequencing ladder prepared from the same genomic template allowed for precise localization of each transcription start site.

shortest active deletion construct and accordingly is designated the minimal B-cell-specific promoter. These changes in transcriptional activity were reproducibly seen in four independent transfections with the set of 5' DNA deletion constructs of the -796 B29 DNA fragment.

The 193-bp human B29 promoter strongly stimulated transcription in all B-lineage cell lines, but exhibited little activity over background in either Jurkat T cells or HeLa cells (Table 1). Like the murine B29 minimal promoter, the human B29 minimal promoter is B-cell-specific. This minimal promoter segment contains the same array of transcription factor motifs previously shown to regulate the activity and B-cell specificity of the murine B29 minimal pr~moter.'~ The A'IT- TGCAT sequence exactly corresponds to the canonical octamer motif (OCT).29.'0 Two ETS motifs immediately downstream of the OCT motif are putative binding sites for the B-cell and macrophage transcription factor, PU. I , as well as for other members of the ETS oncogene family.3"33 A motif for IKAROSLYF-I family members is located upstream of the OCT All these motifs are required for the activity of the murine B29 minimal promoter.23 The sequence in the human B29 minimal promoter containing these transcription factor motifs is 91% identical to the comparable sequence in the murine B29 minimal promoter (see Fig 6).

Activity ofthe BCS. We next analyzed the active regions upstream of the human B29 minimal promoter for other highly conserved sequences. One 29 nucleotide stretch was noted with 83% sequence identity to a sequence upstream of the murine B29 gene. This sequence (5' CCAAGAGGC- TCTGCTCTGGGCCCCTCCAG 3'), called the BCS, is cen- trally located in the -532 to -464 fragment. Deletion of this

.G c 20 c 25r

pCAT -796 -643 -532 -464 -304 -193

Fig 3. CAT reporter gene assays of the B29 5' flanking region. Deletion constructs as noted in Fig 1 were ligated into the promoterless pCAT basic vector and transiently transfected into 729 B cells. The average CAT activity of each construct was determined by fold induction relative t o the vector alone (CAT). All experiments were performed in triplicate and normalized for transfection effeciency by luciferase assay.

fragment produced a significant (5-fold) decrease in transcriptional activity (Fig 3). Deletion of the upstream DNA fragment containing the homologous sequence in the murine B29 gene also caused a significant decrease in transcriptional activity36 (unpublished results). To determine whether the BCS had inherent transcriptional activity, a double-stranded synthetic 29-bp oligomer of the BCS was inserted in both orientations upstream of the the c-fos promoter in the 521- CAT reporter gene vector. This basal promoter is 56-bp long, with a TATA box.26 Either orientation of the BCS produced less than a twofold increase in c-fos promoter CAT activity in transiently transfected 729 human B cells (results not shown). This indicates that the BCS only minimally affects the efficiency of transcription from a heterologous basal promoter. Next, the BCS 29-bp oligomer was inserted in both orientations upstream of the minimal B29 promoter and the -464 deletion construct. A single copy of the BCS oligomer in either orientation upstream of the 193-bp minimal B29

Table 1. Transcriptional Act ivw of B29 Promoter and 5' Region in Different Cell Lines

Normalized CAT Activity

Plasmids 729 HELA Jurkat

pCATBasic 1 1 1

pCAThuB29 (-796) 17 2 0.3 1 2 0.9 1.6 -t 0.5

pCAThuB29 (-194) 16.2 ? 4.8 2.2 t 1.2 2.3 -c 1.3

Mean induction of the CAT gene by the B29 minimal promoter (-193) and upstream sequences (-796) transfected into human 729 B cells, Jurkat T cells, and nonhematopoetic HeLA cells shows the tissue specificity of the control region.




670 THOMPSON ET AL

E’ S 15/ LL 0

A T pCAT -532 -464 -464 -193 -193/

BCS BCS

Fig 4. Transcriptional analysis of the B29 conserved sequence (BCSI. Double-stranded synthetic oligonucleotide corresponding to the BCS was ligated into selected CAT constructs and transiently transfected into 729 B cells, and the effect on CAT activity of each construct relative to the vector alone was measured. Results represent the mean CAT induction and standard deviation of three experiments. Reinsertion of the BCS sequences into the -464 construct from which it had been deleted resulted in CAT activity comparable t o the -532 construct that contains the sequences. The effect of the BCS on increasing CAT activation by the minimum promoter (-1931 is less dramatic.

promoter (-193/BCS) had little effect on minimal promoter activity (-193; Fig 4). However, the addition of a single copy of the BCS oligomer to the -464 deletion construct increased transcriptional activity fivefold, resulting in an transcriptional activity comparable to that seen with the -532 B29 gene fragment containing the BCS (Fig 4). Again. the BCS was equally active in either orientation. This result strongly suggests that the BCS is the principal active element in the human B29 gene sequences from -532 to -464. These results also suggest that the BCS acts on negative regulatory sequences in the -464 B29 gene construct rather than directly on the 193-bp minimal B29 promoter.

BCS factor binding studies. Electrophoretic mobility shift assays (EMSA) were used to detect complexes of nuclear factors bound to the BCS. In these studies, a double- stranded synthetic 29-bp oligonucleotide corresponding to the BCS sequence was incubated with nuclear extracts from human 729 B cells, 697 pre-B cells, 8226 plasmacytoma, Jurkat T cells, and HL-60 myeloid cells. The interaction of the end-labeled BCS oligonucleotide probe with nuclear proteins from 729 cells resulted in retarded mobility of a doublet protein-DNA complex (Fig S). The specificity of this interaction was established by the addition of increasing amounts of unlabeled double-stranded BCS oligonucleotide that resulted in the incremental loss of the retarded band.

An excess of an unrelated oligonucleotide competitor of similar size had no effect on BCS binding. Studies performed on 697 pre-B cells and H929 plasma cells gave results similar to those with 729 nuclear extracts (data not shown). Nuclear extracts from Jurkat T cells and 8226 myeloma cells (which contain no detectable B29 mRNA) yielded only nonspecific binding. No binding was detected in studies using nuclear extracts from HL-60 cells. Additional assays performed with a radiolabeled 130-bp genomic DNA fragment that contained the BCS also showed specific binding and competition of a multibanded complex, suggesting that sequences adjacent to the BCS motif may contribute to nuclear factor binding or stability. These EMSA results, combined with the reporter gene expression assays, strongly suggest that the BCS is an important regulatory element for B29 gene expression.

DISCUSSION

This report identifies the promoter and S’ flanking DNA sequences that regulate the expression of the human B29 gene. The human B29 minimal promoter is contained within a 193-bp DNA fragment that strongly stimulates transcrip-

Probe BCS Competitor - BCS - oct

molar excess 50 125 500 250

BCS -

1 2 3 4 5 6 Fig 5. Competitive electrophoretic mobility shift assay of the BCS

binding. Ten micrograms of nuclear extracts from 729 B cells was incubated at room temperature with 10,000 cpm of a radiolabeled BCS oligonucleotide for each reaction. In lanes 3 through 5, unlabeled BCS oligonucleotide at 50, 125, and 500 times molar excess (10. 25, and l00 ng, respectively) was added t o each reaction. In lane 6,50 ng (250x molar excess) of an unrelated double-stranded oligonucleotide (oct) containing an octamer motif was added as a nonspecific competitor.




HUMAN 829 PROMOTER AND 5‘ FLANKING SEQUENCES 67 1

Fig 6. Comparison of the human and murine B29 minimal B- cell-specific promoters. Tran- scription start sites in each are noted by arrows. The numbering in the murine promoter is from the dominant start site determined by primer extension. Con- sensus sequences for transcription factor binding sites are as noted. Regions surrounding the translation initiation site factor binding sites show very high de- grees of homology.

HUB29 CACCCC-ACCTGTGCTGCCCAAGCTGGGCGACCGC--CAAACCTTAGCCCCCCAGCTGACAMAGCCTG -193

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . W629 AACCCAAAGCTGTCCTACCCAGGCAGCACCACC-CTTCGAGTCCTAGCACACCAGCTGATG-AAG-CTG

-218

IKAROS/LYF-1 OCT ETS HUB29 C ~ C T C C C C C B G G G T C C C C G G A G A G C T G G T G C C T C C C C T G G G T C C C A ~ G G ~ G G G G C C T

MU629 C~CTCCCATAGGGTCCCTGCAGGGATCGTGGTGCCTCCCCTGGGTCTC~mGGGCATGG~GGGGCCT consensus C CCCCAAA T 5 GG

............................................................... ................................................................ AllTCCAT GACGAA

ETS SP1 HUB29 GGTSlAGGAACA~CAGGGACACGCTGCAGGCTGCAGCC~~GG~TG-CAGTTACACGTT~~----TTC-CTC ........................................... . . . . . ........................................... . . . . . W629 AAT~GAGGCGGAGAGGCACAAGCTCCACCCCAGGCTGACA--TACA-GTTACATGTTTCGCCC consensus GAGCAA GGCGGG

+b rwrb HUB29 C-AAGCAGCCTCGGACGTTGTCACGGGmGGGGGGTCGGGGACAGAGCAGTGAC~ . . . .... .......................... . . . .... .......................... MU629 CCAAA---CCTCC---------------TTGGGCTCAGAGAqGAGCAGTGACa

4 4

tion and exhibits B-cell-specific expression in transient transfection assays. This human B29 minimal promoter is functionally equivalent to the previously characterized murine B29 minimal pr~moter.’~ Comparison of the human and murine minimal promoters shows a striking pattern of sequence conservation related to the transcriptional activities of these gene segments (Fig 6). The human B29 minimal promoter contains two regions that are highly conserved in relation to the murine minimal promoter. These are separated by an intervening segment with a different length and lower sequence conservation in relation to the murine minimal promoter. The most highly conserved region in the human promoter (ie, -23 to -34) is 91% identical to the murine B29 promoter sequence (ie, -48 to -158) that contains all the transcription control motifs determined to control the activity of this promoter (Fig 6). The ATTTGCAT at -74 exactly matches the murine B29 octamer motif (OCT) and the canonical OCT motifs in Ig heavy and light chain gene promoters and the Ig heavy chain intron enhan~er.’~.~’ Muta- tion of this motif in the murine promoter completely abol- ished transcriptional activity.23 The two ETS boxes (CAG- GAA and GAGGAA) immediately downstream of the OCT are putative binding sites for the macrophage and B-cell- specific transcription factor PU.1 as well as other members of the ets oncogene family.31 A single consensus motif for SPl (GGCGGG) is located at position -42. The CCTCCC- CCA sequence at - 1 18 closely corresponds to the consensus motif for IKAROSLYF-1 family members that are known to control lymphocyte gene e x p r e ~ s i o n . ~ ~ . ~ ~ ~ ’ ~ Mutations in the SPl, ETS, and IKAROSLYF-l motifs all reduced the transcriptional activity of the murine B29 minimal promoter.23 The region immediately downstream of the IKAROSLYF-l motif (ie, -126 to -138) also contributed to the activity of the murine B29 minimal promoter in B cells.23 The in vitro footprint with purified LYF-1 extended

+l 4 -

through this region and this sequence is well conserved in the human B29 promoter sequence.

The region (ie, -22 to + 27) containing the mapped human B29 transcription start sites exhibits approximately 60% identity (incorporating numerous gaps) to the corresponding murine B29 promoter sequence (ie, nucleotides -8 to -47; Fig 6). The human B29 minimal promoter lacks a TATA box and transcription is initiated at 5 sites located 44 to 53 nucleotides upstream of the ATG codon. The multiple transcription initiation sites in the murine B29 promoter are more broadly distributed and lie 12 to 33 bp upstream of the ATG codon. Neither the location nor spacing of transcription start sites is conserved in human and murine B29 sequences. The murine sites only partially overlap those in the human B29 gene. Multiple transcription initiation sites have now been described in a number of other TATA-less lymphocyte- specific genes, including mb-I,” the surrogate light chains A 5 3 9 and Vpre-B,40 CD7,4’ CDlla;’ CD18,43.44 CD19,45 and CD22.I4 However, it is not known how transcription initia- tions are determined in these genes. TATA-less, GC-rich promoters in constitutively expressed housekeeping genes exhibit multiple transcription starts 40 to 80 bp downstream of multiple SPl motif^.^' Interestingly, the multiple start sites in both the human and murine B29 promoters are located 40 to 80 bp downstream of lone SPl motifs.

The second region of high sequence conservation in the human B29 minimal promoter (ie, +28 to +53) is 88% identical to the homologous murine sequence (ie,-7 to + 19; Fig 6). This region comprises 26 bp of 5’-untranslated (5’- UT) region directly preceding the ATG codon. It is notable that the sequence conservation in this region i s greater than that of the leader coding sequence. The function of this highly conserved 5”UT sequence is not known. The Kozak box directly preceding the ATG codon is the only known functional element in this sequence. This region in the mu-




672 THOMPSON ET AL

rine B29 sequence contains the major transcription initiation site (+ 1) and a minor start site (+g). However, the locations of transcription initiation sites in human and murine B29 genes do not exhibit any discernable spatial relationship to this highly conserved sequence.

The region upstream of the B29 minimal promoter apparently contains multiple elements that stimulate and inhibit B29 gene transcription. The quite substantial loss in transcription activity (ie, 15-fold) seen with 5' deletions from -796 to -464 suggests that this region contains multiple elements that exert positive influences on the B29 minimal promoter. In contrast, the -464 fragment appears to contain sequences that exert a powerful dominant negative effect on the activity of the downstream B29 minimal promoter. The activity of construct -464 was 15-fold lower than that of the B29 minimal promoter in B-lineage cells. Negative regulatory elements may extend into the DNA fragment ending at -304, which showed less activity than the B29 minimal promoter. Collectively, these functional expression studies indicate that the region upstream of the human B29 minimal promoter contains a complex array of both positive and negative transcription control elements. Studies are in progress to identify the functional elements in this region and to determine if they collectively function as enhancers or silencers controlling B29 gene specificity and expression.

One positive 5' regulatory element, initially identified by its high sequence conservation in both human and murine B29 5' regions, is the BCS. The BCS is located in an upstream region which stimulates B29 transcription. Deletion of the 5' segment containing the BCS (ie, -532 to -464) produced a fivefold decrease in transcriptional activity. The sequence of the BCS does not resemble any known transcription factor motif, suggesting that this may represent a novel regulatory element. Studies on the effects of an isolated BCS on either homologous or heterologous promoters and on the -464 B29 gene segment confirm this suggestion. A single 29-bp BCS element had only minimal effects (52-fold) on the 193-bp B29 minimal promoter or a 56-bp c-fos promoter. In contrast, insertion of a single BCS upstream of the -464 construct increased transcriptional activity to the level seen with the -532 construct containing the BCS. These results suggest that the BCS stimulates transcription by counteracting nearby negative regulatory elements rather than by acting directly on the B29 promoter. A similar mode of regulation has been reported in the K intron enhancer in which the inhibitory activity of a 27-bp negative segment (KNE) was prevented by an adjacent 30-bp positive segment ( K B S ) . ~ ~ Interestingly, dimerized K BS segments had no effect on the transcriptional activity of the c-fos pr~moter.~' Like the BCS, the KBS apparently lacks significant transcriptional activity outside of its context in the K intron enhancer.

The stimulatory activity of the BCS may be mediated by specific nuclear proteins. Specific nuclear protein complexes were readily detected in EMSA using a 29-bp oligomer BCS. Specific competition with the BCS oligomer establishes that this sequence is bound by proteins in the complexes. It is possible that additional sequences in the 130-bp DNA fragment may be required for the formation or stabilization of the BCS-binding protein complexes. The BCS-binding activ-

ity was tissue-specific and was detectable at all stages of B- cell development. Interestingly, the BCS complex was not seen in the RPM1 8226 myeloma cell line that does not express B29 &A.

This report continues our exploration of the human B29 gene and increases our understanding of its regulation. This gene plays a critical role in the cell surface display of membrane Ig and in signal transduction and B-cell activation through the B-cell antigen receptor complex. Resolution of the molecular features regulating B29 gene expression should provide insights into potential mechanisms for disease states resulting from abnormal antigen receptor complex expression or function.

REFERENCES

I . Van Noesel CJM, van Lier RAW: Architecture of the human B-cell antigen receptors. Blood 82:363, 1993

2. Reth M, Hombach J, Wienands J, Campbell KS, Chien N. Justement LB, Cambier JC: The B-cell antigen receptor complex. Immunol Today 12:196, 1991

3. Venkitaraman AR, Williams GT, Dariavach P, Neuberger MS: The B-cell antigen receptor of the five immunoglobulin classes. Nature 352:777, 1991

4. Lankester AC, van Schinjndel GMW, Fromme J, Cordell JL, van Lier RAW, van Noesel CJM: Evidence for a direct physical interaction of membrane IgM, IgD, and IgG with the B29 gene product. J Immunol 152:2157, 1994

5. Van Noesel CJM, Brouns GS, van Schijndel GMW, Bende RJ, Mason DY, Borst J, van Lier RAW: Comparison of human B cell antigen receptor complexes: Membrane-expressed forms of immunoglobulin (Ig)M, IgD, and IgG are associated with structurally related heterodimers. J Exp Med 175:151 I , 1992

6. Campbell KS, Hager ET, Friedrich RJ, Cambier JC: IgM antigen receptor complex contains phosphoprotein products of B29 and mb-l genes. Proc Natl Acad Sci USA 88:3982, 1991

7. Grupp SA, Campbell KS, Mitchell R N , Cambier JC, Abbas AK: Signalling-defective mutants of the B lymphocyte antigen receptor fail to associate with lga and Igply. J Biol Chem 268:25776, 1993

8. Sanchez M, Misulovin 2, Burkhardt AL, Mahajan S, Costa T, Franke R, Bolen JB, Nussenweig M: Signal transduction by immunoglobulin is mediated through Iga and Igp. J Exp Med 178:1049, 1993

9. Ishihara K, Wood WJ, Damore M, Hermanson GG, Wall R, Kincade PW: B29 gene products complex with immunoglobulins of B lymphocytes. Roc Natl Acad Sci USA 89:633, 1992

10. Matsuuchi L, Gold MR, Travis A, Grosschedl R, DeFranco AL, Kelly RB: The membrane IgM-associated proteins mb-l and B29 are sufficient to promote surface expression of a partially functional B-cell antigen receptor in a nonlymphoid cell line. Proc Natl Acad Sci USA 89:3404, 1992

11. Costa TE, Franke RR, Sanchez M, Misulovin Z, Nussenweig MC: Functional reconstitution of an immunoglobulin antigen receptor in T cells. J Exp Med 175:1669, 1992

12. Burkhardt AL, Costa T, Misulovin Z, Stealy B, Bolen JB, Nussenweig MC: Iga and lgp are functionally homologous to the signalling proteins of the T-cell receptor. Mol Cell Biol 14:1095, I994

13. Retb M: Antigen receptor tail clue. Nature 338:383, 1989 14. Wilson GL, Najfeld V, Kozlow E, Menninger J, Ward D,

Kehrl JH: Genomic structure and chromosomal mapping of the human CD22 gene. J Immunol 115013, 1993

15. Clark MR, Campbell KS, Kazlaukas A, Johnson SA, Hertz




HUMAN 829 PROMOTER AND 5’ FLANKING SEQUENCES 673

M, Potter TA, Pleiman C, Cambier JC: The B cell antigen receptor complex: Association of Iga and IgP with distinct cytoplasmic ef- fectors. Science 258:123, 1992

16. Lin J, Justement LB: The rnb-lIB29 heterodimer couples the B cell antigen receptor to multiple src family protein tyrosine kinases. J Immunol 149:1548, 1992

17. Hagman J, Grosschedl R: Regulation of gene expression at early stages of B-cell differentiation. Cum Opin Immunol 6:222, 1994

18. Hermanson GC, Eisenberg D, Kincade PW, Wall R: B29: A member of the immunoglobulin gene superfamily exclusively expressed on B-lineage cells. Proc Natl Acad Sci USA 85:6890, 1988

19. Hashimoto S, Gregersen PK, Chiorazzi N: The human Ig-P cDNA sequence, a homologue of murine B29, is identical in B cell and plasma cell lines producine all the human Ig isotypes. J Immunol 150:49 1, 1993

20. Mason DY, van Noesel CJM, Cordell JL, Comans-Bitter WM, Micklem K, Tse AGD, van Lier RAW, van Dongen JJM: The B29 and mb-l polypeptides are differentially expressed during human B cell differentiation. Eur J Immunol 22:2753, 1992

21. Kuzu I, Jones M, Gatter KC, Mason DY: Expression of the Ig-associated heterodimer (mb-l and B29) in Hodgkin’s disease. Histopathology 22:141, 1993

22. Hermanson GC, Briskin M, Sigman D, Wall R: Immunoglob- ulin enhancer and promoter motifs 5’ of the B29 B-cell-specific gene. Proc Natl Acad Sci USA 86:7341, 1989

23. Omori SA, Wall R: Multiple motifs regulate the B-cell-specific promoter of the B29 gene. Proc Natl Acad Sci USA 90:11723, 1993

24. Wood WJ, Thompson AA, Korenberg J, Chen X-N, May W, Wall R, Denny C T Isolation and chromosomal mapping of the human immunoglobulin-associated B29 gene (IgP). Genomics 16:187, 1993

25. Hashimoto S, Chiorazzi N, Gregersen PK. The complete sequence of the human CD79b (IgPIB29) gene: Identification of a conserved exodintron organization, immunoglobulin-like regulatory regions, and allelic polymorphism. Immunogenetics 40:145, 1994

26. Gilman MZ, Wilson RN, Weinberg RA: Multiple protein- binding sites in the 5‘ flanking region regulate c-fos expression. Mol Cell Biol 6:4305, 1986

27. Dignam JD, Lebovits RM, Roeder RC: Accurate transcription initiation by RNA polymerase I1 in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res 11: 1475, 1983

28. Verschuren MCM, Comans-Bitter WM, Kapteijn CAC, Ma- son DY, Brouns CS, Borst J, Drexler HG, van Dongen JJM: Tran- scription and protein expression of mb-l and B29 genes in human hematopoietic malignancies and cell lines. Leukemia 7:1939, 1993

29. Parslow TG, Blair DL, Murphy WJ, Granner DK: Structure. of the 5’ end of immunoglobulin genes: A novel conserved sequence. Proc Natl Acad Sci USA 81:2650, 1984

30. Falkner FG, Zachau HG: Correct transcription of an immunoglobulin kappa gene requires an upstream fragment containing conserved sequence elements. Nature 310:71, 1984

31. Klemsz MJ, McKercher SR, Celada A, Van Beveren C, Maki RA: The macrophage and B cell-specific transcription factor PU.1 is related to the ets oncogene. Cell 61:113, 1990

32. Goebl MC: The PU.l transcription factor is the product of the putative oncogene Spi-l. Cell 61:1165, 1990

33. Nelson B, Tian G, Erman B, Gregoire J, Maki R, Graves B, Sen R: Regulation of lymphoid-specific immunoglobulin 1.1 heavy chain enhancer by ETS-domain proteins. Science 261:82, 1993

34. Molnar A, Georgopoulos K: The Ikaros gene encodes a family of functionally diverse zinc finger DNA-binding proteins. Mol Cell Biol 14:8292, 1994

35. Lo K, Landau NR, Smale ST: Lyf- 1, a transcriptional regula- tor that interacts with a novel class of promoters for lymphocyte- specific genes. Mol Cell Biol 115229, 1991

36. Thompson AA, Omori S, Wall R: Characterization of the promoter and upstream region of the murine and human immunoglobulin associated B29 genes. Blood 80:55a, 1992 (abstr, suppl 1)

37. Smale ST: Core promoter architecture for eukaryotic protein- coding genes, in Conway RC, Conway JW (eds): Transcription: Mechanisms and Regulation. New York, NY, Raven, 1994, p 63

38. Travis A, Hagman J, Groschedl R: Heterogenously initiated transcription from the preB- and B-cell-specific mb-l promoter: Analysis of the requirement for upstream factor-binding sites and initiation site sequences. Mol Cell Biol 115756, 1991

39. Kudo A, Sakaguchi N, Melchers F: Organization of the murine Ig-related X, gene transcribed selectively in pre-B lymphocytes. EMBO J 6:103, 1987

40. Kudo A, Melchers F: A second gene VpreB in the A, locus of the mouse, which appears to be selectively expressed in pre-B lymphocytes. EMBO J 6:2267, 1987

41. Schanberg LE, Fleenor DE, Kurtzberg J, Haynes BF, Kauf- man RE: Isolation and characterization of the genomic human CD7 gene: Structural similarity with the murine Thy-l gene. Proc Natl Acad Sci USA 88:603, 1991

42. Nueda A, Lopez-Cabreras M, Vara A, Corbi AL: Character- ization of the CDlla integrin gene promoter. J Biol Chem 268:19305, 1993

43. Agura ED, Howard M, Collins SJ: Identification and sequence analysis of the promoter for the leukocyte integrin P-subunit (CD 18): A retinoic acid-inducible gene. Blood 79502, 1992 44. Rosmarin AG, Levy R, Tenen DC: Cloning and analysis of

the CD18 promoter. Blood 79:2598, 1992 45. Kozmik Z, Wang S, Dorfler P, Adams B, Busslinger M: The

promoter of the CD19 gene is a target for the B-cell-specific transcription factor BSAP. Mol Cell Biol 12:2662, 1992

46. Saksela K, Baltimore D: Negative regulation of immunoglobulin kappa light-chain gene transcription by a short sequence homologous to the murine B1 repetitive element. Mol Cell Biol 13:3698, 1993




1996 87: 666-673

AA Thompson, WJ Jr Wood, MJ Gilly, MA Damore, SA Omori and R Wall expressionThe promoter and 5' flanking sequences controlling human B29 gene

http://www.bloodjournal.org/content/87/2/666.full.htmlUpdated information and services can be found at:

Articles on similar topics can be found in the following Blood collections

http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requestsInformation about reproducing this article in parts or in its entirety may be found online at:

http://www.bloodjournal.org/site/misc/rights.xhtml#reprintsInformation about ordering reprints may be found online at:

http://www.bloodjournal.org/site/subscriptions/index.xhtmlInformation about subscriptions and ASH membership may be found online at:

Copyright 2011 by The American Society of Hematology; all rights reserved.Society of Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American


http://www.bloodjournal.org/content/87/2/666.full.html

http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests

http://www.bloodjournal.org/site/misc/rights.xhtml#reprints

http://www.bloodjournal.org/site/subscriptions/index.xhtml





Download - The Promoter and 5' Flanking Sequences Controlling Human B29

Top Related