![Page 1: Models in laboratory research The unique position of the ...rusynlab.unc.edu/publications/course_data/Rodent Models.pdf · The unique position of the mouse as a model Mouse genetics](https://reader031.vdocuments.site/reader031/viewer/2022022505/5aba94027f8b9a441d8bcbde/html5/thumbnails/1.jpg)
Overview
Models in laboratory research
The unique position of the mouse as a model
Mouse genetics 101
Genetic engineering for hypothesis testing
Genetic variation
![Page 2: Models in laboratory research The unique position of the ...rusynlab.unc.edu/publications/course_data/Rodent Models.pdf · The unique position of the mouse as a model Mouse genetics](https://reader031.vdocuments.site/reader031/viewer/2022022505/5aba94027f8b9a441d8bcbde/html5/thumbnails/2.jpg)
Why Use Models?
Allows for controlled experiments
Environmental variables can be controlled
Dosage or exposures can be controlled
Experiments can be replicated
![Page 3: Models in laboratory research The unique position of the ...rusynlab.unc.edu/publications/course_data/Rodent Models.pdf · The unique position of the mouse as a model Mouse genetics](https://reader031.vdocuments.site/reader031/viewer/2022022505/5aba94027f8b9a441d8bcbde/html5/thumbnails/3.jpg)
![Page 4: Models in laboratory research The unique position of the ...rusynlab.unc.edu/publications/course_data/Rodent Models.pdf · The unique position of the mouse as a model Mouse genetics](https://reader031.vdocuments.site/reader031/viewer/2022022505/5aba94027f8b9a441d8bcbde/html5/thumbnails/4.jpg)
![Page 5: Models in laboratory research The unique position of the ...rusynlab.unc.edu/publications/course_data/Rodent Models.pdf · The unique position of the mouse as a model Mouse genetics](https://reader031.vdocuments.site/reader031/viewer/2022022505/5aba94027f8b9a441d8bcbde/html5/thumbnails/5.jpg)
![Page 6: Models in laboratory research The unique position of the ...rusynlab.unc.edu/publications/course_data/Rodent Models.pdf · The unique position of the mouse as a model Mouse genetics](https://reader031.vdocuments.site/reader031/viewer/2022022505/5aba94027f8b9a441d8bcbde/html5/thumbnails/6.jpg)
Genes
Phenotypes
Genes
EnvironmentEnvironment
StochasticProcesses
Chapel Hill
Genes
![Page 7: Models in laboratory research The unique position of the ...rusynlab.unc.edu/publications/course_data/Rodent Models.pdf · The unique position of the mouse as a model Mouse genetics](https://reader031.vdocuments.site/reader031/viewer/2022022505/5aba94027f8b9a441d8bcbde/html5/thumbnails/7.jpg)
Effects of Genes Can Be Complex
Gene
Phenotype
Phenotypes
Genes
Pleiotropy
Heterogeneity
![Page 8: Models in laboratory research The unique position of the ...rusynlab.unc.edu/publications/course_data/Rodent Models.pdf · The unique position of the mouse as a model Mouse genetics](https://reader031.vdocuments.site/reader031/viewer/2022022505/5aba94027f8b9a441d8bcbde/html5/thumbnails/8.jpg)
gataccagattagtagttagagttgagagtccgctagatcgc
Gene Content
DETECTION
GeneticTools
Mutagenesis
Genetics
Unique Position of the MouseBiologicToolsHistology
MolecularProfile
ProteomeContent
Strain: A
/JID
: XX
XX
Tissue: col
CHARACTERIZATION
Physiology
EngineeringTools
VALIDATION
TransgenicsKnockouts
Knockins
![Page 9: Models in laboratory research The unique position of the ...rusynlab.unc.edu/publications/course_data/Rodent Models.pdf · The unique position of the mouse as a model Mouse genetics](https://reader031.vdocuments.site/reader031/viewer/2022022505/5aba94027f8b9a441d8bcbde/html5/thumbnails/9.jpg)
Why Mice As an Experimental Organism?
Short life cycle
Easily bred
High fecundity
Hardy
Requires little space
Large amount of phenotypic variation
Easy to genetically engineer
Mammalian species
![Page 10: Models in laboratory research The unique position of the ...rusynlab.unc.edu/publications/course_data/Rodent Models.pdf · The unique position of the mouse as a model Mouse genetics](https://reader031.vdocuments.site/reader031/viewer/2022022505/5aba94027f8b9a441d8bcbde/html5/thumbnails/10.jpg)
Evolutionary Relationships
0 myr bp1002003004005006007008009001000
C. elegans
D. melanogaster
Xenopus
Mice
Humans
![Page 11: Models in laboratory research The unique position of the ...rusynlab.unc.edu/publications/course_data/Rodent Models.pdf · The unique position of the mouse as a model Mouse genetics](https://reader031.vdocuments.site/reader031/viewer/2022022505/5aba94027f8b9a441d8bcbde/html5/thumbnails/11.jpg)
The Mus Species Group
domesticusmusculuscastaneusbactrianus
macedonicus (Greece>Iran>Israel)
spicilegus (Austria.Ukraine>Bulgaria)
spretus (Spain/N. Africa)
caroli (Indonesia)
cookii (India/S.E. Asia)
cervicolor (Nepal/S.E. Asia)
booduga (India/Burma/Pakistan)
dunni (India/Sumatra)
TheM. musculus
group
6.0 3.05.0 4.0 2.0 1.0 0 myr bp
![Page 12: Models in laboratory research The unique position of the ...rusynlab.unc.edu/publications/course_data/Rodent Models.pdf · The unique position of the mouse as a model Mouse genetics](https://reader031.vdocuments.site/reader031/viewer/2022022505/5aba94027f8b9a441d8bcbde/html5/thumbnails/12.jpg)
Genetic Stocks
Outbred• segregating many alleles• ex, Swiss mice, Wistar rats
Hybrid• isogenic until bred• ex, B6D2, B6SJL
Inbred• genetically identical (isogenic)• ex, C57BL/6J
Mutant/Engineered• specific defects• may or may not be ‘genetically clean’
![Page 13: Models in laboratory research The unique position of the ...rusynlab.unc.edu/publications/course_data/Rodent Models.pdf · The unique position of the mouse as a model Mouse genetics](https://reader031.vdocuments.site/reader031/viewer/2022022505/5aba94027f8b9a441d8bcbde/html5/thumbnails/13.jpg)
Exercise A
You have developed a compound that you think will help to prevent rejection of transplanted hearts, and you want to test this experimentally.
The experiment will involve heart grafts between a donor and recipient mouse (whose own heart is not removed) with a control group and one treated with the compound.
The following mouse strains are available: outbred ICR and CD1 and inbred C57BL/6J, A/J, and FVB/NJ.
Which strains will you use as donor and recipient? Why?
![Page 14: Models in laboratory research The unique position of the ...rusynlab.unc.edu/publications/course_data/Rodent Models.pdf · The unique position of the mouse as a model Mouse genetics](https://reader031.vdocuments.site/reader031/viewer/2022022505/5aba94027f8b9a441d8bcbde/html5/thumbnails/14.jpg)
Exercise B
You also need to test the potential toxicity of the compound, and will want to do a long-term study with control and treated mice. You know it is not acutely toxic.
Being a toxicologist, you reason that in this case since you wish to model humans who are genetically heterogeneous, you decide to use outbred genetically heterogeneous ICR mice, the strategy used by virtually all toxicologists.
Do you decide to go with your initial intuition? Why?
![Page 15: Models in laboratory research The unique position of the ...rusynlab.unc.edu/publications/course_data/Rodent Models.pdf · The unique position of the mouse as a model Mouse genetics](https://reader031.vdocuments.site/reader031/viewer/2022022505/5aba94027f8b9a441d8bcbde/html5/thumbnails/15.jpg)
Identify the ‘Experimental Unit’
The unit of randomization
The experimental units must be capable of being assigned to different treatments
Could be:a cage of animalsa single animalan animal for a period of timea well in a tissue culture dish
![Page 16: Models in laboratory research The unique position of the ...rusynlab.unc.edu/publications/course_data/Rodent Models.pdf · The unique position of the mouse as a model Mouse genetics](https://reader031.vdocuments.site/reader031/viewer/2022022505/5aba94027f8b9a441d8bcbde/html5/thumbnails/16.jpg)
The Problem With Genetic Heterogeneity
Treated Control
beagle chickenmouse crowhorse froggerbil hamsterlion beavercat dograbbit toad
![Page 17: Models in laboratory research The unique position of the ...rusynlab.unc.edu/publications/course_data/Rodent Models.pdf · The unique position of the mouse as a model Mouse genetics](https://reader031.vdocuments.site/reader031/viewer/2022022505/5aba94027f8b9a441d8bcbde/html5/thumbnails/17.jpg)
A Better Design
Treated Control
beagle beaglemouse mousehorse horsegerbil gerbillion lioncat catrabbit rabbit
![Page 18: Models in laboratory research The unique position of the ...rusynlab.unc.edu/publications/course_data/Rodent Models.pdf · The unique position of the mouse as a model Mouse genetics](https://reader031.vdocuments.site/reader031/viewer/2022022505/5aba94027f8b9a441d8bcbde/html5/thumbnails/18.jpg)
A Better Design
Treated Control
C57BL/6J C57BL/6JA/J A/JFVB/NJ FVB/NJDBA/2J DBA/2JSWR/J SWR/JSJL/J SJL/JBALB/cJ BALB/cJ
![Page 19: Models in laboratory research The unique position of the ...rusynlab.unc.edu/publications/course_data/Rodent Models.pdf · The unique position of the mouse as a model Mouse genetics](https://reader031.vdocuments.site/reader031/viewer/2022022505/5aba94027f8b9a441d8bcbde/html5/thumbnails/19.jpg)
Variable Results With Heart Transplants
‘We transplanted hearts of young … ICR into … recipient CD1. An outbred strain was selected since such animals are usually heartier and easier to handle …
We are puzzled by our results … palpable heart beats were evident in the saline group long after acute rejections … were expected … Results in the experimental groups varied considerably …’
![Page 20: Models in laboratory research The unique position of the ...rusynlab.unc.edu/publications/course_data/Rodent Models.pdf · The unique position of the mouse as a model Mouse genetics](https://reader031.vdocuments.site/reader031/viewer/2022022505/5aba94027f8b9a441d8bcbde/html5/thumbnails/20.jpg)
Exercise C: Power Calculations for Sample Size
Barbiturate sleeping time
Strain Mean Std. Dev.
BALB/c (inbred) 40 4ICR (outbred) 40 15
What sample size would be needed to detect a 10% change in mean, with a 90% power and 5% significance level using a 2-sample t-test?
Data from Jay (1955) Proc Soc exp Biol Med 90:378
![Page 21: Models in laboratory research The unique position of the ...rusynlab.unc.edu/publications/course_data/Rodent Models.pdf · The unique position of the mouse as a model Mouse genetics](https://reader031.vdocuments.site/reader031/viewer/2022022505/5aba94027f8b9a441d8bcbde/html5/thumbnails/21.jpg)
Power Calculations for Sample Size
BALB/c (inbred) 23ICR (outbred) 297
![Page 22: Models in laboratory research The unique position of the ...rusynlab.unc.edu/publications/course_data/Rodent Models.pdf · The unique position of the mouse as a model Mouse genetics](https://reader031.vdocuments.site/reader031/viewer/2022022505/5aba94027f8b9a441d8bcbde/html5/thumbnails/22.jpg)
![Page 23: Models in laboratory research The unique position of the ...rusynlab.unc.edu/publications/course_data/Rodent Models.pdf · The unique position of the mouse as a model Mouse genetics](https://reader031.vdocuments.site/reader031/viewer/2022022505/5aba94027f8b9a441d8bcbde/html5/thumbnails/23.jpg)
![Page 24: Models in laboratory research The unique position of the ...rusynlab.unc.edu/publications/course_data/Rodent Models.pdf · The unique position of the mouse as a model Mouse genetics](https://reader031.vdocuments.site/reader031/viewer/2022022505/5aba94027f8b9a441d8bcbde/html5/thumbnails/24.jpg)
Types of Genetic Crosses
Cross Matings Uses
Backcross A/a X A/AA/a X a/a
linkage analysis; production of congenicstrains
Incross A/A X A/Aa/a X a/a
Maintenance of aninbred strain
Intercross A/a X A/a Linkage analysis
Outcross A/A X a/a
a1/a2 X a3/a4
Initial step in strain production and linkage analysis; production of F1hybrids
![Page 25: Models in laboratory research The unique position of the ...rusynlab.unc.edu/publications/course_data/Rodent Models.pdf · The unique position of the mouse as a model Mouse genetics](https://reader031.vdocuments.site/reader031/viewer/2022022505/5aba94027f8b9a441d8bcbde/html5/thumbnails/25.jpg)
Making an Inbred Strain% Homozygosity
0 50 100
98.7%F20
Inbred
F1
P
F2Independent Assortment
![Page 26: Models in laboratory research The unique position of the ...rusynlab.unc.edu/publications/course_data/Rodent Models.pdf · The unique position of the mouse as a model Mouse genetics](https://reader031.vdocuments.site/reader031/viewer/2022022505/5aba94027f8b9a441d8bcbde/html5/thumbnails/26.jpg)
Inbred Strain
20 or more generation of brother x sister matingIsogenicHomozyogusPhenotypically uniformLong-term stabilityUnique strain characteristicsInternational distributionEasily identifiable
‘immortal clone of genetically identical individuals’
![Page 27: Models in laboratory research The unique position of the ...rusynlab.unc.edu/publications/course_data/Rodent Models.pdf · The unique position of the mouse as a model Mouse genetics](https://reader031.vdocuments.site/reader031/viewer/2022022505/5aba94027f8b9a441d8bcbde/html5/thumbnails/27.jpg)
EgfrWa5/+
C57BL/6J 129S1/SvImJ BALB/cJ
![Page 28: Models in laboratory research The unique position of the ...rusynlab.unc.edu/publications/course_data/Rodent Models.pdf · The unique position of the mouse as a model Mouse genetics](https://reader031.vdocuments.site/reader031/viewer/2022022505/5aba94027f8b9a441d8bcbde/html5/thumbnails/28.jpg)
‘The introduction of inbred strains into biology is probably comparable in
importance with that of the analytical balance into chemistry’
Gruneberg (1952)
![Page 29: Models in laboratory research The unique position of the ...rusynlab.unc.edu/publications/course_data/Rodent Models.pdf · The unique position of the mouse as a model Mouse genetics](https://reader031.vdocuments.site/reader031/viewer/2022022505/5aba94027f8b9a441d8bcbde/html5/thumbnails/29.jpg)
Outbred Stocks
Widely usedCharacteristics not widely understoodAdvatages
• cheap• easily available (no alternative for some species)• breed well• outbred like humans (?????)
Disadvantages• unknown genetics (heterozygosity)• subject to genetic change (inbreeding, drift, selection)• lack of reliable background information• genotype not internationally distributed• not histocompatible• not easily identifiable
![Page 30: Models in laboratory research The unique position of the ...rusynlab.unc.edu/publications/course_data/Rodent Models.pdf · The unique position of the mouse as a model Mouse genetics](https://reader031.vdocuments.site/reader031/viewer/2022022505/5aba94027f8b9a441d8bcbde/html5/thumbnails/30.jpg)
CF1ICRCD1MF1Swiss-Webster
Outbred Mice
B6D2
![Page 31: Models in laboratory research The unique position of the ...rusynlab.unc.edu/publications/course_data/Rodent Models.pdf · The unique position of the mouse as a model Mouse genetics](https://reader031.vdocuments.site/reader031/viewer/2022022505/5aba94027f8b9a441d8bcbde/html5/thumbnails/31.jpg)
Engineered Models
Allows controlled experimental testing of• specific genes• specific environmental conditions
or exposures
Ideally suited to test specific hypothesis generated from human population studies or other laboratory findings
![Page 32: Models in laboratory research The unique position of the ...rusynlab.unc.edu/publications/course_data/Rodent Models.pdf · The unique position of the mouse as a model Mouse genetics](https://reader031.vdocuments.site/reader031/viewer/2022022505/5aba94027f8b9a441d8bcbde/html5/thumbnails/32.jpg)
Engineered Models
Transgenics• usually used to over-express genes• can be global or tissue-specific• can be temporally regulated
Knockouts/knockins• usually used in inactivate genes• can be global or tissue-specific• can be temporally regulated• can introduce genes into a foreign locus• can make amino acid modifications
![Page 33: Models in laboratory research The unique position of the ...rusynlab.unc.edu/publications/course_data/Rodent Models.pdf · The unique position of the mouse as a model Mouse genetics](https://reader031.vdocuments.site/reader031/viewer/2022022505/5aba94027f8b9a441d8bcbde/html5/thumbnails/33.jpg)
Terminology
Transgenic(carries foreign DNA;may or may not be mosaic;two parents)
Mosaic(may or may not carry foreign DNA;two parents)
Chimeric(may or may notcarry foreign DNA;more than two parents)
![Page 34: Models in laboratory research The unique position of the ...rusynlab.unc.edu/publications/course_data/Rodent Models.pdf · The unique position of the mouse as a model Mouse genetics](https://reader031.vdocuments.site/reader031/viewer/2022022505/5aba94027f8b9a441d8bcbde/html5/thumbnails/34.jpg)
Mosaic vs Chimeric Progeny
Mosaic Chimeric
![Page 35: Models in laboratory research The unique position of the ...rusynlab.unc.edu/publications/course_data/Rodent Models.pdf · The unique position of the mouse as a model Mouse genetics](https://reader031.vdocuments.site/reader031/viewer/2022022505/5aba94027f8b9a441d8bcbde/html5/thumbnails/35.jpg)
Pre-implantation Mouse Development
Fertilization
Activation of embryonic genome
Compaction
Blastocoelic fluid accumulation
TE and endoderm differentiation
E0.5
E2.5
E3.5
E1.5
![Page 36: Models in laboratory research The unique position of the ...rusynlab.unc.edu/publications/course_data/Rodent Models.pdf · The unique position of the mouse as a model Mouse genetics](https://reader031.vdocuments.site/reader031/viewer/2022022505/5aba94027f8b9a441d8bcbde/html5/thumbnails/36.jpg)
Transgenic Production
Flush fertilized
oviduct E0.5
pro-nuclear stage
DNA
recover
pro-nuclearfusion
implant intopseudopregnant females
test for germlinetransmission
founder
test for expressionand phenotype
![Page 37: Models in laboratory research The unique position of the ...rusynlab.unc.edu/publications/course_data/Rodent Models.pdf · The unique position of the mouse as a model Mouse genetics](https://reader031.vdocuments.site/reader031/viewer/2022022505/5aba94027f8b9a441d8bcbde/html5/thumbnails/37.jpg)
Gene Targeting in ES Cells
Analyze offspringfor phenotype
electroporate selection
analyzecolonies
test forgermline
transmission
makechimeras
crossheterozygotes test offspring
for chimerism
implant
P 1 2
![Page 38: Models in laboratory research The unique position of the ...rusynlab.unc.edu/publications/course_data/Rodent Models.pdf · The unique position of the mouse as a model Mouse genetics](https://reader031.vdocuments.site/reader031/viewer/2022022505/5aba94027f8b9a441d8bcbde/html5/thumbnails/38.jpg)
Exercise D
You obtain a mouse line from your collaborator that carries a knockout in PPAR-gamma. The collaborator made the mice by gene targeting in 129 strain derived ES cells. He made chimeras with the cells by blastocyst injection into C57BL/6J embryos. After birth, he bred the chimeras to C57BL/6J mice and then intercrossed heterozygous carriers to make the PPAR-gamma knockout homozygous line.
You need wild-type controls for your experiment. What mice to you use for this? Why?
![Page 39: Models in laboratory research The unique position of the ...rusynlab.unc.edu/publications/course_data/Rodent Models.pdf · The unique position of the mouse as a model Mouse genetics](https://reader031.vdocuments.site/reader031/viewer/2022022505/5aba94027f8b9a441d8bcbde/html5/thumbnails/39.jpg)
Making a Congenic Strain% Homozygosity
0 50 100P
Donor Recipient
F1
N10
99.8%Congenic
N2Independent Assortment
N3ResidualHeterozygosity
![Page 40: Models in laboratory research The unique position of the ...rusynlab.unc.edu/publications/course_data/Rodent Models.pdf · The unique position of the mouse as a model Mouse genetics](https://reader031.vdocuments.site/reader031/viewer/2022022505/5aba94027f8b9a441d8bcbde/html5/thumbnails/40.jpg)
Co-isogenicCongenic
1 2 3 4 5 1 2 3 4 5
![Page 41: Models in laboratory research The unique position of the ...rusynlab.unc.edu/publications/course_data/Rodent Models.pdf · The unique position of the mouse as a model Mouse genetics](https://reader031.vdocuments.site/reader031/viewer/2022022505/5aba94027f8b9a441d8bcbde/html5/thumbnails/41.jpg)
Genetic Variation
Significant extant genetic (and thus phenotypic) variation exists across mouse strains
Can be used to identify a more ‘accurate’ model of specific human exposures or responses
Phenotypic variation across inbred mouse strains is as great or greater than humans for virtually any trait
![Page 42: Models in laboratory research The unique position of the ...rusynlab.unc.edu/publications/course_data/Rodent Models.pdf · The unique position of the mouse as a model Mouse genetics](https://reader031.vdocuments.site/reader031/viewer/2022022505/5aba94027f8b9a441d8bcbde/html5/thumbnails/42.jpg)
Azoxymethane Induction of Mouse Colorectal Tumors
4 X 1 weekly IP injections (10mg/kg)
22 week latency period Tumor Normal
CH3 N N CH3
O
Azoxymethane
Methylazoxymethanol
H3C + N2+
Methyldiazonium(alkylating agent)
Carbonium(methylating agent)
CH3 N N CH2OH
O
CH3 N N+
![Page 43: Models in laboratory research The unique position of the ...rusynlab.unc.edu/publications/course_data/Rodent Models.pdf · The unique position of the mouse as a model Mouse genetics](https://reader031.vdocuments.site/reader031/viewer/2022022505/5aba94027f8b9a441d8bcbde/html5/thumbnails/43.jpg)
Just as one person is not representativeof the human population....
AKR/J A/JSWR/J
....one mouse strain is notrepresentative of the human species
![Page 44: Models in laboratory research The unique position of the ...rusynlab.unc.edu/publications/course_data/Rodent Models.pdf · The unique position of the mouse as a model Mouse genetics](https://reader031.vdocuments.site/reader031/viewer/2022022505/5aba94027f8b9a441d8bcbde/html5/thumbnails/44.jpg)
0
25
50
75
100
Strain
Colorectal Cancer Susceptibility
Swiss strainsCastle’s strainsStrains from AsiaOther strainsC57-related strainsWild-derived strains
![Page 45: Models in laboratory research The unique position of the ...rusynlab.unc.edu/publications/course_data/Rodent Models.pdf · The unique position of the mouse as a model Mouse genetics](https://reader031.vdocuments.site/reader031/viewer/2022022505/5aba94027f8b9a441d8bcbde/html5/thumbnails/45.jpg)
![Page 46: Models in laboratory research The unique position of the ...rusynlab.unc.edu/publications/course_data/Rodent Models.pdf · The unique position of the mouse as a model Mouse genetics](https://reader031.vdocuments.site/reader031/viewer/2022022505/5aba94027f8b9a441d8bcbde/html5/thumbnails/46.jpg)
mouse populations > human populations
Total mouse SNPs = ~40M musculus, domesticus, castaneous
![Page 47: Models in laboratory research The unique position of the ...rusynlab.unc.edu/publications/course_data/Rodent Models.pdf · The unique position of the mouse as a model Mouse genetics](https://reader031.vdocuments.site/reader031/viewer/2022022505/5aba94027f8b9a441d8bcbde/html5/thumbnails/47.jpg)
mouse populations > human populations
Total human SNPs = <20M
Total mouse SNPs = ~40Mmusculus, domesticus, castaneous
![Page 48: Models in laboratory research The unique position of the ...rusynlab.unc.edu/publications/course_data/Rodent Models.pdf · The unique position of the mouse as a model Mouse genetics](https://reader031.vdocuments.site/reader031/viewer/2022022505/5aba94027f8b9a441d8bcbde/html5/thumbnails/48.jpg)
Total human SNPs = <20M
Total mouse SNPs = ~65Mmusculus, domesticus, castaneous
+ spretus
mouse populations > human populations
![Page 49: Models in laboratory research The unique position of the ...rusynlab.unc.edu/publications/course_data/Rodent Models.pdf · The unique position of the mouse as a model Mouse genetics](https://reader031.vdocuments.site/reader031/viewer/2022022505/5aba94027f8b9a441d8bcbde/html5/thumbnails/49.jpg)
Total mouse SNPs = ~65Mmusculus, domesticus, castaneous
+ spretus
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture. +
mouse populations > human populations
![Page 50: Models in laboratory research The unique position of the ...rusynlab.unc.edu/publications/course_data/Rodent Models.pdf · The unique position of the mouse as a model Mouse genetics](https://reader031.vdocuments.site/reader031/viewer/2022022505/5aba94027f8b9a441d8bcbde/html5/thumbnails/50.jpg)
Why would human and mouse biology be similar?
Evolutionary conservation!!
- genome (gene content, arrangement and sequence)
- structure (gross and molecular anatomy)
- function (physiology and molecular circuits)
![Page 51: Models in laboratory research The unique position of the ...rusynlab.unc.edu/publications/course_data/Rodent Models.pdf · The unique position of the mouse as a model Mouse genetics](https://reader031.vdocuments.site/reader031/viewer/2022022505/5aba94027f8b9a441d8bcbde/html5/thumbnails/51.jpg)
Evolutionary conservation!!
- Phenotypic differences are due to a finite set of key genes
- “Key” means nodes in regulatory networks
Why would human and mouse biology be similar?