![Page 1: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/1.jpg)
MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT
INTERFACE TO INDUCE LEAD MOBILITY AND ITS
REMEDIATION
BY
Maria Manzoor
(NUST201490151PSCEE1814S)
A Dissertation Submitted in Partial Fulfillment of the
Requirement for the Degree of Doctor of Philosophy
IN
Environmental Science
Supervisor
Dr. Muhammad Arshad
Institute of Environmental Sciences and Engineering (IESE)
School of Civil and Environmental Engineering (SCEE)
National University of Sciences and Technology (NUST)
Islamabad, Pakistan
(2019)
![Page 2: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/2.jpg)
![Page 3: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/3.jpg)
![Page 4: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/4.jpg)
![Page 5: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/5.jpg)
![Page 6: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/6.jpg)
![Page 7: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/7.jpg)
In the name of ALLAH, the Most Gracious, the Most Merciful"
![Page 8: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/8.jpg)
DEDICATION
This PhD work is dedicated to
My Parents
Mr and Mrs Manzoor Hussain
Without whom nothing would
have been achieveable
![Page 9: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/9.jpg)
i
ACKNOWLEDGEMENTS
Firstly, I would like to deeply express my sincere gratitude to my highly regarded supervisor Dr.
Muhammad Arshad for the continuous support throughout my Ph.D. research, his patience,
motivation, knowledge, immense wisdom, munificent behavior, meticulous critique, and his
dignified doctrine that assisted me to achieve my study objectives. His guidance helped me
throughout research and writing of this thesis. He is the one who gave me international exposure
and help me build by international networks. It would have been difficult to accomplish this work
on time without his help and kind support.
I also desire to acknowledge the earnest cooperation and commendable support of my
distinguished GEC membres Dr. Imran Hashmi and Dr. Zeeshan Ali Khan for monitoring
research progress, insightful comments, encouragement, and guidance and also for the hard
questions which widen my research from various perspectives. My sincere thanks also go to Prof.
Jean Kallerhoff who is my external GEC member. She has broad vision in the field of
phytoremediation. It was indeed a great pleasure and honour for me to visit her lab and work under
her supervision. I am especially thankful to Prof. Lena Q Ma, Professor SWS, University of
Florida (UF), USA for being my foreign advisor. Her enthusiasum, willingness, intensity of
research and interests in developing new ideas and in-depth studies pushed me to learn different
aspects of plant microbe interactions in phytoremediation.
I greatly acknowledge NUST and especially, the NUST Rector for funding my entire research. I
also acknowledge HEC and Campus France for funding the PERIDOT research project and
providing me the opportunity to get training on advanced techniques in phytoremediation at Ecolab
Toulouse, France. A very special gratitude goes to HEC for helping and providing the funding for
six month visit at UF, USA under International Research Support Initiative Program (IRSIP), for
completing my PhD research. I pay my deeped regard to my research group at IESE and research
group at University of Florida (UF), USA for all cooperation and help through out my research. I
also admire and value the genuine encouragement, assistance and motivation provided by
respectable, IESE faculty and staff of environmental biotechnology laboratory, in the successful
completion of my research.
I would like to thank my family, especially my parents Mr Manzoor Hussain and Mrs Kaneez
Fatima for their continuous support and encouragement throughout my PhD. I am thankful to my
sister Alia Manzoor and brothers Aamir Manzoor and Adil Manzoor for their motivation and
support in this journey. I also greatly acknowledge the faithful companionship of Iram Gul and
Fasiha Safdar. At the end I also want to value all those people who have created quandaries and
become a source of physiological torment for me.
Maria Manzoor
![Page 10: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/10.jpg)
ii
TABLE OF CONTENTS
LIST OF TABLES ...................................................................................................................................... VI
LIST OF FIGURES ................................................................................................................................... VII
LIST OF ABBREVIATIONS ..................................................................................................................... IX
ABSTRACT ................................................................................................................................................. X
Chapter 1 ...................................................................................................................................................... 1
INTRODUCTION ....................................................................................................................................... 1
1.1. BIOLOGICALLY ASSISTED PHYTOREMEDIATION – POTENTIAL APPROACH .................... 3
1.2. PROBLEM STATEMENT AND RESEARCH GAP............................................................................ 4
1.3. OBJECTIVES AND SCOPE OF STUDY ............................................................................................. 5
1.4. PRESENTATION OF THE WORK ...................................................................................................... 6
Chapter 2 ...................................................................................................................................................... 8
REVIEW OF LITERATURE .................................................................................................................... 8
2.1. LEAD CONTAMINATION AND ENVIRONMENTAL CONCERNS ............................................... 8
2.1.1. Lead Contamination ................................................................................................................ 8
2.1.2. Sources of Pb in the Environment ........................................................................................... 9
2.1.3. Ecological Impacts of Pb ...................................................................................................... 11
2.2. REMEDIATION TECHNOLOGIES .................................................................................................. 15
2.2.1. Phytoremediation techniques ................................................................................................ 16
2.2.2. Phytoextraction ..................................................................................................................... 18
2.2.3. Pb Uptake and Detoxification Mechanism in Plants ............................................................. 19
2.3. CHALLENGES AND FUTURE PROSPECTS IN PHYTOREMEDIATION ................................... 21
2.3.1. Challenges in Phytoremediation ........................................................................................... 21
2.3.2. Role of Synthetic Chelates and Environmental Concerns .................................................... 23
2.3.3. Role of Genetic Engineering in Phytoremediation ............................................................... 24
2.4. BIOLOGICALLY ASSISTED PHYTOREMEDIATION – A VIABLE OPTION ............................ 25
2.4.1. Plant-Microbial Interactions for Pb Phytoextraction ............................................................ 25
2.5. PRESENT STUDY .............................................................................................................................. 30
Chapter 3 .................................................................................................................................................... 32
SCREENING OF LEAD HYPERACCUMULATOR PLANT SPECIES ........................................... 32
A. SCREENING OF INDIGENOUS ORNAMENTAL PLANT SPECIES FOR Pb
ACCUMULATION POTENTIAL ............................................................................................................. 32
3.1. INTRODUCTION ............................................................................................................................... 32
3.2. MATERIALS AND METHODS ......................................................................................................... 34
3.2.1. Preliminary study .................................................................................................................. 34
3.2.2. Soil Sampling, Preparation and Characterization ................................................................. 35
3.2.3. Plant Growth Experiments .................................................................................................... 36
3.2.4. Harvesting and Plant Sample Analysis ................................................................................. 37
3.2.5. Pb Accumulation in Plants .................................................................................................... 38
3.2.6. Statistical Analysis ................................................................................................................ 38
3.3. RESULTS ............................................................................................................................................ 38
![Page 11: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/11.jpg)
iii
3.3.1. Screening for Pb Accumulation Potential ............................................................................. 38
3.3.2. Lead Concentrations in Roots and Shoots of Selected Species ............................................ 40
3.3.3. Plant Biomass at Varying Pb Concentrations ....................................................................... 42
3.3.4. TF, EF and CF ....................................................................................................................... 42
3.3.5. Lead Uptake .......................................................................................................................... 44
3.4. DISCUSSION ...................................................................................................................................... 45
3.5. OUTCOMES AND PERSPECTIVES ................................................................................................. 49
B. LEAD PHYTOAVAILABILITY AND UPTAKE: RHIZOSPHERE STUDY ....................... 51
3.6. BACKGROUND ................................................................................................................................. 51
3.7. MATERIAL AND METHODS ........................................................................................................... 52
3.7.1. Soil and Pb Spiking ............................................................................................................... 52
3.7.2. Pre-Experimental Setup and Plant Acclimatization .............................................................. 52
3.7.3. Rhizosphere Experiment ....................................................................................................... 54
3.7.4. Soil and Plant Analysis ......................................................................................................... 54
3.7.5. Statistical Analysis ................................................................................................................ 55
3.8. RESULTS AND DISCUSSION .......................................................................................................... 55
3.8.1. Root Induced Rhizosphere Modifications ............................................................................. 55
3.8.2. Lead Concentrations in Shoots and Roots ............................................................................ 59
3.9. OUTCOMES AND PERSPECTIVES ................................................................................................. 64
C. ORGANIC LIGANDS DERIVED LEAD SPECIATION USING SPECIATION MODEL . 65
3.10. INTRODUCTION ............................................................................................................................. 65
3.11. MATERIALS AND METHODS ....................................................................................................... 66
3.12. RESULTS AND DISCUSSION ........................................................................................................ 67
3.12.1. Effect of pH on Pb Speciation in Nutrient Solution ............................................................ 67
3.12.2. Effect of Organic Ligands on Solution pH ......................................................................... 67
3.12.3. Effect of Organic Acids on Pb Speciation in the Nutrient Solution .................................... 68
3.13. SUMMARY ....................................................................................................................................... 70
Chapter 4 .................................................................................................................................................... 71
PLANT-MICROBE INTERACTION IN PHYTOREMEDIATION OF LEAD ................................ 71
A. FUNGI-ENHANCED PLANT GROWTH AND PHYTOEXTRACTION OF LEAD:
TOLERANCE, PGP ACTIVITY AND PHYTOAVAILABILITY ...................................................... 71
4.1. INTRODUCTION ............................................................................................................................... 71
4.2. MATERIALS AND METHODS ......................................................................................................... 73
4.2.1. Soil Characterization ............................................................................................................. 73
4.2.2. Pb Tolerant Fungal Strains .................................................................................................... 74
4.2.3. Effect on Soil pH, Organic Matter and Pb Mobility ............................................................. 74
4.2.4. Plant Growth Promoting Activities of Fungal Strains .......................................................... 75
4.2.5. Culture Experiment ............................................................................................................... 77
4.2.6. Statistical Analysis ................................................................................................................ 77
4.3. RESULTS AND DISCUSSION .......................................................................................................... 77
4.3.1. Pb Tolerant Fungi.................................................................................................................. 77
4.3.2. Effect of Fungi on soil properties.......................................................................................... 79
4.3.3. PGP Assays ........................................................................................................................... 83
![Page 12: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/12.jpg)
iv
4.3.4. Effect of Fungi on Pb Accumulation and Uptake ................................................................. 86
4.4. OUTCOMES AND PERSPECTIVES ................................................................................................. 89
B. METAL TOLERANCE OF ARSENIC-RESISTANT BACTERIA AND THEIR ABILITY
TO PROMOTE PLANT GROWTH OF Pteris vittata IN Pb-CONTAMINATED SOIL .................. 91
4.5. BACKGROUND ................................................................................................................................. 91
4.6. MATERIALS AND METHODS ......................................................................................................... 93
4.6.1. Metal Tolerance and Metal Solubilization ............................................................................ 93
4.6.2. Metal Uptake and Metal Resistant Genes ............................................................................. 94
4.6.3. Plant Growth Promoting Hormones ...................................................................................... 95
4.6.4. Effect of Bacteria on P. vittata Growth Under Pb Stress ...................................................... 96
4.6.5. Statistical Analysis ................................................................................................................ 97
4.7. RESULTS AND DISCUSSION .......................................................................................................... 97
4.7.1. Bacterial Resistance to Pb ..................................................................................................... 97
4.7.2. Genes Involved in Metal Resistance in PG-12 ..................................................................... 99
4.7.3. Bacterial Pb Uptake and Solubilization .............................................................................. 101
4.7.4. Plant Growth Promoting Characteristics ............................................................................. 102
4.8. OUTCOMES AND PROSPECTS ..................................................................................................... 106
C. METAL TOLERANT BACTERIA ENHANCED PHYTOEXTRACTION OF LEAD BY
TWO ACCUMULATOR ORNAMENTAL SPECIES........................................................................ 107
4.9. CONTEXT ......................................................................................................................................... 107
4.10. MATERIALS AND METHODS ..................................................................................................... 108
4.10.1. Isolation and Characterization of Pb Resistant Bacteria ................................................... 108
4.10.2. Effect of Resistant Bacteria of Soil Pb Mobility ............................................................... 109
4.10.3. Molecular Characterization of Resistant Bacterial Strains ............................................... 110
4.10.4. PGP Characteristics of Bacteria ........................................................................................ 110
4.10.5. Influence of Resistant Bacteria on Pb Uptake ................................................................... 112
4.10.6. Statistical Analysis ............................................................................................................ 112
4.11. RESULTS AND DISCUSSION ...................................................................................................... 113
4.11.1. Isolation and Characterization of Pb Resistant Bacterial Strains ...................................... 113
4.11.2. Plant Growth Promoting Traits of Isolated Bacteria ......................................................... 117
4.11.3. Pb Mobilization by Resistant Bacteria .............................................................................. 119
4.11.4. Effect of Pb Resistant Bacteria on Plant Growth .............................................................. 120
4.11.5. Effect of Pb Resistant Bacteria on Pb Uptake ................................................................... 121
4.12. OUTCOMES AND PERSPECTIVES ............................................................................................. 123
Chapter 5 .................................................................................................................................................. 125
EFFECTS OF MICROBIAL CONSORTIUM ON Pb UPTAKE AND ENZYMATIC
ACTIVITIES ........................................................................................................................................... 125
A. EFFECT OF CO-INOCULATION ON PHYTOEXTRACTION OF Pb BY Pelargonium
hortorum ................................................................................................................................................... 125
5.1. INTRODUCTION ............................................................................................................................. 125
5.2. MATERIALS AND METHODS ....................................................................................................... 126
5.2.1. In Vitro Screening for Co-Inoculation of Bacteria and Fungi ............................................. 126
5.2.2. Effect of Co-inoculation on Pb Mobility ............................................................................ 127
![Page 13: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/13.jpg)
v
5.2.3. Effect of Co-Inoculation on Pb Accumulation and Uptake ................................................ 127
5.2.4. Harvesting and Plant Analysis ............................................................................................ 128
5.3. RESULTS AND DISCUSSION ........................................................................................................ 128
5.3.1. Compatibility for Co-inoculation of Bacteria and Fungi .................................................... 128
5.3.2. Effect of Co-Inoculation on Soil Pb Mobility and Soil pH ................................................. 130
5.3.3. Plant Biomass and Pb Accumulation .................................................................................. 132 5.4. OUTCOMES AND PERSPECTIVES ............................................................................................... 136
B. EFFECTS OF BIOINOCULANTS ON SOIL ENZYMATIC ACTIVITIES IN Pb
CONTAMINATED SOIL ...................................................................................................................... 137
5.5. BACKGROUND ............................................................................................................................... 137
5.6. MATERIALS AND METHODS ....................................................................................................... 138
5.6.1. Soil Characterization ........................................................................................................... 138
5.6.2. Pb Resistant Bacteria .......................................................................................................... 139
5.6.3. Experimental Design ........................................................................................................... 139
5.6.4. Soil Enzymatic Assays ........................................................................................................ 140
5.6.5. Statistical Analysis .............................................................................................................. 140
5.7. RESULTS AND DISCUSSION ........................................................................................................ 141
5.7.1. Soil Characterization ........................................................................................................... 141
5.7.2. Effect of Increasing Pb Concentrations on Soil Enzymatic Activities ................................ 141
5.7.3. Correlation Analysis ........................................................................................................... 143
5.7.4. Microbial Biomass and Respiration .................................................................................... 144
5.7.5. Soil Enzymatic Activities .................................................................................................... 147
5.8. SUMMARY ....................................................................................................................................... 150
Chapter 6 .................................................................................................................................................. 152
CONCLUSIONS AND PERSPECTIVES ............................................................................................ 152
6.1. GENERAL DISCUSSION ................................................................................................................ 152
6.1.1. Pb hyperaccumulator selection ........................................................................................... 152
6.1.2. Plant microbe interactions for Pb phytoextraction .............................................................. 153
6.1.3. Soil enzymatic activities ..................................................................................................... 154
6.2. CONCLUSIONS ................................................................................................................................ 155
6.3. FUTURE PERSPECTIVES ............................................................................................................... 157
6.3.1. Interactive Effect of Multiple Metals and Nutrients in Real Field Soil .............................. 157
6.3.2. Chelators and Phytohormones along with Plant Microbial Interaction .............................. 158
6.3.3. Proteomics and Metabolomics and Gene Expression ......................................................... 159
REFERENCES ........................................................................................................................................ 161
ANNEXURE ............................................................................................................................................ 182
LIST OF PUBLICATIONS ................................................................................................................... 182
![Page 14: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/14.jpg)
vi
LIST OF TABLES
Table 1.1: Lead regulatory standards in the environment. 1
Table 2.1: Heavy metal concentrations likely to exist in soil. 8
Table 2.2: Lead contamination in different areas of Pakistan. 9
Table 2.3: Pb induced phytotoxicity in crop plants. 12
Table 2.4: Pb phytoremediation techniques to decontaminate Pb in environment. 17
Table 2.5: Threshold metal concentration in plants. 18
Table 2.6: Lead hyperaccumulator plant species reported in littrature. 19
Table 2.7: Different studies reported in littrature for microbially enhanced lead uptake. 29
Table 3.1: Characteristics of soil used for research experiment. 36
Table 3.2: Classification of ornamental plants for Pb accumulating abilities. 39
Table 3.3: Pb accumulation characteristics and plant dry biomass. 43
Table 3.4: Composition of nutrient solution used in culture experiment. 53
Table 3.5: Biomass and Pb uptake factors after 15 day of culture experiment. 61
Table 4.1: Reduction in dry biomass, tolerance index (TI) of fungal strains. 83
Table 4.2: Pb uptake (mg) in plants treated with fungi at different soil Pb concentrations. 88
Table 4.3: Primers used to amplify efflux genes in metal resistant bacteria. 94
Table 4.4: Bacterial biomass reduction and tolerance index. 99
Table 4.5: Molecular identification of isolated lead tolerant bacterial strains. 116
Table 4.6: Plant growth promotion traits of bacterial isolates. 118
Table 4.7: Effect of bacterial inoculation on plant biomass. 121
Table 5.1: Total plant biomass (g) co-inoculated with bacteria and fungi. 134
Table 5.2: Physico-chemical characteristics of soil. Values are mean of three replicates. 141
Table 5.3: Correlation among and between soil enzymes and Pb concentration in soil. 143
Table 5.4: Effect of bio-inoculation on soil microbial activity in Pb contaminated soil. 145
Table 5.5: Effect of bio-inoculation on soil enzymatic activities in Pb contaminated soil. 151
![Page 15: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/15.jpg)
vii
LIST OF FIGURES
Figure 1.1: Plant-microbe interaction at soil plant interface. 4
Figure 2.1: Sources and toxicological impacts of Pb in environment. 10
Figure 2.2: Effect of Pb on plant’s physiological activities. 11
Figure 2.3: Soil remediation techniques for Pb. 16
Figure 2.4: Pb uptake mechanism in plants. 20
Figure 2.5: Phytoremediation challenges and constrains. 22
Figure 2.6: Microbial interactions in response to Pb exposure 26
Figure 2.7: Experimental approach and design of study 30
Figure 3.1: Pb concentration in selected plants. 41
Figure 3.2: Pb uptake by selected ornamental plants. 44
Figure 3.3: Locally designed cropping device setup. 53
Figure 3.4: Root induced changes in rhizosphere. 56
Figure 3.5: Root induced changes in soil organic matter 58
Figure 3.6: Lead concentrations in plant parts after three week culture on Pb spiked soil. 60
Figure 3.7: Lead uptake and adsorption by plants. 63
Figure 3.8: Effect of pH on Pb speciation. 67
Figure 3.9: Effect of solution pH and OA on Pb speciation 68
Figure 3.10: Effect of OA conc. on Pb speciation. 69
Figure 4.1: Fungi tolerance to Pb. 78
Figure 4.2: Effect of fungal inoculation on Pb mobility. 79
Figure 4.3: Effect of fungal inoculation on PDA media pH and soil pH. 81
Figure 4.4: Change in organic matter (%) in soil treated with different fungal strains. 82
Figure 4.5: Effect of fungal treatment on Pb accumulation. 87
Figure 4.6: Growth of bacterial isolates on media containing 1 mM Pb. 98
Figure 4.7: Metal uptake, adsorption and solubilization by bacteria. 102
Figure 4.8: Effect of bacteria on P. vittata biomass, pH, Pb and P concentration 103
Figure 4.9: Effect of living (12L) and dead (12D) PG-12 cultures. 105
Figure 4.10: Pb resistance of isolated bacterial strains in LB media. 114
Figure 4.11: Phylogenetic tree showing bacterial identification. 115
![Page 16: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/16.jpg)
viii
Figure 4.12: Effect of bacterial inoculation on water soluble Pb in soil. 120
Figure 4.13: Effect of bacterial inoculation on Pb uptake at different concentration of soil Pb. 122
Figure 5.1: Comparative analysis of antibacterial and antifungal activity. 129
Figure 5.2: Effect of co-inoculation on extractable Pb. 130
Figure 5.3: Effect of co-inoculation on soil pH. 131
Figure 5.4: Effect of co-inoculation on Pb uptake per plant. 135
Figure 5.5: Inhibitory effects of Pb on soil enzymatic activities. 142
Figure 6.1: Interactive effect of nutrients and heavy metals on phytoextraction of Pb. 158
Figure 6.2: Integrated application of plant-bacteria-chelates for phytoextraction of Pb. 159
Figure 6.3: Proteomic and metabolomics basis for Pb uptake and detoxification mechanism. 160
![Page 17: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/17.jpg)
ix
LIST OF ABBREVIATIONS
Abbreviations Stands For
ACC 1-Aminocyclopropane-1-Carboxylate
ACGIH American Council of Government and Industrial Hygienists
ANOVA Analysis of Variance
ATSDR Agency for Toxic Substances and Disease Registry
CDC Centers for Disease Control and Prevention
CPSC Consumer Products Safety Commission
DOC Dissolved Organic Carbon
FDA Food and Drug Administration
GA3 Gibberellic Acid
IAA Indole-3-Acetic Acid
NCCP National Culture Collection of Pakistan
NIOSH National Institute of Occupational Safety and Health
OA Organic Acids
OM Organic Matter
OSHA Occupational Safety and Health Administration
PCR Polymerase Chain Reaction
PGP Plant Growth Promoting
PGPR Plant Growth Promoting Rhizo-bacteria
SPSS Statistical Package for the Social Sciences
TEL Tetraethyl Lead
US-EPA Environmental Protection Agency
![Page 18: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/18.jpg)
x
ABSTRACT
Lead (Pb) is a toxic metal whose widespread use has caused extensive environmental
contamination and health problems through food chain contamination in many parts of the world.
Recently, phytoremediation has appeared as an effective and alternative solution to conventional
physiochemical techniques for removal of Pb from contaminated soil. However, lack of
understanding and information regarding Pb availability, speciation, uptake and translocation
mechanisms, suitable plant species for hyperaccumulating Pb, microbial association that interfere
phytoremediation process at plant soil interface are hindering its full-scale application. The aim of
the current research was to develop an integrated plant-microbial association system for enhanced
remediation of Pb contaminated soils using indigenous biological systems including plants and
microorganisms. In the first step, extensive screening of ornamental plants locally grown in
Pakistan was done for selection of Pb hyperaccumulator plant. Fortunately, two plants
Pelargonium hortorum and Mesembryanthemum criniflorum were selected based on significantly
higher Pb accumulation (>1000 mg Pb kg-1 in shoot dry biomass) and better translocation i.e.,
higher accumulation in shoot compared to root without significant (p<0.05) decrease in plant dry
biomass (up to 1500 mg kg-1 soil Pb conc.). The selected plants were further investigated for root
induced changes in rhizosphere during three-week culture in special cropping device fabricated
locally. Results indicated significant ability of P. hortorum to acidify rhizosphere soil (∆pH= -0.22
pH units) and increasing dissolved organic compounds (DOC) contents (1.4-1.7 –folds) that
induced Pb mobility in soil (1-2 –folds) compared to M. criniflorum and control soil.
Plant-microbial association studies for phytoremediation potential were performed in the
subsequent step. Indigenous Pb resistant bacteria were isolated from soil collected from battery
recycling units in industrial zones of Islamabad and Rawalpindi, Pakistan. Klebsiella
![Page 19: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/19.jpg)
xi
quasipneumoniae (NCCP-1862), Klebsiella variicola (NCCP-1857), Pseudomonas beteli (NCCP-
1845), Microbacterium paraoxydans (NCCP-1848) and Bacillus tequilensis (NCCP-1860)
showed Pb tolerance and solubilization and plant growth promoting (PGP) activity. Plant-bacterial
interaction studies exhibited the potential of M. paraoxydans as efficient bio-inoculant for
increased Pb phytoextraction. Fungal-soil interaction studies showed the ability of Aspergillus
flavus, and Mucor spp. to increase the bioavailable fraction by lowering soil pH. Fungal-plant
interaction studies exhibited the potential of Mucor spp. as efficient bio-inoculant for enhanced Pb
uptake in P. hortorum (2.21 mg per plant) followed by A. flavus (1.85 mg per plant). In the later
step, multiple heavy metal accumulator plants (Pteris vittata) and associated rhizospheric bacteria
were studied for Pb phytoextraction in sterile conditions. The results showed decrease in Pb uptake
while improving plant growth in both inoculated and un-inoculated P. vittata and P. hortorum.
Amplification of metal efflux transporter gene fragments (pbrA, cadA2 and czcR) from
Pseudomonas sp. genomic DNA explained molecular mechanisms involved in Pb resistance and
detoxification in bacteria.
Finally, a novel integrated plant-microbial system was developed through series of experiments
by co-inoculating bacteria and fungi. Strong inhibitory effect of Pb on soil enzymatic activities,
microbial biomass and respiration and significant restoration by bio-inoculants were achieved. Co-
inoculation of bacteria and fungi significantly improve soil enzymatic activities. The outcome of
this detailed investigation provided optimized, efficient and integrated biological system for
enhanced remediation of Pb contaminated sites that could be considered as a potential alternative
to synthetic chelators and reduce the associated environmental concerns. The findings of the
present study may be helpful in developing a pilot scale treatment facility for contaminated soil in
industrial and urban soil.
![Page 20: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/20.jpg)
1
Chapter 1
INTRODUCTION
Industrialization and urbanization all over the world, as well as in Pakistan, has led to release of
noxious effluents, which are inappropriate for soil, water and eventually for crop acquiesce (WHO,
2017). Heavy metals (HM) pollution of soil is a widespread problem throughout woprld that
threatens the quality of human and environmental health. Lead is one of the prominent examples
for anthropogenic environmental metal pollution. In natural soils, concentration of Pb is 10-100
mg kg-1 whereas in industrial zones, Pb concentration up to 39,250 mg kg-1 has been reported
(Greipsson et al., 2013; Arshad et al., 2008). Lead permissible limits in air, water and soil are given
in table 1.1.
Table 1. 1: Lead regulatory standards in environment (ATSDR, 2018, EPA, 2001).
Organizations Medium Limits EPA Soil (residential) 400 mg kg-1 (play areas) EPA Air (ambient) 0.15 µg/m
3 ACGIH Air (workplace) 50 µg/m
3 NIOSH Air (workplace) 50 µg/m3 OSHA Air (workplace) 50 µg/m
3 EPA Water (drinking) 15 µg L-1 FDA Drinking water 5 ppb CPSC Paint (0.009%) ACGIH Blood 30 µg dL-1 CDC Blood 5 µg dL-1 OSHA Blood 40 µg dL-1
These high concentrations of Pb in industrial sectors is attributed to activities including smelting
or ores and burning of fuels and recycling of batteries. A study by Memon et al. (2014) reported
high concentrations of Pb in soils and grasses near battery recycling complex Hyderabad Pakistan
and consequent toxicity and health impacts on animals. Similar Pb contamination has also been
![Page 21: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/21.jpg)
2
reported by Afzal et al. (2014) in Gujranwala and consequent toxicity impacts on human
population. Pb toxicity leads to decreases in germination percentage, length and dry mass of root
and shoots disturbed mineral nutrition, reduction in cell division (Bashmakov et al., 2017; WHO,
2017; Hossain et al., 2012). Through agricultural products, these heavy metals may enter into the
food chain and can potentially cause human liver and brain damage (Kushwaha et al., 2018). It is
reported that Pb is one of the most persistent metals. The soil retention time of Pb is estimated to
be 150 to 5000 years (Sobolev & Begonia, 2008). It is potentially toxic even at low concentrations,
and concentration above 400–500 mg Pb kg-1 is considered a risk for agriculture production and
human health (US-EPA, 2001). In this context, there is urgent need for exploring the remediation
options for wide spread Pb contamination.
Physico-chemical techniques for Pb remediation such as soil excavation, landfilling, acid leaching
and electro-reclamation are not suitable for practical applications, because of their high cost,
physical disturbance of land, destruction of soil structure and production of secondary waste that
can destroy soil microflora. Biological treatment methods provide affordable alternative solution
to soil remediation, through phytoremediation strategies. The use of plants to decontaminate soils
offers an environment-friendly solution to soil remediation (Gul et al., 2019; Arshad et al., 2016,
2008). Arshad et al. (2008) reported three cultivars of scented Pelargonium species as Pb-
hyperaccumulator plants: they accumulated more than 1000 mg Pb kg-1 dry weight and produced
high biomass. The factors that limit phytoremediation efficiency include various external (soil)
and internal (plant physiological) processes that directly or indirectly affect Pb phytoextration.
Bioavailability is a serious limiting factor that lowers the phytoremediation efficiency. To solve
this problem, various organic and inorganic synthetic chelating agents like EDTA have been
extensively studied for improving the solubility of Pb in soils and consequent uptake by plants
![Page 22: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/22.jpg)
3
(Gul et al., 2019; Zhang et al., 2016; Shahid et al., 2014). However, there are several environmental
concerns associated with the use of these synthetic chelates including low biodegradeability
(Pandey & Bhattacharya, 2018), leaching, ground water contamination and toxicity to soil
microbial diversity and enzymatic activities (Lu et al., 2017). Keeping in mind the environmental
concerns in using synthetic chelates, the current study was focused on investigating the potential
of bio-inoculants for enhancing the phytoremediation process.
1.1. Biologically Assisted Phytoremediation – Potential Approach
The fate of Pb in soils is directly and/or indirectly governe by soil microorganisms (bacteria and
fungi). These microorganisms and their extracellular enzymes are responsible for dissolution,
precipitation, complex formation and stabilization of Pb in soil. Different studies have explored
the functional ability of these bacteria and fungi for improved phytoextraction of Pb. Many soil
bacteria like Pseudomonas aeruginosa, Pseudomonas fluorescens, Ralstonia metallidurans,
Bacillus edaphicus, Bradyrhizobium sp., Ochrobactrum cytisi, Azotobacter chroococcum, Bacillus
megaterium and Bacillus mucillaginosus have been found efficient in increasing Pb uptake and
plant growth in different studies (Dary et al., 2010; Braud et al., 2009; Sheng et al., 2008b; Wu et
al., 2006). Similarly, many fungal strains have also been found to have promising effects on Pb
phytoextraction particularly saprophytic and mycorrhizal fungi including Glomus mosseae, Lewia
sp. and Mucor sp. (Loria et al., 2015; Deng et al., 2011; Punamiya et al., 2010).
In phytoremediation, the intrinsic ability of plant is responsible for rhizosphere modification and
uptake of Pb. Plants can modify the rhizosphere through excretion of root exudates. The
application of Pb tolerant, solubilizing and plant growth promoting microorganisms (bacteria and
fungi) can alleviate the toxicity of Pb by promoting plant growth under elevated soil Pb
![Page 23: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/23.jpg)
4
concentration and increase the phytoabvailability and subsequent uptake by plant as illustrated in
figure 1.1.
1.2. Problem Statement and Research Gap
Although some related work has been done, but currently no treatment methods are being applied
in Pakistan. Conventional treatment methods are not cost effective and environmently acceptable.
Biologically assisted phytoremediation has the potential to remediate Pb contaminated soils.
However, there are certain short comings.
The identification of appropriate bacterial and fungal strains in the study area is needed.
For efficient phytoremediation system, indigenous plants and microbial population need to
be identified.
Pb
Pb
Pb
Pb
Pb
Pb Pb Pb
M+P
Bio chelation
P
Pb+2
Pb (Sulphate,
phosphate,
hydroxides) Pb
+2
Pb+2
Pb+2
Pb+2
Root exudates (Citric, oxalic, malic,
tartaric acids)
High pH
Solubilization
Induce root exudation Bio chelates Pb Siderophores Reduce pH
Lower pH
Increase DOC
Dissolution Pb
PGPR activity Phytohormones
production Reduce metal toxicity
Improve
growth
Figure 1. 1: Plant-microbe interaction at soil plant interface that induced Pb availability and
phytoextraction (Shahid et al., 2010; Arshad et al., 2016; Loria et al., 2015). P and M+P indicate
plant and microbial + plant interaction for phytoremediation of Pb.
![Page 24: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/24.jpg)
5
These studies remain limited to particular plants and microorganism interactions that have
climatic and edaphic limitations.
Combinations of bacterial and fungal strains for the development of integrated biological
systems for enhanced phytoextraction are not available.
Plant microbe interactions at soil plant interface need to be studied in detail for improving
phytoremediation efficiency.
1.3. Objectives and Scope of Study
Based on the extent of the problem and study gaps, it was hypothesized that indigenous Pb
hyperaccumulator plant species, in combination with indigenous Pb tolerant and solubilizing
bacteria and fungi, could be more suitable for improved Pb phytoremediation and would reduce
environmental concerns. Keeping in mind the hypothesis and problem statement, the objectives
with stepwise experiments are as follows;
1. Screening of indigenous plant species capable of extracting high levels of Pb
Ornamental plant species were investigated for Pb hyperaccumulation potential in pot
experimental setup using Pb spiked soils. Twenty-one plant species were subjected to screening
for Pb uptake characteristics and biomass production. Selected plant species were then studied for
rhizosphere induced Pb phytoavailbility in cropping device setups.
2. Isolation and characterization of bacterial and fungal strains for Pb mobilization in
contaminated soil
Bacteria were isolated from Pb contaminated soils and characterized for Pb tolerance,
mobilization, plant growth promotion and Pb phytoextraction potential. Selected strains were
finally identified through 16SrRNA gene sequencing. Fungal strains, pre-isolated from heavy
metal-contaminated soils, were obtained and characterized in similar manner.
![Page 25: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/25.jpg)
6
3. Effects of applying microbial consortium on Pb solubility and enzymatic activity.
Bacterial and fungal interaction on soil enzymatic activity and Pb solubility were studied in soil
incubation experiments. In last step, plant-microbe (bacteria+fungi) interaction for imoroved Pb
phytoextraction was studied in pot experimental setup.
1.4. Presentation of the Work
In view of understanding and describing the background of the scientific problem, objectives of
study, advances in research, methodology and experimental design, outcomes and conclusions of
study, the desertation have been divided in 5 different chapters. The first chapter provides the
background, need and scope of this study, highlighting specific objectives. The second chapter
covers in detail the ecological toxicity, available remediation techniques, challenges, recent
developments and short comings in microbially assisted phytoremediation techniques.
Methodologies are presented along with respective results and discussion. Results are divided in
two chapters. Chapter 3 covers experiments for screening of indigenous plant species capable of
extracting high levels of Pb, rhizosphere study of selected plants and role of organic acids in Pb
speciation. Chapter 4 is divided in three sections. The first section covers fungal-plant interactions.
It includes characterization of fungal strains for Pb tolerance, mobilization, plant growth
promotion and interaction for phytoextraction of Pb. The second section is about bacterial studies.
In this section, multiple heavy metal resistant bacteria were investigated for plant growth
promotion under Pb stress and the molecular mechanisms were studied through amplification of
heavy metal resistant genes. The strains improved plant growth under Pb stress but decreased the
Pb uptake by phytostabilizing Pb in roots and soil. Therefore, the study was repeated, and
indigenous bacteria were isolated and characterized for Pb tolerance, mobilization, plant growth
promoting characteristics and improving phytoextraction potential of plants. Results are presented
![Page 26: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/26.jpg)
7
in section three. In chapter five, last objective is covered and work is divided in two sections. The
first section covers effects of co-inoculation of bacteria-fungi on Pb uptake by selected plant and
the second section covers impacts of microbial inoculation on soil enzymatic activity under Pb
stress. The last chapter presents conclusions and future perspectives, summarizing brief outcomes
of this study and outlining the possible directions for extention of this work.
![Page 27: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/27.jpg)
8
Chapter 2
REVIEW OF LITERATURE
2.1. LEAD CONTAMINATION AND ENVIRONMENTAL CONCERNS
2.1.1. Lead Contamination
Development of industrialization and mechanization since beginning of 19th century has led to
increase in anthropogenic human activities that generated enormous number of toxic contaminants
including metals and metalloid, which ultimately are posing serious damage to ecological and
environmental health (WHO, 2017). Most commonly present heavy metals in the environment that
induce toxicity to biological systems are; lead (Pb), cadmium (Cd), chromium (Cr), copper (Cu),
mercury (Hg) and nickel (Ni). The average and acceptable metal concentrations in soil are given
in table 2.1. Among them, Pb remains one of the most common heavy metal in the surface soil
because of its increased use, high persistence and low mobility.
Table 2. 1: Heavy metal concentrations likely to exist in soil (mg kg−1 dry soil) (EPA, 2005;
Sezgian et al., 2004; WHO, 2017).
Metal(iod)s Concentration in
uncontaminated soil
Threadhold levels in
contaminated soil
Permissible limits in
plants
As 7-40 0.39-40 0.5
Cd 0.1-1 3 0.02
Cu 5.0-20 50 10
Ni 10.0-50 50 10
Pb 0.1-20 200 2
Zn 10.0-50 300 0.60
Lead is a wide spread heavy metal contaminant, considered as being a serious ecological concern
worldwide. It is ubiquitous in the environment besides being non-biodegradable, highly persistent,
with a low mobility and poor solubility. The predominant forms of Pb in soil are phosphates,
carbonates, oxides and hydroxides which are highly insoluble forms states of Pb in soil. However,
![Page 28: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/28.jpg)
9
nitrates, chlorates and chlorides salts are merely soluble in water (WHO, 2001). Pb contamination
in differen region of Pakistan is given in table 2.2.
Table 2. 2: Lead contamination in different areas of Pakistan
Locations Pb (mg kg-1) References
Urban soils and road dusts
Islamabad 212 Ali & Malik, 2011
Islamabad (drain side) 203 Ali & Malik, 2011
Islamabad (green area) 209 Ali & Malik, 2011
Rawalpindi 146 Abbasi et al., 2013
Lahore 168 Siddique et al., 2011
SGV 450 Shi et al., 2008
CEQSS-II 300 Ni et al., 2009
Northern area
Kohistan region 103000 Muhammad et al., 2011
Pazang site 117 Muhammad et al., 2011
Lahor Site 1753 Muhammad et al., 2011
SGV 450 Shi et al., 2008
CEQSS-II 300 Ni et al., 2009
2.1.2. Sources of Pb in the Environment
The biggest and most profound source of Pb contamination is industrial, transportation and energy
sector (figure 2.2). It has wide industrial applications and mostly used in the form of tetraethyl lead
(TEL) ((CH₃CH₂)₄Pb). TEL was extensively used in gasoline in the past and its current application
in aviation fuel makes Pb as one of the most common and wide spread heavy metal contaminants
in soils (Kessler, 2013). Emissions from burning of fuels containing tertra ethyl lead and batteries
recycling process generated large quantity of fumes containing Pb. The Pb thereby travels large
distances and deposits on top soil at far proximal surroundings of industrial source resulting in
unacceptable increase of soil Pb concentrations (>200 ppm) (Greipsson et al., 2013). According to
an estimation, millions of hectares of area in urban and peri-urban area have been contaminated
with Pb and require immediate remediation (ATSDR, 2018; WHO, 2017; EPA, 2001).
![Page 29: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/29.jpg)
10
Figure 2.1: Sources and toxicological impacts of Pb in environment (Chen et al., 2006; IARC, 2006; Fewtrell et al., 2004; US-EPA,
2001)
Pb2+
Persistence
Low Mobility
Sources of Pb contamination
Pb is toxic (>400–500 mg Pb kg-1 in soil)
1% of the global disease
IARC
Group 2B (organic Pb) Group 3A (Inorganic)
Pb contamination in soilPb toxicity in
plants -Slow growth rate
-Less biomass
-Yellowing of leaves
-Inefficient root
system
Pb toxicity in humans Neurological
Hematological
Cardiovascular
Reproductive
Kidney
78% Lead used in battery
50% Lead production by battery recycling
Metal plating and finishing
Battery industries
Smelting of ores
Urban soil
waste
Exhaust from
Automobiles
Additives in gasoline
Factory chimneys
![Page 30: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/30.jpg)
11
2.1.3. Ecological Impacts of Pb
Heavy metals being non-biodegradable once come in soil remains there for long period of time
and becomes a continuous source of heavy metal toxicity. Therefore, contamination of
agricultural soil by Pb is a significant problem causing toxicity to plants animals and microflora.
2.1.3.1. Pb toxicity in plants
Lead is a major soil heavy metal pollutant that induces phyto-toxicity (Shahid, 2011). Pb enters
plants through root hairs in soil (Lasat, 2002) and or through air deposition (Uzu et al., 2010).
Lead exposure causes damage to cell membrane, impair seed germination, disturb cell division
and cell elongation, reduce root length, reduce transpiration, lower chlorophyll production,
induce oxidative stress and resulting production of reactive oxygen species (ROS) radical’s
including superoxide (O2-), hydroxyl (OH-), perhydroxyl (HO2 -), alkoxy (RO), as well as the
non-radicals hydrogen peroxide (H2O2) and singlet oxygen (O2)) (Anjum et al., 2015, Pourrut et
al., 2008) as summerised in figure 2.2.
Uptake of Cations
(K+, Ca
+, Mg
2+, Mn
2+,
Zn2+
, Cu2+
, Fe3+
)
Uptake of anions
Cell turgor pressure
and structure
Guard cell size
Stomatal
conductance
Abscisic acid level
Leaf area
Alteration in thylakoid
membrane composition
Chlorophyll II, plastoquinone,
carotenoids, NADPH activity,
oxidoreductase
Electron transport
Enzymatic activity of Calvin
cycle
Irregular shape
DNA damage
Micronucleus
Mitotic
irregularities
Chromosome
Electron transport
Proton transport
Enzymatic activities
of Kerb’s cycle
PPP
P
P
PPP
CELL DIVISION
PHOTOSYNTHESIS RESPIRATION
WATER REGIME
NUTRIENT UPTAKE
Figure 2. 2: Effect of Pb on plant’s physiological activities (Roy & McDonald, 2015; Pourrut et al.,
2011).
![Page 31: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/31.jpg)
12
The uptake of Pb in edible plants is also a serious concern. Ahmad & Goni (2010) observed the
concentrations of Pb in vegetables grown in agricultural soils of Bangladesh in the range of 10-
26 mg kg–1 dry weight. Whereas, the acceptable tolerance level of Pb concentration in vegitables
is 5 mg Pb kg–1 dry weight and 10-20 mg Pb kg–1 dry weight given by FAO and WHO
(Sauerbeck, 1982). Moreover, once Pb is uptaken, it causes severe damage to plant physiological
and reproductive systems. Lead induced phyto-toxicity in crop plants is summarized in table 2.3.
Table 2.3: Pb induced phytotoxicity in crop plants.
Plants Pb conc. Pb induced toxicity References
Maize (Zea mays) 0, 25, 50,
100, 200,
500 mM
Decrease germination percentage, reduce
plant biomass & protein content
Hussain et
al., 2013
Scented Rice
(Meixiangzhan-2,
Xinagyaxiangzhan
and Basmati-385)
400, 800,
and 1200
mg kg-1
Reduced photosynthetic pigments
(chlorophyll contents and carotenoids) and
induced oxidative stress
Reduced yield of all rice cultivars
Ashraf et
al., 2017
Vicia faba 5 µM Induction of MDA and H2O2 content Shahid et
al., 2015
Water hyacinths
(Eichhornia
crassipes Mart.)
100, 200,
400, 600,
800, 1000
mg L-1
50% inhibition in plant growth at 1000 mg
L-1 Pb concentration
Decreased the chlorophyll content
Malar et
al., 2016
Wheat (Triticum
aestivum)
50 and 250
μM
36% and 89% higher MDA content
compared to control after 2 h of exposure
Induced ROC 80% and 206% over the
untreated control in response to 50 and 250
μM Pb
Kaur et al.,
2015
Vicia faba 5 µM Increased the activities of superoxide
dismutases (SOD), guaiacol peroxidase
(GPOX), ascorbate peroxidase (APX) and
glutathione reductase (GR)
Shahid et
al., 2014
Wheat (Triticum
aestivum)
2 mM Decrease in the activity of Rubisco and ATP
sulfurylase (ATP-S), chlorophyll and
nutrients content in Pb-treated plants.
Alamri et
al., 2018
2.1.3.2. Pb toxicity in human
Many crop plants can uptake these toxic and non-essential metal elements and thereby raising
the risk of food chain contamination with toxic heavy metals leading to wide health concerns of
![Page 32: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/32.jpg)
13
human and animals (Roy & McDonald, 2015). The Centers for Disease Control and Prevention
(CDC) has stated that soil containing >50 mg kg-1 of Pb, poses serious risk to human health. Pb
can enter through dermal exposure, possible ingestion, inhailing, uptake by plants (CDC, 2010).
Detrimental effects of Pb are depicted almost in every organ of body but most frequently affected
and sensitive organs include nervous system, cardiovascular system, reproductive system and
excretory system. Pb poisoning is more common in children compared to adults. The
bioaccumulation of Pb in human body over time causes serious ill effects such as headaches,
short term memory loss, mental disorders, muscle and joint pains, gastro intestinal disorders,
food intolerance, fatigue, metabolic problems and mental confusions (Kushwaha et al., 2018).
2.1.3.3. Effect of Pb on soil microbial communities
Microorganisms differ in their ability to cope with heavy metal stress. Some microorganisms
have intrinsic ability to uptake heavy metals, resist the metal without any change in growth,
tolerate up to certain level, change the metal toxic state to less toxic through enzymatic activity
and chelation, however, some microorganisms can die out due to toxic effect of the same metal.
Therefore, the ability of microrganisms to behave differently under changing environmental
conditions tends to change the microbial community structure and diversity.
a. Microbial Community Structure and Diversity
Soil contaminated with heavy metals particularly with Pb have been repeatedly reported as
posing inhibitory effects on soil microbial community directly or indirectly by affecting their
structure and diversity. The culture independent techniques such as polymerase chain reaction-
denaturing gradient gel electrophoresis (PCR-DGGE) and phospholipid fatty acid (PLFA)
analysis are frequently and widely used techniques for analysis of soil microbial communities.
Shifts in soil microbial communities due to Pb contamination have been reported in a study
![Page 33: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/33.jpg)
14
conducted at polluted site (Indiana Department of Transportation (INDOT), USA). PLFA
analysis indicated that soil containing less concentration of Pb and Cr were higher in mole
fractions of branched-chain PLFA and cyclopropane PLFA (bacterial origin), whereas at higher
concentration of Pb, and Cr and hydrocarbons, the PLFA of fungal origin (polyunsaturated
18:2w9,12) was significantly higher (Joynt et al., 2006). Microbial community diversity,
evaluated by DGGE analysis, also showes direct effect of Pb on microbial diversity and
abundance. Similarly, in another study the detrimental effects of low (1 mg kg-1) and high (500–
2000 mg kg-1) levels of Pb on soil microbial communities were investigated by DGGE
community analysis (Sobolev & Begonia, 2008). The sequencing results of denaturing gradient
gel electrophoresis bands indicated that Pb inhibited the growth of Acidobacteria, Ascomycota
and Chytridiomycota. The PCR data of 16S and 18S r RNA copies further revealed that Pb was
more toxic to fungi compared to bacteria (Chen et al., 2014). Qing et al. (2007) also studied
microbial diversity around Pb-Zn mine tailing through PCR-DGGE technique and observed
decrease in bacterial diversity with decrease in distance from Pb-Zn mine. Now a days, high
throughput sequencing analysis techniques are applied to assess the ecotoxicological effects of
Pb on soil microbial community structures. In a study conducted by Zhang et al. (2016), the soil
microbial community structure indices and miseq-pyrosequencing results clearly indicated
inhibition of microbial richness and diversity on exposure to decabromodiphenyl ether-Pb. A
recent study by Yu et al. (2019) also confirmed the detrimental effects of Pb soil microbial
diversity and composition. The study reported slight decrease in values of Ace, Chao1, Simpson,
and Shannon-Weaver indices in soil containing 400 mg kg-1 Pb. The community profiles
indicated presence of Actinobacteria (17.77–48.53%) and Proteobacteria (17.85–39.66%) as
![Page 34: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/34.jpg)
15
dominant phylums in all experimental groups. However, at 400 mg kg-1 soil Pb concentration,
Bacteroidetes and Firmicutes were the most abundant phylum observed.
b. Soil enzymatic activities
The health of ecosystem in terms of environmental contamination from natural or anthropogenic
sources is expressed widely by estimating the soil enzymatic activity due do their hypersensitivity
to slight change in environmental conditions (Jaiswal & Pandey, 2018). Several studies have
confirmed the direct inactivation of enzymatic activity in soil upon heavy metal interaction with
sulphydral groups, and indirect by altering the composition and diversity of microbial community
by changing the favorable environmental conditions which are necessary to synthesizes enzymes
(Kandeler et al., 2000). The majority of reactions that takes place in the environment, particularly
in soil environment, includes decomposition, degradation, mineralization and immobilization are
catalyzed by enzymes and most of them are produced by active microbial communities (Jaiswal
& Pandey, 2018; Cui et al., 2013). Alkaline phosphatase (ALP) and dehydrogenase (DEH)
activities were significantly decreased at increasing levels of heavy metal, the decrease in ALP
and DEH activities were 13.1%–24.3% and 12.1%–18.2% in 500 mg kg-1 Pb treated soils,
respectively (Sardar et al., 2007).
2.2. REMEDIATION TECHNOLOGIES
Figure 2.3 summarizes various physical, chemical and biological approaches that are utilized for
remediation of Pb contaminated soil. None of these physiochemical treatment methods are
feasible and reduce Pb toxicity by just transforming the oxidation state of Pb and also have
adverse effects on soil physical, chemical and biological properties (Mohammed et al., 2013).
Considering environmental safety and remediation of Pb contaminated soil, biological treatment
methods offer wide range of treatment options that are more environment. Bioremediation
![Page 35: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/35.jpg)
16
techniques are safer, environment friendly (Dubchak & Bondar, 2019) and low cost compared to
conventional techniques as reported by Blaylock et al. (1997), where 50–65% cost was saved for
1 acre of soil remediated using bioremediation techniques compared to conventional methods
(excavation and landfill). In the recent years, more interest has been shown in plant-based
remediation of toxic heavy metals owing to high metal accumulation properties and higher
biomass production in presence of metal contaminated soil.
Figure 2. 3: Soil remediation techniques for Pb.
2.2.1. Phytoremediation techniques
Phytoremediation is the ability of metal tolerant plants to remediate heavy metals from soil.
Plants use different strategies to cope with metal pollution. It is low cost, ecofriendly,
Pb remediation
Techniques
Physical methods
Incineration
Washing
Land excavation
Land filling
Chemical methods
Extractive metallurgy
Precipitation
Pyrometallurgy
Hydrometallurgy
Biometallurgy
Bioremediation
Phyto-remediation
Phytoextraction
Phyto-stabilization
Rhizofiltration
Micro-remediation
Bacteria
Fungi
Algae
Vermi remediation
![Page 36: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/36.jpg)
17
nondestructive and natural technique to remove toxic heavy metals including Pb from soil. Metal
tolerant plants also known as metallophytes can be classified into three major categories (Baker
& Brooks, 1989): a) excluders, in which metal concentrations in the shoot are kept lower than
metal concentration in soil; b) accumulators, in this strategy, plants concentrate metals in above-
ground plant parts; and c) indicators, in which plants maintain a linear relationship between plant
and soil metal concentrations.
Table 2. 4: Pb phytoremediation techniques emploid to decontaminate Pb in environment.
Techniques Plants sp. Soil Pb conc. Plant characteristics References
Phytoextraction
Bidens pilosa Surrounding
Pb mines
(4881–5255
mg kg-1)
Shoot Pb conc. > 1000 mg
kg-1
TF > 1
Yongpisanphop
et al., 2017
Alcea aucheri Natural ore
deposit (> 500
mg kg-1)
Remediation of 204.12 kg
ha-1 Pb
Ravanbakhsh et
al., 2016
Colocasia
esculenta L.
0, 50, 200 and
400 μM.
1121 shoot conc. mg kg-1
mg kg-1
TF >1
Islam et al.,
2016
Colocasia
esculenta L.
0, 300, 600
and 1200 mg
kg-1
Shoots Pb conc. 7748 mg
kg-1
Islam et al.,
2016
Phytostabilization Thysanolaena
latifolia and
Mimosa
pudica
Pb mines
4881–5255
mg kg-1
Excluder
BF> 1 and TF < 1
Yongpisanphop
et al., 2017
Brachiaria
reptans L. &
Solanum
nigrum L.
2.0–29.0 mg
kg-1
BF >1
TF <1 for Pb
Malik et al.,
2010
Rhizofiltration Eichhornia
crassipes
(Mart.), and
Myriophyllum
aquaticum
(Vell.)
-
97.88 % of Pb removal Romero-
Hernández et
al., 2017
Carex
pendula
1, 5, 10 mg L-
1
Tolerance upto1600 mg
kg-1 Pb
Yadav et al.,
2011
![Page 37: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/37.jpg)
18
More accumulation in root
compared to shoot Bioconcentration Factor=BF; Biotranslocation Factor=TF.
Here in this case, the internal tissue concentration reflects the external soil levels. Regarding Pb
contamination, the three major phytoremediation strategies, extensively employed, are
phytoextraction, phytostabilization and rhizofiltration (Pilon-Smits, 2005). Few case studies for
each type from literature have been summarized in table 2.4.
2.2.2. Phytoextraction
Phytoextraction is the intrinsic ability of plants to sequester high amounts of toxic heavy metal
though roots and transport and accumulate in above ground tissues. There is a certain group of
plants that can accumulate elevated metal concentration in aerial parts of plants without
compromising biomass loss. There plants are termed as hyperaccumulators. The threshold metal
concentration in plants for different metals in hyperaccumulator plant species and Pb
hyperaccumulators so far identified are given in table 2.5 and 2.6, respectively.
Table 2.5: Threshold metal concentrations in plants for different metals in hyperaccumulator
plant species.
Heavy metals Threshold levels
(mg kg-1)
Baker & Brooks (1989)
Revised levels
(mg kg-1)
Van der Ent et al. (2013)
Arsenic 1000 1000
Cadmium 100 100
Cobalt 1000 300
Copper 1000 300
Chromium 1000 300
Lead 1000 1000
Manganese 10,000 10,000
Nickel 1000 1000
Zinc 10,000 3000
Some plants accumulate higher concentrations of Pb in roots than in shoots. They limit the
translocation to shoots, and the strategy is termed as phytostabilization. Removal of heavy metals
![Page 38: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/38.jpg)
19
from water using plants is termed as rhizofiltration (Anawar et al., 2008). This may involve
different mechanisms including absorption of metals in root cells by the process of
chemisorption, ion exchange, and complexation (Lasat, 2002), adsorption through complexation
with different functional groups of organic compounds present in mucilage and epidermal cells
(Sanchez-Galván & Olguín, 2009).
Table 2. 6: Some examples of Pb hyperaccumulator plant species reported in the litterature.
Hyperaccumulators Heavy metals Features References
Pelargonium species Pb >1000 mg kg-1 in shoot
TF >1
Arshad et al.,
2008
Alcea aucheri Pb, Cd >1000 mg kg-1 Pb in
shoot biomass
Remediation of 204.12
kg ha−1 Pb from soil in a
48 days period
Ravanbakhsh
et al., 2016
Cortaderia
hapalotricha
Pb and Zn >1000 mg kg-1 in shoot
TF >1
Bech et al.,
2016
Colocasia esculenta
L.
Pb 7748 mg kg-1 in shoot Islam et al.,
2016
2.2.3. Pb Uptake and Detoxification Mechanism in Plants
The figure 2.4 shows the schematic uptake of Pb in plants. Lead enters the plant through root
hairs in soil. Generally, the bioavailable Pb in soil is adsorbed on to root surface and is attached
to mucilage (carboxyl groups), uronic acid and polysaccharides of the rhizoderm cells (Seregin
et al., 2004). Once adsorbed, Pb may enter in roots passively and translocate along water channel.
Pb concentration gradient is never uniform along root cells (Seregin et al., 2004). It is observed
that the highest Pb concentrations are mostly found around root apices. The cells in root apex are
thin walled and the low rhizospheric pH facilitates Pb solubility and uptake (Seregin et al., 2004).
The uptake and translocation through biological membranes of both necessary (e.g Cu2+, Zn2+,
Mn2+) and unnecessary metals (e.g., Cd2+, Pb2+, Hg2+) are brought about by P-type ATPases
(Williams et al., 2000). Although Pb uptake is a non-selective and greatly depends on strong
![Page 39: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/39.jpg)
20
negative membrane potential in rhizoderm cells as kept by H+/ATPase pump (Wang et al., 2007).
The main pathway by which Pb enters roots is the Ca2+ permeable channels as documented by
different researchers (Pourrut et al., 2008; Wang et al., 2007). However, transgenic plants also
showed other non-selective channels for Pb uptake. These include cyclic nucleotide-gated ion
channels (Pourrut et al., 2010; Kohler et al., 1999) and low-affinity cation transporters. Metals
that are absorbed by the plant roots, enters the xylem through passive and or slow diffusion
through cell walls of different cells. They are transported through the xylem to different parts of
plant where they are detoxified and accumulated (Lasat, 2002).
Xylem loading
Pb translocation
Upward
movement
Dissolved salts/ nutrients
Casparian strip-
block apoplas Pb
movement
Apoplast
movement
Pb uptake
in roots
Cell wall Sequestration in
cell wall Xylem unloading
Vacuole
Pb storage in
vacuole
Pb translocation to
shoot through
symplast pathway
Figure 2. 4: Pb uptake mechanism in plants.
![Page 40: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/40.jpg)
21
Hyperaccumulator plants have evolved unique mechanisms to detoxify Pb inside plant tissue.
The mechanisms include highly selective Pb uptake, exudation of phytohormones, chelation with
specific ligands, metal binding to root surface, reduction and compartmentalization. Further, the
induction of antioxidants including non-protein thiol (NP-SH), cysteine, glutathione, ascorbic
acid, proline and enzymes (superoxide dismutase (SOD), ascorbate peroxidase (APX), guaiacol
peroxidase (GPX), catalase (CAT), and glutathione reductase (GR)) helps in reducing the Pb
stress and tolerance in plants (Anjum et al., 2015; Pourrut et al., 2008).
2.3. CHALLENGES AND FUTURE PROSPECTS IN PHYTOREMEDIATION
2.3.1. Challenges in Phytoremediation
Pb availability is one of the most important challenge that limits the phytoremediation efficiency
of specialized plants. Mostly encountered factors that limits phytoremediation efficiency are
elaborated in figure 2.5. Lead is normally bound to soil organic matter fractions or strongly
adsorbed on to mineral and soil particles. One of the major factor that determines the speciation
of Pb in soil is the pH. Low pH generally favors Pb solubilization and activity as free Pb2+ ion,
which reduces as pH tends to increase (Shahid, 2010). At high pH, Pb is either adsorbed,
precipitaded or complexed with hydroxyl ions and other soil particles and lower the available
fraction of Pb in soil. Soil pH influence negative surface affinity (CEC) of soil for metal ions
including Pb2+ (Wu et al., 2003), which results in Pb adsorption to soil particles. In soil plant
system pH interfere with phytoavailability of Pb through ion pairing and altering the solubility
of carbonates, hydroxides and phosphates and organic matter (Romero-Freire et al., 2015) which
ultimately reduces Pb availability and phytoextraction (Arshad et al., 2016).
![Page 41: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/41.jpg)
22
Figure 2. 5: Phytoremediation challenges and constrains in past developments (Arshad et al.,
2016, 2008; Shahid et al 2014).
Organic matter also greatly influences fate of Pb in soil. Lead is generally adsorbed and
immobilized by soil organic matter fractions. Dissolved organic matter (DOM) like humic acid
can interact with Pb2+ making its unavailable for plant uptake. It is reported that humic substance
have greater Pb complexation ability than the essential nutrients (Ca, Fe and K) (Botero et al.,
2010). Whereas some studies also showed Pb dissolution is governed by DOM which increases
Pb solubility upon rise in pH by making soluble organo-Pb complexes (Shahid et al., 2012a). The
dual function of soil organic matter greatly depends on composition of organic matter.
Phytoremediation efficiency is directly related to ability of plant to sequester higher
concentration of Pb in plant tissue and ability to produce high biomass. It is observed that Pb
induced toxicity in plants at higher concentration and plant biomass reduced which ultimately
![Page 42: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/42.jpg)
23
reduced the overall uptake of Pb and phytoremediation efficiency (Arshad et al., 2016, 2008;
Shahid et al., 2012a). In this regard, there is need to investigate potential additives that reduce
the Pb induced toxicity or support plant growth and biomass production in high metal
contaminated soils.
2.3.2. Role of Synthetic Chelates and Environmental Concerns
Synthatic chelates have been extensively studied for enhancing the Pb phytoavailability and
consequent uptake by plants. The most important chelates that successfully improved the
phytoextraction characteristics of treated plants include ethylenediaminetetraacetic acid (EDTA),
nitrilotriacetate (NTA), diethylenetriaminepentaacetic acid (DTPA), N-hydroxy
ethylenediaminetriacetic acid (HEDTA), ethylenediaminedisuccinate (EDDS) and citric acid.
Application of EDTA (3.148 mmol kg-1) increased shoot Pb concentration from 680.56 to
1905.57 mg kg-1 in Bidens maximowicziana (Wang et al., 2007). In another study, EDTA at 5
mmol kg-1 increased Pb uptake by 8.9– & 13.3–fold in two cultivars of Ricinus communis L.
(Zibo-3 & Zibo-9) compared to control plants (Zhang et al., 2016). Lu et al. (2017) also reported
1.69, 1.54, and 1.24–folds higher Pb phytoextraction in Zea mays L. when applied with 2.5 mmol
EDTA kg-1 soil. Similarly, EDDS (5mmol kg-1) also increased Pb uptake by 2.3 & 2.9–times for
Zibo-3 & Zibo-9, respectively in Ricinus communis L.
There are several environmental concerns associated with the use of these synthetic chelates
including Pb leaching to ground water, toxicity to plants, low plant biomass production, increased
soil acidity, low biodegradability of synthetic chelates, and toxic secondary metabolites
production may also cause damage to soil microbial and enzymatic activities. The most widely
used synthetic phytochelatin is EDTA, however, it has extremely low biodegradability (120-300
days half-life) (Pandey & Bhattacharya, 2018) and highly soluble in aqueous solution causing
![Page 43: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/43.jpg)
24
leaching of Pb to ground water (Lu et al., 2017; Hartley et al., 2014). Toxic impacts on soil biota
(Kaurin et al., 2018) were also confirmed in another study, where soil microbial activity and
basal respiration were decreased upon application of EDTA and EDDS (Epelde et al., 2008).
Keeping in mind the environmental concerns in using synthetic chelates, the current study was
focused on studying the potential of bio-inoculants for enhancing the phytoremediation process.
2.3.3. Role of Genetic Engineering in Phytoremediation
There are currently two approaches being explored to develop genetically modified plants with
enhanced metal uptake characteristics. These include conventional (1) breeding and (2) genetic
engineering. Conventional breeding is mainly achieved through hybridization which involves
transfer of hyperaccumulator traits (Pb tolerance and high uptake potential) from less biomass
producing plants to low accumulator of non-accumulator and high biomass producing plants
(Bhargava et al., 2012). Transfer of metal resistant traits of T. caerulescens into B. juncea have
successfully been achieved through somatic cells-based hybridization technique (Iqbal et al.,
2015). However, constraints like sexual incompatibility between different taxa and other
anatomical factors, limit the development of hybrids with desired traits of enhanced
phytoextraction. To this end, genetic manipulation of plants through advanced techniques and
development of transgenic plants with improved metal accumulation and tolerance and metal
detoxification system proved to be a promising technique. Through genetic engineering, ideal
hyperaccumulator plants can be developed by choosing and selecting ideal traits like high metal
accumulation and high biomass production (Fasani et al., 2017).
The advances in phyto-technology through application of transgenic plants have improved
phytoextraction of Pb and other heavy metals (Cd, Cu, Zn) and metalloids (As, Se) through
induction of metal transporters, production of antioxidants, improved metal tolerance and defense
![Page 44: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/44.jpg)
25
mechanism, production of metal detoxifying chelators-metallothioneins and phytochelatins
(Kotrba et al., 2009). Other environmental concerns include, increased bioavailability and
leaching of Pb, unrestricted invasiveness of transgenic plants and undesired genetic variability in
crop plants due to cross-pollination leading to possible human and animal exposure to heavy
metals though food chain contamination (increase metal accumulation in vegetable crops)
(Davison, 2005). The public acceptance is another barrier for field application of genetically
manipulated plants for phytoremediation purpose. Therefore, the current study was focused on
studying the potential of bio-inoculants for enhancing the phytoremediation process.
2.4. BIOLOGICALLY ASSISTED PHYTOREMEDIATION – A VIABLE OPTION
Within the group of microorganisms included in soil activities, there are the plant-associated
bacteria which can be endophytic or from rhizosphere and both provoke diverse consequences to
the plant, to the soil and to the destiny of Pb in soil. Among them, there are modifications for
solubility, bioavailability and transport of metal, reducing the soil pH and releasing biological
chelating compounds (Tak et al., 2013).
2.4.1. Plant-Microbial Interactions for Pb Phytoextraction
According to soil conditions, bacteria can produce and release different types of metabolites.
These can be such as organic acids, bio–surfactants and siderophores. Metabolites can modify at
the same time trace elements’ behavior and bioavailability; providing two possible responses to
increase the plant trace metal uptake and accumulation or to immobilize trace metals (Sessitsch
et al., 2013) as illustrated in figure 2.6. Metabolites may provoke the increase of metal mobility,
so the plant trace metal uptake is raised, and this process enhances the shoot biomass production
and raises the extraction of metals from soil.
![Page 45: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/45.jpg)
26
2.4.1.1. Microbial interaction and detoxification mechanism
These Pb tolerant microbes have extensively been studied for bioremediation of metals. The
major mechanisms include; (1) stabilization; (2) sorption; (3) accumulation; (4) transformation;
(5) leaching and (6) microbially assisted chemisorption of metals (Patel & Kasture, 2014).
Among these, bioleaching is of major importance that enhances phytoremediation process when
coupled with hyperaccumulator plants. Many soil bacteria (Pseudomonas aeruginosa,
Pseudomonas fluorescens, Ralstonia metallidurans, Microbacterium paraoxydans (Braud et al.,
2009; Sheng et al., 2008a) and some fungi (Mucor spp. CBRF59; Glomus mosseae) have also
been found to significantly increase the availability of soil Pb (Deng et al., 2011; Punamiya et
al., 2010).
Figure 2. 6: Microbial interactions in response to Pb exposure
Bio-chelation of metals
Microbial
community
IAA, ACC deaminase,
GA3, Phosphatase,
nitrogenase,
sideophores
Function
Microbial
activity
Structure
Decomposition
Mineralization
C & N cycle
C & N input
C & N output
PGPR characteristics
pH alteration
Siderophore metal-complexes
Organic acids (oxalic acid,
malic acid and citric acid)
Uptake, adsorb,
detoxification (expression
of Pbr and Cad)
Pb
Pb
(1)
(2)(3)
![Page 46: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/46.jpg)
27
Different studies have reported Pb detoxification mechanisms in bacteria (Jarosławiecka &
Piotrowska-Seget, 2014; Leedjärv et al., 2008). Lead efflux and precipitation are a two-
component Pb detoxification mechanism in bacteria (Hynninen et al., 2009). The major Pb
detoxification system in bacteria is led by pbr efflux system, which is surrounded by mer and czc
families on pMOL30 (Monchy et al., 2007). pbrA transports Pb from inside cytoplasm to
periplasm where released inorganic phosphate groups by pbrB precipitates Pb and prevents its
re-entry into cells. The export of Pb ions to the periplasm involves joint function of pbrA and
PIB ATPases, cadA and zntA and their functions are not limited to Pb only. In Pseudomonas
putida KT2440, the main efflux transporter identified for Cd and Pb is cadA2 (Hynninen et al.,
2009).
2.4.1.2. Organic acid release and Pb chelation
Plant associated microbes are able to produce low molecular weight organic acids. These
contribute differently in heavy metal solubility and mobilization of nutrients in the rhizosphere
(Rajkumar et al., 2012). Soil properties like sorption, metal complexation can modify the
behavior of organic acids (Arshad et al., 2016; Shahid et al., 2010; Sheng et al., 2008a). Most
frequently released organicacids by bacteria and fungi are oxalic acid, malic acid and citric acid,
gluconic acid and fumaric acid as the mean of carboxylates acids that can alter the pH and DOM
and could directly impact Pb availability for plant uptake. In-vitro assay indicated significant
production of citric (121 mg L-1) and oxalic acid (110 mg L-1) was observed by A. niger in the
presence of Pb (50 mg L-1), that results in lowering pH of medium and increasing extractable
fraction of Pb (Chandran et al., 2014). Mucor spp. have also been reported for production of citric
and oxalic acid (0.29 and 0.21 mg L-1, respectively) (Xiao et al., 2009; Wang & Chen, 2009)
which are well known chelators of Pb.
![Page 47: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/47.jpg)
28
Organic acids as siderophores can form complexes with metals in soil solution (Rajkumar et al.,
2012; Sheng et al., 2008a). The soluble organo-metal complexes increase the mobility and uptake
of metals. Siderophores are the second most released metabolites from bacteria and can reach
several molecular structures (Sessitsch et al., 2013). These metabolites are involved in metal
chelation, pH alteration and oxidation/reduction reactions (Rajkumar et al., 2012). Moreover,
siderophores are “iron-carriers” and they are released under iron-limiting conditions such as soils.
Furthermore, they are known as iron chelators due to a strong tendency to form a complex with
iron. Hence in presence of trace elements bacteria induce the siderophore synthesis and guide to
form siderophore metal-complexes with Al, Cd, Cu, Ga, In, Pb and Zn (Rajkumar et al., 2012).
2.4.1.3. Plant growth promotion through PGPR activity
Different strains of Pseudomonas (Rajkumar & Freitas, 2008), Microbacterium (Sheng et al.,
2008b), Klebsiella (Farina et al., 2012), Enterobacter (Kumar et al., 2009) have been documented
for PGPR characteristics in metal contaminated soil. It has been documented that Pb resistant
bacteria with indole acetic acid (IAA), siderophores and 1-aminocyclopropane-1-carboxylate
(ACC) deaminase, siderophopre (Sheng et al., 2008), hydrogen cyanate (HCN), nitrogenase
activity and phosphate solubilization can promote plant growth, tolerate Pb and improve Pb
uptake in plants (Belimov et al., 2005) and can be used as potential bio-inoculants in
phytoremediation. Moreover, these compounds are involved in the protection of plants against
Ni, Pb and Zn toxicity (Zhang et al., 2010; He et al., 2009; Sheng et al., 2008a,b).
2.4.1.4. Examples of biologically assisted phytoremediation
Phytoremediation is a slow process compared to physicochemical remediation techniques. By
combining phytoextraction with soil augmentation can enhanced removal of soil contaminants
has been achieved. Various studies reported enhancement of plant biomass under stress by
![Page 48: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/48.jpg)
29
associating with soil bacteria or plant growth promoting rhizobacteria (PGPR) and fungi are
listed in table 2.7.
Table 2. 7: Different studies reported in the litterature for microbially enhanced Pb uptake and
plant biomass.
Microorganisms Plants Metals Outcomes References
Bacterial assisted phytoextraction
Pseudomonas
aeruginosa,
Pseudomonas
fluorescens,
Ralstonia
metallidurans
Maize Pb, Cr Promoted plant growth,
increase bioavaiability and
uptake of Cr and Pb
Braud et
al., 2009
Bacillus edaphicus
Brassica
juncea
Pb Increased plant growth,
Increased Pb mobilization,
and uptake
Sheng et
al., 2008a
Bradyrhizobium sp.
750,
Pseudomonas sp.,
Ochrobactrum
cytisi
Lupinus
luteus
Cu, Cd,
Pb
Improved plant biomass,
nitrogen content and metal
uptake
Dary et al.,
2010
Pseudomonas spp. Centaurea
cyanus L
Pb Higher shoot Pb conc. in
inoculated plants
BCF: 5.33–5.63
TF: 1.09–1.2
Karimi et
al., 2018
Fungi assisted phytoextraction
Glomus mosseae vetiver
grass
Pb Increase Pb conc. in root
Increased translocation
Punamiya
et al., 2010
Glomus sp. (four
strains)
Hordeum
vulgare
and
Helianthus
annuus
Pb More shoot Pb conc. (40.4 mg
Pb kg-1) in inoculated than
non-colonized controls (26.5
mg Pb kg-1)
Arias et al.,
2015
Lewia sp. Dodonaea
viscosa
Pb 4.4–6.5 times more Pb in
roots
than in shoots
Improve Pb-phytostabilization
Loria et al.,
2015
Mucor sp. Brassica
chinensis
Pb, Cd Increased bioavailability of Pb
and Cd by 77% and 11.5-fold
Deng et al.,
2011
![Page 49: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/49.jpg)
30
2.5. PRESENT STUDY
Based upon extensive literature survey, present study was planned to investigate the potential of
indigenous ornamentals along with microorgansims in order to facilitate Pb mobility and
ultimately to improve phytoremediation of contaminated soil. Specific research objectives
(section 1.3) were developed to address the gaps identified through literature survey. The
experimental approach followed to achieve the study objectives is demonstrated in figure 2.7.
Preliminary studies were initially conducted to develop baselines for designing experimental
conditions in later experiments. Industrial zones of Islamabad and Rawalpindi were selected as
study areas. Soil sampling was done for the quantification of Pb contamination and for isolation
of indigenous bacteria. In the 2nd step, screening of ornamental plants was done for selection of
Pb hyperaccumulator plant(s). This was followed by rhizospheric and physiological studies on
selected plant(s). In the next step, bacteria and fungi were evaluated as potential bio-inoculants
Preliminary study Soil characterization, Bacteria isolation
Fungal studies Pb resistance and solubilization
PGP characteristics
Bacterial studies Pb resistance and solubilization
PGP characteristics
Integrated phytoextraction of Pb Bacterial and fungal co-inoculation
Enhance Pb phytoextraction
Screening of ornamental
plants Selection of Pb hyperaccumulator
Rhizosphere study Root induced changes
Soil enzymatic activities Microbial application
1
2
3 5 4
6
7
Figure 2. 7: Experimental approach and design of study
![Page 50: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/50.jpg)
31
for improving Pb phytoextraction. Finally, soil enzymatic activities were monitored on the
application of optimized integrated techniques for phytoextraction efficacy.
Soil sampling was performed to estimate Pb concentrations present around battery recycling sites
of Islamabad and Rawalpindi, Pakistan. For this purpose, soil samples were collected from eight
different locations randomly, and were combined to form a representative composite sample for
determination of Pb concentration in the study area. Samples were acid digested with 16 mL (1:4;
v/v) of HNO3 (65%) and HCl (37%) (Merck Millipore) (McGrath & Cunliffe, 1985). Extracts
were then analyzed for total Pb concentration by atomic absorption spectrophotometer (AAS),
(Model: GBC 932 plus, Australia). The sampled soil contained 1352 mg kg-1 of Pb. This value
served as the reference for choosing Pb levels (500, 1000, 1500 and 2000 mg kg-1) in later
experiments. The detailed methodology has been presented along with results in upcoming
chapters.
![Page 51: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/51.jpg)
32
Chapter 3
SCREENING OF LEAD HYPERACCUMULATOR PLANT SPECIES
This chapter is divided in to three sections. The first section covers the screening of indigenously
grown ornamental plant species in Islamabad, Pakistan for Pb hyperaccumulation potential. In
the second section, root induced changes in rhizosphere that influence Pb phytoavailability was
studied using locally designed cropping device setup. In the third section, the effects of organic
ligands on Pb speciation and availability was studied using speciation model VISUAL minteq3.
Details of experiments are summarized in each part as follows.
A. SCREENING OF INDIGENOUS ORNAMENTAL PLANT SPECIES
FOR Pb ACCUMULATION POTENTIAL
3.1. INTRODUCTION
Contamination of soils with Pb is a serious environmental concern due to its wide spread
prevalence and very high persistence, with poor solubility in water except for nitrates, chlorates
and chlorides (WHO, 2001). It is highly toxic and is a potential risk for plants and human health
at concentrations above 400 Pb kg−1 in soil (US-EPA, 2001). High Pb concentrations directly
affect plant growth and development by disturbing important physiological processes like
photosynthesis, nutrient uptake (Hossain et al., 2012), enzyme and hormone production (Ali et
al., 2013), slow growth rates, less biomass and an inefficient root system (Sharma and Dubey,
2005). Concentrations above 1 mM Pb inhibited axial growth, decreased leaf area, water
absorption and biomass in Zea mays (Bashmakov et al., 2017). According to the International
![Page 52: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/52.jpg)
33
Agency for Research on Cancer (IARC), Pb is classified as a possible human carcinogen (IARC,
2006).
High concentrations of Pb in soils is mainly attributed to anthropogenic activities including
industrial, transport, energy and power sectors (Prasad and Freitas 2006). Among these, battery
recycling is the major point source of Pb contamination, since it accounts globally for 50% of Pb
production (Afzal et al., 2014). In Pakistan, recycling of Pb batteries is a major industry with the
capacity to produce over thousands of metric tons of recycled Pb per month (Memon et al., 2014).
The recycling is carried out through open furnaces without the necessary infrastructure, which
results in the generation of excessive amounts of fumes that contaminate the soil environment
(Afzal et al., 2014). For sustainable and suitable solutions to these Pb contaminated sites, low
cost techniques need to be identified (Gregorio et al., 2000). For this purpose, the development
of appropriate technologies to assess the presence, the mobility and remediation of metals in soil
have been initiated during the past decades (Baker, 1981). Conventional treatment methods
(chemical and physical) are not feasible due to high cost, waste generation, secondary
contaminants and physical disturbance. Under this scenario, natural soil remediation using higher
plants has gained much importance (Robinson et al., 2003; Raskin and Ensley, 2000).
The technique termed as “phytoremediation” proved to be the best adaptable and low-cost
alternative (Kotrba et al., 2009). Members of the Brassicaceae and Fabaceae families were first
characterized for metal hyper-accumulating properties (Salt et al., 1998). Presently, more than
450 species (Prasad and Freitas, 2003; Maestri et al., 2010) across 45 families have been reported
to accumulate substantially high amounts of different heavy metals in their biomass. Other than
hyperaccumulators, many plants like torpedo grass (Gao et al., 2017), Zea mays (Bashmakov et
al., 2017), Phalaris arundinacea (Wiche et al., 2017) and Pelargonium sp. (Arshad et al., 2008)
![Page 53: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/53.jpg)
34
can accumulate substantial amount of Pb, in their biomass. These plants can influence metal
uptake by modifying soil pH upon release of root exudates (Arshad et al., 2016).
Although 18 plant species have been reported as hyperaccumulators of Pb in literature, yet most
of them are not feasible for field applications (Liu et al., 2008; Estrella-G´omez, 2009). Most of
these plants are edible or exogenous to the environment. Heavy metals are likely to transfer into
the food chain and there are climatic and environment factors that limit efficiency of
phytoremediation system (Wei et al., 2008). Therefore, to avoid any risk of food chain
contamination and better adaptivity to soil and climate, the current study was focused on
assessing the potential of Pb phytoextraction by nonfood plants that easily grow in Pakistan. The
overall objective of this work was to determine potential of 21 ornamental species for Pb uptake,
translocation and sequestration in different plant parts (root and shoot) along with tolerance
capability through biomass variations upon exposure to different levels of Pb in soil.
3.2. MATERIALS AND METHODS
3.2.1. Preliminary study
Soil sampling was performed to estimate Pb concentration present around battery recycling sites
of Islamabad and Rawalpindi, Pakistan. For this purpose, eight soil samples were collected from
different locations randomly, and were combined to form a representative composite sample for
determination of Pb concentration. Samples were acid digested with 16 mL (1:4; v/v) of HNO3
(65%) and HCl (37%) (Merck Millipore) (McGrath & Cunliffe, 1985) purchased from local
vendor, Public Traders. Extracts were then analyzed for total Pb concentration by atomic
absorption spectrophotometer (AAS), (Model: GBC 932 plus, Australia). The sampled soil
![Page 54: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/54.jpg)
35
contained 1352 mg kg−1 of Pb. This value served as the reference for choosing Pb levels in
concentration gradient experiment.
3.2.2. Soil Sampling, Preparation and Characterization
For culture experiments, uncontaminated top soils (0−15 cm) were collected from the vicinity of
National University of Science and Technology, Islamabad, Pakistan, air-dried, crushed and
passed through 2-mm sieve. The characteristics of this soil, used in culture experiment, are
presented in table 3.1. Soil pH is one of the most important parameter that determines the fate of
metal availability and transport to plant tissues. The pH of the soil was slightly alkaline (7.39)
(McLean, 1982). Total organic matter content was 0.42% (Walkey and Black, 1934). Soil texture
was clay loam, determined by saturation percentage method (Malik et al., 1984). The soil was
also analyzed for essential nutrients and trace elements. Total concentrations of Pb, nitrogen (N),
phosphorus (P), potassium (K), magnesium (Mg) and iron (Fe) in digested samples were 4.39,
0.31, 6.29, 740, 307.5 and 3095.5 mg kg−1, respectively.
For controlled experiments, uncontaminated soil was artificially spiked with Pb(NO3)2 (Merck
Millipore). Doses were selected keeping in view the level of Pb in field soil samples and
literature. The following five concentrations were prepared: Soil with no Pb (0), and soil with
increasing concentrations of Pb from 500, 1000, 1500 to 2000 mg Pb kg−1 of soil. To achieve the
desired Pb concentration levels, Pb as Pb (NO3)2 was added to the soil in solution form, mixed
and kept for two weeks to reach equilibrium. For uniform distribution and stabilization of Pb,
soil was regularly mixed and soil moisture was maintained around 60%. After two weeks, Pb
concentrations in each spiked level were determined analytically (McLaughlin 2001). For this
purpose, 0.5 g of each spiked soil sample was subjected to acid digestion and subsequent analysis
![Page 55: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/55.jpg)
36
through atomic absorption spectrophotometer (AAS). Pb concentrations were found as 458, 921,
1434 and 1860 mg Pb kg−1 soil at 500, 1000, 1500 and 2000 mg Pb kg−1 soil spiking levels
indicating the metal recovery as 92.4%.
Table 3.1: Characteristics of soil used for research experiment.
3.2.3. Plant Growth Experiments
Twenty-one ornamental plant species listed in Table 1S were exposed to different concentrations
of Pb in culture experiments. Two factors were taken in to account for the choice of plants (a)
the literature related to Pb accumulating plants and (b) indigenous and most widely cultured
ornamental plants. Plants were taken from 15 different families including Asteraceae (5),
Brassicaceae (2) and Caryophyllaceae (2). Many plants from Geraniaceae (Pelargonium species)
(Arshad et al., 2008) and Brassicacease (Szczygłowska et al., 2011) have already been reported
in literature as hyperaccumulators of Pb. The seeds of these plants were obtained from Green
Implex (Seed Bank), Islamabad, Pakistan and were stored at 4°C. For germination, seeds were
soaked in water for 2 hours, surface-sterilized by 1% calcium hypochlorite for 10 minutes and
germinated at 25°C. Twenty seeds were sown in each pot containing 2 kg of air-dried soil. After
Sr.No.Parameters Values
1 Soil pH 7.39
2 EC (dS m-1
) 0.45
3 Texture Clay loam
4Organic matter content
(carbon %)0.42
5 Total nitrogen (%) 0.031
6 Total phosphorus (mg kg-1
) 6.29
7 Potassium (mg kg-1
) 740
8 Magnesium (mg kg-1
) 307.5
9 Iron (mg kg-1
) 3095.5
![Page 56: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/56.jpg)
37
sowing, the soil was moistened by adding distilled water to maintain 75% of the soil saturation
percentage and pots were then kept in dark for germination. Upon germination, pots were placed
in open air with ambient light and allowed to grow for 3 weeks to produce seedlings with four to
five leaves each.
Seedlings of uniform size were selected for experimentations. Seedlings with 4-5 leaves were
transplanted to pots filled with soil spiked at four different levels of Pb. For control, experimental
pots with soil having no Pb were also set for each plant species. For each treatment, there were
three replicates. The plants were placed in a growth chamber with a 16 h and 8 h day-night regime
at 25°C. The pots were watered daily with distilled water to maintain moisture content at 65–
70% water-holding capacity with care to avoid heavy-metal leakage from the pots.
3.2.4. Harvesting and Plant Sample Analysis
To evaluate phytoextraction potential, the plants were exposed to Pb for 7 weeks (Thamayanthi
et al., 2013). After which, plants were carefully harvested from the pots, washed with tap water
until free of soil, then rinsed with distilled water and soaked in 50% nitric acid for 5 min to
remove any adsorbed Pb on root surface, rinsed again with distilled water and blotted with filter-
paper. Plants were then subdivided in to roots and shoots and the fresh weight was measured
immediately, and the dry weight after 48 h of desiccation in an oven at 60°C. The dried samples
were ground in a pestle mortar and stored in polythene bags. For acid digestion, 100 mg of the
powdered plant material was digested with HNO3/HClO4 (4:1) mixture. The digestion was done
on hot plate at 150°C for 2-3 hours and continued till a clear aliquot was obtained. These aliquots
were diluted with distilled water to make 50 mL final volume. Then all solutions were filtered
with Whatman# 42 before metal analysis with AAS.
![Page 57: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/57.jpg)
38
3.2.5. Pb Accumulation in Plants
The accumulation characteristics of plants can be defined by three factors: Enrichment factor
(EF), Biotranslocation factor (TF) and Bioconcentration Factor (CF). EF is calculated as the ratio
of Pb content in shoots to Pb content in soil. TF indicates the ability of plant to translocate the
metal from root to aerial parts and is calculated as the ratio of the metal content in the shoots to
that in soils (Zu et al., 2005) whereas CF is defined as the capacity of plant roots to sequester Pb
from the surrounding soil environment. The formulas used to calculate these factors were;
TF = [Metal]shoot / [Metal]root …………… (Zu et al., 2005)
EF = [Metal]shoot / [Metal]soil ……………. (Zu et al., 2005)
CF = [Metal]root / [Metal]soil ……………... (Yoon et al., 2006)
3.2.6. Statistical Analysis
All treatments were replicated thrice and data were analyzed by performing one way Analysis of
Variance (ANOVA) and significance among different plants were determined by Least
Significant Difference (LSD) test in Statistical Package for the Social Sciences (SPSS) 16.0
software. All results are expressed as mean values with corresponding standard errors.
3.3. RESULTS
3.3.1. Screening for Pb Accumulation Potential
The ability of plants to uptake Pb in shoot is the most import characteristic in phytoremediation.
Pb concentration in above ground portion of all plants at different soil Pb levels is presented in
table 2. Results indicated varying ability of plants to accumulate Pb in above ground portion.
![Page 58: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/58.jpg)
39
Based on Pb accumulation in above ground portion, all the plants were grouped into 3 classes
(table 3.2).
Table 3.2: Classification of ornamental plants for Pb accumulating abilities in shoot biomass
when exposed to different levels of Pb in concentration gradient experiment. Different letters
i.e. a-d, f-k, l-q, r-z indicates significance difference (p<0.05) in Pb accumulation by plant
species at 500, 1000, 1500 and 2000 mg Pb kg-1 soil, respectively.
Plant Species Pb conc. in spiked soil (mg kg−1)
500 1000 1500 2000
Class A (> 800 mg Pb kg−1 shoot biomass)
Dianthus barbatus 436.7c 626.0ghi 843.0m 414.3tuvw
Mesembryanthemum criniflorrum 699.0b 996.7f 1268.8l 841.5r
Pelargonium hortorum 1028.3a 776.2g 438.1mn 233.7t
Class B (400-800 Pb kg−1 shoot biomass)
Antirrhinum majus 524.5bc 776.8g 561.0no 373.7uvw
Brassica oleracea 267.3c 540.3hi 384.5o 117.4x
Calendula officinalis 580.7b 281.1jk 256.7pq 237.4wx
Dianthus caryophyllus 440.3c 452.6ij 600.8no 183.8x
Godetia grandiflora 365.5c 666.6gh 713.4mn 668.0s
Limonium sinuatum 574.3b 293.5jk 238.4pq 41.7z
Matthiola incana 325.0c 275.1jk 312.6p 480.4tu
Nemesia strumosa 130.5d 183.0k 485.3nop 195.7xy
Phlox drummondi 230.3cd 344.7j 443.7nop 339.0vwx
Tropaeolum majus 333.9c 379.7ij 432.7n 346.5wx
Viola wittrockiana 220.7d 312.0jk 415.3n 485.5tuv
Class C (< 400 Pb kg−1 shoot biomass)
Dhalia hortensis 141.5d 391.3ij 271.7pq 107.9x
Callistephus chinensis 127.8d 155.8jk 147.5q 115.5x
Gazania rigens 145.0d 108.8k 189.1q 74.1z
Petunia hybrida 62.1de 357.3j 99.8q 75.8z
Sage splendens 224.3d 225.2k 107.7pq 78.9z
Tagetes erecta 137.3d 181.3k 106.5pq 35.7z
Verbena hybrida 132.9d 356.6j 146.7pq 86.8y
Class A represents the highest accumulating plants with shoot Pb concentration >800 mg Pb kg−1,
B with average (400−800 mg Pb kg−1) and C with the lowest Pb accumulating abilities (< 400
mg kg−1). The %age abundance of Class A, B and C plants out of experimented 21 plants were
![Page 59: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/59.jpg)
40
14.3%, 52.4% and 33.33%, respectively. In class A plants, significantly high Pb accumulation
(>1000 mg Pb kg−1 shoot biomass) was observed in Mesembryanthemum criniflorrum and
Pelargonium hortorum at different concentrations of Pb in soil. Mesembryanthemum
criniflorrum was the most significant accumulator of Pb in shoot dry biomass (996.7, 1268.8 and
841.5 mg kg−1 at 1000, 1500 and 2000 mg Pb kg−1 soil, respectively). It was interesting to note
that Mesembryanthemum criniflorrum’s potential to accumulate decreased at the highest
exposure level, probably due to activation of excluder strategy at 2000 mg Pb kg−1 of soil. At 500
mg kg−1 Pb concentration, Pelargonium hortorum accumulated the highest amount of Pb (1028.3
mg kg−1) in shoot biomass. In average Pb accumulating plants (class B), Antirrhinum majus and
Godetia grandiflora accumulated substantial amount of Pb 776.8 (at 1000 mg Pb kg−1 soil) and
713.4 mg kg−1 (at 1500 mg Pb kg−1 soil), respectively. At 2000 mg kg−1 Pb concentration, all the
plants had the lowest Pb accumulation. Overall, better accumulation was observed in
Mesembryanthemum criniflorrum. Other plants such as Brassica oleracea, Callistephus
chinensis, Dhalia hortensis, Gazania rigens, Limonium sinuatum, Petunia hybrid, Sage
splendens, Tagetes erecta and Verbena hybrid had low Pb concentrations in shoots, 117, 116,
108, 74, 42, 76, 79, 36 and 89 mg Pb kg−1, respectively along with low biomass production at
2000 mg Pb kg−1 soil. Therefore, these plants are not presented further for the sake of
simplification and better understanding.
3.3.2. Lead Concentrations in Roots and Shoots of Selected Species
Plants that performed better in primary screening for accumulation of Pb in roots and shoots are
presented in figure 1. Results indicate that all plant species within and between families differ in
their capacity to accumulate Pb in roots and shoots. Wide range of Pb accumulation was observed
![Page 60: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/60.jpg)
41
in roots of different ornamental plants grown in soil with different Pb concentrations (figure
3.1a).
Figure 3. 1: Pb concentration in selected plants; (a) Pb concentration in roots; (b) Pb
concentration in shoots. Different treatments showing significant difference are indicated by
different letters i.e. a-c, g-j, m-p and w-z for 500, 1000, 1500 and 2000 mg Pb kg−1 soil,
respectively.
At treatments 500 and 1000 mg Pb kg−1 of soil, Calendula officinalis showed significant Pb
accumulation in roots, i.e. 1439 and 1170 mg kg−1, respectively. With increasing Pb
concentration up to 2000 mg Pb kg−1 soil, the capacity was reduced by 4.31–folds. At higher
concentrations, i.e. 1500 and 2000 mg Pb kg−1 of soil, Godetia grandiflora exhibited significant
c
a
d
b
ed
h
g
j
g
ii
n
o
no
m
n
no
xyz
x
w
wx
y
0
200
400
600
800
1000
1200
1400
1600
1800
Pb c
onc.
(mg
kg-1
)
Plant species
500 1000 1500 2000 mg kg-1
bcc
cdd
b
a
g
h
g
g
g
g
n
o
nn
m
ny
xy
y
wx
w
x
0
200
400
600
800
1000
1200
1400
1600
Pb c
onc.
(mg
kg-1
)
Plant species
500 1000 1500 2000 mg kg-1
(a)
(b)
![Page 61: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/61.jpg)
42
Pb uptake in roots, 1180 and 1021 mg kg−1, respectively. Overall, the least Pb accumulation (<
100 mg kg−1) was observed in Gazania rigens, Limonium sinuatum, Sage splendens and Tagetes
erecta, Verbena hybrida at 2000 mg Pb kg−1 soil, respectively. Similarly, all plants showed
different capacity in transporting metal to shoots with increasing concentration of soil Pb (figure
3.1b). At 500 mg Pb kg−1, Pelargonium hortorum accumulated significantly high level (1028.3
mg kg−1) of Pb in shoot dry biomass. At 1000, 1500 and 2000 mg Pb kg−1 Mesembryanthemum
criniflorum accumulated 996.7, 1268.8 and 841.5 mg Pb kg−1, respectively. Dianthus barbatus
also accumulated substantial amount of Pb (up to 843 mg kg−1) in shoot biomass.
3.3.3. Plant Biomass at Varying Pb Concentrations
All the plants had the highest biomass at control (no Pb added) and by increasing the Pb
concentration from 500 to 2000 mg kg−1, the biomass was generally reduced with the highest
reduction by 2.27–folds for Brassica oleracea. However, a slight insignificant reduction was
observed in Tropaeolum majus (1.13–fold) and Pelargonium hortorum (0.8–fold). Results of
biomass production by selected plants at 2000 mg kg−1 are presented in table 3.3. Among
different experimented plants, Pelargonium hortorum and Tropaeolum majus produced
significantly higher biomass i.e. 0.78 and 0.71 g per plant, respectively at 2000 mg Pb kg−1 soil
followed by Mesembryanthemum criniflorrum (0.6 g per plant). However, Brassica oleracea and
Verbena hybrid produced significantly less biomass compared to the rest of plants. Also, their
biomass reduced sharply by increasing Pb concentrations (data not shown).
3.3.4. TF, EF and CF
For selection of suitable candidate for phytoremediation of contaminated soil, the plants were
analyzed for the properties including biotranslocation, enrichment and bioconcentration factor
![Page 62: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/62.jpg)
43
for Pb in plant biomass. The performance of selected plants in terms of EF, TF and CF indices
are presented in table 3.3. Among the tested plants, Pelargonium hortorum, Matthiola incana,
Tropaeolum majus, Mesembryanthemum criniflorum and Dianthus barbatus had TF values
greater than 1 at 500 mg kg−1. With increase in soil Pb concentrations, TF values tended to be
lower than 1. In case of EF index analysis, Calendula officinalis, Pelargonium hortorum,
Limonium sinuatum, Mesembryanthemum criniflorrum and Antirrhinum majus had EF values
greater than 1.
Table 3.3: Pb accumulation characteristics and plant dry biomass of selected ornamental plants
exposed to 2000 mg kg−1 soil Pb concentration. Significance is calculated at P> 0.05 and
denoted by alphabets.
Plant Species Dry Weight
(g)
Pb Conc. in soil 2000 mg kg−1
EF TF CF
Antirrhinum majus 0.53de 0.2 0.9 0.2
Callistephus chinensis 0.56cd 0.1 0.2 0.3
Dianthus barbatus 0.56c 0.2 0.8 0.2
Dianthus caryophyllus 0.42f 0.1 0.5 0.2
Godetia grandiflora 0.63bc 0.3 0.7 0.5
Matthiola incana 0.47ef 0.2 1.5 0.2
Mesembryanthemum
criniflorrum 0.65b 0.4 1.0 0.4
Pelargonium hortorum 0.78a 0.1 1.7 0.1
Phlox drummondi 0.46f 0.2 0.6 0.3
Tropaeolum majus 0.71ab 0.2 1.0 0.2
viola wittrockiana 0.56cd 0.2 0.8 0.3 (EF=Enrichment factor; TF=Bio translocation Factor; CF=Bio concentration Factor)
Considering the CF values at 500 mg kg−1, only few plants including Calendula officinalis,
Petunia hybrida, Godetia grandiflora, Viola wittrockiana and Antirrhinum majus could attain
CF values greater than 1. A decrease in these values was observed with the increasing
concentrations of Pb in soil. Out of 21 ornamental plants, only 7 plant had TF values >1, while 5
plants had EF values >1 and only 5 plants had CF values >1. With increase in soil Pb
![Page 63: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/63.jpg)
44
concentration, all the values for TF, EF and CF decreased to less than one. At the highest Pb
level, 2000 mg Pb kg−1 of soil, Matthiola incana, Mesembryanthemum criniflorum, Pelargonium
hortorum and Tropaeolum majus had TF >1 whereas all the plants had EF and CF values <1.
3.3.5. Lead Uptake
Pelargonium hortorum and Godetia grandiflora had significant uptake (0.62 and 0.70 mg per
plant) at 500 and 1000 mg Pb kg−1 soil. Whereas Mesembryanthemum criniflorum accumulated
high levels of Pb (0.79 and 0.50 mg per plant) along with the biomass produced at 1500 and 2000
mg Pb kg−1 soil respectively. Results related to uptake of Pb at 2000 mg Pb kg−1 by selected
plants are presented in figure 3.2.
Figure 3.2: Pb uptake by selected ornamental plants exposed to 2000 mg kg−1 soil Pb
concentration. Bars indicate means of three replicates and letters indicate significance
difference at p<0.05.
At the highest soil Pb concentration i.e. 2000 mg kg−1 Mesembryanthemum criniflorrum and
Godetia grandiflora showed the highest per plant uptake by 0.54 and 0.51 mg per plant,
respectively followed by Pelargonium hortorum with 0.32 mg per plant.
c
d
bcd
a a
b
0
0.1
0.2
0.3
0.4
0.5
0.6
0.7
0.8
Am
ou
nt
of
Pb
per
pla
nt
(mg)
Plant species
![Page 64: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/64.jpg)
45
3.4. DISCUSSION
In the present study, there was great variation among all ornamental plants for their ability to
accumulate Pb in roots and translocation to shoots. The Pb concentrations in the roots of 21
ornamental plants exposed to different levels of Pb in spiked soil ranged from 55 mg kg−1
(Limonium sinuatum) at 2000 mg kg−1 Pb to as high as 1439 mg kg−1 at 500 mg Pb kg−1 of soil
in the roots of Calendula officinalis. Liu et al. (2008) also reported Calendula officinalis as Pb
accumulator and a potential candidate for remediation of urban soil contaminated with Cd and
Pb. In case of shoots, minimum and maximum Pb concentrations were 42 mg kg−1 (Limonium
sinuatum) at 2000 mg kg−1 Pb and 1269 mg kg−1 (Mesembryanthemum criniflorum) at 1500 mg
kg−1 Pb.
For selection of hyperaccumulator plants, certain standards are given in the literature. These
include four characteristics; (1) Plant should be able to accumulate Pb>1000 mg kg−1 in shoot
biomass (Wei et al., 2002; Kakar et al., 2011), (2) can accumulate 10−500 times more Pb in shoot
than ordinary plants (Shen and Liu, 1998), (3) TF, EF and CF values should be >1 and (4)
tolerance capability of plant at high metal contamination (Brown et al., 1994; Wei et al., 2002,
Nazir et al., 2011). Efficiency of phytoremediation is based upon efficient sequestration of total
amount of the metal from soil though extensive root system and translocating the metal from root
to above ground biomass of plant. Two most import factor in this regard are (1) metal
concentration or uptake efficiency of plant and (2) Total dry biomass of plant (Baker, 1981).
Considering these criteria, Pelargonium hortorum, Mesembryanthemum criniflorum and Godetia
grandiflora showed significantly high Pb accumulation in the plant biomass. In this study, plant
dry biomass, Pb uptake and translocation factor were mainly considered for identification of Pb
hyperaccumulators (Arshad et al., 2008). Pelargonium hortorum and Mesembryanthemum
![Page 65: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/65.jpg)
46
criniflorum were able to satisfy the required characteristics of Pb hyperaccumulator. These
findings were only based upon pot experiments and soils spiked with Pb(NO3)2, the accumulation
behavior of selected plants could be different in soils contaminated over longer periods through
anthropogenic activities.
The accumulation characteristics of Pelargonium hortorum indicated that at 500 mg Pb kg−1 soil,
there was 7.24−fold increase in Pb as compared to other plants. The Pb concentration in shoot
reached 1028.3 mg kg−1, which is critical threshold value for a hyperaccumulator (Srivastava et
al., 2006). The concentration of Pb in total biomass produced by plant reached 0.6 mg per plant
which was significantly high among all other ornamental plants in 500 mg Pb kg−1 soil. At the
same time, TF and EF values were greater than 1.0 but CF was lower and only reached 0.47,
which means little amount of Pb was accumulated in plant as compared to the soil upon which it
was cultivated. As the concentration of Pb was increased in soil, TFs were still >1 whereas EFs
and CFs values of all the treatments were <1. Keeping in view these results, multiple hypothesis
can be built here. This might be because at higher concentration the plant growth was limited and
less biomass was produced. The Pb metal could be fixed at exchange sites and phytoavailable
amount might have been reduced (Petruzzelli et al., 2015). Some plants might have the activation
of excluder mechanisms that restrict the entry of metal into plant after certain level.
Many Pelargonium species have been reported in literature as Pb hyperaccumulators. Manshadi
et al. (2013) experimented five pelargonium species for phytoextraction of Pb and Cd and
revealed that Pelargonium hortorum, peltatum and citrosum exhibited best TFs for Pb. In all the
treatments, TFs values were higher than one for Pelargonium hortorum which demonstrated that
the plant was able to accumulate higher amounts of Pb in shoots than roots, therefore, it is suitable
for phytoremediation. Dan (2001) also worked with four different species of scented
![Page 66: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/66.jpg)
47
Pelargonium to assess their ability for phytoextraction of Cd, Ni and Pb. The results showed that
Pelargonium hortorum was tolerant to high soil Pb concentration and accumulated >1000 mg
kg−1 in shoot biomass. Arshad et al. (2008) also tested six scented Pelargonium cultivars and
declared 3 plants as hyperaccumulators of Pb.
Mesembryanthemum criniflorum accumulated 1268.8 mg Pb kg−1 in shoots at 1500 mg Pb kg−1
soil. Uptake for this plant was 0.5 mg per plant, which was the most significant among all 21
plant species at the highest soil Pb contamination level (2000 mg kg−1). The values of TF and
EF were >1 at 500 and 1000 mg Pb kg−1 soil and <1 at 1500 and 2000 mg Pb kg−1 soil, whereas
CF was <1 in all the treatment levels. No work has been reported so far for Mesembryanthemum
criniflorum. However, another plant of the same genus, Mesembryanthemum crystallinum have
been found as accumulator of copper besides being halophyte (Thomas et al., 1998).
Many plants accumulate high concentrations of Pb in different plant parts but do not meet all the
four characteristics to be regarded as hyperaccumulator of Pb. Similar response was observed in
case of Godetia grandiflora. The concentration of Pb in root was higher than shoots. In roots,
Godetia grandiflora accumulated 1014, 1180, 1021 mg Pb kg−1 of dry root weight at 1000, 1500
and 2000 mg Pb kg−1 soil, respectively. Pb uptake values for this plant were0.7, 0.7 and 0.5 mg
per plant at 1000, 1500 and 2000 mg Pb kg−1 soil, respectively. Many plants accumulate more
Pb in roots than shoots (Shen et al., 2002) showing limited translocation to the above ground
biomass (Stoltz et al., 2002). TF, EF and CF values were <1 in all the treatment levels except 500
and 1000 mg Pb kg−1 soil where CF was >1. Liu et al. (2008) reported three ornamental plants,
Impatiens balsamina, Calendula officinalis and Althaea rosea as potential accumulators of Cd
and Pb for decontamination in urban areas. Of these plants, Althaea rosea accumulated <1000
mg kg−1 Pb in plant biomass (i.e. 344 and 890 mg kg−1 Pb in shoot and root, repectively) under
![Page 67: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/67.jpg)
48
hydroponic conditions. Cui et al. (2013) also evaluated three ornamental plants for
hyperaccumulation of Pb and found Celosia cristata to accumulate >1000 mg Pb kg−1 dry
biomass, however TF, EF and CF were less than 1.
Indigenous plants have more vigor to tolerate the metal contamination in their natural habitat and
can accumulate high Pb concentration in their biomass (Sheng et al., 2008b). Our results
indicated that during the course of experiment, no phytotoxicity symptoms were observed in
Pelargonium hortorum, Tropaeolum majus, Mesembryanthemum criniflorum, Godetia
grandiflora, Dianthus barbatus and Viola wittrockiana even at the highest Pb concentration,
2000 mg Pb kg−1 soil. Correlation analysis of biomass produced and Pb uptake by above
mentioned six plant species gave a value of 0.61 (p< 0.01), indicating weak but positive
correlation among the two variables. It means that upon Pb uptake there was no significant
decrease in biomass of these plants.
The suitability of Plants for phytoremediation purpose depends on the qualities of
hyperaccumulators including fast growth rate, able to produce high biomass i.e. more than three
tons DW ha−1 y−1 (Schnoor, 1997) and can tolerate high levels of Pb without exhibiting any
toxicity symptoms (Schnoor, 1997; Ma et al., 2001). Plants tested in this study were evaluated
for biomass production per year considering the optimum planting density and number of cultures
performed per year. Only flower yield of Tagetes erecta is 30–60 tons/hectare annually (Lin et
al., 2015). Biomass production by Pelargonium hortorum was estimated to be 3.1 tones DW ha−1
y−1. Whereas Mesembryanthemum criniflorum is a seasonal plant with limited biomass
production and high Pb uptake potential.
For the current study, uncontaminated soil was spiked with highly soluble salt of Pb (lead nitrate).
Subsequently, these spiked soils were used to assess Pb phytoextraction potential of ornamental
![Page 68: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/68.jpg)
49
plants. There are different advantages and limitations in using spiked soil approach. Working
with spiked soil allowed to control all other environmental variable that would affect the
phytoextraction process. Moreover, this experimental design allowed to assess the Pb tolerance
ability of these plants at different concentrations of Pb. At the same time, there are some
limitations of using spiked soil. In spiked soil, usually metal bioavailability is different (usually
higher than in aged contaminated soil). In aged soil with Pb contamination, a much lower
performance would be expected as the metal could be strongly bound to exchange sites and
in/organic fractions of soil. Overall, such experiments at lab scale could serve as indicator for
phytoextraction studies at field scale. Results of current study support this hypothesis and
highlight the potential of certain plant species to be used for metal removal at larger/field scale.
3.5. OUTCOMES AND PERSPECTIVES
Among 21 ornamental plants, Pelargonium hortorum and Mesembryanthemum criniflorum
accumulated >1000 mg Pb kg−1 shoot dry biomass at different soil Pb concentrations. These two
plants could be regarded as hyperaccumulators of Pb considering TF, EF and CF index and the
amount of biomass produced by each plant whereas Godetia grandiflora can be considered as
potential accumulator that can efficiently be used for phytoextraction of Pb contaminated soil.
These plants produced no phytotoxic symptoms even at 2000 mg kg−1 soil Pb contamination,
therefore, have great ability particularly in urban environment to remediate Pb contaminated site
while beautifying the environment. These experiments were conducted using spiked soil which
gave an insight about potential of ornamental plant species to accumulate substantial amount of
Pb in above ground tissues. However, phytoremediation potential of these plants in real
contaminated soil should be evaluated before field application. The changes at root soil interface
![Page 69: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/69.jpg)
50
that may interfere Pb phytoavailability also needs to be investigated for understanding and further
development of this technique.
The experiment exhibited potential or ornamental plants for Pb phytoextraction abilities. Two
plants Pelargonium hortorum and Mesembryanthemum criniflorum showed Pb accumulator
characteristics and produced high biomass with no phyto-toxicity symptoms compared to other
plants reported in literature. Pb phytoextraction varied in different plants when grown on same
soil and Pb concentration gives an insight to plant induced changes in rhizosphere that facilitated
Pb solubility and uptake by plant roots. To study the phytoavailable fractions of Pb, as a result
of rhizosphere modification by cultivated plants, controlled experiments were conducted in the
glass house using special cropping devices (Uzu et al., 2009; Arshad et al., 2016), designed
locally. The device helped in separating plant roots from rhizosphere soil and only allowed root
exudates to modify physicochemical characteristics of soil to favor Pb phytoextraction. Detailed
methodology and results are summarised in the next section.
![Page 70: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/70.jpg)
51
B. LEAD PHYTOAVAILABILITY AND UPTAKE: RHIZOSPHERE
STUDY
3.6. BACKGROUND
Lead (Pb) is one of the most abundantly found toxic heavy metals in soils and have no biological
function. It is ubiquitously distributed in soil as a results of anthropogenic activities 1000-fold
increase in Pb soil contamination is observed over the past years (Kushwaha et al., 2018). It is
potentially toxic to living systems and is considered as chemical of great concern in the new
European REACH regulations (EC 1907/2006; Registration, Evaluation, Authorization, and
Restriction of Chemicals). The in-situ decontamination of Pb contaminated soils by using
suitable hyperaccumulator plants is cost effective, environmental friendly and best alternative to
old and conventional physicochemical techniques (Gul et al., 2019; Manzoor et al., 2018; Arshad
et al., 2016, 2008). However, the efficiency of phytoremediation system greatly depends on Pb
phytoavailability, which is typically very low (<2.5%) (Wierzbicka et al., 2007), only 0.14 % of
total Pb in soil is in exchangeable fraction (Jena et al., 2013). Low availability and mobility of
Pb in soil limits the field application of phytoremediation system. Generally, Pb is found attached
to inorganic ions like HCO3-, CO3
2-, SO42- and Cl- or may complexed with organic ligands (amino
acids, fulvic acids and humic acids). Some faction of Pb is also found adsorbed on to soil particles
(Fe-oxides, organic matter and clay particles) (Shahid et al., 2010), and strongly bound to organic
and colloidal material (Kushwaha et al., 2018; Punamiya et al., 2010).
Different soil and biological factors controls Pb speciation and availability in soil. The soil factors
that directly interact with Pb speciation includes pH, soil texture, structure, organic matter,
organic colloids, iron oxides, cation exchange capacity (CEC), Pb concentration and other
![Page 71: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/71.jpg)
52
chemical additives in soil (Silveira et al., 2003). Whereas biological factors include root
exudation that alters the pH and dissolved organic carbon (DOC) contents of the rhizosphere soil
(Adejumo et al., 2018; Khoshgoftarmanesh et al., 2018). Therefore, studying the ability of plants
to modify its rhizosphere that favors Pb phyoavailability would further increase in developing
phytoremediation technology. In our previous study (Manzoor et al., 2018), two plants
Mesembryanthemum criniflorum and Pelargonium hortorum have been identified for
phytoextraction of Pb in study area. The following study have been designed to evaluate in detail
the ability of these plants to induce rhizosphere changes that favors Pb mobility and
phytoextraction.
3.7. MATERIAL AND METHODS
3.7.1. Soil and Pb Spiking
For rhizosphere experiment soil was collected (NUST nursery, Islamabad) and artificially spiked
(500, 1000, 1500 and 2000 mg kg-1) after air-drying (3 weeks) and sieving through a 2mm mesh.
The physicochemical characteristics of soils were the same as used in the previous study
(Manzoor et al., 2018). Soil pH, texture and organic matter was 7.39 and clay loam and 0.42%
respectively as determined by laboratory protocols.
3.7.2. Pre-Experimental Setup and Plant Acclimatization
For rhizosphere study, two plant species Mesembryanthemum criniflorum and Pelargonium
hortorum were selected based on previous study for screening of Pb hyperaccumulator plants.
Two months old seedlings of these plants were obtained from the local nursery (Islamabad
Nursery Ltd.). Plants were removed from pots, washed in running water carefully and placed in
![Page 72: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/72.jpg)
53
hydroponic solution for acclimatization and development of new roots. After two weeks plants
were transferred to cropping devices designed locally (figure 3.3) (Arshad et al., 2016) Chaignon
& Hinsinger, 2003).
Figure 3. 3: Locally designed cropping device setup (a), Experimental setup for rhizosphere
study.
The devise helped in separating direct contact of soil and roots. The total of forty cropping
devices containing one device per plant were placed in container having 15 L of nutrient solution
to support root growth and contact with soil. The plants Mesembryanthemum criniflorum and
Pelargonium hortorum will be referred as Mesembryanthemum and Pelargonium hereafter. Each
treatment was replicated four times. The composition of nutrient solution is given in table 3.4.
Table 3. 4: Composition of nutrient solution used in culture experiment.
Chemicals Concentration (μM)
KNO3 5000 μM
Ca(NO3)2 5000 μM
KH2PO4 2000 μM
MgSO4 1500 μM
H3BO3 46 μM
MnSO4.H2O 9 μM
MoNaO4.2H2O 0.1 μM
CuSO4.5H2O 0.9 μM
ZnSO4.7H2O 15 μM
Fe–EDTA 180 μM
(a) (b)
![Page 73: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/73.jpg)
54
Plants were allowed to grow in cropping device for two weeks prior to experiment for
development of root mat. During this period distilled water was used to maintain the level of
nutrient solution. The experimental units were placed in the glasshouse with a photoperiod of 14
h, temperature ranged between 26-21 °C.
3.7.3. Rhizosphere Experiment
After two weeks of root development, ten g of control and spiked soil was added in detachable
unit of cropping device (diameter 60 mm) to form 3 mm thick soil layer and soil was analyzed
for initial chemical properties. During the course of experiment soils were humidified through
filter paper dipped in nutrient solution. Containers were covered with aluminum foil to limit
evaporation loss. During this stage 0.2 strength Hoagland’s solution was used to favor Pb uptake
by reducing ion competition. Nutrient solution was added regularly to maintain enough level in
container to keep filter paper wet. Control soil with similar setting were placed to evaluate pH
change. After three weeks plants were harvested and analyzed for Pb concentration in root and
shoots. Soil was considered as rhizosphere soil and analyzed for physicochemical parameters.
3.7.4. Soil and Plant Analysis
Rhizosphere soil was analyzed for pH determination (AFNOR, 1994) immediately after
harvesting. Soil pH and Pb content was analyzed by extracting soil with 0.01 M CaCl2 (1:5 soil:
extractant on dry basis). The mixture was shaken for 30 minutes at 150 rpm and the pH was
determined from supernatant after 30 minutes. Solutions were then filtered for Pb determination
through AAS (Model: GBC 932 plus, Australia). DOC was analyzed through TOC analyzer.
After harvesting plants were washed thoroughly under running tap water and then roots were
immersed in 0.01 N HCL to determine adsorbed amount of Pb on to root cells ([Pb]ad) (Arshad
![Page 74: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/74.jpg)
55
et al., 2016). After plants were placed in oven for drying at 65 °C. After 48 h, dry weights were
recorded and plants were ground to power form prior to mineralization with HNO3 and HClO4
(4:1). After complete digestion, clear aliquots were obtained and filtered for Pb determination
through AAS. TF and BF were calculated from the results (Manzoor et al., 2018).
3.7.5. Statistical Analysis
Statistical analysis were performed in SPSS software. Data was analyzed though analysis of
variance ANOVA and least significant difference (LSD) tests.
3.8. RESULTS AND DISCUSSION
3.8.1. Root Induced Rhizosphere Modifications
a. Soil pH
Soil pH was measured by extracting soil (1:5 soil/extractant ratio) with CaCl2 (0.01 mM)
(expressed as pH CaCl2) and presented in figure 3.4(a). Changes in pH can be defined in terms
of ΔpH and calculated using following formula;
ΔpH = (final pH in treated soil – final pH of the control soil (C) ----------------------------- (Eq 1)
The negative and positive values of ΔpH indicated acidification and alkalination of the soil.
Significant (p<0.05) decrease in soil pH was observed in case of Pelargonium in 1500 and 2000
mg Pb kg-1 soil compared to Mesembryanthemum and control plants at all levels of soil Pb
concentration. There was no significant effect of nutrient solution on ΔpH in control soil.
Therefore the change in soil pH can be attributed to root derived chemical changes in soil.
![Page 75: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/75.jpg)
56
Figure 3. 4: Root induced changes in rhizosphere pH (a) and available Pb fraction (b) in
rhizosphere soil at different soil Pb concentrations.
Pelargonium acidified the soil by -0.22 pH units CaCl2 extracted soil solutions at 2000 mg kg-1
soil Pb concentration. Mesembryanthemum could not significantly change soil pH irrespective
of Pb concentrations in soil. Change in soil pH depends on many factors. Plant genotype, amount
and composition of root exudates rhizo depositions, mineral and nutrients composition in soil,
bio geochemical processes and other environmental factors accounts for pH change in soil (Sun
et al., 2018). Khoshgoftarmanesh et al. (2018) working with Zinc fractionation found that
rhizosphere pH was lower than that of bulk soil facilitating bioavailability of zin of uptake in
Triticum aestivum.
b. Lead phytoavailable fractions in soils
Soil was extracted with 0.01 M CaCl2 for determination of labile fraction of Pb which is readily
available for plant uptake. The ability of plants to modify the labile fraction of Pb in soil are
given in figure 3.4 (b). Results indicates higher ability of Pelargonium to increase available
7.4
7.5
7.6
7.7
7.8
7.9
0 500 1000 1500 2000
pH
Soil Pb conc. (mg kg-1)
ControlMesembryanthemumPelargonium
ed
d
cc
e
d
c
b
a
0
30
60
90
120
0 500 1000 1500 2000
[Pb
] m
g k
g-1
[Pb] soil (mg kg-1)
(a) (b)
![Page 76: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/76.jpg)
57
fraction of Pb compared to Mesembryanthemum at all levels of soil Pb concentrations.
Pelargonium increased Pb mobility 1-2 –folds more compared to Mesembryanthemum and
control soil. Maximum PbCaCl2 observed for Pelargonium was 94±5 mg kg-1 at 2000 mg Pb kg-1,
which is 2 –fold higher than Pb mobilized by Mesembryanthemum at the same soil Pb
concentration. Maximum Pb solubility induced by Mesembryanthemum was 48±5 mg kg-1 in soil
containing 2000 mg Pb kg-1 soil. Generally, soil acidification directly favors solubility and
mobilization of heavy metals. In different studies it was observed that exchangeable Pb, Cd and
Zn fractions were higher in rhizosphere soil compared to bulk soil (Adejumo et al., 2018; Zhan
et al., 2018; Khoshgoftarmanesh et al., 2018). The available fractions were increased due to
reduction in rhizosphere pH and exudation of greater amounts of DOC (Zhan et al., 2018).
Adejumo et al. (2018) reported genotype effect on increased Pb availability in rhizosphere soil
then bulk soil. Eleucine indica capable of lowering soil pH (5.0) and high DOC accumulated
significantly high Pb in shoot (8030 mg kg-1) compared to Chromolaena odorata which
accumulated least Pb in shoot (209 mg kg-1) owing to the highest values for rhizosphere pH.
c. Organic matter
Plants accounts for major contributor in soil organic matter content through root exudation, cell
debris, dry and dead plant tissue, mucilage and root turnover (Sun et al., 2018). Considerable
effect of plants were noticed on OM, TOC and DOC content at varying soil Pb concentrations
(figure 3.5a,b,c). Significant (p<0.05) increase in organic matter derivatives were observed for
Pelargonium up to 1000 mg Pb kg-1 soil compared to Mesembryanthemum. Maximum OM and
TOC (1.4% and 0.8%) in Pelargonium were obtained at 500 mg Pb kg-1 soil. Similarly, maximum
OM and TC observed in case of Mesembryanthemum were 1.0% and 0.6%, which were 1.4 times
lower than OM and TOC obtained Pelargonium at same soil Pb concentration (500 mg Pb kg-1
![Page 77: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/77.jpg)
58
soil). With increase in Pb concentration, a general decrease in OM and TOC percentage was
observed for both plants.
Figure 3. 5: Root induced changes in soil organic after three weeks of plant soil contact. a) OM;
b) TOC; c) DOC
The decrease in OM and TOC in Mesembryanthemum was 1.8 times, whereas in Pelargonium
the decrease was 1.6 times when Pb concentration was increased from 500 to 2000 mg kg-1 soil.
Similar trends were noticed for DOC content in the soil solution. Highest significant (p<0.05)
increase in DOC was obtained at 500 mg Pb kg-1 soil by Pelargonium. Maximum DOC observed
in Pelargonium cultured soil was 121±11 mg L-1 which is 1.7 times more compared to
Mesembryanthemum at same soil Pb concentration. Similar findings were obtained by Adejumo
et al. (2018) while studying rhizosphere soil. More amount of DOM and carbohydrates functional
groups (C-O; 1100 -1000 and O-H; 3700–3600) were observed in rhizosphere soil compared to
de
cdd d
e
abca
ab
bcd
d
0.0
0.5
1.0
1.5
2.0
0 500 1000 1500 2000
OM
(%
)
MesembryanthemumPelargonium
decd d d
e
abca
abbcd
d
0.0
0.5
1.0
1.5
2.0
0 500 1000 1500 2000
TO
C (
%)
dcd d
dd
aba ab
abc
bcd
0
40
80
120
160
0 500 1000 1500 2000
DO
C i
n s
oil
(m
g L
-1)
Soil Pb conc (mg kg-1)
(a)
(c)
(b)
![Page 78: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/78.jpg)
59
bulk soil (Adejumo et al., 2018; Khoshgoftarmanesh et., 2018) showing root induced changes in
rhizosphere that favors Pb mobility and uptake by plants (Zhan et al., 2018).
3.8.2. Lead Concentrations in Shoots and Roots
Concentrations of Pb in roots and shoots are given in figure 3.6. Results indicated that Pb
concentrations in both plants significantly differ. Many factors interact and define plant’s ability
to concentrate Pb in root and shoot tissue that might include genotype, total and bioavailable
fraction of Pb in soil medium, plant induce rhizosphere modifications and other environmental
factors (Arshad et al., 2008). Results indicated that with increase in soil Pb concentration, Pb
accumulation in root and shoots of both plants increased significantly, compared to control
plants. Among both plants, Pelargonium accumulated significantly (p<0.05) high concentrations
of Pb in both roots and shoots (1281±77 and 276±7 mg Pb kg-1 DW) at highest soil Pb
concentration level (2000 mg kg-1). These results are in accordance with those reported in
screening of ornamental plants for Pb accumulation presented by Manzoor et al. (2018).
Maximum Pb concentrations in root and shoot of Mesembryanthemum was 755±99 and 207±12,
and for Pelargonium was 1281±77 and 275±7 mg Pb kg-1 DW, respectively. Lower shoot
accumulation in this study may be due to limiting direct root soil contact in cropping device
setup.
Similar trend of lower shoot accumulation by Pb hyperaccumulator Attar and Concolor was
observed by Arshad et al. (2008) while studying rhizosphere soil. The maximum Pbshoot
accumulation recorded in Attar was 284 mg kg-1 at 1500 mg Pb kg-1 soil after 2 weeks of
exposure. Whereas in our case the maximum accumulation observed in Pelargonium was 276
mg kg-1 DW at 2000 mg Pb kg-1 soil. The difference lies in the fact that Pelargonium accumulates
![Page 79: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/79.jpg)
60
less amount of Pb in shoot and root compared to Attar when studied on pot and field experiment
(Arshad et al., 2008; Manzoor et al., 2018).
a. Biomass and Pb uptake characteristics
Biomass of both plants after culture experiment is presented in table 3.5. Pelargonium exhibited
1-2 times more biomass (root and shoot) at all levels of soil Pb concentrations compared to
Mesembryanthemum. Pelargonium showed significantly high biomass of root and shoot (1.1±0.1
and 1.6±0.1 g DW) in soil containing 500 mg Pb kg-1 soil. Maximum root and shoot biomass
(0.8±0.1 and 1.2±0.1 g DW) of Mesembryanthemum was also obtained at 500 mg Pb kg-1 soil.
With increasing Pb concentration from 500 to 2000 mg Pb kg-1 soil, a 2.1 and 1.7 –folds decrease
in root and 1.5 and 1.6 –fold decrease in shoot biomass was observed for Mesembryanthemum
and Pelargonium, respectively. Contrary to this, no decrease in biomass of Pelargonium cultivars
(Attar and Concolor) was observed, irrespective of soil Pb concentrations (500 and 1500 mg Pb
kg-1 soil) (Arshad et al., 2008) indicating greater potential for Pb phytoextraction. The plant
Figure 3. 6: Lead concentrations in plant parts after three week culture on Pb
spiked soil.
![Page 80: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/80.jpg)
61
biomass was significantly higher in 500 mg Pb kg-1 soil level, which indicates that Pelargonium
is Pb lover plant up to certain concentration of Pb in soil (500 mg kg-1), however with further
increase in Pb concentration, decrease in plant dry biomass was observed. The higher Pb uptake
with minimum decrease in dry biomass of Pelargonium could be due to higher Pb tolerance
ability and detoxification of Pb inside plant tissue (Arshad et al., 2008).
Table 3. 5: Biomass and Pb uptake factors after 15 day of culture experiment.
Parameters Mesembryanthemum Pelargonium
Soil [Pb] mg kg-1 500 1000 1500 2000 500 1000 1500 2000
TF 0.30 0.25 0.30 0.21 0.24 0.23 0.23 0.22
CFr 0.93 0.60 0.48 0.38 1.40 0.86 0.73 0.64
CFs 0.26 0.14 0.14 0.08 0.32 0.19 0.17 0.14
Biomassr (g) 0.78bc 0.58d 0.50ed 0.37e 1.14a 1.08a 0.84bc 0.67cd
Biomasss (g) 1.16bcd 1.20bcd 1.00de 0.76e 1.63a 1.49ab 1.33a-d 1.00de
TF, CFr & CFs corresponds to translocation factor, root concentration factor & shoot
concentration factor; Biomassr,s corresponds to biomass of root and shoot, respectively.
Results of TF and CF are given in table 3.5. Values of TF were higher for both plants at 500 mg
Pb kg-1 soil compared to increasing soil Pb concentrations. This indicates lesser translocation to
shoots when Pb concentration in the soil was raised. Bio-concentration factors (CF) were
calculated separately for root and shoot (CFr and CFs, respectively). Results (table 3.5) showed
that CFr values were higher than CFs values which depicts that more accumulation was observed
in roots of both plants compared to shoot. Reduction in TF, CFr and CFs values in
Mesembryanthemum and Pelargonium have previously been reported by Manzoor et al. (2018)
and can be attributed to several plant and soil factors. At higher soil Pb concentration blockage
of ion channels may occur, or Pb may attach and fixed on exchange sites, also adsorption or
binding of Pb on to carboxyl groups present on cell wall may reduce the overall Pb available and
translocation inside plant tissue (Petruzzelli et al., 2015; Pendergrass and Butcher, 2006).
![Page 81: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/81.jpg)
62
Total Pb uptake by both plants was calculated by multiplying Pb concentration with biomass
obtained in respective soil Pb concentrations. The formula used for uptake calculation is as
follows;
Pb uptake (mg) = ([Pbshoot] x DWshoot) + ([Pbroot] x DWroot) -------------------------------- (Eq 2)
Lead uptake by Pelargonium was significantly (p<0.05) higher compared to
Mesembryanthemum at all levels of soil Pb concentration (figure 3.7a). Pelargonium uptake 2-3
times more Pb per plant compared to Mesembryanthemum. The maximum uptake in
Mesembryanthemum and Pelargonium was 0.6 and 1.3 mg plant-1 at 1500 mg Pb kg-1. The higher
uptake in Pelargonium could be due to the influence of different factors. Firstly, acidification of
rhizosphere pH. Pelargonium was able to lower the soil pH significantly compared to
Mesembryanthemum and control soil (figure 3.4a). It is well reported that at lower pH more Pb
is solubilized and available for plant uptake (Zhan et al., 2018). Secondly, it increased labile
fraction of Pb for plant uptake (figure 3.4b). Thirdly, Pelargonium increased soil organic matter
pool (OM, TOC and DOC) (figure 3.5a,b,c). DOC plays important role in Pb chelation, solubility
and increase Pb uptake by plant (Khoshgoftarmanesh et al., 2018). Last but not the least,
Pelargonium produced higher biomass (table 3.5) and exhibited higher [Pb]root and [Pb]shoot
compared to Mesembryanthemum at all soil Pb concentrations (figure 3.5), which are important
components of uptake calculation.
Apart from Pb uptake and accumulation, considerable amount of Pb has been found loosely
attached on cell wall of roots (Arshad et al., 2016; Uzu et al., 2009). This loosely attached Pb
also termed as [Pb]adsorbed was determined after extracting the adsorbed Pb fraction with 0.01N
HCl solution. Results given in figure 3.6b showed considerable amount of Pb adsorbed on roots
of both plants. With increase in soil Pb concentration, significant increase in [Pb]adsorbed was
![Page 82: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/82.jpg)
63
observed for both plants. Significantly (p<0.05) higher (1-2 times) Pb was adsorbed on
Mesembryanthemum roots compared to Pelargonium at 1500 and 2000 mg Pb kg-1 soil
concentrations. Maximum adsorbed Pb concentration for Mesembryanthemum (351±51 mg Pb
kg-1 DWroot) and Pelargonium (237±17 mg Pb kg-1 DWroot) were observed at 2000 mg Pb kg-1
soil. Percentage Pbadsorbed was calculated by following formula;
% Pbadsorbed = [Pbadsorbed]/ [Pbroot] x 100 --------------------------------------------------------- (Eq 3)
Figure 3. 7: Lead uptake and adsorption by plants after three week of culture experiment. a)
Lead uptake, b) Pbadsorbed.
Results indicated that Pbadsorbed ranged for 3-18% Pelargonium and 10-48% for
Mesembryanthemum. This highest % Pbadsorbed and Pbadsorved (figure 3.7b) for
Mesembryanthemum could be reason for low Pb accumulation (figure 3.6), uptake (figure 3.7a)
and translocation (table 3.5) compared to Pelargonium. Lead adsorption can take place on
polysaccharides of the rhizodermal cells and carboxyl group of mucilage and uronic acid
(Petruzzelli et al., 2015; Pendergrass & Butcher, 2006). The binding of Pb to these exchange sites
limits the entry in plant tissue.
c
b b bb
c
aa a
a
0.0
0.5
1.0
1.5
2.0
0 500 1000 1500 2000
[Pb
] m
g p
er p
lan
t
[Pb] soil (mg kg-1)
MesembryanthemumPelargonium
e
dcd
ab
a
e
dcd
cdbc
0
100
200
300
400
500
0 500 1000 1500 2000
[Pb
] m
g k
g-1
[Pb] soil (mg kg-1)
MesembryanthemumPelargonium
(a) (b)
![Page 83: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/83.jpg)
64
3.9. OUTCOMES AND PERSPECTIVES
The study concluded that both plants have ability to induce rhizosphere changes during three-
week culture in cropping device. Results indicated great ability of Pelargonium to acidify
rhizosphere soil and increase DOC content in soil that may have influenced Pb mobility in soil
solution. Lead accumulation results showed greater uptake in Pelargonium hortorum then
Mesembryanthemum criniflorum at all levels of Pb in spiked soil. The results indicated influence
of root derived chemical changes in soil that impacted Pb speciation. Therefore, in next part
different organic acids and their possible interaction with Pb was studied using speciation model
MINTEQ 3. Results are summarized in next part.
![Page 84: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/84.jpg)
65
C. ORGANIC LIGANDS DERIVED LEAD SPECIATION USING
SPECIATION MODEL
3.10. INTRODUCTION
Phytoavailability of Pb is one of the major factor that hampers phytoremediation afficieny. Low
availability and mobility of Pb in soils seriously limits the full scale application of
phytoremediation system (Arshad et al., 2016; Gul et al., 2019; Jena et al., 2013). In this regard
hyperaccumulator plant derived root exudates may play significant role in defining Pb speciation
and bioavailability of nutrients, minerals and soil contaminants. The organic acids in root
exudates readily makes soluble complexes with metal ion by reducing soil Ph and increasing soil
DOC and therefore reduce adsorption of metals onto soil particle and improve their uptake by
plant (Khoshgoftarmanesh et al., 2018). Greater release of organic acids including citric acid,
acetic acid, malic acid, tartaric acid and phytic acid in root exudates of hyperaccumulator plants
such as Pteris vittata and Pelargonium sp. have been repoted (Fu et al., 2017; Arshad et al.,
2016). The organic acids greatly influence the chemical forms of Pb thereby affects Pb
mobility/immobility, adsorption, bioavailability and toxicity (Shahid et al., 2012b). Lead
speciation in soil plant system is strongly influenced by root exudates and organic ligands present
in rhizosphere. These ligands greatly influence Pb speciation, fractionation and mobility in soil
solution. Therefore understanding the interaction and mechanism of Pb sorption/desorption in
presence of root derived organics acids is needed.
In this study major components of root exudated identified in many plants have been assessed
for their interations towards Pb speciation. Pb speciation in soil is determined analyticaly through
complex and time-consuming techniques including anodic stripping voltammetry, ion selective
![Page 85: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/85.jpg)
66
electrodes, competitive ligand equilibration/adsorptive stripping cathodic voltammetry and
sorption onto C18 columns (Cobelo-Garcia and Prego, 2004). Nowadays new, advanced
computer based softwares like WHAM VI, VISUAL MINTEQ, CHEAQS, PHREEQC,
ORCHESTRA, ECOSAT and CHESS served as rapid alternatives for quick estimation of metal
speciation in different medium (soil & aqueous).
3.11. MATERIALS AND METHODS
In this study, Visual Minteq ver 3.1 (Gustafsson, 2008; Shahid et al., 2012b) was used to
estimated Pb speciation in 0.2 X Hoagland solution containing 1.6mM Ca(NO3)2. 4H20, 2.4mM
KNO3, 0.4mM NH4H2PO4, 0.8mM Mg(SO4). 7H2O, 0.023mM H3BO3, 0.0045mM MnSO4. H2O,
0.0003mM CuSO4. 5H2O, 0.0015mM ZnSO4. 7H2O, 0.0001mM (NH4)6Mo7O24. 4H2O and
0.1mM FeSO4. This software is extensively used (cited in more than 400 research articles), most
appropriate and best fitted to chemical speciation studies of organic chelates such as EDTA and
LMWOAs (Shahid et al., 2012b). Four organic ligands (citric acid, oxalic acid, malic acid and
tartaric acid) mostly present in root exudates as reported in literature (Arshad et al., 2016; Shahid
et al., 2012b) were selected for this study. Insoluble salt of Pb as PbCO3 (1 mM) was used in the
speciation study, as carbonate and sulphate salts are most predominant forms of Pb in soil
(Arshad et al., 2008). Different pH range (4-10) and different concentrations of organic ligands
(0.1, 0.5, 1, 5 and 10 mM) were considered in the speciation study.
![Page 86: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/86.jpg)
67
3.12. RESULTS AND DISCUSSION
3.12.1. Effect of pH on Pb Speciation in Nutrient Solution
pH is considered as one of most important parameter controlling Pb availability and subsequent
uptake by plants (Arshad et al., 2016; Shahid et al., 2014, 2010). The effect of pH on Pb
speciation estimated through visual minteq software is shown in figure 3.8a. The results indicate
that in acidic conditions (pH 4-5) >80% Pb is available as Pb+2. Whereas in alkaline conditions
80% Pb is predominantly found as insoluble hydroxide (PbOH). The ions that interacts with Pb
speciation are carbonate ions (CO3-) followed by sulphate ions (SO42- ). Shahid et al. (2012) also
reported similar trend of pH effect on speciation on Pb in full strength Hoglands solution taking
PbNO3 as source of Pb. However the adsorption to inorganic ligands was more towards NO3- and
SO42-, which may be due to the different strength of nutrients and different source of Pb.
Figure 3. 8: Effect of pH on Pb speciation (a) and effect of OA in pH change in nutrient
solution (b).
3.12.2. Effect of Organic Ligands on Solution pH
Figure 3.8b shows the effect of organic ligands on solution pH. Results clearly indicates that in
the absence of organic acids the solution pH was raised from 7.1 to 7.8. The pH was strongly
0
20
40
60
80
100
4 5 6 7 8 9 10
Pb
(%
)
pH
Pb⁺²
Pb-NO₃
Pb-CO₃
PbSO₄
Pb-OH
Pb-PO₄
0
2
4
6
8
10
0.1 0.5 1 5 10
pH
OA Conc. (mM)
controlcitratemalateoxalatetartrate
(a) (b)
![Page 87: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/87.jpg)
68
decreased in upon addition of all organic acids. Greater decrease in pH was observed up to 5 mM
concentration of organic acid. The decrease in pH by organic acids followed the decending order
citric acid > tartaric acid > malic acid > oxalic acid.
3.12.3. Effect of Organic Acids on Pb Speciation in the Nutrient Solution
The results from speciation models showed the binding capacity of organic acids to Pb at
different solution pH in descending order of malic acid >citric acid > tartaric acid > oxalic acid.
Figure 3. 9: Effect of solution pH and OA on Pb speciation in 0.2 strength Hogland solution; a)
citrate; b) malate; c) oxalate; d) tartrate. Calculations are made by Visual Minteq-3 software.
0
20
40
60
80
100
4 5 6 7 8 9 10
Pb⁺² Pb-NO₃Pb-CO₃ PbSO₄Pb-OH Pb-PO₄Pb-citrate
0
20
40
60
80
100
4 5 6 7 8 9 10
Pb⁺² Pb-NO₃Pb-CO₃ PbSO₄Pb-OH Pb-PO₄Pb-malate
0
20
40
60
80
100
4 5 6 7 8 9 10
Pb⁺² Pb-NO₃Pb-CO₃ PbSO₄Pb-OH Pb-PO₄Pb-oxalate
0
20
40
60
80
100
4 5 6 7 8 9 10
Pb⁺² Pb-NO₃Pb-CO₃ PbSO₄Pb-OH Pb-PO₄Pb-tartrate
pH of nutrient solution
Pb
spec
iati
on
(%
)
(a) (b)
(c) (d)
![Page 88: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/88.jpg)
69
Results indicates that application of 0.5 mM of malic, citric and tartaric acids chelated >80% of
Pb where as oxalic acid chelated < 80% of Pb. Lead availability as free radicle Pb+2 was more
in case of citric and malic acid addition compared to oxalic and tartaric acids (figure 3.9).
Similar trend was observed by Shahid et al. (2012), where highest chelation up to 90% was
observed in case of EDTA (5 μM EDTA) and much lower chelation (46%) was observed by
application of 100 μM citric acid in Hoglands solution. The effect of different concentrations of
organic ligands on Pb speciation was futher analysed and results are given in figure 3.10.
Figure 3. 10: Effect of OA conc. on Pb speciation in 0.2 strength Hogland solution; a) citrate;
b) malate; c) oxalate; d) tartrate. Calculations are made by Visual Minteq-3 software.
The results indicated that with increase in concentration of organic acids the complexation of Pb
to organic ligands was increased with highest increase in oxalic acid followed by tartaric acid >
0
20
40
60
80
100
120
0.1 0.5 1 5 10
Pb⁺² PbNO₃ PbCO₃PbSO₄ Pb(OH)₂ PbPO₄Pb-citrate
0
20
40
60
80
100
120
0.1 0.5 1 5 10
Pb⁺² PbNO₃ PbCO₃PbSO₄ Pb(OH)₂ PbPO₄Pb-malate
0
20
40
60
80
100
120
0.1 0.5 1 5 10
Pb⁺² PbNO₃ PbCO₃PbSO₄ Pb(OH)₂ PbPO₄Pb-oxalate
0
20
40
60
80
100
120
0.1 0.5 1 5 10
Pb⁺² PbNO₃ PbCO₃PbSO₄ Pb(OH)₂ PbPO₄Pb-tartrate
Conc. of organic ligands (mM)
Pb
spec
iati
on
(%
)
(a) (b)
(c) (d)
![Page 89: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/89.jpg)
70
citric acid > malic acid. Similar findings were obtained by Shahid et al. (2018). The Pb
complexation with citric acid increased with increase in concentration of citric acid (0-1000 µM).
Gul et al. (2019) also worked with 5 different organic and inorganic ligands and found citric acid
as efficient Pb chelating agent after EDTA for dissolution of Pb in soil and subsequent uptake by
Pelargonium hortorum.
3.13. SUMMARY
The study concluded that organic ligands plays important role in Pb speciation in nutrient
solution. pH is the main factor controlled by concentration of organic acids that ultimately defines
Pb speciation and fractionation in nutrient medium. Organic acids form organo-metalic
complexes of different stability and solubility.
This study gave an insight and clear understanding of plant induced rhizosphere changes and
interaction of different organic acids (root exudates) for Pb availability in soil and nutrient
solution and subsequent phtoextraction. However, phytoremediation is a slow process that
requires more time for complete removal of Pb form contaminated soil. Synthetic chelates have
been found to induce Pb solubility but also accounts for ground water leaching and toxicity to
biological systems. Whereas, genetic engineering and gene manipulation includes high cost and
gene transfer. In this regard the use of biological agents for enhanced Pb mobility and subsequent
uptake by plants gives environmental friendly option to decontaminate Pb with greater
effeciency. Upcoming chapter is focused on studying plant-microbe interactions in
phytoremediation and comprises of four parts; (I) Fungal studies and (II) Bacterial studies, (III)
co-inoculation studies for Pb uptake and (IV) and soil enzymatic activities.
![Page 90: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/90.jpg)
71
Chapter 4
PLANT-MICROBE INTERACTION IN PHYTOREMEDIATION OF
LEAD
Biological methods are natural, favorable, and suitable for phytoremediation of Pb contaminated
soil along with retaining soil biological health and nutrients turnover. In this chapter, the effects
of bioinoculants (bacteria and fungi) and their interactions for Pb availability in soil and
contribution in phytoextraction of Pb and soil enzymatic activities were studies. The chapter is
divided in 4 sections.
A. FUNGI-ENHANCED PLANT GROWTH AND PHYTOEXTRACTION OF LEAD:
TOLERANCE, PGP ACTIVITY AND PHYTOAVAILABILITY
Lead (Pb) is known for its low mobility and persistence in soils. The main aim of present study
was to explore potential of different fungal strains to promote phytoextraction of Pb-
contaminated soils.
4.1. INTRODUCTION
The long term ecological ramification due to continuous exposure of Pb in the environment has
increased interest in developing and improving the already existing remediation technologies.
Anthropogenic activities contribute to soil and water multi-metal contamination, of which Pb is
a major concern. Due to its high persistence, it is known as a threat to soil organisms, plants and
animals. Soils containing Pb above 1000 mg kg-1 may negatively impact microbial populations
thereby disturbing the major soil biogeochemical processes such as decomposition and
![Page 91: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/91.jpg)
72
mineralization of nutrients which ultimately affect growth of inhabiting plants and animals
(Sahodaran & Ray, 2018).
The remediation of Pb-contaminated soils using Pb-hyperaccumulator plants is an area of
continuing consideration. More than 500 plant species comprising of 101 families have been
reported to accumulate heavy metals (Prasad & Freitas, 2003) of which Pb hyperaccumulators
(>1000 mg Pb kg-1 shoot biomass) including fragrant (Arshad et al., 2008), or ornamental species
of Pelargonium genus such as Pelargonium hortorum and, Mesembryanthemum criniflorum
(Manzoor et al., 2018), Bidens pilosa (Yongpisanphop, 2017) and Alcea aucheri (Ravanbakhsh,
2016) have been identified. In our previous work, certain accumulators belonging to ornamental
families have been identified for Pb phytoremediation (Manzoor et al., 2018; Arshad et al., 2016,
2008).
The efficiency of phytoremediation highly depends upon the available fraction of Pb that may be
phytoextracted. Lead is not available and is more often found in its bound form with soil and
organic matter and only 2% of it is in its bioavailable form (Smith et al., 2011). In order to
increase the efficiency of Pb phytoextraction, the use of chelating agents have gained much
importance for the past 50 years (Gul et al., 2019; Shahid et al., 2014). Synthetic chelators alter
the natural state of Pb and make it more bioavailable through increased dissolution (Gul et al.,
2019). Extensive research on the use of these chelators in the environment such as EDTA have
highlighted several concerns including slow biodegradability, persistence (Pandey &
Bhattacharya, 2018), leaching of the metallic elements to the ground water (Hartley et al., 2014),
and decreased soil flora and fauna (Kaurin et al., 2018).
Besides chelating compounds, biological organisms also offer wide range of properties that may
be utilized for increasing metal availability in soils. In the case of soil fungi, these excrete variety
![Page 92: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/92.jpg)
73
of different extra cellular substances including enzymes and organic acids (gluconic acid, fumaric
acid, and citric acid) that may alter the pH and organic matter status and could directly influence
the bioavailability and speciation of Pb. Some of the fungi which have been studied for positive
effects on phytoremediation process are arbuscular mycorrhiza fungi (AMF) and species of the
genus Trichoderma. Different studies indicated AMF to increase uptake and sometimes decrease
Pb uptake and translocation in associated plants. Yang et al. (2015) reported two AMF species
(F. mosseae and R. intraradices) associated with R. pseudoacacia able to decrease Pb
concentration in shoot. There are reports that Trichoderma may stimulate plant growth by up to
300%, besides protecting them from various environmental stresses (Kavamura & Esposito,
2010). Penicillium simplicissimum has been reported to induce plant growth and activate multiple
defense signals under variety of biotic and abiotic stresses (Hossain et al., 2007).
Keeping in view that fungi may improve phytoremediation of Pb through modification of the soil
physicochemical characteristics, specific objectives of the current study were (a) to assess the
impacts of Pb tolerant fungi upon Pb soil mobility, (b) monitor plant growth promoting
characteristics of tested fungi and (c) their influence on phytoextraction of Pb by
hyperaccumulator plant species.
4.2. MATERIALS AND METHODS
4.2.1. Soil Characterization
Soil sampling was done from industrial area located near battery recycling units in Islamabad
and Rawalpindi. The top 20 cm soil (represented upper layers O and A horizons) was collected
and analyzed for Pb concentration. It was found to be 1352 mg kg-1. For controlled experiment
soil was collected (NUST nursery, Islamabad) and artificially spiked (500, 1000, 1500 and 2000
![Page 93: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/93.jpg)
74
mg kg-1) after air-drying (3 weeks) and sieving through a 2mm mesh. The physicochemical
characteristics of soil were the same as those used in the previous study (table 3.1) (Manzoor et
al., 2018). Soil pH, texture and organic matter were 7.39, clay loam and 0.42%, respectively as
determined by laboratory protocols. (Manzoor et al., 2018).
4.2.2. Pb Tolerant Fungal Strains
Fungal strains: Trichoderma harzianum, Penicillium simplicissimum, Aspergillus flavous,
Aspergillus niger and Mucor spp. were studied for their Pb tolerance. The strains were earlier
isolated from heavy metal contaminated industrial areas and were obtained from Fungal Culture
Bank, University of Punjab, Lahore, Pakistan. Their Pb tolerance was recorded at gradually
increasing concentrations of Pb(NO3)2. Potato dextrose agar (PDA) and potato dextrose broth
(PDB) were used as growth medium. For each concentration, fungi were incubated at 28 °C for
7 days. The metal concentration, where no significant change in fungal growth was observed by
measuring optical density, were compared to control (no Pb), was considered as the highest metal
concentration tolerated by the fungal strain.
4.2.3. Effect on Soil pH, Organic Matter and Pb Mobility
The biomass of fungi was harvested using sterilized water as explained by Deng et al., (2011).
Spore suspension at OD 570nm was adjusted to 0.5 OD. Then 1 mL of freshly prepared spore
suspension was added to 20 g autoclaved and previously Pb-spiked soil in petri dish plates (60
mm × 15 mm). Autoclaved distilled water was added to maintain 65% moisture content. Plates
were then wrapped with parafilm and placed in an incubator at 28 °C for 15 days. After
incubation, the soil was extracted with 0.01M CaCl2 extractant on a rotary shaker at 150 rpm
(Deng et al., 2011) for 2 hours. The filtrate was used to determine the pH and the amount of
![Page 94: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/94.jpg)
75
available Pb in soil solution using an Atomic Absorption Spectrophotometer (AAS) (Model:
GBC 932 plus Australia) (AFNOR, 1994). Organic matter was determined through titration
method (Walkley & Black, 1934).
4.2.4. Plant Growth Promoting Activities of Fungal Strains
a. Indole acetic acid (IAA)
IAA producing ability of Pb tolerant fungi was examined by the method adopted from
Bhagobathi & Joshi (2009) with some modifications. Fungi was inoculated by loop full of spores
in PDB supplemented with a sterilized solution of 1% L-tryptophan in 50 mL Teflon tubes and
incubated at 28 °C for 4 days. After centrifugation (5000 rpm for 15 min), 2 mL supernatant of
fungal extract was mixed with 2 drops of ortho-phosphoric acid followed by addition of 4 mL of
Salkowsky reagent. The mixture was then incubated for 20 minutes for development of pink
color depicting IAA production by strains. Intensity of color developed was determined by
measuring absorbance through UV/Vis spectrophotometer (Specord 200 plus UV-VIS
Spectrophotmeter, Analytikjena, Germany) at a wavelength of 535 nm. Standard curve was used
to estimate the amount of IAA produced by individual fungi.
b. Phosphate solubilization
Qualitative and quantitative estimation of phosphorus solubilization ability of fungal isolates
were estimated using Pikovskaya agar and broth media (Pikovskaya, 1948). For quantitative
assays, isolates were cultured in 250 mL conical flask containing Pikovskaya broth medium and
placed in rotary shaker (150 rpm) for 7 days. After filtration with Whatman No. 42, filtrate (20
mL) was centrifuged for 15 minutes at 1000 rpm. Available phosphorus in the media was
determined by a colorimetric method using Barton’s reagent (Clesscerl et al., 1998). Absorbance
![Page 95: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/95.jpg)
76
was noted at a wavelength of 693 nm, using a doubled beam spectrophotometer. Uninoculated
Pikovskaya broth medium was used as a control.
c. Gibberellic acid production
Fungi were inoculated in 100 mL conical flask containing 50 mL of PDB and placed in a shaking
incubator at 28 °C and 150 rpm. After 48 h, media were filtered, and samples were acidified to
pH 2.5 using 1N HCl. Samples were then extracted using liquid-liquid (ethyl acetate/NaHCO3)
extraction. Solvent was evaporated to 10 mL on a rotary evaporator for quantification of GA3
and absorbance was noted at 254 nm through spectrophotometer (UV/VIS). The amount of
gibberellic acid in the ethyl acetate phase was calculated from standard curve (Bilkay et al.,
2010).
d. Siderophore production
Siderophore production was determined using the protocol of Schwyn & Neilands (1987).
Freshly prepared Chrome azurol S (CAS) agar plates were point inoculated with test fungi and
incubated for 4 days. Development of orange or pink halo zones indicated siderophore production
and was expressed as mm of halo zone. Uninoculated plates (controls) were prepared and
incubated in the same manner. Quantification of siderophores was done in CAS- malt extract
(ME) broth media. Inoculated and uninoculated broth were placed in shaking incubator at 30 °C
and 120 rpm. After 3 days, fermented broth was filtered using Whatman no.1 filter paper and
analyzed colorimetrically using ferric per chloride assay method. Absorbance was measured at
630 nm (Aziz et al., 2016). Calculations were done by using following formula;
% Siderophore units = Ar − As × 100
Ar
Where Ar and As is the absorbance of reference (CAS reagent) and sample at 630 nm.
![Page 96: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/96.jpg)
77
4.2.5. Culture Experiment
Pot experiments were setup by transplanting uniformly developed one-month old seedlings of
Pelargonium hortorum and Mesembryanthemum criniflorum in 1 kg pot containing soils spiked
with different levels of Pb (500, 1000, 1500 and 2000 mg kg-1). Selected fungal strains from Pb
solubilization assay were applied on to plants after acclimatization of 1 week. Fungal inocula
were prepared as described above. Plants were allowed to grow in the greenhouse under natural
day and light conditions. The moisture content was maintained at 60% by adding distilled water.
After 6 months, plants were harvested and analyzed for biomass and Pb accumulation properties.
4.2.6. Statistical Analysis
Statistical analysis of data was carried out using the SPSS statistical package (version 20.0 for
Windows). All experimental data were analyzed using the one-way analysis of variance
(ANOVA). Significance difference (p< 0.05) was determined by least significant difference
(LSD) test and Duncan multiple range test.
4.3. RESULTS AND DISCUSSION
4.3.1. Pb Tolerant Fungi
Tolerance of fungi to Pb was recorded up to 500 and 1000 mg L-1 on PDA and PDB, respectively.
Results indicated different Minimum Inhibitory Concentrations (MIC) values of Pb for tested
fungi. The MIC is the lowest inhibitory concentration of metal that affects visible growth of
tested organism. Radial hyphal growth rate revealed that most of tested fungi were characterized
by a high tolerance to Pb. On PDA at 500 mg L-1 (data not shown), the tolerance pattern was T.
harzianum> A. flavus> A. niger> Mucor sp.> P. simplicissimum, whereas on PDB, the tolerance
![Page 97: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/97.jpg)
78
(1000 mg L-1) of fungi followed the sequence T. harzianum> A. niger> Mucor sp.> A. flavus> P.
simplicissimum (figure 4.1). The results of the present study showed that the highest significant
tolerance was exhibited by T. harzianum and A. niger. Minimum decrease in total dry biomass
production by 5.74% and the highest tolerance index of 0.94 was observed with A. niger (table
4.1).
Figure 4. 1: Fungi tolerance to Pb was expressed as the ratio of the absorbance in Pb
supplemented medium (Am) with respect to that of the control (Ac.) representing the growth
observed in PDB supplemented with 1000 mg L-1 of Pb .
Different studies reported A. niger, Penicillium sp. and Fusarium sp. as efficient tools for
decontamination of heavy metals including Pb, Cr, Zn, Ni and Cd (Iram et al., 2012; Bai &
Abraham, 2003). In a study conducted by Mohammadian et al. (2017), T. harzianum was more
tolerant to Cd, Pb and Cu metals with MIC value of 35-650 mg L-1. Similar findings were
obtained by Iskandar et al. (2011) where the highest Pb tolerance was showed by A. niger (500
mg L-1). Pb tolerance in A. niger have been found because of increased proline indicating metal
tolerance mechanism. Proline act as scavenger of hydroxyl radicals generated during Pb toxicity
inside cell wall (Chandran et al., 2014). The variation in fungal isolates to tolerate increasing Pb
aab
bb
b
0.0
0.5
1.0
1.5
Rati
o (
Am
/Ac)
Fungal strains
![Page 98: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/98.jpg)
79
concentrations may be attributed to the inherent ability, defense response, detoxification
mechanism and other biochemical characteristics that vary from genome to genome (Baldrian &
Gabriel, 2002).
4.3.2. Effect of Fungi on soil properties
a. Effect of fungal treatment on soil Pb mobility
The results from soil incubation experiments showed that fungal strains vary in their ability to
modify Pb availability and thereby increase the Pb mobility. Figure 4.2 presents the effect of
each tested fungal strain on Pb mobility. It was observed that with increase in soil Pb
concentration from 500 to 2000 mg Pb kg-1 soil, solubility was increased by 5.2 –folds.
Figure 4. 2: Effect of fungal inoculation on Pb mobility with increasing soil Pb concentrations
(500, 1000, 1500 and 2000 mg Pb kg-1 soil). Control indicated no fungal inoculation. Pb
concentration in control soil (0 Pb mg kg-1) was < 3 mg kg-1. The graph is plotted by taking the
mean of three replicates per treatment. Bars marked with different letters are significantly
different at p<0.05.
At 2000 mg kg-1 Pb concentration, Mucor spp. and A. flavus were able to significantly (p<0.05)
increase Pb solubility by 1.8 and 1.6–folds, whereas T. harzianum and P. simplicissimum
j j
ij
c
ij
cd
ij ij
gh
b
hi
b
fghefg
ef
a
fgh
a
cd
hi
ef
b
cd
a
0
20
40
60
80
100
Control T.harzianum P.simplicissimum A.flavous A.niger Mucor spp.
Pb
Con
c. (
mg k
g-1
)
Fungal strains
500 1000 1500 2000 mg kg-1
![Page 99: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/99.jpg)
80
decreased Pb solubility by 2.2 and 1.2–folds compared to the control soil (no fungi) at 2000 mg
Pb kg-1 soil. In a study conducted by Munawar & Irum (2014), the addition of the active mycelia
of A. niger and A. flavus increased the soil Pb chelation after 24 h of inoculation. A. niger was
more efficient in adsorbing Pb instead of releasing it in soil solution. Mucor spp. (CBRF59) have
also been found to significantly increase the availability of soil Pb by 77% (Deng et al., 2011).
The ability of A. flavus and Mucor spp. to increase Pb mobility may be due to production of
organic compounds. Most of the soil fungi secreted organic acids that form complexes with
metals and define metal speciation which served as chelating agents during the course of
incubation. Natural low molecular weight organic acids (NLMWOA) such as citric acid, oxalic
acid, or malic acid and humic substances (HS) belong to natural chelating agents. These
compounds play an important role in the metal solubility directly by changing soil pH and
indirectly by their effects on microbial activity, rhizosphere chemistry, and root growth dynamics
and directly, through acidification, chelation, precipitation, and oxidation-reduction reactions in
the rhizosphere (Evangelou et al., 2007). Number of studies have reported the ability of A. niger
to produce the NLMWOA in large quantities of which oxalic and citric acids contain 90% of the
total organic acid produced (Ousmanova & Parker, 2007).
b. Effect of fungal treatment on soil pH
Fungal ability to modify pH was monitored in broth (PDB) and soil. Inoculation of fungi in broth
culture and the corresponding changes in the pH of solution are presented in figure 4.3a. From
results, it is obvious that pH of broth slightly declined with increasing number of days. The pH
of freshly prepared broth was 5.6. Upon inoculation of fungi, clear change in pH of solution was
observed. Among the five strains, A. niger drastically lowered the pH on 2nd day of culturing
which continued up to 6th day. The highest significant effect in lowering pH on 6th day of
![Page 100: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/100.jpg)
81
incubation was obtained by A. niger followed by A. flavus. Our results are in agreement with
previous studies reported in literature. A. niger lowered the pH of solution up to 4.17 besides
solubilizing phosphorus when growing on PVK medium (Reena et al., 2013). This wide change
in pH may be due to release of organic acids. Chandran et al. (2014) working with A. niger
observed production of citric (121 mg L-1) and oxalic acid (110 mg L-1) in PDB medium in the
presence of Pb (50 mg L-1), which could be a reason of media acidification by A. niger in current
study.
Figure 4. 3: Effect of fungal inoculation on PDA media pH (a); soil pH after incubation (b).
Graph is plotted by taking mean of three replicates.
Similar results had also been obtained in soil treated with different fungal inoculums (figure
4.3b). According to the results, a slight decrease in pH was observed in control soil with
increasing concentration of Pb and this change was not significant (P < 0.05). Reduction in soil
pH depicts that fungi may modify soil environment which may favor phytoremediation of Pb and
other heavy metals. The change in pH (ΔpH) as a result of fungal treatment was obtained by
subtracting pH obtained in control soil from pH obtained in fungal treated soil. Acidification of
3.0
4.0
5.0
6.0
7.0
0 2 4 6
pH
Days
ControlT.harzianumP.simplicissimumA.flavousA.niger 6.5
6.7
6.9
7.1
7.3
7.5
0 500 1000 1500 2000
pH
Soil [Pb] mg kg-1
(b) (a)
![Page 101: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/101.jpg)
82
soil was indicated by negative values of ΔpH. Three strains including A. flavus, A. niger and
Mucor spp. lowered the soil pH (-0.15, - 0.05 and -0.13 ΔpH, respectively) whereas T. harzianum
and P. simplicissimum increased the soil pH (+0.08 and +0.11 ΔpH, respectively).
c. Effect of fungal treatment on soil organic carbon content
Fungi provide major contribution to soil organic matter since it plays important role in
decomposition of biomaterials added to soil. Increase in soil organic matter increases Pb
immobilization (Xu et al., 2018). The effect of five fungal strains upon soil organic matter is
presented in figure 4.4.
Figure 4. 4: Change in organic matter (%) in soil treated with different fungal strains. The
values are means of three replicates. Means marked with different letters are significantly
different at p<0.05.
The initial value (before treatments) of organic matter (OM) in control soil was 0.88% which
was significantly (p<0.05) reduced to 0.046% at 2000 mg kg-1 soil Pb concentration. Significant
increase in organic carbon was observed by A. flavus at increasing concentration of Pb in soil
when compared to other strains and control soil. The maximum values for increase in organic
carbon recorded were 1.68 and 1.36% for A. flavus and A. niger, respectively, at 500 mg kg-1 soil.
b
b-f
b-e
a
a
b-db-f
d-ge-i
b-e
bc
e-h
f-ie-i
g-i
c-g
b-e
c-e
hi
g-i
hi
g-i
i
f-h
0
0.4
0.8
1.2
1.6
2
Org
am
ic c
arb
on
(%
)
Fungal strains
500 1000 1500 2000 mg kg-1
![Page 102: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/102.jpg)
83
Contrary to pH, with increase in soil Pb concentration, organic carbon decreased. This could be
due to Pb toxicity. Under elevated Pb concentration, there might be decrease in secretions of
sugars and weak organic acids which at the same time increased the pH of solution but decreased
the organic content.
4.3.3. PGP Assays
The potentials for plant growth promotion and biochemical enzyme activity of the selected fungal
strains were evaluated. The details are as follows.
Table 4. 1: Reduction in dry biomass, tolerance index (TI) of fungal strains after exposing to
1000 mg L-1 Pb in PDB media after 5 d and PGP activity. Letters indicate significance
difference at p value <0.05.
Sr # Fungal strains Reduction in
dry biomass
(%)
TI IAA
(µg mL-1)
P
solubilization
(µg mL-1)
Gibberellins
production
(µg mL-1)
Siderophores
production
(%)
1 A.niger 5.74 0.94 249±7.2a 27±1.9b 43±1.1a 61±1.3a
2 T.harzianum 12.87 0.87 99±3.2c 22±0.5bc 36±1.3b 38±3.8c
3 A.flavous 17.93 0.82 65±2.5d 8±1.2d 7±0.8d 49±2.6b
4 Mucor spp. 24.69 0.75 203±5.8b 17±1.9c 5±0.6d 28±5.1cd
5 P.simplicissimum 56.74 0.43 16±1.5e 58±2.2a 13±1.2c 25±2.6d
TI=Biomass in Pb supplemented medium/ Biomass in control
a. IAA production
Auxins play an important role in plant growth, reproduction, metabolism and responses to various
environmental cues including interactions between auxin homeostasis and heavy metal toxicity
(Waqas et al., 2012). The ability of tested fungal isolates for IAA production is presented in table
4.1. Among five strains, the highest IAA was recorded in A. niger (249 μg mL-1) followed by
Mucor spp. (203 μg mL-1). This agrees with the results of many investigators where the high
production of IAA was observed in A. niger (710 and 100 μg mL-1) (Usha & Padmavathi, 2013;
Bilkay et al., 2010) T. harzianum has also been reported for IAA production (52.57 μg mL-1) (Al-
![Page 103: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/103.jpg)
84
Askar, 2016). IAA plays significant role in the phytoextraction of Pb by improving plant biomass
and contributing to Pb detoxification mechanisms in plants (Hac-Wydro et al., 2016). Auxins can
promote modification of membrane properties, thereby alleviating toxic effects of heavy metal
exposure. In the presence of lead, naphthalene acetic acid (NAA) has been found effective in
reducing heavy metal toxicity by protecting plants from membrane damage and disorganizing
(Hac-Wydro et al., 2016). In another study, IAA increased Pb accumulation into harvestable
tissue by 2800% over control plants (Lopez et al., 2005).
b. Phosphate solubilization
Phosphate induced Pb biomineralization is the main Pb detoxification mechanism in fungi and
considered as one of the most important and efficient bioremediation strategies. Many soil fungi
secrete organic ligands that effectively solubilize metal and liberate metal cations such as Pb. On
the other hand, there is group of phosphate solubilizing fungi (PSF) that interact with lead through
immobilization processes such as biomineralization of lead oxalates, phosphates and carbonates
(Povedano-Priego et al., 2017). In the present study, the phosphate solubilization potential of
tested fungi was monitored and given in table 4.1. Results indicated that P solubilization ability
of fungi ranged between 8 to 58 µg mL-1. P. simplicissimum greatly increased the soluble P in
culture medium (58 µg mL-1) followed by A. niger and T. harzianum (27 and 22 µg mL-1,
respectively). The least phosphate solubilization potential was observed in A. flavus (8 μg mL-1).
This is comparable to the P solubilized by P. simplicissimum (58.8 mg L-1) in a liquid medium
containing phosphate rock (Wakelin et al., 2004). P. simplicissimum is repeatedly reported as
efficient phosphate solubilizer in many studies. Even in saline conditions (3.5% NaCl), higher
number of spores and content of soluble P in the medium has been reported with P.
simplicissimum, followed by A. niger and A. japonicus (Xiao et al., 2011). Reena et al. (2013)
![Page 104: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/104.jpg)
85
revealed A. niger as major phosphate solubilizer, while testing rhizospheric microbial community
of banana plant. A. niger formed clear halo zone (2.3 cm diameter) on LB agar and in broth assay
the phosphate solubilization activity 3.90 mg 25 mL-1 was recoded. Xiao et al. (2009) found
phosphate solubilizing ability of Mucor spp. as 89.65 mg L−1. In another study, A. niger and T.
harzianum showed solubilization activity of 1.67% and 0.32%, respectively depicting the ability
of these strains to solubilize P (Yasser et al., 2014). Comparing these results with pH changes in
incubation experiment, acidification of culture medium seemed to be the main mechanism for
phosphorus solubilization. However, acid production may not be the only reason for phosphate
release into the medium. There might be other factors including acidification either by proton
release coupled with ammonium assimilation or proton release from organic acid production.
Acid phosphatases and phytases secreted by these microorganisms also have an important role
in phosphate solubilization (Yasser et al., 2014).
c. Gibberellin production
All fungal strains could produce gibberellin. The highest GA3 production was recorded in A.
niger (43 µg mL-1) followed by T. harzianum (36 µg mL-1) and P. simplicissimum (13 µg mL-1)
as shown in table 4.1. A. flavus and Mucor spp. produced the least and insignificant amount of
GA3 when compared to control. In some other studies, Aspergillus species have been tested for
production of GA3 and it was found that ~60 µg mL-1 of GA3 was produced by A niger (Bilkay
et al., 2010). In another study, T. harzianum 1-SSR produced 34.80 μg mL-1 of GA3 depicting its
plant growth promoting ability (Al-Askar, 2016).
d. Siderophore production
![Page 105: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/105.jpg)
86
Strains had different abilities to produce siderophores in both CAS agar and CAS broth media.
CAS agar assay confirmed siderophores producing ability of A. niger, A. falvous and P.
simplicissimum. The extent and color of halo zones after 4 days incubation varied among fungal
strains showing different type and quantity of siderophores produced by different fungi (data not
shown). The highest siderophore production was observed by A niger (4.4 cm) followed by A.
flavus (1.7 cm) and P. simplicissimum (0.3 cm). Negligible production of siderophores was
observed in T. harzianum and Mucor spp. Similar results were obtained in CAS broth. A. niger
was found to have significantly high siderophores production (61%) followed by A. flavus (49%)
(table 4.1). Our results are in agreement with several other investigations where A. niger (12 U
mL-1) and A. flavus str1 (10 U mL-1) showed higher siderophore production compared to other
tested fungi (Usha & Padmavathi, 2013). Siderophore production abilities of soil fungi depends
on several environmental factors including elevated iron concentration in the vicinity.
Siderophore production is influenced in the presence of organic acids produced from fungi. It is
well documented that citric, oxalic and malic acids and, other organic acids play important role
in CAS reagent reaction in presence of iron. These acids can react with CAS reagent in the same
manner as true siderophores, thereby, change the color of assay medium (Carson et al., 1992).
4.3.4. Effect of Fungi on Pb Accumulation and Uptake
Pb accumulation by Pelargonium hortorum and Mesembryanthemum criniflorum as a result of
fungal treatment is presented in figure 4.5. Results showed that fungal treatment improved the
Pb accumulation up to 1500 mg kg-1 Pb treatment with the highest significant accumulation in
Pelargonium hortorum treated with A. falvus. At the highest soil Pb treatment (2000 mg kg-1),
the Pb accumulation was significantly reduced in control plants which may be due to high toxicity
induced by increased concentrations of Pb in soil. However, plants treated with fungi showed
![Page 106: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/106.jpg)
87
better performance with significant (P>0.05) accumulation in Pelargonium hortorum treated
with A. falvous followed by Mucor spp. In case of dry biomass production by each plant, A niger
sustained plant biomass with increasing concentrations of Pb in soil (data not shown).
Figure 4. 5: Effect of fungal treatment on Pb accumulation. Pb concentration in control soil (0
Pb mg kg-1) was < 2 mg kg-1. The values are means of three replicates. Means marked with
different letters are significantly different at p<0.05.
Results of Pb uptake per plant calculated from biomass and concentration of Pb in root and shoot
is given in table 4.2. Among two plants, Pelargonium hortorum was more efficient in
accumulating Pb in plant biomass. Total per plant Pb uptake in Pelargonium hortorum was 1.7–
folds higher than that in Mesembryanthemum criniflorum. This difference could be due to the
lesser biomass produced by Mesembryanthemum criniflorum. The reason lies in the fact that
Mesembryanthemum criniflorum is a seasonal plant and could only be grown for 4 months,
whereas Pelargonium hortorum is perennial showing higher biomass production. All fungal
isolates were found to increase Pb uptake in both plants. At 2000 mg kg-1 soil Pb concentration,
all strains equally increased Pb uptake in Mesembryanthemum criniflorum 2 –folds compared to
the control plants. In case of Pelargonium hortorum, the increase in Pb uptake was 3, 2 and 2–
m…lmn
e-h ghi
cde cd
klmjk
klmkl
cd
ab
cd
a
c-fbc
n
klm
ghi ghi d-g
cdef
ijkhijk
kl klm
cdee-h
cdec
fghc-g
0
500
1000
1500
Mc Ph Mc Ph Mc Ph Mc Ph
500 1000 1500 2000
Pb
acc
um
ula
tion
in
sh
oo
t (m
g
kg
-1)
Pb conc. in soil (mg kg-1)
Control
A. flavous
A. niger
Mucor Sp.
![Page 107: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/107.jpg)
88
folds in plants treated with Mucor spp. A. flavus and A. niger, respectively. Highest significant
(p<0.05) uptake was observed in Pelargonium hortorum by Mucor spp. (2.21 mg per plant)
followed by A. flavus (1.85 mg per plant) in soil containing 500 mg Pb kg-1 soil.
Table 4. 2: Pb uptake (mg) in plants treated with fungi at different soil Pb concentrations.
Letters indicate significance difference at p value <0.05.
Treatments Pb concentrations in soil (mg kg-1)
500 1000 1500 2000
Mesembryanthemum criniflorum
Control 454no 752i-m 685j-n 342o
A. flavous 566m-o 890h-k 685i-n 602l-o
A. niger 574m-o 952h-j 685h-l 599l-o
Mucor Sp. 718i-n 979hi 685h-j 612k-o
Pelargonium hortorum
Control 955h-j 1465de 1623cd 593m-o
A. flavous 1060gh 1853bc 1614cd 1164f-h
A. niger 1405d-f 2142a 1951ab 1291e-g
Mucor Sp. 1295e-g 1769bc 1963ab 1342ef
Mucor spp. is well reported for plant growth improvement in Pb and other heavy metal
contaminated soil. In an experiment, Mucor treated Guizhou oilseed rape, the concentration of
Pb and Cd in plant tissues were increased by 117.6% and 63.5%, respectively, and decreased soil
Pb and Cd concentration by 60.6% and 27.1%, respectively (Zhu et al., 2015). This significant
(p<0.05) uptake by Mucor spp. treated plants may be attributed to the plant growth promoting
activities of Mucor spp. as confirmed by PGP assays (table 4.1). Mucor spp. was found to have
significant production of IAA (203 µgm L-1) and gibberellin (36 µgm L-1). Several studies have
reported the role of IAA and gibberellin in Pb chelation and uptake in plant tissues. In an
experiment conducted by Hadi et al. (2010), significantly high total Pb uptake in Zea mays L.
was found when plants were treated with combination of EDTA and gibberellin instead of EDTA
alone. Mucor spp. have also been reported for production of citric and oxalic acid (1.5 and 2.3
![Page 108: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/108.jpg)
89
nmole L-1, respectively) (Wang & Chen, 2009; Xiao et al., 2009) which are well known chelators
of Pb. Our results from broth culture experiments also showed that Mucor spp. could lower the
pH of cultured PDB that favors solubility of Pb and uptake by plant. Mucor spp. have previously
been reported to adsorb Pb on outer cell wall which could facilitate metal uptake by plants. Pb
efflux mechanism in Mucor spp. could also increase the availability of Pb for plant uptake
(Velásquez & Dussan, 2009). A. flavus have also been found as an efficient Pb and Cr solubilizer
in mustard rhizosphere soil (Akhtar & Iram, 2016). This may be attributed to significant
production of gibberellin (43 µg mL-1) and siderophores (49%). Production of different organic
acids including maleic, tartaric, glutamic, acetic, lactic, succinic, citric and gluconic acids by A.
niger and flavus have been reported (Max et al., 2010). Meanwhile A. niger was also significant
phosphate solubilizer (27 µg mL-1) (table 4.1) which can immobilize or precipitate available Pb
in soil or can adsorb or accumulate and store inside the periplasm.
4.4. OUTCOMES AND PERSPECTIVES
Among studied fungi, A. niger was most tolerant strain against Pb. Besides tolerance, the strains
have excellent abilities to modify soil physicochemical characteristics inducible for Pb chelation.
PGP assays also confirmed the plant growth promoting characteristics of these fungi.
Significantly high production of IAA and siderophores was observed in A. niger and GA3
production in A. flavus. Phytoextraction of Pb was improved in both plants upon fungal treatment.
However, Pelargonium hortorum was more efficient owing to high biomass production. Our
results suggested that in Pb-contaminated soil, Pelargonium hortorum treated with Mucor spp.
have greater potential to remediate Pb contaminated soil. The current study gave an insight of
fungal-plant interaction in phytoremediation of Pb. However, soil bacteria is another major
component that effects the speciation and availability of Pb at soil plant interface. Also, many
![Page 109: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/109.jpg)
90
bacteria are known to be Pb resistant and contribute towards phytoextraction through PGP
activity. Keeping this in mind in next section, indigenous bacteria were isolated from field
contaminated soil and characterized for promoting phytoextraction ability of selected plants.
Details are in next section.
![Page 110: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/110.jpg)
91
B. METAL TOLERANCE OF ARSENIC-RESISTANT BACTERIA AND THEIR
ABILITY TO PROMOTE PLANT GROWTH OF Pteris vittata IN Pb-
CONTAMINATED SOIL
In this part, preisolated bacteria from rhizosphere of metal hyperaccumulator Pteris vittata were
used for Pb phytoextraction by sporophytes of Pteris vittata in controlled conditions at soil and
water science department, University of Florida, USA. The Pb resistance mechanism of bacterial
strains were studied in detail and Pb resistant genes (PbrA, CadA2, ZntA & CzcR) were amplified.
But the strains did not help much in phytoextraction. Instead, the bacterial strains stabilized Pb
in soil and roots. Similar Pb phytostabilization was achieved when the bacteria were applied on
Pelargonium hortorum.
4.5. BACKGROUND
Soil contamination by heavy metals is a serious problem worldwide, causing adverse effects on
plant growth and human health. Heavy metals of major concern include As, Cd and Pb (Zhu et
al., 2014). Of these, Pb contamination in soils is of major environmental significance due to its
wide spread presence and toxicity to humans, especially to children (Ma et al., 1995). Lead
concentrations in soils range from 1 to 200 mg kg−1, averaging 15 mg kg−1 (Zimdahl and
Skogerboe, 1997). However, Pb concentrations in contaminated soils in shooting ranges can be
up to 17,850 mg kg-1 (Fayiga et al., 2011). According to USEPA, Pb levels in soils exceeding
400 mg kg-1 are hazardous and require remediation (OSWER, 1994).
Among soil remediation techniques, phytoremediation is environmentally-friendly and relatively
inexpensive. However, limited Pb bioavailability for plant uptake in soils hinders its
effectiveness (Arshad et al., 2008, 2016; Gul et al., 2019; Manzoor et al., 2018). Bacteria are
![Page 111: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/111.jpg)
92
effective in solubilizing Pb from soils by secretion of extracellular enzymes and organic acids
(Drewniak et al., 2017). As such, microbes have been used to enhance Pb availability in soils
(Lors et al., 2004). Many bacteria are effective in enhancing plant metal uptake and plant growth.
For example, metal-resistant bacteria enhanced Pb accumulation in rapeseed (Brassica napus;
Sheng et al., 2008b), and Pb and Cd uptake in tomato (Solanum lycopersicum; Sarathambal et
al., 2017).
Ghosh et al. (2015ab) isolated 7 As-resistant bacteria from the rhizosphere of As-
hyperaccumulator Pteris vittata (PG-4, 5, 6, 9, 10, 12 and 16), which were tolerant to 10 mM As
and identified as Pseudomonas sp. by 16S rRNA sequencing. Among them, while PG-12 and 5
oxidized arsenite (AsIII) to arsenate (AsV), others reduced AsV to AsIII (Ghosh et al., 2015b).
In addition, they were effective in enhancing As and P uptake by P. vittata and tomato growth
under P-deficient conditions (Ghosh et al., 2015a; Han et al., 2016). This was probably due to
their ability in producing siderophores, ranging from 9.47 to 115 µM DFOM (deferroxamine
mesylate) equiv./OD of cells (Ghosh et al., 2015). Siderophores are low molecular weight, high
affinity Fe chelators, which are effective in solubilizing Fe from soils, thereby releasing the
associated As and P to enhance plant uptake.
Although bacteria-enhanced metal phytoextraction from soils has been reported, limited
information is available regarding the role of metal-resistant bacteria on Pb availability and plant
growth of P. vittata in Pb-contaminated soils. Rhizobacteria associated with P. vittata have been
characterized for their ability to deal with arsenic stress, P solubilization and plant growth
promotion (Huang et al. 2010; Ghosh et al., 2015ab), but little information is available about
their potential utility in soils contaminated with As and Pb. The objective of this study was to
![Page 112: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/112.jpg)
93
characterize the metal resistance of these strains and to evaluate their ability in enhancing plant
growth of As-hyperaccumulator P. vittata grown in Pb-contaminated soil.
4.6. MATERIALS AND METHODS
4.6.1. Metal Tolerance and Metal Solubilization
In this study, 6 As-resistant bacteria (PG-4, 5, 6, 9, 10, 12 and 16) from P. vittata rhizosphere
isolated by Ghosh et al. (2015a,b) were further characterized. Their ability to tolerate Pb in Luria-
Bertani (LB) liquid medium was examined by determining the minimum inhibition concentration
(MIC) of PbCl2. The bacteria were incubated in LB broth at pH 7.5 supplemented with 0.5-10
mM Pb concentrations in a shaker incubator at 28°C and 200 rpm. Optical density (OD) was
noted for all cultures at different intervals using a UV–vis spectrophotometer at 600 nm
(Beckman Coulter, DU® 730). In addition, their cross tolerance to Pb was tested (Naik and
Dubey, 2011). Their tolerance index was calculated by dividing the bacterial dry biomass
obtained in LB media supplemented with 1 mM Pb to that in the control after 24 h of incubation
at 28°C and 200 rpm.
After 24 h incubation, logarithmic phase cells were used for making bacterial inoculum at 0.1
OD600nm. To determine metal solubilization, inoculum at 2 mL was added in culture vials
containing 2.5 mg mL-1 insoluble PbCO3 and incubated in a shaker incubator at 28°C and 200
rpm. Uninoculated media were kept as a control to determine the influence of abiotic factors on
metal solubility and solution pH. After 24 h, spent media were harvested by centrifugation at
10,000 g for 15 min and filtered through 0.22 µm Millipore filter. Half of the filtrate was used
for pH determination and other half was used for Pb and Cd determination by inductively coupled
plasma-mass spectrometry (ICPMS; Perkin-Elmer Corp., Norwalk, CT; de Oliveira et al., 2017).
![Page 113: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/113.jpg)
94
4.6.2. Metal Uptake and Metal Resistant Genes
For metal uptake, bacteria were incubated in culture tubes containing 2 mL LB liquid media at
28°C and 200 rpm. After 24 h, bacterial density was adjusted to 0.1 OD600nm and 1 mM PbCl2
was added. Cultures were incubated for 24 h, then cells were harvested by centrifugation at
10,000 g for 10 min. The supernatants were collected and filtered through 0.22 µm before
analysis. Bacterial pellets were washed by suspending once in LB liquid media and 2 times in
sterile deionized water prior to drying. After washing, bacteria pellets were re-suspended in 0.5
mM EDTA and vortexed for 5 sec, followed by centrifugation. This step was performed 3 times
to ensure removal of adsorbed metal on cell walls by EDTA. After which, bacterial pellets were
dried, and fresh and dry biomass were determined. Dried pellets were digested with HNO3/H2O2
using USEPA Method 3050B on a hot block (Environmental Express, Ventura, CA) and Pb and
Cd concentrations in bacteria were determined by ICP-MS.
Table 4. 3: Primers used to amplify efflux genes in metal resistant bacteria.
Serial
No. Genes Direction Sequences(5’ to 3’)
Fragment
size (bp) References
1 CadA2 Forward CCTGCTGCGCATCGAGATAA
178 Leedjärv et al., 2008;
Lee et al., 2001 Reverse GTTGGTGACGAACCAGGTGA
2 PbrA Forward CCTCGCCATCGATCACTACC 281 Permina et al., 2006; Monchy et al. 2007 Reverse GCACCAGTGCATCACGAATC
3 ZntA Forward CGTAGCGAAGGCAACTATCG 110
Permina et al., 2006;
Lee et al., 2001 Reverse AGCAGGGTACGGATTTCCTC
4 CzcR Forward TCAACCTGACGACCAAGGAG
201
Leedjärv et al 2008;
Jarosławiecka &
Piotrowska-Seget, 2014 Reverse CGCGAATGGTATGGATCAGC
bp= base pair
In addition, genomic DNA was extracted from bacteria using total DNA extraction kit
(Invitrogen). The amount of DNA eluted in samples was quantified by Nano DropTM 2000
![Page 114: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/114.jpg)
95
(Thermo Scientific). The expression of specific genes coding for efflux proteins included pbrA,
cadA2, zntA, and czcR involved in metal resistance was tested using PCR. The details of
amplifications and primers used are given in table 4.3. The total reaction mixture for PCR was
20 µL per sample. The conditions were as follows: initial denaturation was done at 94°C for 2
min followed by 40 cycles of 94°C for 1 min, 60°C for 1 min, and 3 min at 72°C. A final extension
was done at 72°C for 7 min. PCR products were separated on 0.8 % (wt/v) agarose gels at 100 V
for 1 h in Tris-acetate-EDTA buffer. The gel was stained with ethidium bromide and Gel images
were captured by a Gel imaging system (Bio-Rad).
4.6.3. Plant Growth Promoting Hormones
The ability of the 7 bacterial strains for siderophores production and P solubilization was
examined by Ghosh et al. (2015). In this study, their ability to produce plant growth promoting
hormones including indole acetic acid (IAA) and gibberellic acid was determined (Bharucha et
al., 2013). Briefly, LB liquid media supplemented with 1% L-tryptophan were inoculated with
0.1 mL bacteria (OD600 nm=0.1) and incubated at 28°C and 200 rpm in a shaking incubator. After
24 h, cell-free supernatant was obtained by centrifugation (10,000 g for 15 min) and mixed with
2 mL of Salkowaski’s reagent (0.5 M FeCl3 in 35% H2SO4). The intensity of pink color was
determined by taking absorbance through spectrophotometer at 530 nm and amount of IAA was
calculated through standard curve.
Production of gibberellic acid was determined following Holbrook et al. (1961). Culture tubes
containing 10 mL of LB media was inoculated with 1 mL of bacteria at 0.1 OD600 nm and
incubated for 48 h at 28°C at 200 rpm. Bacterial cells were harvested by centrifugation (10,000
g for 15 min), and cell free supernatant was acidified to pH < 2.0 using 2 N HCl. Mixture was
then extracted with 15 mL ethyl acetate for three times to obtain 40 mL extract, which was
![Page 115: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/115.jpg)
96
evaporated to 5 mL final volume. The amount of gibberellic acid was measured by colorimetric
method (Bharucha et al., 2013).
4.6.4. Effect of Bacteria on P. vittata Growth Under Pb Stress
P. vittata plants were germinated from spores under sterile conditions (Mathews et al., 2010).
Briefly, spores of P. vittata from Florida, USA were soaked in sterile water for 30 min, 70%
ethanol for 30 s and 10% NaClO for 30 min. They were then washed 3 times with autoclaved
distilled water and were incubated on LB agar plates at 30°C for 4 d. No bacterial growth
confirmed successful disinfection of spores. For germination, spores were incubated on sterile ½
Murashige and Skoog (MS) agar medium (0.8% at pH 5.7) in petri dishes. After 2 weeks of
germination, gametophytes were transplanted in fresh media and kept under sterile conditions to
develop sporophytes. Six-month old sporophytes with 2-3 fronds were used for this study.
Based on their metal tolerance and plant growth promoting characteristics, three bacterial isolates
PG-5, 12, and 13 were selected, with PG-2 as a control. P. vittata plants were transplanted from
MS media to pre-autoclaved GA-7 boxes containing sterile potting soil containing 1 mM PbCl2.
Soil was watered with 0.2 strength sterile Hoagland solution as needed. Bacterial inoculum was
prepared in LB liquid media for 16 h at 28°C and 200 rpm. Bacterial cells were harvested and
washed 3 times with phosphate buffer saline solution and resuspended in sterile distilled water.
One milliliter of bacterial suspension (OD600 nm=0.5) was applied to the roots of 5-month old P.
vittata plants. All treatments were carried out in a laminar flow hood and care was taken to keep
sterile conditions. Plants were allowed to grow in a lighted growth chamber for 1 month before
harvest. P. vittata roots were washed under running tap and distilled water before fresh and dry
biomass were recorded (Han et al., 2016). Plant biomass was digested with HNO3/H2O2 using
USEPA Method 3050B on a hot block (Environmental Express, Ventura, CA). Pb concentrations
![Page 116: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/116.jpg)
97
in P. vittata were determined by ICP-MS. To investigate whether Pb immobilization was due to
an energy-dependent mechanism by living bacterial cells, a control experiment with dead
(autoclaved for 15 min at 120 °C and 15 psi) bacteria was included. Plant biomass and Pb
concentration were determined as above.
4.6.5. Statistical Analysis
All experiments were performed in triplicate and the values are expressed as mean ± standard
deviation. Analysis of variance and Tukey's multiple comparison tests were done using SPSS
software, and least significant difference (LSD) was determined at P ≤ 0.05.
4.7. RESULTS AND DISCUSSION
4.7.1. Bacterial Resistance to Pb
According to Ghosh et al. (2015ab), all 6 bacterial strains were As-resistant, with PG-12 and 5
being AsIII oxidizers and others being AsV reducers. In this study, they were tested for Pb
tolerance after 24 h growth in LB liquid media containing 1 mM Pb (figure 4.6A). In addition,
their biomass reduction and tolerance index (biomass produced with Pb to that in control) after
24 h growth was determined (table 4.4). The highest Pb tolerance was observed for PG-12
followed by PG-5 and PG-16 (figure 4.6 A; table 4.4).
Strain PG-12 identified as Pseudomonas was tolerant up to 10 mM As in LB media (Ghosh et
al., 2015a), displaying high As resistance. Among all strains, PG-12 showed the highest tolerance
to all metals followed by PG-5. For example, strain PG-12 showed minimal inhibitory
concentrations of 0.6, 5, 8, 10, and 10 mM Cd, Co, Cu, Pb, and Ni (table 4.4). Results from
![Page 117: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/117.jpg)
98
biomass and tolerance index were also consistent (table 4.4). For example, no decrease in dry
biomass was observed in PG-12 after 24 h growth.
Figure 4. 6: Growth of bacterial isolates on media containing 1 mM Pb (A) after 24 h
incubation based on the ratio of OD in treated to control and PCR amplification of fragments of
metal resistant genes in PG-12 (B). Bars represent means of three replicates and standard error
and bars with same letters are not different at α = 0.05. Lane 1 has molecular weight markers
(100 bp ladder), and lanes 2, 3, 4 and 5 correspond to pbrA, cadA2, zntA and CzcR,
respectively.
Researchers have reported the ability of Pseudomonas to tolerate 3.2-8 mM Pb (Jebara et al.,
2015; Sinha and Mukherjee, 2009). Among bacteria, PG-2 was the most sensitive to Pb. The
(B)
(A)
![Page 118: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/118.jpg)
99
negative effects of Pb on growth of P. putida, P. fluorescens and Enterobacter spp. were reported
(Vashishth and Khanna, 2015). Strain Pseudomonas (PG-12) showed high resistance to multiple
metals including As, Cd and Pb (table 4.4). Similar metal resistances in Pseudomonas has been
reported. Lin et al. (2016) reported high tolerance of P. aeruginosa against Cd (20 mM), Zn (28
mM) and Pb (5.8 mM). Raja et al. (2006) reported that Pseudomonas (BC15) sorbed 30-93% Ni,
Pb, Cd and Cr from wastewater within 48 h, showing its multiple metal resistances. Another
strain of Pseudomonas, i.e., P. fluorescens (JH 70-4), showed high Pb tolerance (9 mM) and
partial tolerance to As (8 mM), Cu (6 mM), Cd (0.9 mM), and Ni (6 mM) (Shim et al., 2014).
When comparing bacterial metal tolerance in literature, bacteria PG-12 showed high tolerance
against multiple metals, making it a suitable inoculant in soils contaminated with multiple metals.
Table 4. 4: Bacterial biomass reduction and tolerance index after growing for 48 h in LB media
with 1 mM Pb, and minimum inhibitory concentration (MIC) of Pb, Cd, Ni, Co and Cu, and
production of phytohormones in bacteria after growing on LB agar media for 24 h.
Bacteria
l strains
Biomass
reduction (%)
Tolerance
index1
Minimum inhibitory
concentration2
Phytohormone
(µg mL-1)3
Pb Pb Pb Cd Ni Co Cu IAA gibberellin
PG-12 0.0 1.0 10 0.6 10 5 8 b17.4±0.36 a3.54±0.09
PG-16 8.0 0.9 5 0.2 5 5 2 e2.40±0.06 e0.81±0.01
PG-5 8.3 0.9 8 0.2 10 4 2 d3.76±0.04 c2.06±0.30
PG-14 12 0.9 2 1 2 0.5 2 c6.27±0.04 d1.23±0.09
PG-13 18 0.8 3 1 5 0.5 5 a19.5±1.23 b3.22±0.10
PG-2 68 0.3 0.1 0.1 1 1 0.1 de3.32±0.19 d1.18±0.11 1 Tolerance index = biomass produced with Cd or Pb to that in control. 2 Lowest concentration of a chemical to prevent visible bacterial growth 3 Different letters indicate significant difference (p<0.05).
4.7.2. Genes Involved in Metal Resistance in PG-12
To better understand the mechanisms associated with metal tolerance, PCR-based amplification
of genes possibly responsible for bacterial metal resistance in strain PG-12 were tested, including
pbrA, cadA2, zntA and czcR. These genes are from different metal detoxification systems
![Page 119: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/119.jpg)
100
encoding for efflux proteins. czcR encodes for regulatory protein for czcCBA metal efflux system
(Leedjarv et al., 2008). PCR reaction yielded three bands consistent with expected product sizes
for amplification of pbrA, cadA2 and czcR in PG-12 (figure 4.6 C). The results suggested that
high metal tolerance of PG-12 could be due to the presence of these efflux transporters. Other
studies reported that pbrA, cadA and czcCBA are responsible for Pb and Cd detoxification in
bacteria (Jarosławiecka, and Piotrowska-Seget, 2014; Leedjärv et al., 2008). Efflux and ion
precipitation are a two-component Pb detoxification mechanism in bacteria (Hynninen et al.,
2009).
For Pb tolerance, pbr efflux system is the major detoxification mechanism in bacteria surrounded
by mer and czc families (Monchy et al., 2007). pbrA transports Pb from inside the cytoplasm to
the periplasm where released inorganic phosphate groups by pbrB precipitates Pb and prevents
its reentry into cells. The export of Pb ions to the periplasm involved both pbrA and P-type
ATPases of the class IB (PIB ATPases). cadA and zntA and their functions are not limited to only
Pb ion. In Pseudomonas putida KT2440, the main efflux transporter identified for Pb and Cd
ions is cadA2. cadA2 functions with czcCBA1 for Pb detoxification in bacteria. czcCBA1 is
known for transporting Zn, Cd and Co ions from the periplasm to cell exterior in Pseudomonas
putida KT2440 and C. metallidurans CH34 (Leedjarv et al., 2008). czcCBA efflux system is also
responsible for Pb efflux system in C. metallidurans (Hynninen et al., 2009). The presence of
these three efflux transporter genes suggested their potential involvement in high tolerance of
PG-12 towards Pb, Cd and Zn.
![Page 120: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/120.jpg)
101
4.7.3. Bacterial Pb Uptake and Solubilization
Bacterial isolates were further studied for their ability to tolerate Pb by determining their metal
sorption ability after 24 h culture in LB liquid media (figure 4.7A). Data showed that bacteria
had different ability in metal uptake. More Pb uptake inside bacteria was observed for all the
strains, consistent with metal tolerance data (table 4.4). A 5 –fold higher Pb accumulation inside
cells of PG-12 was observed than that sorbed on cell surface (193 vs. 41 µM). The efficiency of
Pseudomonas sp. for metal uptake is well known. The cell walls of G-negative bacteria contain
negatively-charged functional groups (carboxyl, phosphate, imidazole and amino groups), which
are responsible for metal sorption (Burnett et al. 2006). Chang et al. (1997) working with P.
aeruginosa observed similar behaviors for Pb, i.e., more Pb was taken up than sorption onto cell
surface (531 vs. 338 µM). The reason for high tolerance of PG-12 against Pb could be the
presence of several metal resistant genes (figure 1C). In particular, pbrA is a Pb-efflux protein
responsible for Pb detoxification and immobilization in cells. It is possible that PG-12 took up
Pb from medium and detoxified it inside the cell as inclusion and/or in plasma membrane.
In addition to metal uptake and sorption, selected bacteria were further investigated for their
ability to solubilize insoluble Pb and Cd. Results revealed that all bacteria were efficient in
solubilizing PbCO3 (figure 4.7B). The maximum Pb observed for PG-12 and PG-13 was 0.14%.
Strains PG-12 and PG-5 were efficient in siderophores production (115 and 73.2 µM equiv),
which may contribute to P solubilization (Ghosh et al., 2011; 2015a). Similar effect on Pb
solubilization was observed for P. fluorescens strain (Shim et al., 2014) wherein exchangeable
Pb decreased by 49% while organic- and sulfide-bound Pb increased by 31% in its presence.
Plant growth promoting bacteria including Pseudomonas, Bacillus, and Burkholderia are
![Page 121: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/121.jpg)
102
efficient in P solubilization (Glick et al., 1995), which are consistent with a report, showing 84
and 65% phosphate solubilization by PG-12 and PG-5 from phosphate rock (Ghosh et al., 2015a).
Figure 4. 7: Metal uptake, adsorption and solubilization: (A) uptake and sorption, and (B)
solubilization by selected bacteria. Bacteria were grown in LB media with 1 mM PbCl2 (A) and
2.5 mg mL-1 insoluble PbCO3 (B) for 24 h. The values are means of three replicates. Means
marked with different letters are significantly different at p<0.05. Capital and small letters
indicates significance among individual parameters.
4.7.4. Plant Growth Promoting Characteristics
These bacteria are known for their siderophore production and phosphate solubilization (Gosh et
al., 2015a). To further study their plant growth promoting characteristics, their production of
indole acetic acid (IAA; 2.7-20 µg mL-1) and gibberellin (0.81-3.5 µg mL-1) was determined
(table 4.4). The results showed that among all tested strains, again PG-13 and PG-12 displayed a
higher production of IAA and gibberellin. IAA production in Pseudomonas has been reported in
the literature. For example, Malik and Sindhu (2011) isolated IAA-producing (18-31 μg mL-1)
Pseudomonas from the rhizosphere of Cicer arietinum and Vigna radiate. Ahmad et al. (2005)
reported high production of IAA (41-53 μg mL-1) by 5 Pseudomonas isolates. Pandya and Desai
(2014) found high gibberellin production by Pseudomonas monteilii (93 µg mL-1). In
(B) (A)
![Page 122: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/122.jpg)
103
comparison, the production of IAA and gibberellin by PG-12 in this study was slightly lower
than those reported in literature. However, among all tested strains, PG-12 showed the highest
production of IAA and gibberellin, and PG-12 was also efficient in siderophore production and
phosphate solubilization (Ghosh et al., 2015ab), which may have contributed its ability in metal
uptake and solubilization (figure 4.7).
Figure 4. 8: Effect of bacteria on P. vittata biomass (A), potting media pH (b), and Pb (c) and P
(d) concentrations in the roots and shoots (R and S) of P. vittata grown in potting media
containing 1 mM Pb concentration. Bars indicates mean of three replicates and error bars show
standard errors. Letters indicates significant difference among treatments at p value <0.05.
Capital and small letters indicate significance among individual parameters.
1
2
3
4
5
6
7
8
(A)
(D)
![Page 123: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/123.jpg)
104
Three bacteria with multiple metal tolerances (PG-5, 12, and 13) and one isolate with no
resistance (PG-2) were inoculated with P. vittata under sterile conditions to study their effect on
plant growth under Pb contamination (figure 4.8). Results showed that some strains influenced
plant biomass with or without Pb stress, with PG-12 being the most effective in improving plant
biomass (figure 4.8A). Under Pb stress, the increase in root and shoot biomass of P. vittata was
2-3 fold. On the other hand, PG-2, PG-5 and PG-13 did not improve plant growth in presence of
Pb. The increase in P. vittata biomass by PG-12 could be attributed to its metal resistance to Pb.
In addition, PG-12 was efficient in phosphate solubilization and siderophores production (Ghosh
et al., 2015a). Furthermore, PG-12 produced highest IAA and gibberellin among all strains (17
and 3.5 µg mL-1), all contributing to its effectiveness of promoting plant growth (table 4.4, figure
4.8).
Besides plant biomass, we also determined plant Pb and P uptake. Regardless the treatments,
more Pb was accumulated in the roots (128-262 mg kg-1) than shoots (10-29 mg kg-1; figure
4.8C), consistent with literature (Wan et al., 2014). Compared to the control, while root Pb
increased by 2-fold in PG-5 treatment and shoot Pb decreased by 3-fold in PG-12 treatment, little
changes in Pb concentrations were observed in other treatments. The decrease in Pb
accumulation may partially be explained by pH modification of the potting media (figure 4.8B).
While PG-12 increased, PG-5 lowered media pH by 0.4-0.5 pH units. It is known that Pb
availability increases at lower pH (Ma et al., 1997; Arshad et al., 2016). The increase in biomass
by 2-3 folds and decrease in Pb concentrations by 2-3 folds of P. vittata can also be attributed to
efflux transporters coded by pbrA and cadA2 genes. pbrA together with expression of pbrB is
responsible for phosphate-based Pb immobilization in bacterial cell, making it unavailable for
![Page 124: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/124.jpg)
105
plant uptake (Hynninen et al., 2009; Jarosławiecka and Piotrowska-Seget, 2014). Similar to Pb,
more P was also accumulated in the roots (705-1406 mg kg-1) than shoots (551-1128 mg kg-1;
figure 4.8D). With or without Pb, PG-12 was the most effective in increasing plant P uptake.
While PG-5 and 13 also increased plant P uptake, control strain PG-2 showed little effect. A
similar increase in P uptake in tomato by PG-12, 5, and 13 was observed by Ghosh et al. (2015a).
The shoot and root P concentrations with PG-12 inoculation were 2–3 folds higher than the
control without bacterial inoculation (figure 4.8 D).
To test whether active PG-12 cells were required to improve plant growth under Pb stress, an
experiment was performed using P. vittata cultures grown in potting media inoculated with living
or dead (autoclaved) bacterial cultures. In addition, we tested the effect of adding IAA, equivalent
IAA amounts produced by PG-12. While both living and dead PG-12 were effective in enhancing
P. vittata growth (figure 4.9A), living PG-12 cells were 2-3 –folds more effective.
Figure 4. 9: Effect of living (12L) and dead (12D) PG-12 cultures, and IAA on plant biomass
(A) and Pb concentrations in P. vittata roots and shoots (B). The values are means of three
replicates with standard deviation shown as error bars. Means marked with different letter
codes are significantly different at p<0.05. Capital and small letters indicate significance among
individual parameters.
(A) (B)
![Page 125: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/125.jpg)
106
Considering results of Pb accumulation in the roots and shoots of treated P. vittata plants (figure
4.9 B), it is evident that alive PG-12 significantly lowered Pb concentrations in P. vittata
compared to control without bacteria. In contrast, an increase in Pb concentration both in the
roots and shoots were observed in plants treated with dead PG-12 and IAA. The data showed that
the ability of Pb immobilization in bacterial cell is lost when bacteria were dead and energy
dependent mechanism inside cells was probably involved in reducing Pb uptake into plant tissue.
The effect of dead PG-12 cells was similar to that of added IAA. The higher plant biomass with
living PG-12 than IAA indicated that IAA was not the main reason for plant growth promotion
by PG-12. It was possible that PG-12 provided more P to plants (figure 4.8 D) by producing Fe
chelating compounds such as siderophores, which is supported by its significant siderophore
production and P solubilization ability (Ghosh et al., 2015ab).
4.8. OUTCOMES AND PROSPECTS
The current study indicated that As-resistant bacteria from P. vittata rhizosphere displayed
significant ability to resist multiple metals. Among the different strains tested, PG-12 was the
most effective in metal tolerance and plant growth promotion. Presence of pbrA, cadA2 and czcR
efflux transporters in PG-12 may support the involvement of metal efflux transporters in Pb and
Cd resistance. Besides metal resistance and ability in siderophores production and phosphate
solubilization, PG-12 also produced significant amount of plant growth hormones (IAA and
gibberellin) to support plant growth in Pb-contaminated soil. Bacterial strain PG-12 in
combination with P. vittata could be further tested for remediation of soils contaminated with
multiple metals, particularly As and Pb.
![Page 126: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/126.jpg)
107
C. METAL TOLERANT BACTERIA ENHANCED PHYTOEXTRACTION OF LEAD
BY TWO ACCUMULATOR ORNAMENTAL SPECIES
For selection of Pb resistant and mobilizing bacteria, the activity was repeated, and indigenous
bacteria were isolated from contaminated soil collected from industrial zone of Islamabad and
Rawalpindi. The isolated strains were characterized for Pb tolerance, solubilization, PGPR and
Pb phytoextraction characteristics.
4.9. CONTEXT
Contamination of urban soil with lead (Pb) is a common heavy metal pollution in developing
countries. Pb has been used by humans for centuries but anthropogenic activities have increased
significantly in recent decades causing global contamination of biotopes and biocoenosis (Uzu
et al., 2010; Sahodaran & Ray, 2018). Lead being non-biodegradable and stable element, it poses
continuous threat to living biota. Pb is ranked 2nd among hazardous substances by the Agency
for Toxic Substances and Disease Registry (ATSDR, 2007). The Institute for Health Metrics and
Evaluation (IHME), based on 2015 data reported Pb responsible for 494,550 deaths, loss of 9.3
million disability-adjusted life years (DALYs), 12.4% of the global burden of idiopathic
developmental intellectual disability, 2.5% of the global burden of ischaemic heart disease and
2.4% of the global burden of stroke (WHO, 2017). It is therefore of immense need to remediate
Pb contaminated by developing environmentally safe technologies (Gul et al., 2019; Manzoor et
al., 2018; Arshad et al., 2016, 2008).
Currently, the biological approaches for safe removal of Pb from environment are gaining strong
status among environmentalists. Phytoremediation have been extensively studied and publically
accepted for safe removal of highly toxic metals (Gul et al., 2019; Manzoor et al., 2018; Arshad
![Page 127: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/127.jpg)
108
et al., 2016; Kumar et al., 2009). Among different heavy metals, Pb phytoextraction is most
challenging task owing to most stable heavy metal. According to Wierzbicka et al. (2007) 2.4%.
Pb is soil is in soluble form and 0.14 % is in exchangeable form only of total Pb present in soil
(Jena et al., 2013). Different methods employed to enhance phytoremediation efficiency include
use of specialized hyperaccumulating plants (Arshad et al., 2008), application of chemicals such
as EDTA and organic acids to increase Pb availability for phytoextraction (Gul et al., 2019).
However, issue regarding cost, leaching and toxicity are associated with these synthetic chelators
(Lu et al., 2017; Pandey & Bhattacharya, 2018; Kaurin et al., 2018). Soil bacteria have also been
extensively studied for novel traits like Pb tolerance and detoxification (He et al., 2009),
siderophopre (Sheng et al., 2008b) and have been reported to stimulate phytoextraction of Pb
through biomass enhancement by PGP activity (Kumar et al., 2009; Rajkumar & Freitas, 2008)
but little is known indigenous soil bacteria to enhance Pb solubility and accumulation in Pb
hyperaccumulator plants. The main objectives of current study were to characterize Pb resistant
and mobilizing bacteria for PGP characteristics and investigate their potential to improve
phytoextration of Pb by Mesembryanthemum criniflorrum and Pelargonium hortorumin Pb
contaminated soil.
4.10. MATERIALS AND METHODS
4.10.1. Isolation and Characterization of Pb Resistant Bacteria
Fresh soil samples collected from area around battery recycling sites of Islamabad and
Rawalpindi. These samples were used for isolation of bacteria. Isolation was done through serial
dilution method. Briefly, 1 g soil was serially diluted in sterile water and 200 µL of soil
suspension was spread on Luria–Bertani (LB) media containing 50 mg L-1 of Pb as PbNO3. Plates
![Page 128: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/128.jpg)
109
were then incubated at 27 °C for 48 h for growth of Pb resistant colonies. Enumeration of bacteria
was done on colony counter. Apparently different colonies were picked and pure streaks were
done to get pure cultures. Isolated pure strains were preserved in glycerol (35%) for further
analysis. Isolated strains were studied for morphological characteristics by determining size,
shape, margin texture and ram staining was performed by standard methods (APHA, 2005).
Biochemical parameters studied included catalase, oxidase, Simmons citrate and Mannitol,
urease. Pb tollerance in bacteria was recorded by growing them on LB agar containing different
Pb concentrations ranging 100-800 mg L-1. Pb resistance was quantified in terms of bacterial
growth by measuring Optical Density (OD) at 600 nm and minimum inhibitory concentration
was noted for each strain.
4.10.2. Effect of Resistant Bacteria of Soil Pb Mobility
Batch experiments were performed to monitor the effects of bacteria on Pb mobility in soil.
Briefly 10 g of soil spiked with different concentrations of Pb were placed in glass petri-plates
and autoclaved at 121 °C for 40 min in order to study the effect of tested microbial strain only.
Autoclaved plates were then oven dried at 105 °C for 2 h. Meanwhile bacteria were inoculated
in liquid LB medium and incubated at 28 °C at 200 rpm for 16 h. Exponential phase cells were
harvested by centrifugation, washed twice with sterile distilled water. To prepare inocula,
bacterial pellet was again resuspended in sterile distilled water and adjusted optical density (600
nm) to 0.5. And 1 mL of this inocula were added to each pre-sterilized petri plates containing
soil. Soil without bacterial treatment was kept as control. Soil moisture was maintained at 60%
by adding sterilized distilled water. Plates were then covered by parafilm in order to conserve the
moisture during incubation. Plates were incubated at 28 °C for 15 days. After incubation plates
were dried in oven at 105 °C for 2 h to stop bacterial activity. Soil was then extracted with 0.01
![Page 129: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/129.jpg)
110
M CaCl2 for available Pb in soil solution. Pb concentration in soil solution was finally determined
through extracted filtrates using atomic absorption spectrometer (AAS) (He et al., 2009).
4.10.3. Molecular Characterization of Resistant Bacterial Strains
Twenty-four hours fresh bacterial culture gown in LB agar were used for extraction of template
DNA. PCR tube containing bacteria was given heat shock (10 min at 95 °C) followed by
centrifugation in micro centrifuge (Eppendorf Minispin, Germany) (Ahmed et al., 2014). Clear
supernatant containing template DNA was amplified for 16S rRNA gene sequence through
conventional PCR using 9F; 5'-GAGTTTGATCCTGGCTCAG-3' and 1510R;
5’GGCTACCTTGTTACGA-3' as forward and reverse primers (Hayat et al., 2013). Reaction
conditions are described by Ahmed et al. (2014) and PCR was performed in thermocycler (Veriti,
Applied Biosystems). The amplification of 16S rRNA gene was confirmed with the help through
agorose gel (0.8% w/v) electrophoresis in 1X TBE and ethidium bromide (0.5 μg/mL). The
confirmed amplified product was then sent to MACROGEN (Seoul, Korea) for sequencing and
homology. GeneBank data base were matched with obtained 16S rDNA sequences using Ez
Taxon. Phylogenetic analyses were performed using bioinformatics software MEGA-7. For
sequence alignment and comparison CLUSTAL X and BioEdit were used, respectively.
Phylogenetic tree was then constructed by aligned sequences using the maximum likelihood
method (Ahmed et al., 2014).
4.10.4. PGP Characteristics of Bacteria
IAA production was measured following method of Bhagobathi & Joshi (2009). Bacteria were
cultured in LB broth containing 1% L-tryptophan at 27 °C and 200 rpm for 48 h. Cell free
supernatant (2 mL) was then mixed with 2 drops of concentrated orthophosphoric acid and 4 mL
![Page 130: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/130.jpg)
111
of Salkowski’s reagent. Intensity of pink color developed was estimated by taking sample
absorbance at 530 nm. IAA production was determined through standard curve. For phosphate
solubilization, bacteria were cultured in Pikovskaya agar and broth media (Pikovskaya, 1948)
containing 0.5% calcium phosphate at 27 °C and 150 rpm for 24 h. Cell free supernatant obtained
by centrifugation at 10,000 rpm for 10 min was used for soluble phosphate determination by
colorimetric method using Barton’s reagent (Pande et al., 2017).
The ACC deaminase activity was recorded by estimating by enzymatic hydrolysis of ACC and
corresponding generation of α- ketobutyrate (Belimov et al., 2005). Briefly, bacterial strains
grown in DF salt minimal media were harvested at 10,000g for 10 min and resuspended in 1 mL
of 0.1 M Tris-HCL (pH 7.5). Cells were again centrifuged and resuspended in 600 µl of 0.1 M
tris-HCL (pH 8.5) and 5% toluene. After vortex, 100 µl cell suspension were incubated for 30
min at 27 °C after adding 10 µL of 0.5 M ACC and 100 µL of 0.1 M HCL (pH 8). After incubation
1 mL of 0.56 N HCL was added to reaction mixture, vortex and cell free supernatant was obtained
by centrifugation for 5 min at 14,000 g. In 500 µL of supernatant, 400 µL of 0.56 N HCl and 150
µL of 0.2% of 2,4-dinitrophenylhydrazine in 2 N HCl was added and mixture was incubated for
30 min at 27 °C. Finally, 1 mL of 2 N NaOH was added before taking absorbance at 540 nm.
The amount of α -ketobutyrate was determined through standard curve of α -ketobutyrate ranging
0.2 -1 mM (Belimov et al., 2005).
Siderophores production was assayed on chrome azurol S (CAS) agar plates by spot inoculating
bacterial strains (10 µL of 10-6 CFU/mL) followed by incubation. Appearance of orange-yellow
hallo around inoculated strains was considered positive indication for siderophores production
(Schwyn & Neilands, 1987). For quantitative estimation, bacteria grown in malt extract (ME)
![Page 131: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/131.jpg)
112
broth medium at 27 °C and 150 rpm for 24 h. Bacterial cells were then harvested by centrifugation
(10,000 rpm for 10 min) and 0.5 mL of supernatant was then mixed with 0.5 mL of CAS reagent.
Finally, color intensity was determined by taking absorbance at 630 nm. Uninoculated succinate
medium containing CAS was used as reference. Siderophore units were calculated by formula
[(Ar - As)/Ar] x 100. Where Ar and As is absorbance of reference and sample at 630 nm
respectively (Aziz et al., 2016). Other functional characteristics including HCN production were
determined by methods of Lock (1948). Gibberellic acid production was quantified
colorimetrically following method of Holbrook et al. (1961).
4.10.5. Influence of Resistant Bacteria on Pb Uptake
Pot culture experiment was performed to study the influence of Pb resistant and solubilizing
bacterial strains on Pb uptake by Pelargonium hortorum and Mesembryanthimum criniflorum.
Soil used in pot experiments was same as used in previous study (Manzoor et al., 2018). Seeds
were surface sterilized and germinated in sterilized non-contaminated soil under controlled
conditions. Uniform seedlings (1 month old) were selected for transplanting in pots. Bacterial
inocula was prepared in same manner as described above. To each pot, 10 mL of bacterial inocula
was added. Three replicates were kept for each treatment. After 6 months the plants were
carefully removed from the pots, washed to remove adhere metal on surface of roots, cut in to
root shoots and dry weight was recorded. Plant samples were then acid digested (Nitric acid:
Hypochloric acid; 4:1) and analyzed for Pb concentration through AAS (Manzoor et al., 2018).
4.10.6. Statistical Analysis
Statistical analysis of data was carried out using the SPSS statistical package (version 16.0 for
Windows). All experimental data was analyzed using the one-way analysis of variance
![Page 132: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/132.jpg)
113
(ANOVA) with a 5% least significant difference (LSD test, P < 0.05) and Duncan multiple range
test.
4.11. RESULTS AND DISCUSSION
4.11.1. Isolation and Characterization of Pb Resistant Bacterial Strains
A total of 30 strains were isolated from composite soil samples collected from around battery
recycling sites in Rawalpindi and Islamabad. All strains were able to grow in LB agar
supplemented with 100 mg L-1 Pb. Among isolates 40 strains, 20%strains were resistant, 17%
had moderate resistance, whereas remaining strains were not resistant at 800 ppm of Pb
concentration. However in both agar and fermented broth, five strains (NCCP-1862, NCCP-
1857, NCCP-1851, NCCP-1848 and NCCP-1860) showed maximum Pb resistance up to 800 mg
L-1. Bacterial Pb tolerance at 800 mg L-1 Pb concentration in broth is given in figure 4.10.
The strains with good and moderate resistance were then identified, results are given in table 4.5.
Phylogenetic analysis showing close relatives is given is figure 4.11. Of these strains 38% were
Klebsiella; 23% were Pseudomonas; 15.4% were Staphylococcus; and other 23% were from
Bacillus, Mycobacterium and Sporosarcina. The resistance among these strains followed the
sequence Klebsiella quasipneumoniae. (NCCP-1862) > Klebsiella variicola (NCCP-1857) >
Pseudomonas beteli (NCCP-1845) > Microbacterium paraoxydans (NCCP-1848) > Bacillus
tequilensis (NCCP-1860) > Pseudomonas hibiscicola (NCCP-1863) > Staphylococcus
saprophyticus subsp. Bovis (NCCP-1854) > Sporosarcina newyorkensis (NCCP-1855).
![Page 133: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/133.jpg)
114
Figure 4. 10: Pb resistance of isolated bacterial strains in LB media. As/Ac indicates ratio of
absorbance in media supplemented with Pb (800 mg L-1) to that of in control (without Pb). Bars
present average of three replicates and error bars indicate standard deviation.
aa
ab ababc
bcc
c
0.7
0.8
0.9
1.0
1.1
Pb
tole
ran
ce (
As/
Ac)
Bacterial strains
![Page 134: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/134.jpg)
115
Figure 4. 11: Phylogenetic tree showing the interrelationships of isolated lead tolerant strains
along with their close relatives inferred from 16SrRNA gene sequence. The rooted tree was
constructed using the maximum likelihood method contained in the MEGA5 software. Closely
related type species were presented in bold letters and the 3% bar shows sequence divergence.
Klebsiella sp. NCCP-1857
Klebsiella sp. NCCP-1862
Klebsiella sp. NCCP-1851
Klebsiella sp. NCCP-1838
Klebsiella sp. NCCP-1840
Klebsiella variicola DSM 15968T (CP010523) Klebsiella quasipneumoniae 07A044T
(CBZR010000040)
Pseudomonas sp. NCCP-1863
Pseudomonas hibiscicola ATCC19867T (AB021405)
Pseudomonas sp. NCCP-1845
Pseudomonas beteli ATCC 19861T (AB021406)
Sporosarcina sp. NCCP-1855
Sporosarcina newyorkensis 6062T (GU994085)
Staphylococcus sp. NCCP-1858
Staphylococcus saprophyticus subsp. bovis GTC843T (AB233327)
Bacillus sp. NCCP-1860
Bacillus tequilensis KCTC13622T (AYTO01000043)
100
100
100
76
100
98
100
53
100
32
51
62
2%
![Page 135: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/135.jpg)
116
Strain ID Genus name Length of 16S
rRNA gene (nt)
Accession
Number
Closely related validly published
taxa
Similarity of
16S rRNA
(%)
No. of species >97% (>
98.2%) similarity of 16S
rRNA
NCCP-1838 Klebsiella sp. 1123 LC424405 Klebsiella variicola (CP010523) 99.29 > 25 (8)
NCCP-1840 Klebsiella sp. 1171 LC424406 Klebsiella variicola (CP010523) 99.49 > 25 (10)
NCCP-1844 Pseudomonas
sp.
1125 LC424407 Pseudomonas beteli (AB021406) 99.47 6 (4)
NCCP-1845 Pseudomonas
sp.
1125 LC424408 Pseudomonas beteli (AB021406) 99.73 9 (6)
NCCP-1848 Microbacterium
sp.
929 LC424409 Microbacterium paraoxydans NBRC
103076(T)
99.35 9 (6)
NCCP-1851 Klebsiella sp. 1117 LC424410 Klebsiella variicola (CP010523) 99.1 > 25 (9)
NCCP-1854 Staphylococcus
sp.
785 LC424411 Staphylococcus saprophyticus subsp.
bovis (AB233327)
100 > 25 (17)
NCCP-1855 Sporosarcina
sp.
1435 LC424412 Sporosarcina newyorkensis
(GU994085)
97.34 1 (1)
NCCP-1857 Klebsiella sp. 1120 LC424413 Klebsiella variicola (CP010523) 99.37 > 25 (11)
NCCP-1858 Staphylococcus
sp.
1127 LC424414 Staphylococcus saprophyticus subsp.
bovis (AB233327)
99.47 24 (7)
NCCP-1860 Bacillus sp. 1133 LC424415 Bacillus tequilensis (AYTO01000043) 99.65 20 (14)
NCCP-1862 Klebsiella sp. 1412 LC424416 Klebsiella quasipneumoniae subsp.
similipneumoniae (CBZR010000040)
98.73 > 25 (9)
NCCP-1863 Pseudomonas
sp.
1112 LC424417 Pseudomonas hibiscicola (AB021405) 99.46 12 (6)
Table 4. 5: Molecular identification of isolated lead tolerant bacterial strains based on 16S rRNA gene sequence and their accession
numbers published in DNA database.
![Page 136: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/136.jpg)
117
Klebsiella was the most frequently isolated genera in this study and have been reported repeatedly
in various studied conducted in industrial areas of Pakistan. Aslam et al. (2016) isolated and
characterized whole genome of Klebsiella quasipneumoniae subsp. similipneumoniae MB373
because of its high resistance to range of different heavy metals and antibiotics and regarded as
effective bioremediator for heavy metal contamination. Similarly Bacillus tequilensis (Sunil et
al., 2015), Pseudomonas beteli (Jackson et al., 2012) and Microbacterium paraoxydans
(Panneerselvam et al., 2013) have previously been identified for resistance against Pb and other
heavy metals. Morphological characteristics of isolated strains were compared with that of
standard species by following Bergey’s Manual of Determinative Bacteriology (Holt et al.,
1994). Briefly, 62% strains were gram negative and rod-shaped bacteria with variable color size
and appearance. The biochemical properties of tested strains indicates that 15.4, 92.3, 62.5, 84.6,
76.9, 84.6, 69.2 and 92.3% bacteria were positive for oxidase, catalase, mannitol, urease, citrate,
acid production, MacConkey agar and nitrate-reductase tests, respectively (data not shown).
4.11.2. Plant Growth Promoting Traits of Isolated Bacteria
PGP assisted phytoremediation is now becoming important area of research. Results given in
table 4.6 indicates the ability of bacteria for plant growth-promoting traits. All bacteria were
capable of producing variable concentration of IAA. In presence of L-tryptophan in the growth
medium, Microbacterium paraoxydans, Klebsiella quasipneumoniae and Klebsiella variicola
produced higher amount of IAA (92.26, 91.61 and 88.17μg mL-1, respectively). For ACC
deaminase, P solubilization and GA3 production, the highest significant activity (p<0.05) was
recorded for Microbacterium paraoxydans (260.5 nmol alphaketobutyrate mg-1 h-1),
Pseudomonas beteli (117.5 µg mL-1) and Bacillus tequilensis (1.18 µg mL-1), respectively.
![Page 137: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/137.jpg)
118
Highest siderophore production was recorded for Klebsiella quasipneumoniae (74%) followed
by Pseudomonas beteli (58%).
Different strains of Pseudomonas (Rajkumar & Freitas, 2008), Bacillus (Bal et al., 2013),
Microbacterium (Sheng et al., 2008b), Klebsiella (Farina et al., 2012), Enterobacter (Kumar et
al., 2009) have been found to have plant growth promoting activities. Among all bacteria studied
Microbacterium paraoxydans exhibited PGPR ability for all PGP assays and previously been
reported in many studies for PGPR characteristics. Microbacterium sp. was found to have IAA
production by 27.9 - 94.16 µg mL-1and ACC production by 28.5 - 961.84 mM α KB mg-1 h-1,
respectively (Sheng et al., 2008b, Bal et al., 2013). Microbacterium paraoxydans was reported
first time for phosphate solubilization (472.0 μg mL-1) by Kaur et al., (2011). Siderophore
production was also observed in Microbacterium paraoxydans by (Sheng et al., 2008b).
Table 4. 6: Plant growth promotion traits of bacterial isolates. Different letters indicate
significance difference (p<0.05) among PGP activity.
Strains
NCCP- HCN
NH
3
IAA
µg mL-1
Siderophore
production
ACC mM
αKB mg-1 h-1
P
solubilization
µg mL-1
GA3 μg
mL-1
1857 + + 88.2ab 28.7cde 86.5b 56.5cde 0.5cd
1851 - - 74.4d 24.0bcd 86.5b 42.3efg 0.5cd
1844 - + 17.6ef 58.0ab 43.8c 91.2b 0.4cd
1845 + ++ 22.8e 48.7abc 38.6c 117.5a 0.2d
1848 + + 92.3a 41.3abc 260.5a 23.9g 1.0ab
1840 + + 78.3d 44.0bcd 86.4b 37.3fg 0.3cd
1854 + + 13.1f 9.3ef 8.3d 62.2cd 0.1d
1855 + - 4.9g -- 9.8d 30.2fg --
1838 - + 85.2bc 28.7de 85.9b 45.9def 0.5cd
1858 + - 16.8ef 8.0ef 12.6d 33.8fg 0.1d
1860 + + 78.9cd 28.7abc 44.8c 23.9g 1.2a
1862 + - 91.6ab 74.0 a 86.3b 30.2fg 0.8bc
1863 + - 6.0g -- 33.3c 73.5c --
HCN= Hydrogen cyanide; NH3= Ammonia; IAA= Indole acetic acid; ACC= 1-
Aminocyclopropane-1-carboxylate deaminase; αKB = α-ketobutyrate; P= Phosphate; GA3=
Gibberellin
![Page 138: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/138.jpg)
119
Rhizospheric Klebsiella variicola have also been characterized for IAA production ability
ranging from 4.52 and 84.27 µg mL-1 (Navarro-Noya et al., 2012; Kim et al., 2017) and phosphate
solubilization by 84.01 mg L-1 (López-Ortega et al., 2013). Phosphate solubilization and
siderophores production by Klebsiella was also confirmed qualitatively by (Farina et al., 2012).
Bacillus sp. also exhibited the highest IAA production (187.93 µg mL-1) in rhizosphericaly
isolated bacteria by Bal et al., (2013). In another study, IAA and P solubilization by Pseudomonas
beteli was found to be14.35 and 147.53 µg mL-1, respectively (Ehsan et al., 2016).
4.11.3. Pb Mobilization by Resistant Bacteria
Significant increase in water soluble Pb was observed in soil inoculated with Pb resistant bacteria.
Results of selected bacteria are presented in figure 4.12. Soil inoculated with Microbacterium
paraoxydans and Klebsiella quasipneumoniae significantly (p< 0.05) improved water soluble Pb
compared to the un-inoculated. Highest significsnt increase in water soluble Pb was obtained by
inoculation of Microbacterium paraoxydans (1.9 –folds) followed by Klebsiella
quasipneumoniae (1.5 –fold) at 2000 mg Pb kg-1 soil treated.
Similar observations have been made by Sheng et al. (2008b), where Pseudomonas fluorescens
(G10) and Microbacterium paraoxydans (G-16) in solution containing insoluble salt of Pb
(PbCO3) increased water soluble Pb by 6250 and 7540 mg Pb L-1, respectively after 60 h
incubation. In soil both bacteria increased water soluble Pb from 3.3 to 5.9 –folds (strain G10)
and from 3.2 to 5.6 –folds (strain G16) compared to control. This Pb solubilizing ability of
Microbacterium paraoxydans may be attributed to the biochemical properties of strain.
Siderophores produvtion (41.33%) (table 4.6) by Microbacterium paraoxydans may account for
Pb release in soil.
![Page 139: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/139.jpg)
120
Figure 4. 12: Effect of bacterial inoculation on water soluble Pb in soil. Spiked soil at different
Pb concentrations was incubated with bacteria (0.5 OD600 nm). Mean values of three replicates
were used to compute this graph.
4.11.4. Effect of Pb Resistant Bacteria on Plant Growth
Plant growth promotion by PGPB in soil contaminated with heavy metals have been evidenced
in several studies (Sheng et al. 2008ab; Rajkumar and Freitas, 2008; He et al. 2009). In our study
the effects of Pb-resistant and solubilizing bacterial strains on dry weight of Pelargonium
hortorum and Mesembryanthemum criniflorrum are shown in table 4.7. Control plants of
Mesembryanthemum criniflorrum and Pelargonium hortorum had dry biomass of 1.21 and 2.30,
respectively. Biomass of both plants increased significantly (p <0.05) in absence and presence of
Pb in soil when inoculated with Pb resistant bacteria, compared to un-inoculated control plants.
At 2000 mg kg-1 soil Pb concentration the highest significant increase in plant biomass was
observed in increase in Microbacterium paraoxydans (NCCP 1848) inoculated plants. The
increase in biomass of Mesembryanthemum criniflorrum and Pelargonium hortorum was 1.5 and
1.6 –folds, compared to uninoculated plants at 2000 mg kg-1 soil Pb concentration. Ability to
improve plant growth and biomass under high soil Pb concentration have been found in many
0
20
40
60
80
100
500 1000 1500 2000
Wa
ter
solu
ble
Pb
co
nc.
(m
g k
g-1
)
Soil Pb conc. (mg kg-1)
Control
Klebsiella variicola
Microbacterium paraoxydans
Pseudomonas beteli
Bacillus tequilensis
Klebsiella pneumoniae subsp. Ozaenaevariicola
![Page 140: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/140.jpg)
121
heavy metal resistant bacteria. Pb-resistant endophytic bacteria Pseudomonas fluorescens and
Microbacterium sp. increased root shoot biomass of Brassica napus by 23 to 37% and 12 to 39%
in 800 mg kg-1 of soil Pb (Sheng et al., 2008b).
Table 4. 7: Effect of bacterial inoculation on plant biomass at different concentration of soil Pb.
All values are mean of three replicates. Statistical significance is given at p<0.05.
Bacterial
treatments
Biomass (g) at varying soil Pb concentrations (mg kg-1)
0 500 1000 1500 2000
Mesembryanthemum criniflorrum
Control 1.21 1.13 1.01 0.83 0.58
NCCP-1857 1.10 0.99 0.87 0.68 0.51
NCCP-1848 1.64* 1.52 1.32 1.20 0.86*
NCCP-1845 1.19 1.12 1.05 0.87 0.56
NCCP-1860 1.18 1.11 1.10 0.87 0.73
NCCP-1862 1.41 1.34 1.18 1.03 0.84
Pelargonium hortorum
Control 2.30 2.03 1.96 1.72 1.14
NCCP-1857 2.18 2.04 1.79 1.54 1.21
NCCP-1848 2.59 2.63 2.55 1.89 1.87*
NCCP-1845 2.57 1.88 1.77 1.38 0.85
NCCP-1860 2.11 1.91 1.61 1.46 0.88
NCCP-1862 2.93* 2.61 2.60 2.06 1.48
Treatment with such auxin (Kumar et al., 2009), gibberellin and siderophore (Sheng et al., 2008;
Farina et al., 2012) producing rhizobacteria promotes plant growth under Pb stress. Pseudomonas
sp. with ACC deaminase activity (Rajkumar & Freitas, 2008) have been reported to increase
Ricinus communis growth in Ni, Cu and Zn contaminated soil. The presence of specific PGP
traits suggests that these bacteria can promote plant growth by more than one mechanism.
4.11.5. Effect of Pb Resistant Bacteria on Pb Uptake
Microbially induced phytoextraction of heavy metals have been evidenced by numerous studies
(Yahaghi et al. 2018; Kim et al., 2017; Sheng et al., 2008b). To test effective contribution of
isolated strains in our study, five Pb resistant bacteria were selected on the basis of their Pb
![Page 141: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/141.jpg)
122
solubilizing ability and PGP traits for possible effects on phytoextraction of Pb by
Mesembryanthemum criniflorrum and Pelargonium hortorum. As shown in figure 4.13, both
plants differe in Pb uptake. Pelargonium hortorum uptake significantly (p <0.05) higher amount
of Pb in per plant biomass. Microbacterium paraoxydans treated Pelargonium had highest
significant uptake (1.9 –fold) followed by Klebsiella quasipneumoniae (1.8 –fold) and Klebsiella
variicola (1.3 –fold). In contrast Pelargonium inoculated with Pseudomonas beteli had uptake
less than control plants which could be due to significantly high phosphate solubilization activity
of the bacteria (117.5 µg mL-1) (table 4.6).
Figure 4. 13: Effect of bacterial inoculation on Pb uptake in M. criniflorrum and P. hortorum at
different concentration of soil Pb. Bars presents mean values of three replicates and error bars
indicate standard error. Bars with different letter are statistically significant at p<0.05.
Phosphate induce Pb immobilization is well known and could be reason for reduce Pb uptake in
Pseudomonas beteli inoculated plants. Among all strains Microbacterium paraoxydans treated
Pelargonium plants had significantly higher uptakes at all levels of soil Pb concentration. Several
other studies have also reported similar role of heavy metal resistant bacteria for enhanced
phytoextraction of Pb. Pseudomonas fluorescens and Microbacterium spp. increased total Pb
ef def
l
f-if-i
i-l
noef fg
hikl
f-i e-h
bcd
mnba
c
ij
e-h
aab
def
fg
c
fg
l
cde
d-g
j-m
oh gh gh
ij
j-m i-l
klmlmn
cde cd def
jk
e-i
h-k
abc
g-j
0
1
2
3
500 1000 1500 2000 500 1000 1500 2000
Messembry Pelargonium
Pb
up
tak
e (µ
g p
er p
lan
t b
iom
ass
)
Soil Pb conc. (mg kg-1)
ControlNCCP-1857NCCP-1848NCCP-1845NCCP-1860
gh
![Page 142: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/142.jpg)
123
uptake in shoots of Brassica napus from 4-5 and 3-5 –fold (Sheng et al., 2008b). Promising
effects of IAA and siderophores upon Pb phytoextraction have been reported in literature. It is
reported that IAA treatment increased Pb phytoextraction ability by improving over al plant
biomass. IAA have been found to improve Pb phytoextraction in Sedum alfredii Hance and Picris
divaricate by 234.7 and 37.3%, respectively, compared with control plants (Liu et al., 2007; Du
et al., 2011). Similarly siderophore producing bacteria Bacillus paralicheniformis have also been
found to increase Pb uptake in Brassica juncea by 4.6 times compared to non-inoculated plants
possibly because of improve Pb chelation and facilitating plants in uptake (Yahaghi et al., 2018).
4.12. OUTCOMES AND PERSPECTIVES
The isolated bacterial strains had substantial plant growth promotion activities and may be used
for plant growth promotion in microbial assisted phytoextraction of Pb. Water soluble Pb was
increased by inoculation of Microbacterium paraoxydans and Klebsiella quasipneumoniae. In
particular, Microbacterium paraoxydans and Klebsiella quasipneumoniae directly increased the
Pb accumulation and uptake in both plants and indirectly by stimulating the growth and biomass
of plants under highest soil Pb concentration. From previous studies we found that
Mesembryanthemum criniflorrum because of annual plant accumulates less biomass and Pb
uptake compared to Pelargonium hortorum. Therefore, further studies were performed with
Pelargonium hortorum only. The individual bacterial and fungal studies helped in identifying Pb
resistant bacteria and fungi capable of promoting Pb phytoextraction. But in natural systems both
bacteria and fungi exist together, each having its own specific adaptations and role in the soil
complex plant-soil phytoextraction sytem. There is need to develop integrated plant-bacteria-
fungi sytem with better phytoextraction efficient and adaptation to different soil types. Therefore,
![Page 143: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/143.jpg)
124
in next chapter, the selected plant, bacteria and fungi were investigatedfor Pb mobilization. Fungi
and bacteria were co-inoculated and the corresponding effects on Pb uptake were studied.
![Page 144: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/144.jpg)
125
Chapter 5
EFFECTS OF MICROBIAL CONSORTIUM ON PB UPTAKE AND
ENZYMATIC ACTIVITIES
Improving phytoremediation efficiency in Pb contaminated soil through synthetic and bio-
inoculant have extensively been studied with different success and limitations. In this study
integration of plant bacteria and fungi have been investigated for development of integrated lead
(Pb) phytoremediation. Lead resistant and plant growth promoting bacteria and fungi were first
monitored for antagonistic activity. Further the co-inoculation studies were performed to analyze
the combined effect of bacteria and fungi on soil pH and available Pb fraction for enhanced
uptake by Pelargonium hortorum along with high biomass production.
A. EFFECT OF CO-INOCULATION ON PHYTOEXTRACTION OF Pb BY
Pelargonium hortorum
5.1. INTRODUCTION
Phytoremediation of lead is a challenging task and interesting area of environmental research.
Lead being toxic and unavailable limits the efficiency of phytoremediation system (Shahid, 2011;
WHO, 2001). Different plants capable of phytoextracting more than 1000 mg Kg-1 of Pb in shoot
biomass have been reported (Gul et al., 2019; Manzoor et al., 2018; Arshad et al., 2016, 2008)
However the process takes long time for complete removal because of low availability of Pb
(<0.24%), less accumulation in above ground tissue and low biomass production (Jena et al.,
2013; Shahid, 2010; Wierzbicka et al., 2007). Different researchers have reported the ability of
soil bacteria to improve phytoremediation efficiency of hyper accumulators and non-
![Page 145: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/145.jpg)
126
accumulators of Pb by inoculating with Pb resistant bacteria (Sunil et al., 2015; Panneerselvam
et al., 2013) and fungi (Mohammadian et al., 2017; Iskandar et al., 2011). The mechanism involve
therein might be the PGPR activity of to support plant growth (Zhang et al., 2010; He et al., 2009;
Sheng et al., 2008b), elevate Pb toxicity, provide nutrients, solubilize unavailable Pb though
exudation of organic acids (Deng et al. 2011; Punamiya et al., 2010).
Interactions among soil microbes in the rhizosphere have been studied for improvement of soil
fertility, nutrients availability including nitrogen (N), phosphorus (P), potassium (K), Iron (Fe)
and many more, soil structure and physicochemical properties and very positive synergistic
effects have been observed (Bandara et al., 2017; Seneviratne et al., 2015). Co-inoculating
bacteria and fungi have been regarded as better and sustainable technique that provided highly
valuable ecosystem services including improvement in soil enzymatic activities and nutrients
minrilization and availability to plants in heavy metal contaminated soil (Seneviratne et al.,
2015). However co-inoculating bacteria and fungi for enhanced phytoextraction of Pb
contaminated soil is not addressed. Therefore, the main objectives of this study was to investigate
the effect of co-inoculation of bacteria and fungi on Pb availability in soil and integrating plant-
bacteria-fungi for combined effect on maximizing phytoremediation of Pb in soil.
5.2. MATERIALS AND METHODS
5.2.1. In Vitro Screening for Co-Inoculation of Bacteria and Fungi
Bacteria and fungi compatibility for co-inoculation was tested on agar plates using method of
(Shehata et al., 2016) with some modifications. Fungal and bacterial strains were cultured in PD
and LB broth at 25 °C for 2 days. The OD were adjusted to 0.5 by taking absorbance at 600 and
580 for bacteria and fungi respectively. About 100µL of each inocula were spread on LB and
![Page 146: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/146.jpg)
127
PDA plates respectively. After solidifying 20µL of the bacteria and fungi were cross inoculated
in the center of LB and PDA plates and incubated at 25 °C for 3 days. After with zone of
inhibition was recorded for both bacteria and fungi. The antagonistic activity of bacteria and
fungi was also studied in broth cultures. Cell free extracts of bacteria and fungi (10 µL) were
cross added in LB and PDB and pre-inoculated with loop full of bacterial and fungal spores and
incubated at 25°C and 150 rpm for 24 hours. After which bacterial and fungal growth was
recorded by taking absorbance at 600 and 580 nm through UV/Vis spectrophotometer.
5.2.2. Effect of Co-inoculation on Pb Mobility
Bacteria and fungi were cultured in LB and PDA plates and inocula (OD 0.5) were prepared in
distilled water as described before. About 0.5 mL of each inoculum were co-inoculated in pre-
autoclaved soil spiked with different levels of Pb concentrations (500, 1000, 1500 and 2000 mg
kg-1) and incubated at 28 °C for 15 days. After which plates were oven dried at 105 °C for 2
hours to stop biological activity. Finally, available fraction was determined by extracting 5 g soil
with 0.01 M CaCl2 solution (1:5; soil:extractant). Filtrate was then analyzed for Pb concentration
through AAS.
5.2.3. Effect of Co-Inoculation on Pb Accumulation and Uptake
Pot culture experiment was conducted in control conditions to investigate the effect of co-
inoculating Pb mobilizing bacterial and fungal strains on Pb accumulation by Pelargonium
hortorum. Soil was prepared and artificially spiked at different Pb concentration levels (500,
1000, 1500 and 2000 mg kg-1) as describe in chapter 4. Uniform and 2 months old seeding’s with
4-5 leaved each plant were selected and transplanted in pot containing 1 kg of spiked soil. After
1 week of acclimatization 5 mL of each bacterial and fungal inoculum (OD adjusted to 0.5 in
![Page 147: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/147.jpg)
128
distilled water) were co-inoculated to plants. Plants were then allowed to grow for 4 months. The
plants were placed green house with 16-8 hour and 25-20 °C day-night regime. The pots were
watered daily with distilled water to maintain moisture content at 65–70% of water-holding
capacity with great care to avoid heavy-metal seepage from the pots.
5.2.4. Harvesting and Plant Analysis
After the length of exposure, plants were harvested and washed under tap water to remove soil.
Great care was taken to minimize root damage during harvesting and washing. Roots were then
dipped in 0.1 N HCL to remove adsorbed Pb on root cell walls. Immediate after washing plants
were dived in root and shoot and fresh biomass was taken. Plants were then placed in oven for
drying at 65 °C for 2 days. After complete dry, root shoot samples were grounded to powder
form and digested with digested with HNO3/HClO4 (4:1) mixture. Clear aliquots obtained were
diluted to 50 mL and used for determination of Pb content through AAS. Pb concentration data
was then used to calculate Pb uptake and other attributes.
5.3. RESULTS AND DISCUSSION
5.3.1. Compatibility for Co-inoculation of Bacteria and Fungi
Results from compatibility testing express as zone of inhibition are given in figure 5.1(a,b). It
was observer that more antibacterial effect of fungi was noticed compared to antifungal activity
expressed by tested bacterial strains. Figure 5.1(a) clearly indicates higher antibacterial activity
imposed by Mucor spp. on tested bacteria compared to A. flavus.
![Page 148: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/148.jpg)
129
Figure 5. 1: Comparative analysis of antibacterial and antifungal activity of tested bacteria and
fungi; zone of inhibition against fungi and bacteria (a,b). Af, M, Kv, Mp and Kq corresponds to
A. flavus, Mucor spp., K. variicola, M. paraoxydans and K. quasipneumoniae, respectively.
Results with significant difference at p<0.05 are denoted by different letters.
In presence of Mucor spp. greater zone of inhibition was observed for K. quasipneumoniae
followed by K. variicola and lesser antibacterial effect was observed on M. paraoxydans. Similar
pattern with much lesser effect on zone inhibition was observed in case of A. flavus. Whereas no
significant (p<0.05) difference among bacterial strains was observed for antifungal activity
towards A. flavus and Mucor spp. The reduced bacterial growth in presence of Mucor spp. is in
agreement with the antibacterial effect of Mucor spp. reported in literature (Aziz et al., 2016;
Etcheverry et al., 2009). In a study, silver nanoparticles treated with extracts from Mucor hiemalis
significantly increased the antimicrobial characteristics of nanoparticles against Klebsiella
pneumoniae, Pseudomonas brassicacearum, Aeromonas hydrophila, Escherichia coli, Bacillus
cereus, and Staphylococcus aureus (Aziz et al., 2016). In another study antifungal activity of
Microbacterium oleovorans DMS 16091 was investigated on 3% maize meal extract agar against
two strains of A. flavus (MPVPA 2092, 2094) and three strains of F. verticillioides MPVPA (285,
a
b
a
ab
b
a
0
5
10
15
20
Kv Mp Kq
Zon
e of
inh
ibit
ion
(m
m)
Bacterial strains
Af
M
a aa aa a
0
5
10
15
Af M
Zo
ne
of
inh
ibit
ion
(m
m)
Fungal strains
KvMpKq
(b) (a)
![Page 149: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/149.jpg)
130
289, and 294). Results indicated minimal antifungal activity of Microbacterium oleovorans
(Etcheverry et al., 2009).
5.3.2. Effect of Co-Inoculation on Soil Pb Mobility and Soil pH
The results of bioavailable Pb in co-inoculated soil with bacteria and fungi are presented in figure
5.2. Increase in available Pb was observed in all microbial interaction with least effect in soil
containing co-cultures of Mucor spp.+K. variicola. Highest significant increase in extractable Pb
fraction was observed when soil was co-inoculated with A. flavus+M. paraoxydans at all levels
of soil Pb concentrations. The increase in Pb availability was found to be 5 times more compared
to control soil (un-inoculated soil) at 2000 mg Pb kg-1 soil concentration. Much higher effect was
noticed in soil when bacteria were inoculated in combination with A. flavus compared to Mucor
spp.
Figure 5. 2: Effect of co-inoculation on extractable Pb. Bars indicates mean of three replicates.
Significant (p<0.05) difference among bacterial interactions are express by different letters.
o
k-n
h-k h-k
mno
j-mk-n
no
h-k
cd
d-g
k-n
efg
g-j
lmn
ghi
b
c
i-l
cde c-f
k-n
c
a
b
fgh
cd
d-g
0
40
80
120
160
Control Kv Mp Kq Kv Mp Kq
Af M
[Pb
] m
g k
g-1
Microbial strains
500 1000 1500 2000 mg Pb/kg soil
![Page 150: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/150.jpg)
131
In case of Mucor spp. higher significant Pb solubilization was noticed when Mucor spp. was
inoculated along with M. paraoxydans. The increase in available Pb was found to be 3 –folds
compared to control soil at 2000 mg Pb kg-1 soil concentration. A 2 –folds increase in Pb
availability was observed in A. flavus + M. paraoxydans compared to Mucor spp. + M.
paraoxydans. The reason could be the antibacterial property of Mucor spp. towards M.
paraoxydans. It is could be possible that Mucor spp. limited bacterial growth as expressed by
zone inhibition assay (figure 5.1a) and reduced the overall functional ability of bacteria to
solubilize Pb.
Figure 5. 3: Effect of co-inoculation on soil pH; A. flavus co-inoculations with bacteria (a),
Mucor spp. co-inoculation with bacteria (b). Graph is plotted by mean values of three
replicates.
6.4
6.8
7.2
7.6
0 500 1000 1500 2000
pH
[Pb] soil (mg kg-1)
ControlKv+AfMp+AfKq+Af
6.4
6.8
7.2
7.6
0 500 1000 1500 2000
pH
[Pb] soil (mg kg-1)
ControlKv+MMp+MKq+M
(a) (b)
![Page 151: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/151.jpg)
132
Change in pH induced by co-inoculation in soil after 15 days incubation is demonstrated in figure
5.3(a,b). The pH results were consistent with pH availability indicating that pH reduction was
the main factor that controls the Pb solubilization in inoculated soil. In control soil pH was
slightly decreased (from pH 7.4 to pH 7.0) by -0.4 pH units upon addition of Pb from 0 to 2000
mg kg-1. In inoculated soil the pH was decreased by all microbial inoculation at all levels of soil
Pb concentrations with higher decreased observed in soil containing A. flavus + M. paraoxydans
(figure 5.3a). The lowest soil pH (6.8) was observed at 2000 mg Pb kg-1 soil A. flavus + M.
paraoxydans. The acidity developed by individual fungi in their mono-inoculation was
marginally increased when co-inoculated (figure 5.3a,b). No significant effect on pH change
was observed in case of Mucor spp. Only small change in pH (-0.2 pH units) was observed in
Mucor spp. + M. paraoxydans application. Which shows the ability of M. paraoxydans to
decrease soil pH probably due to high tolerance of this strain to Pb and lowest antagonistic
activity with both fungi which contributed towards growth and proliferation of bacteria and
production of extracellular organic acids that lower the pH of soil medium.
5.3.3. Plant Biomass and Pb Accumulation
Plant biomass was significantly improved in all microbial treatments, results are given in table
5.1. A general decrease in biomass was observed in all inoculated and control plants upon
increasing soil Pb concentration. In control soil, plant biomass was significantly decreased (from
2.0 to 1.0 g) by 2 –folds as Pb concentration was increased from 0 to 2000 mg Pb kg-1 soil. Higher
biomass was observed in plants when Mucor spp. was co-inoculated with bacteria compared to
A. flavus. The increase in biomass was 1.2 to 1.9 –folds and 1.1 to 1.6 –folds with Mucor spp.
and A. flavus when inoculated along with bacteria in Pb spiked soil (0-2000 mg kg-1). Highest
significant (p<0.05) increase in plant biomass by was observed in control soil (without Pb
![Page 152: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/152.jpg)
133
addition) co-inoculated with Mucor spp. + M. paraoxydans (M+Mp) with no significant decrease
up to 1000 mg Pb kg-1 soil concentration. Upon further increase in Pb contentration to 1500 and
2000 mg Pb kg-1 soil, a decrease by 1.2 and 1.3 –fold was observed, compared to M+Mp
inoculated plants in control soil. But still at highest level of soil Pb concentration (2000 mg kg-
1), M+Mp inoculated plants gained 2.3 –folds higher biomass compared to un-inoculated plants
at same level of Pb concentration.
Similar trend was observed in case of A. flavus + bacteria co-inoculated plants, with highest
biomass achieved in A. flavus + M. paraoxydans (Af+Mp) inoculated plants at all levels of soil
Pb concentrations. Af+Mp inoculated plants had 1.2 1.2, 1.1, 1.2 and 1.2 –folds less biomass at
0, 500, 1000, 1500 and 2000 mg Pb kg-1 soil compared to M+Mp inoculated plants. This indicated
higher plant growth promoting ability of Mucor spp. compared to A. flavus. Moreover the plant
growth potential was improved in the presence of M. paraoxydans. In individual studies
(Manzoor et al., 2018b) and results obtained in chapter 5 both Mucor spp. and M. paraoxydans
increased the root biomass by 1.4 and 2.0 –folds and shoot biomass by 1.5 and 1.6 –folds in
Pelargonium hortorum at 2000 mg Pb kg-1 soil concentration. This could be attributed to high
Pb tolerance of Mucor spp. (up to 1000 mg L-1) and M. paraoxydans (up to 800 mg L-1) and plant
growth promoting characteristics (IAA, GA3 and siderophopre production) (table 4.1 and 4.6).
Lead uptakes in Pelargonium hortorum at different levels of soil Pb concentration upon co-
inoculation of fungi and bacteria are given in figure 5.4. Results indicates that higher per plant
uptake was achieved in plants inoculated with Af+Mp followed by M+Mp at all levels of soil Pb
concentrations. Plants with Af+Mp had uptake values of 2.6-3.1 mg plant-1 at different soil Pb
concentrations. The Pb uptake was 1.9, 2.4, 2.7 and 4.8 folds higher in Af+Mp inoculated plants
compared to control at 500, 1000, 1500 and 2000 mg Pb kg-1 soil concentrations. In case of
![Page 153: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/153.jpg)
134
Mucor spp., higher significant (p<0.05) per plant uptake was found when Mucor spp. was co-
inoculated with M. paraoxydans compared to K. variicola and K. quasipneumoniae and control
plants at all levels of soil Pb concentrations. Both these interactions have higher significant per
plant uptake. The Af+Mp inoculation have significantly improve Pb availability and subsequent
accumulation in root and shoot. Which is possible owing to production of low molecular weight
organic acids (NLMWOA) such as maleic, tartaric, glutamic, acetic, lactic, succinic, citric and
gluconic acids by A. flavus have been reported (Max et al., 2010). Usha & Padmavathi, (2013)
also indicated higher siderophopre production ability of A. flavus that might have improved the
Pb dissolution and availability and consequent plant uptake.
Table 5. 1: Total plant biomass (g) co-inoculated with bacteria and fungi at different levels of
soil Pb concentration. Values given are mean of three replicates. Letters indicated significant
different at p value < 0.05.
Microbial co-
inoculation
Pb conc. in soil (mg kg-1)
0 500 1000 1500 2000
Control 2.0h-k 1.9i-m 1.5mn 1.4n 1.0o
Af+Kv 2.1f-i 2.0h-l 1.9i-l 1.7j-n 1.4n
Af+Mp 2.5b-e 2.4c-f 2.5c-f 2.2f-i 2.0h-l
Af+Kq 2.3d-h 2.2d-i 2.3d-h 2.1g-k 1.6lmn
M+Kv 2.4d-g 2.3d-h 2.2f-i 2.0h-l 1.6k-n
M+Mp 3.0a* 2.8ab 2.8abc 2.5bcd 2.3d-g
M+Kq 2.8abc 2.5bcd 2.3d-h 2.2e-i 1.9h-l
Munawar & Iram (2014) also observed 30-35% dissolution of Pb after 24 hours incubation in
heavy metal contaminated soil collected from Multan, Pakistan. Similar Pb chelation by
Microbacterium paraoxydans have been reported by Sheng et al. (2008b), where Microbacterium
paraoxydans-G-16 strain increased water soluble Pb by 7540 mg Pb L-1 after 60 h incubation in
![Page 154: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/154.jpg)
135
liquid growth medium containing insoluble salt of Pb (PbCO3). The bacterial strain also increased
water soluble Pb from 3.2- to 5.6 –folds compared to control. Both strains A. flavus and M.
paraoxydans also showed no growth retardation and antagonistic activity as determined in this
study (figure 5.1). Whereas Mucor spp. and M. paraoxydans have been observe to produce
significant amount (203 and 92.26 μg mL-1, respectively) of indole acetic acid (IAA) (table 4.1
& 4.6) that improves plant growth, metabolism and contributes to Pb detoxification mechanisms
in plants (Hac-Wydro et al., 2016). Microbacterium sp. was found to have IAA production by
27.9 and 94.2 µg mL-1 and ACC production by 28.5 and 961.84 mM α KB mg-1 h-1, respectively
(Sheng et al., 2008, Bal et al., 2013). Siderophore production was also observed in
Microbacterium paraoxydans by (Sheng et al., 2008b). Therefore, it is possible that the M+Mp
inoculation improve plant biomass (table 5.1) that ultimately improved per plant Pb uptake.
Which could be due to lesser antagonistic activity as observed in figure (5.1) and PGPR activity
of both strains.
Figure 5. 4: Effect of co-inoculation on Pb uptake per plant. Graph is plotted by taking mean
values of three replicates. Bars bearing different letters are significantly differ at p<0.05.
ij
f-i
b-e
e-h
g-j
a-d
c-f
ij
g-i
a
a-d
hij
abc
d-g
j
e-h
ab
a-d
1.6hij
abc
e-h
k
ij
abc
e-h
hij
a-d
e-h
0.0
1.0
2.0
3.0
4.0
Control Kv Mp Kq Kv Mp Kq
Af M
Pb
up
tak
e (m
g p
lan
t-1)
Microbial interactions
500 1000 1500 2000 mg kg-1
![Page 155: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/155.jpg)
136
5.4. OUTCOMES AND PERSPECTIVES
In this study fungi and bacteria, selected from preceding experiments, were tested for co-
inoculation and their effect on Pb bioavailable fraction in soil and uptake by plant. Compatibility
of co-inoculation was observed by investigating zone of inhibition and growth retardation in
presence of cell extracts. Results showed antibacterial activity of Mucor spp. against K.
quasipneumoniae followed by K. variicola. Synergistic effect of A. flavus and M. paraoxydans
was noticed for Pb solubilization and accumulation in root shoot of Pelargonium hortorum,
whereas as plant biomass was significantly improved with co-inoculated with Mucor spp. and M.
paraoxydans. Highest and significant per plant Pb uptake was noticed for both of these
inoculations when compared to single inoculations and control plants. Our results suggested that
in Pb-contaminated soil, Pelargonium hortorum inoculated with A. flavus + M. paraoxydans and
Mucor spp. + M. paraoxydans have greater potential to remediate Pb contaminated soil.
The study concluded the improvements in phytoextraction effecienct of Pb by P. hortorum when
bacteria and fungi were co-inoculated. There is still need to understand the microbial interaction
for soil enzymatic activity that could further help in understanding the microbial interaction soil
plant system for Pb uptake. In this regard, effect of bacteria and fungi on soil enzymatic activities
were studied in detail and presented in next section.
![Page 156: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/156.jpg)
137
B. EFFECTS OF BIOINOCULANTS ON SOIL ENZYMATIC ACTIVITIES IN Pb
CONTAMINATED SOIL
Soil enzymes are important indicators of soil environmental quality. The focus of current study
was to evaluate the soil enzymatic activities inhibition at different levels of Pb contamination and
restoration by introducing Pb resistant bacteria.
5.5. BACKGROUND
Soil is fundamental and irreplaceable resource governing important biogeochemical cycles and
nutrients turnover for terrestrial plants productivity (Alef & Nannipieri, 1995). Soil microbiota
play an important role in sustaining soil health and fertility by secreting extracellular enzymes
that facilitates different reactions and metabolic processes by acting as biological catalysts. These
enzymes are of great agronomic significance, the important ecological processes mediated by
extracellular enzymes include decomposition, modifying organic carbon pool and mineralization
of N, P, K (Zaveri et al., 2016). Soil enzymes are extremely sensitive to external environmental
cues than other variables and are considered as potential indicator of soil quality and biological
changes, thereafter (Jodaugienė et al., 2010; Paz-Ferreiro et al., 2010). Any change in microbial
community diversity due to biotic or abiotic factors is directly reflected by change in soil
microbial and enzymatic activities (Dick et al., 1996). Therefore, enzymatic activities are
frequently used for determining the influence of various pollutants including heavy metals on
soil productivity (Shen et al., 2005). Lead is one of the most significant and ubiquities toxic heavy
metal. The natural concentration of Pb in normal agricultural soils ranges from 10 to 100 mg kg-
1 (Soon & Abboud, 1993) with direct or indirect flux of Pb through anthropogenic activities. Pb
is regarded as a chemical of great concern in the new European REACH regulations (EC
![Page 157: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/157.jpg)
138
1907/2006; Registration, Evaluation, Authorization and Restriction of Chemicals). The elevated
level of Pb in soil may adversely affect soil biological properties by disturbing soil microbial
community, structure and diversity (Sardar et al., 2007). Increased Pb concentration in soil
inhibits enzymatic activities by interfering with normal biochemical properties of soil, shifting
microbial population and diversity (Moreno et al., 2002), denaturing the enzymes and protein by
interacting and blocking the active sites (Megharaj et al., 2003). Soil Pb exposure causes decrease
in total microbial count, microbial biomass carbon, soil dehydrogenase activity (Zaveri et al.,
2016; Khan et al., 2007; Jin-Yan et al., 2014), soil respiration, phosphatase, urease (Zaveri et al.,
2016; Khan et al., 2007) and related enzyme activities. Although a number of studies have
quantified the detrimental effect of Pb on soil enzymatic activities, yet all studies were focused
on lower levels of Pb in soil and no remediation techniques were employed to restore the negative
impacts by applying bio inoculants. Hence this study was undertaken to understand the extents
of enzyme inhibition at different application rates of Pb in soil along with application of Pb
resistant bacteria for reviving the enzymatic function of Pb contaminated soil.
5.6. MATERIALS AND METHODS
5.6.1. Soil Characterization
Soil (0-15 cm) were collected from vicinity of National University of Science and Technology.
Soil was air dried, crushed in ball mill and sieved to achieve 2 mm particle size prior to use.
Prepared soil was then characterized for physiochemical properties (table 4.9) using standard
laboratory procedures.
![Page 158: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/158.jpg)
139
5.6.2. Pb Resistant Bacteria
Three Pb resistant bacteria (tolerant up to 800 mg L-1 Pb) were obtained from Environmental
Biotechnology Laboratory, NUST, Pakistan. These strains were isolated from Pb contaminated
soil.
5.6.3. Experimental Design
Soil incubations experiment was performed for studying effect of increasing soil Pb
concentration on soil enzymatic activities. Uncontaminated soil obtained was artificially spiked
with four different levels of Pb (500, 1000, 1500 and 2000 mg kg-1). These levels were chosen
based on Pb contamination reported in contaminated soil around battery recycling sites in
Pakistan. Pb was added as solution of Pb(NO3)2. In total 20 treatments were placed in a
randomized complete block design with tri-replicates. Inocula were prepared as described in
section I and II. For co inoculation, 0.5 mL of each bacterial and fungal spore suspension (OD
set at 0.5) prepared in distilled water was added in petriplates containing pre-autoclaved and dried
soil (105 °C for 2 hours) after cooling. Moisture continent was maintained with sterile distilled
water at 60 % of soil saturation percentage. All work was done in laminar flow hood with greater
care in order to minimize contamination. Plates were then incubated at 28°C for 15 days and
analyzed for soil enzymatic activities and Pb availability as influenced by microbial inoculations.
Soil without Pb and bacterial/fungal strains were kept as control. Soil was jar filled and incubated
for four weeks at room temperature. Soil samples were collected after 1, 2, 3 and 4 weeks and
stored at -80 until analysis of soil enzymes.
![Page 159: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/159.jpg)
140
5.6.4. Soil Enzymatic Assays
Soil enzymatic activities were measured with incubated soil samples. In order to simulate the
field conditions, enzyme assays were performed in un-buffered extracts solutions. Soil
respiration was determined by the amount of alkali (1 N NaOH) neutralization by CO2 evolved
in air tight jar (Ano et al., 2012). Microbial biomass carbon was estimated by rapid chloroform
fumigation extraction method (Witt et al., 2000). Soil dehydrogenase activity was estimated by
measuring the reduction of triphenyl tetrazolium chloride (TTC) to triphenyl formazan (TPF) and
expressed as mg TPF g-1 h-1 (Tan et al., 2017). Alkaline phosphatase (ALP) activity was analyzed
by photometric measurement of p-nitrophenyl phosphate in filtrate at 400 nm (Specord 200 plus
UV-VIS Spectrophotmeter, Analytikjena, Germany) (Tabatabai & Bremner, 1969). Urease
activity was determined by incubating soil with 10% urea solution and citric acid buffer (pH 6.7)
at 37 °C for 24 hours (Sebiomo et al., 2017). The intensity of blue color produced was estimated
by taking absorbance at 578 nm (Leilei et al., 2012). Catalase activity was determined by
following method of Burns (1978) and expressed as mL KMnO4 g-1 h-1. Soil IAA was estimated
by method of Sarwar et al. (1992).
5.6.5. Statistical Analysis
All treatments were statistically analysed using SPSS 16 computer software. Difference among
means of treatments was determined using analysis of variance (ANOVA) and duncan multiple
range test with a significance level of p<0.05.
![Page 160: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/160.jpg)
141
5.7. RESULTS AND DISCUSSION
5.7.1. Soil Characterization
Physicochemical analysis of soil is presented in table 5.2. The results shows that the soil used in
experiment had slightly alkaline pH (7.81). Soil pH can effect soil enzymatic activities by
regulating or inhibiting enzyme activators and inhibitors by modifying soil chemical
environment, substrate concentrations and functional groups (Dick et al., 2000).
Table 5. 2: Physico-chemical characteristics of soil. Values are mean of three replicates.
Soil texture was clay loam and organic matter content of 0.47%. Generally positive influence of
OM on extracellular enzymes have been found (Katsalirou et al., 2010). Considerable amount of
nutrients were present that may influence and/or regulate various soil enzymatic activities in soil.
The total Pb concentration in soil was 2.33 mg kg-1.
5.7.2. Effect of Increasing Pb Concentrations on Soil Enzymatic Activities
Lower enzyme activities were detected in all Pb amended samples than in control (figure 5.5).
Mean values of all enzyme activities decreased with increasing Pb dose and incubation time in
Physico chemical parameters Values
Soil pH 7.81
EC (dS m-1
) 0.45
Texture Clay loam
Organic matter content (carbon %) 0.47
Total nitrogen (%) 0.04
Total phosphorus (mg kg-1
) 6.08
Potassium (mg kg-1
) 687
Magnesium (mg kg-1
) 298
Pb (mg kg-1
) 2.33
![Page 161: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/161.jpg)
142
soil compared to control. A relatively higher decline was observed in soil respiration and DEH
activity by 2.8 and 2.5–folds, respectively at 2000 mg Pb kg-1 soil after 4 weeks of Pb exposure.
Figure 5. 5: Inhibitory effects of Pb on soil enzymatic activities during different time intervals.
(a) soil respiration; (b) microbial biomass; (c) dehydrogenase activity; (d) catalase activity; (e)
urease activity; (f) alkaline phosphatase activity. The error bars indicate standard error.
Soil respiration was significantly declined at all Pb levels and sampling intervals. The highest
decline was observed in soil treated with 2000 mg Pb kg-1 soil and no significant change in soil
respiration was observed with increase in incubation period depicting toxic concentration of Pb
that limits soil respiration. Microbial biomass carbon was affected by 500 mg Pb kg-1 soil even
after 4 weeks incubation whereas significant decrease was observed at 1000, 1500 and 2000 mg
Pb kg-1 soil at after two weeks of incubation by 1.2, 1.2 and 1.4–folds, respectively. Means values
of DEH activities were decreased sharply at each Pb treatment and sampling interval compared
to the control soil. Similar decrease in CAT activity was observed. DEH activity decreased 1.2,
0
100
200
300
400
500
600
0 1 2 3 4
CO
2-C
(m
g k
g-1
so
il)
Time (Weeks)
0 500 1000 1500 2000 mg/kg
0
0.1
0.2
0.3
0.4
0.5
0 1 2 3 4
DE
H (
mg
TP
E k
g-1
h-1
)
Time (Weeks)
0 500 1000 1500 2000 mg/kg
0
100
200
300
400
0 1 2 3 4
Mic
ro
bia
l b
iom
as
s (
µg
C g
-1
so
il)
Time (weeks)
0 500 1000 1500 2000 mg/kg
0
0.2
0.4
0.6
0.8
1
0 1 2 3 4
Urea
se
(µ
g N
H4-N
g-1
h-1
)
Time (weeks)
0 500 1000 1500 2000 mg/kg
0
2
4
6
0 1 2 3 4
AL
P (
mg
p-n
itro
ph
en
ol g
-1 h
-1
)
Time (weeks)
0 500 1000 1500 2000 mg/kg
0
1
2
3
4
5
0 1 2 3 4
CA
T (
KM
NO
4g
-1h
-1)
Time (weeks)
0 500 1000 1500 2000 mg/kg
(a) (b) (c)
(d) (e) (f)
![Page 162: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/162.jpg)
143
1.4, 1.7 and 2.5–folds in soil treated with 500, 1000, 1500 and 2000 mg Pb kg-1, respectively.
Compared to control soil, the decline in urease activity was observed in all Pb treated soil till 3rd
week of incubation, after which no significant decline was noticed. Like CAT, microbial biomass
and urease, the ALP activity was slightly affected by 500 and 1000 mg Pb kg-1 soil up to 3 weeks.
However, by further increasing incubation period, ALP activity at 500, 1000, 1500 and 2000 mg
Pb kg-1 soil was decreased by 1.1, 1.2, 1.3 and 1.5–folds compared to 0 week. It is well
documented that the Pb reacts thiol groups of enzymes and generates mercaptides that inhibit and
inactivate the enzymatic activities (Sarwar et al., 1992). Different studies (Khan et al., 2007; Jin-
Yan et al., 2014; Tan et al., 2017) have reported that Pb may significantly inhibit soil urease
activity, FDA hydrolysis and reduce the number of microorganisms that produce enzymes.
5.7.3. Correlation Analysis
Table 5.3 shows the Pearson’s correlation coefficients between all enzyme activities and Pb
concentrations in soil. Between all enzymes, significantly (p<0.01) positive correlation was
observed except respiration and ALP, where weak insignificant (p>0.05) negative correlation
was observed with increasing Pb concentration in soil.
Table 5. 3: Correlation among and between soil enzymes and Pb concentration in soil.
**,*. Correlation is significant at the 0.01 and 0.05 level (2-tailed).
Pb Res DEH MB CAT Urease ALP IAA
Pb 1 -.702** -.498* -.741** -.627** -.582** -.522** -.767**
Res -.702** 1 0.011 0.291 0.096 0.089 -0.015 0.365
DEH -.498* 0.011 1 .919** .974** .980** .985** .906**
MB -.741** 0.291 .919** 1 .939** .922** .935** .971**
CAT -.627** 0.096 .974** .939** 1 .987** .964** .935**
Urease -.582** 0.089 .980** .922** .987** 1 .966** .926**
ALP -.522** -0.015 .985** .935** .964** .966** 1 .900**
IAA -.767** 0.365 .906** .971** .935** .926** .900** 1
![Page 163: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/163.jpg)
144
Negative correlation was observed for all enzyme activities with increasing soil Pb
concentrations. Most significant negative correlation (p<0.001) was observed for soil respiration,
microbial biomass, CAT, urease, ALP and IAA in response to increasing Pb concentration in
soil. DEH also showed significant (p<0.05) negative correlation with increasing Pb
concentration.
5.7.4. Microbial Biomass and Respiration
Effect of bio-inoculants on soil microbial growth was quantified by determining soil respiration
(RES) and microbial biomass (MB) at different soil Pb concentrations (table 5.4). It was observed
that significant decrease in both parameters were observed when soil was subjected to elevated
Pb concentration. No significant decrease in soil respiration was observed up to 1500 mg Pb kg-
1 after which significant decrease in soil respiration by 1.6 –folds was observed at 2000 mg Pb
kg-1 soil, compared to control soil (without Pb addition).
All bacterial strains had positive influence on soil respiration activity. Particularly, Kq (K.
quasipneumoniae) was most significant (p<0.05) in improving soil respiration at all Pb levels
(table 5.4). Addition of fungi significantly improved soil respiration. Both A. flavus (Af) and
Mucor spp. (M) improved soil respiration at all soil Pb concentration compared to un-inoculated
soil. At 2000 mg Pb kg-1, soil the increase in soil respiration was 1.8 and 1.5 –folds upon A. flavus
and Mucor spp. inoculations. Interestingly, soil respiration was substantially increased when
fungi was co-inoculated with bacteria. With higher significant (p<0.05) effect on soil respiration
was observed in A. flavus and M. paraoxydans (Af+Mp) co-inoculation.
![Page 164: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/164.jpg)
145
Table 5. 4: Effect of bio-inoculation on soil microbial activity in Pb contaminated soil.
Microbial
indicators
Pb conc.
(mg kg-1
)
Bio-inoculants
C Af M Kv Mp Kq Af+Kv Af+Mp Af+Kq M+Kv M+Mp M+Kq
RES 0 165c-h
202bd
198de
272c
330a
348a
216d
215d
210de
194ef
211cd
185c-h
500 168a-h
213b-g
194cd
263c
301ab
356a
211d-e
216d
207de
192de
211abc
179c-e
1000 161e-h
197cde
179dh
274bc
294bc
329ab
203de
215de
199def
176d-h
206d
166d-h
1500 148h
201cd
163d-h
245cd
284bc
312bc
204de
211d
193def
161e-h
205ab
160e-h
2000 104i
190d-g
155fgh
212d
246c
330ab
195de
208dc
190d-g
150h
203de
152gh
MB 0 241ab
240abc
235a-d
227c-f
237b-e
251ab
246ab
253a
246ab
230a-f
244ab
233a-e
500 221a-h
238a-d
223a-g
218d-h
223b-g
242ab
242ab
249ab
242ab
221a-h
238a-d
222a-g
1000 197c-h
223a-g
211a-h
191c-h
229c-h
232a-e
239a-d
246ab
231a-f
210a-h
239a-d
210a-h
1500 185g-h
212a-h
213a-h
216efg
223c-h
221a-g
220a-h
239a-d
224a-g
209a-h
235a-d
209a-h
2000 178h
208b-h
187f-h
197c-h
217d-h
230b-f
211a-h
226a-g
213a-h
195d-h
224a-g
190e-h
![Page 165: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/165.jpg)
146
Highest significant (p<0.05) increase in soil respiration by A. flavus and M. paraoxydans was
1.3, 1.3, 1.3, 1.4 and 2.0 –folds compared to un-inoculated soil at 0, 500, 1000, 1500 and 2000
mg Pb kg-1 soil. Compared to single inoculation of A. flavus, in co-inoculation the respiration
was improved by 1.1 –folds at all soil Pb concentrations.
Similarly, microbial biomass was also negatively affected with increasing concentration of Pb in
soil (table 5.4). Microbial biomass in control soil (no Pb added) was (241±7 µg C g-1 soil) and did
not significantly decrease up to 500 mg Pb kg-1 soil. However with further increase in soil Pb
concentration, the significant decrease by 1.1, 1.2 and 1.4 –folds was observed in 1000, 1500 and
2000 mg Pb kg-1 soil. Like soil respiration, similar trend was obtained in case of microbial biomass.
No significant decrease in microbial biomass was noticed in soil treated with Kq (K.
quasipneumoniae) and Kv (K. variicola) at all soil Pb concentrations. In case of fungi, soil
microbial biomass by improved by 1.2 and 1.1 –folds (by A. flavus and Mucor spp., respectivesly)
at 2000 mg kg-1 soil Pb concentration. Compared to single inoculation, co-inoculation with bacteria
significantly improved microbial biomass at all soil Pb concentrations and no significant (p<0.05)
decrease in microbial biomass was observed with increasing concentrations of Pb in soil (0-2000
mg kg-1). Co-inoculating A. flavus and Mucor spp. with M. paraoxydans significantly (p<0.05)
improve microbial biomass by 1.3 –folds compared to un-inoculated soil at 2000 mg kg-1 soil Pb
concentration. This indicated strong positive interaction among A. flavus and M. paraoxydans for
growth enhancement and biological activity. Both strains also did not show any antagonistic
activity as determined in figure 5.1.
![Page 166: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/166.jpg)
147
5.7.5. Soil Enzymatic Activities
Soil enzymes are extremely sensitive and one of most important indicator to monitor soil health as
affected by heavy metal contamination (Jaiswal & Pandey, 2018). Among all enzymes in soil
including oxidoreductases, hydrolases, isomerases, lyases and ligases. The dehydrogenases are the
major representative of oxidoreductases tightly linked with microbial redox reaction involving
decomposition of organic matter (Moeskops et al., 2010). Therefore, used as indicator of overall
soil microbial and enzymatic activities in soil. Results indicated decreased DEH activity upon
increasing soil Pb concentration from 500 to 2000 mg Pb kg-1 soil (table 5.5). At 500 mg Pb kg-1
soil, no significant decrease in DEH activity was observed, but upon further increase in soil Pb
concentration to 1000, 1500 and 2000 mg kg-1, the significant (p<0.05) decrease in DEH by 1.2,
1.3 and 1.7 –folds was observed in control soil (un-inoculated). However, the DEH activity was
signinificantly (p<0.05) improved by microbial treatment (table 5.5). In Mucor spp. and K.
quasipneumoniae inoculated soils, the DEH activity remained constant in all Pb amended soil and
no significant decrease in enzyme activity was observed with increasing soil Pb concentrations. At
2000 mg kg-1 Pb significant increase in DEH activity by 1.7 and 1.6 –folds was observed in K.
quasipneumoniae and Mucor spp. inoculated soils, compared to control soil (un-inoculated soil
containing Pb). However, unlike soil respiration and microbial biomass when Mucor spp. was co-
inoculated with K. variicola (M+Kv), no significant improvement in DEH activity was observed
compared to bacterial and fungal strains alone.
Soil urease (URE) activity also plays important role in maintaining soil fertility and nutrients
availability and like DEH, urease activity was also negatively affected with increasing soil Pb
concentrations (table 4.12). In control soil (no Pb and un-inoculated) the urease activity was
0.80±0.01 µg NH4-N g-1 h-1 and did not change with addition of 500 mg Pb kg-1 soil. However
![Page 167: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/167.jpg)
148
with further increase in soil Pb concentration to 1000, 1500 and 2000 mg kg-1, significant (p<0.05)
decrease in urease activity by 1.2, 1.4 and 1.9 –folds was observed. Results from fungal inoculated
showed no change in urease activity across all Pb concentration indicating no effect on soil urease
activity. However, bacterial inoculation significantly improved soil urease activity at all levels of
soil Pb concentrations. Amoung three bacterial treatments, M. paraoxydans (Mp) signifinatly
improved soil urease activity by 1.6–folds at 2000 mg kg-1 soil Pb concentration. In case of co-
inoculation, the urease activity was reduced when A. flavus and Mucor spp. were inoculated along
with M. paraoxydans (Mp). Higher significant urease activity of 0.87±0.01 µg NH4-N g-1 h-1 was
observed in control soil (with no Pb) when co-inoculated with A. flavus and K. variicola (Af+Kv)
followed by A. flavus and K. quasipneumoniae (0.84±0.03 µg NH4-N g-1 h-1), showing the positive
effect of K. variicola and K. quasipneumoniae on soil urease activity. Overall, 1.1 to 1.3 –folds
increase in soil urease activity was observed when A. flavus was co-inoculated with K. variicola
and K. quasipneumoniae.
Alkaline phosphatase (ALP) activity showed similar response as urease activity (table 5.5). ALP
did not alter significantly up to 1000 mg Pb kg-1, however significant (p<0.05) decrease by 1.4 and
1.7 –folds was observed in ALP activity at 1500 and 2000 mg Pb kg-1 soil. Beside Pb toxicity to
soil microbial community and reduced enzymatic activity, decrease in soil pH upon Pb addition is
also a major factor in decreasing ALP activity. Chen et al. (2013) also found that decrease in soil
pH tends to decrease alkaline phosphatase but increase acid phosphatase activities. ALP activity
remain unchanged with bacterial and fungal inoculations, individual and in combinations.
Catalase is also an important soil enzyme that determine soil redox potential and plays important
role in nutrients mineralization and availability (Cui et al., 2013). The present results shows that
soil catalase activity remain unchanged up to 1000 mg kg-1 soil Pb concentration after which
![Page 168: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/168.jpg)
149
decrease in activity by 1.2 and 1.5 –folds was observed at 1500 and 2000 mg Pb kg-1 soil (table
5.5). All fungal inoculation had no significant effect on soil catalase activity. Whereas, bacterial
strains significantly improved soil catalase activity in Pb amended soils. At 2000 mg kg-1 soil Pb
concentration, the catalase activity 3was significantly (p<0.05) improved by 1.3 –folds in soil
inoculated with K. quasipneumoniae. However in co-inoculation of K. quasipneumoniae with
fungal strains the catalase activity was slightly decreased. In co-inoculation, highest significant
catalase activity (4.37±0.3 KMNO4 g-1 h-1) was noticed in A. flavus and K. quasipneumoniae
(Af+Kq) inoculated soil containing no Pb. Hu et al. (2014) and Yang et al. (2016) also observed
significant negative correlation between Pb and urease and catalase activities.
Comparing all bacterial treatments at all Pb levels, K. quasipneumoniae had the highest positive
impact on soil enzymatic activities and was able to sustain them even at 2000 mg Pb kg-1 soil
concentration. K. quasipneumoniae inoculated soil had 2, 1.3, 1.7, 1.3 and 1.5–folds increase in
soil respiration, microbial biomass, DEH, CAT and urease activities at 2000 mg kg-1 after 15 days
incubation, respectively. Increased microbial biomass and soil respiration may be attributed to high
Pb tolerance of these strains (Aslam et al., 2009), and ability for enhanced activities of
dehydrogenase, catalase, urease, phosphate solubilisation by Klebsiella pneumoniae (Marçal et al.,
2009).
Similarly in case of fungal inoculation, Mucor spp. significantly improved dehydrogenase, urease,
and alkaline phosphatase activities. However in co-inoculations, the enzymatic activities was
slightly decreased when Mucor spp. was applied along bacterial strains, which may be due to
antibacterial properties of Mucor spp. (Aziz et al., 2016; Etcheverry et al., 2009). Our results are
in accordance with the previous studies that reported detrimental effects of Pb on soil enzymatic
activities through direct or indirect mechanisms (Hu et al., 2014; Cui et al., 2013; Khan et al.,
![Page 169: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/169.jpg)
150
2007). Negative correlation of Pb and soil enzymes was also observed by Ahmad et al. (2012).
Addition of organic material can significantly improve the soil enzymatic activities as reported by
Yang et al. (2016), where urease activity was improved by 143% by addition of coarse rice straw
as a results improment in soil catalase activity was noticed. Wheras, ALP did not change
significantly. To the best of our knowledge, no study have been done on restoration of soil enzymes
through application of bio-inoculants. This is the first study reported on potential of these Pb
resistant strains on improving soil health and enzymatic activity along with phytoremediation in
Pb contaminated soil.
5.8. SUMMARY
Results indicated significant detrimental effect of Pb on soil microbial and enzymatic activities.
Individual inoculations were less effective compared to co-inoculations. In single inoculations
Mucor spp was more effective and showed significant improvement only in dehydrogenase
activity. However, in co-inoculation of fungi and bacteria dehydrogenase, urease and catalase
activities were significantly improved when co inoculated with K. variicola and K.
quasipneumoniae. No significant effect of bio-inoculations was noticed for alkaline phosphatase
activity. Results indicated co-inoculation of bacteria and fungi was more effective for improving
soil enzymatic activities in Pb contaminated soil and could be used to restore microbial activity in
Pb contaminated soil.
![Page 170: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/170.jpg)
151
Table 5. 5: Effect of bio-inoculation on soil enzymatic activities in Pb contaminated soil. Table presents mean values of three
replicates. Values bearing different letter are significantly differ at p<0.05. Significance is denoted by *.
Enzyme
activities
Pb conc.
(mg kg-1
)
Bio-inoculants
C Af M Kv Mp Kq Af+Kv Af+Mp Af+Kq M+Kv M+Mp M+Kq
DEH
0 0.34a-d
0.36abc
0.38a*
0.39a*
0.38a*
0.38a*
0.35abc
0.35abc
0.35abc
0.36ab
0.36abc
0.35abc
500 0.34a-d
0.35a-d
0.34a-d
0.36ab
0.37a
0.35ab
0.34a-d
0.34a-d
0.32a-e
0.33a-d
0.35abc
0.34a-d
1000 0.28b-g
0.31a-f
0.33a-d
0.33abc
0.36bcd
0.36ab
0.34a-d
0.29a-g
0.32a-e
0.31a-f
0.32a-f
0.31a-f
1500 0.27c-h
0.29a-g
0.32a-f
0.32bcd
0.33bcd
0.33abc
0.34a-d
0.28b-g
0.31a-f
0.31a-f
0.30a-g
0.29a-g
2000 0.19h
0.21g-h
0.31a-f
0.25cd
0.25cd
0.33a-d
0.30a-f
0.23e-h
0.23f-h
0.29a-g
0.26d-h
0.27b-h
URE
0 0.80abc
0.81abc
0.78a-d
0.80abc
0.87a
0.85ab
0.87a
0.78a-d
0.84ab
0.81abc
0.81abc
0.78a-d
500 0.76a-d
0.72a-e
0.75a-d
0.73bcd
0.89a
0.89a*
0.79a-d
0.73a-d
0.78a-d
0.77a-d
0.72a-e
0.75a-d
1000 0.67c-f
0.68c-f
0.69c-f
0.69cde
0.83abc
0.82a-d
0.76a-d
0.68c-f
0.72a-e
0.73a-e
0.69c-f
0.71b-e
1500 0.55f-i
0.56f-i
0.55f-j
0.66d-f
0.79a-d
0.66cde
0.68c-f
0.54f-j
0.64d-g
0.56f-i
0.56f-i
0.58e-h
2000 0.42ij
0.42ij
0.46hij
0.42e-g
0.69cd
0.61c-f
0.51g-j
0.46hij
0.52g-j
0.51g-j
0.41j
0.50g-j
ALP
0 4.14ab
3.83a-e
4.04abc
3.90bcd
4.06bcd
4.11a-b
4.18ab
3.83a-e
4.04a-d
4.25a*
4.09ab
4.14ab
500 3.88a-e
3.67a-g
3.80a-f
3.74b-e
3.64b-f
3.95a-e
4.06ab
3.65a-h
3.71a-f
4.05abc
3.65a-h
3.91a-e
1000 3.57a-i
3.31d-i
3.49b-i
3.40d-j
3.27cde
3.61b-e
3.7a-f
3.31d-i
3.47b-i
3.79a-f
3.49b-i
3.55a-i
1500 2.94hij
2.93hij
3.09f-j
2.91e-j
2.76def
3.20d-j
3.32c-i
2.92ij
3.26e-i
3.51b-i
3.22e-i
3.22e-i
2000 2.43j
2.40j
2.85ij
2.65fj
2.64efj
2.76d-j
2.95g-j
2.4ij
2.85ij
3.09f-j
2.88ij
2.91ij
CAT
0 4.00a-e
4.03a-d
4.11abc
3.95bcd
3.92b-e
4.03a-d
4.03a-d
4.03a-d
4.37a*
4.11abc
4.00a-e
4.21ab
500 3.81a-g
3.73a-h
3.81a-g
3.92cd
3.95bcd
4.19bcd
3.73a-h
3.68a-h
3.95a-f
3.87a-g
3.81a-g
3.95a-f
1000 3.71a-h
3.6a-h
3.68a-h
4.05b-f
4.05abc
4.13abc
3.60a-h
3.49b-h
3.79a-g
3.79a-g
3.57a-h
3.84a-g
1500 3.25d-h
3.41b-h
3.17e-h
3.65d-j
3.87cde
3.84cde
3.41b-h
3.39b-h
3.65a-h
3.71a-h
3.28c-h
3.71a-h
2000 2.75hi
3.15fgh
3.15fgh
3.05fjh
3.57d-j
3.79c-f
3.15fgh
3.04gh
3.47b-h
3.33c-h
3.04gh
3.33c-h
![Page 171: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/171.jpg)
152
Chapter 6
CONCLUSIONS AND PERSPECTIVES
It is well known that hyperaccumulator plants are a promising tool for remediation of soil
contaminated with lead. However, the efficiency of phytoremediation is limited owing to slow
process and low availability of Pb in soil. Advances in techniques included use of engineered
plants and synthetic phytochelatins with associated environmental concerns. In this study plant-
microbe interaction were focused as a viable option for enhanced phytoremediation of lead
contaminated soil. Lead resistant soil bacteria and fungi were investigated individually and in
combination to promote phytoextraction of lead in ornamental plant selected through screening of
indigenous ornamental plants through series of well-designed experiments. The key findings of
the research are concluded below.
6.1. GENERAL DISCUSSION
6.1.1. Pb hyperaccumulator selection
Results of screening activity indicated P. hortorum and M. criniflorum as hyperaccumulators of
Pb (shoot Pb conc. >1000 mg kg-1). This high Pb uptake could be attributed to rhizosphere
modifications by the two plants (results presented in chapter 3: section II). Both plants were able
to significantly modify rhizosphere pH and DOC content, which intern has increased water
extractable Pb concentration. Soil pH was significantly (p<0.05) decreased (ΔpH = -0.22 pH) and
dissolved organic carbon (DOC) content was significantly improved (by 1.7 –folds) in soil
cultivated with P. hortorum compared to M. criniflorum. It is well known that different soil factors
like pH, soil texture, structure, organic matter, organic colloids, iron oxides and cation exchange
![Page 172: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/172.jpg)
153
capacity (CEC); and biological factors such as root exudation that alters the pH and dissolved
organic carbon (DOC) controls Pb speciation and availability in soil (Adejumo et al., 2018;
Khoshgoftarmanesh et al., 2018). Low pH generally favors Pb solubilization and activity as free
ion Pb2+ (Shahid, 2010). Whereas, some studies also showed Pb dissolution is governed by DOC
which increases Pb solubility upon decrease in pH by making soluble organo-Pb complexes
(Shahid et al., 2012a) therefore, plays important role in Pb chelation, solubility and increased Pb
uptake by plant (Khoshgoftarmanesh et al., 2018).
6.1.2. Plant microbe interactions for Pb phytoextraction
In next steps, the selected plants were further studied for plant-microbe interactions in
phytoremediation of Pb. Bio-inoculants (bacteria and fungi) were identified and studied for their
possible effects on improving Pb uptake and soil enzymatic activities. Results of Pb uptake
experiments showed that bacteria and fungi both had ability to improve Pb phytoextraction through
improving water extractable Pb fraction and plant biomass through PGPR activity. Plant associated
microbes are able to produce low molecular weight organic acids. Most frequently released organic
acids by bacteria and fungi are oxalic acid, malic acid and citric acid, gluconic acid and fumaric
acid as the mean of carboxylates acids that can alter the pH and DOC and could directly impact
Pb availability for plant uptake. In-vitro assay indicated significant production of citric (121& 0.29
mg L-1) and oxalic acid (110 & 0.21 mg L-1) in A. niger and Mucor spp., respectively, that results
in lowering pH of medium and increasing extractable fraction of Pb (Chandran et al., 2014; Xiao
et al., 2009; Wang & Chen, 2009). Our results showed that application of bacteria and fungi
increased the water extractable Pb by adjusting soil chemical properties (pH and DOC content).
Limited work has been done in littrature. Microbacterium paraoxydans (G-16), Mucor spp.
(CBRF59) have been found to significantly increase the availability of soil Pb (Sheng et al., 2008b;
![Page 173: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/173.jpg)
154
Deng et al., 2011), but the relative effect on soil biochemical properties were not studied. In this
regards, our results greatly improve the mechanistic understanding of Pb dissolution upon
application of bioinoculants. And conclude that, the strains which greatly improved the overall
phytoextraction of Pb were effective in lowering soil pH by exudation of organic acids and plant
growth hormones particularly IAA and siderophores. Siderophores are the second most released
metabolites from bacteria (Sessitsch et al., 2013) and are involved in metal chelation, pH alteration
and oxidation/reduction reactions (Rajkumar et al., 2012). Similarly IAA (auxins) play important
role in plant growth, reproduction, metabolism and responses to various environmental cues
including interactions between auxin homeostasis and heavy metal toxicity (Waqas et al., 2012).
In a study, IAA increased Pb accumulation into harvestable plant part by 2800% over control
plants (Lopez et al., 2005).
6.1.3. Soil enzymatic activities
Promising effects on soil enzymatic activities were also observed upon application of
bioinoculants in Pb contaminated soil, which is a great advantage of using bio-inoculants instead
of synthetic chelators for improving phytoremediation efficiency. Until now, the most widely used
synthetic phytochelatin is EDTA. But it has several environmental concerns including extremely
low biodegradability (120-300 days half-life) (Pandey & Bhattacharya, 2018), highly soluble in
aqueous solution causing leaching of Pb to ground water (Lu et al., 2017; Hartley et al., 2014),
toxic impacts on soil biota (Kaurin et al., 2018), decreased soil microbial activity and basal
respiration upon application of EDTA and EDDS (Epelde et al., 2008). In contrast, the
bioinoculants identified in this study not only improve overall phytoextraction of Pb but also
restore the soil enzymatic and biological activity required for sustainable development of
technology and site remediation.
![Page 174: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/174.jpg)
155
6.2. CONCLUSIONS
In the first phase twenty-one ornamental plants out of eleven different plant families were screened
for Pb hyperaccumulation potential in a concentration gradient experiment. Among all plants,
Pelargonium hortorum and Mesembryanthemum criniflorum accumulated >1000 mg Pb kg-1 shoot
dry biomass at different soil Pb concentrations. These two plants could be regarded as
hyperaccumulators of Pb considering TF, EF and CF index and the amount of biomass produced
by each plant. Pelargonium hortorum and Mesembryanthemum criniflorum were further
investigated for root induce rhizosphere modification for possible influence on bioavailable
fraction of Pb in soil. Both plants had the ability to induce rhizosphere changes for three weeks
culture in cropping device setup. Results indicated great ability of Pelargonium hortorum to
acidify rhizosphere soil and increasing DOC content that induces Pb mobility in soil. Pelargonium
hortorum acidified the soil by -0.1 pH units in CaCl2 extracted soil solutions at 2000 mg kg-1 soil
Pb concentration. Pelargonium hortorum increased Pb mobility 1-2 –folds more compared to
Mesembryanthemum and control soil. DOC was also 1.4 to 1.7 times more in soil cultured with
Pelargonium (121±11 mg L-1) compared to Mesembryanthemum at 500-1000 mg Pb kg-1 soil. For
further development of technology following perspectives should be considered.
In the next step the plants were then further investigated in plant-microbial association studies for
phytoremediation potential. Fungal interactions revealed the ability of A. flavus, and Mucor spp.
to increased bioavailable fraction of Pb by 1.6 and 1.8–folds compared to the control (no fungi).
A. flavus and Mucor spp. also lowered the soil pH by -0.14 and -0.13 units in spiked soil (2000 mg
Pb kg-1). A. flavus and Mucor spp. also showed significant production of siderophores (61±1 %)
and IAA (203±5.8 μg mL-1). Highest significant Pb uptake were obtained in Pelargonium
hortorum inoculated by Mucor spp. (2.21 mg per plant) and A. flavus (1.85 mg per plant).
![Page 175: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/175.jpg)
156
Rhizospheric bacteria Pseudomonas spp. and multiple heavy metal accumulator plant (Pteris
vittata) were studied for Pb accumulation and plant growth enhancement in Pb contaminated
medium under sterile conditions. The results showed decreased in Pb uptake while improving plant
growth in both inoculated and un-inoculated Pteris vittata and Pelargonium hortorum.
Amplification of metal resistant gene fragments (pbrA, cadA2 and czcR) from Pseudomonas spp.
genomic DNA suggested that metal efflux may play a role in Pb resistance and detoxification in
bacteria. Indigenous bacterial were isolated from Pb contaminated soil collected from industrial
zone of Islamabad and Rawalpindi. Of these strains Klebsiella quasipneumoniae. (NCCP-1862),
Klebsiella variicola (NCCP-1857), Pseudomonas beteli (NCCP-1845), Microbacterium
paraoxydans (NCCP-1848) and Bacillus tequilensis (NCCP-1860) showed Pb tolerance (up to 800
mg L-1) and solubilization and PGPR activity. Significantly high IAA (92.26 μg mL-1) and ACC
deaminase activity (260.5 nmol alphaketobutyrate mg-1 h-1) was observed in Microbacterium
paraoxydans. Microbacterium paraoxydans treated Pelargonium had highest significantly high Pb
uptake (2.4 –fold) followed by Klebsiella quasipneumoniae (1.8 –fold) and Klebsiella variicola
(1.2 –fold). The increase uptake was directly related to increased Pb solubilization and
accumulation in root/shoot and indirectly by stimulating plant growth and biomass though PGPR
activity.
Finally, a novel integrated plant-microbial system was developed through series of experiments
by co-inoculating bacteria and fungi. The results indicated the strong inhibitory effects of Pb on
enzymatic activities, microbial biomass and basal respiration. This inhibitory effect of Pb have
previously been reported in many studies (Hu et al., 2014; Chen et al., 2013; Khan et al., 2007)
but not adequately addressed. Significantly restoration of soil enzymatic activities were achieved
in Pb contaminated soil by the application of bio-inoculants particularly when bacteria and fungi
![Page 176: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/176.jpg)
157
were co-inoculated. Synergistic effect of A. flavus and M. paraoxydans was noticed for Pb
solubilization and accumulation, whereas biomass was significantly improved with Mucor spp.
and M. paraoxydans co-inoculation. Co-inoculation of bacteria and fungi significantly improve
soil enzymatic activities and Pb phytoextraction potential of Pelargonium hortorum compared to
single inoculations. Plant-microbe interaction served as promising technique for safe remediation
of Pb polluted soil, some of the perspective that would further increase the understanding and
development of technology are described bellow:
6.3. FUTURE PERSPECTIVES
6.3.1. Interactive Effect of Multiple Metals and Nutrients in Real Field Soil
These experiments were conducted using spiked soil, which gave an insight about potential of
ornamental plants and associated microbial associations to accumulate substantial amount of Pb
in above ground tissues. However, phytoremediation potential of these plants in real/field
contaminated soil should be evaluated before field application. The changes at root soil interface
due to the presence of several nutrients in soil like calcium (Ca), Iron (Fe), magnesium (Mg),
phosphorus (P) and zinc (Zn) may interfere Pb phytoavailability and compete for uptake also need
to be investigated for understanding and further development of this technique (figure 6.1). The
optimized biological system developed should also be studied for other heavy metals and mixed
heavy metal contaminated soil. Heavy metals may compete and reduce Pb uptake by plant.
Therefore, there is prior need of investigating the interactive effect of different nutrients and
heavymetals upon Pb uptake before field application. Natural chelating compounds (root exudates)
may also be studied for assisting phytoremediation of Pb.
![Page 177: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/177.jpg)
158
Figure 6. 1: Interactive effect of nutrients and heavymetals on Phytoextraction of Pb.
6.3.2. Chelators and Phytohormones along with Plant Microbial Interaction
There is also great room for investigating the effect of naturally used organic and inorganic soil
amendments (Gul et al., 2019) and organic acids along wo=ith bioinoculants for improving overall
efficiency of phytoremediation system (figure 6.2). It is reported that citric acid is a major
component of root exudates and plays significant role in Pb dissolution and subsequent uptake by
plant (Gul et al., 2019; Shahid et al., 2012b). Gul et al. (2019) working with five different soil
amendments including citric acid, TiO2 NPs and ammonium nitrate, compost and EDTA found
that citric acid (10 mM) significantly improved Cd uptake (1.44 g per plant) by Pelargonoum
hortorum with a metal extraction ratio of 4.4% and can be used as a substitute of EDTA.
Many bacteria and fungi have been reported to reduce oxidative stress in plants upon exposure to
Pb through metabolic expressions (Waqas et al., 2012). Auxins and ACC deaminase plays
important role in plant growth and directly response to a biotic environmental stress including
ZnAs
CdCrPb
(As, Cd, Zn, Cr )
Pb
(Ca, P, Mg )
Ca
P
Nutrients
Ca, P, Mg
Metals
As, Cd,
Zn, Cr
Pb
![Page 178: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/178.jpg)
159
heavy metal toxicity (Waqas et al., 2012). Similarly, there is need to study the possible interaction
of microrganisms and plant metabolic responses during phytoremediation process.
Phytoextraction of Pb by plants and microbial associations is a slower system compared to chelate
assisted phytoextraction of Pb. Higher Pb phytoextraction is achieved when soil is amended with
organic and/or inorganic soil amendments (Gul et al., 2019, Zhang et al., 2016, Shahid et al., 2014).
Integration of plant-microbe system with suitable soil amendments would further improve the
phytoremediation efficiency and reduce the time required for large scale phytoremediation of Pb
contaminated site. In this regard natural phyto-hormones and organic acids such as citric acid,
tartaric acid, malic acid, and oxalic acids (Chandran et al., 2014; Xiao et al., 2009; Wang & Chen,
2009) should also be studied in combination with plant-microbe system optimized in this study.
Figure 6. 2: Integrated application of plant-bacteria-chelates for phytoextraction of Pb.
6.3.3. Proteomics and Metabolomics and Gene Expression
Pbr efflux system is the major Pb detoxification mechanism in bacteria, which play significant
role in phosphate induced Pb immobilization in bacterial periplasm thereby, favors Pb stabilization
Pb accumulation
ΔpH
ΔDOC
Pb - OA binding
Plant metabolite
Citric, Malic,
Oxalic
Bacterial
metabolite
Growth regulators
Chelators (organic
and inorganic)
fertilizers
Improved phytoextraction
![Page 179: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/179.jpg)
160
instead of Pb phytoextraction (Hynninen et al., 2009; Monchy et al., 2007). This indicates that
bioinoculants may greatly influence Pb speciation and phytoextraction. There is need to investigate
Pb regulating genes in bacteria and fungi that would further enhance the phytoavailability of Pb
for plant uptake while reducing the oxidative damage in plant tissue. Advance techniques should
be employed for exploring the pathway of metabolites produced in plant when exposed to lead and
microbial associations. Detailed and quantitative analysis of bioactive compound should further
be explored. These studied would lead to the identification of the protein and metabolic responses
that is responsible for Pb hyperaccumulation. However, there are studies wherein, exogenous
application of phytohormones and natural chelators improved the overall Pb phytoavailability and
extraction while improving plant biomass and reducing Pb leaching (Gul et al., 2019). Integration
of such natural compounds with the plant microbe system (optimized in this study) may further be
studied.
Figure 6. 3: Proteomic and metabolomics basis for Pb uptake and detoxification mechanism in
plant.
-Pb +Pb
↑ ↓ genes
expression
compared to
control
Metabolic
expressions/
plant/microbial
exudates
Enzymes Phytohormones
Metal detoxification
Physiological response
Oxidative response
MetabolomicsProteomic
![Page 180: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/180.jpg)
161
REFERENCES
Abbasi M.N, Tufail M & Chaudhry M.M. (2013). Assessment of heavy elements in suspended
dust along the Murree Highway near Capital City of Pakistan. World App Sc J., 21(9): 1266-
1275.
AFNOR. (1994). Recueil de normes françaises. Qualité des sols, détermination du pH. AFNOR,
Paris, 63pp.
Afzal Z, Hamid A & Ahmad M. (2014). Workplace and ambient air monitoring of lead and other
emissions at lead acid battery recycling units and survey of health impacts on workers. J Bio
Env Sc., 5: 279-286.
Ahmad J.U & Goni M.A. (2010). Heavy metal contamination in water, soil and vegetables of the
industrial areas in Dhaka, Bangladesh. Environ Monit Assess., 166: 347-357.
Ahmad M, Hashimoto Y, Moon D.H, Lee S.S & Ok Y.S. (2012). Immobilization of lead in a
Korean military shooting range soil using eggshell waste: an integrated mechanistic approach.
J Hazard Mater., 209–210:392–401
Ahmed I, Kudo T, Abbas S, Ehsan M, Iino T, Fujiwara T & Ohkuma M. (2014). Cellulomonas
pakistanensis sp. nov., a moderately halotolerant Actinobacteria. Int J Syst Evol Microbiol.,
64(7): 2305-2311.
Ahmed M. (2014). Phosphate-solubilizing bacteria-assisted phytoremediation of metalliferous
soils: a review. 3 Biotech 5: 111–121. doi :10.1007/s13205-014-0206-0
Akhtar S & Iram S. (2016). Enhanced phytoremediation of heavy metal polluted soil with native
crops of Punjab, Pakistan. J Bio Env Sci., 8(4): 158-171.
Alamri S.A, Siddiqui M.H, Al-Khaishany M.Y, Nasir K.M, Ali H.M, Alaraidh I.A, Alsahli A.A,
Al-Rabiah H & Mateen M. (2018). Ascorbic acid improves the tolerance of wheat plants to
lead toxicity. J Plant Interact., 13(1): 409-419.
Al-Askar A.A. (2016). Bioactive compounds produced by Trichoderma harzianum 1-SSR for
controlling Fusarium verticillioides (Sacc.) Nirenberg and growth promotion of Sorghum
vulgare. Egypt J Biol Pest Co., 26(2): 379-386.
Alef K & Nannipieri P. (1995). Methods in applied soil microbiology and biochemistry. Academic.
Press, San Diego, USA.
Ali H, Khan E & Sajad M.A. (2013). Phytoremediation of heavy metals concepts and applications,
Chemosphere., 91(7): 869–881.
![Page 181: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/181.jpg)
162
Ali S.M & Malik R.N. (2011). Spatial distribution of metals in top soils of Islamabad City,
Pakistan. Environ Monit Assess., 172(1-4): 1-16.
Anawar H.M, Garcia-Sanchez A, Kul Alam M.T & Rahman M.M. (2008). Phytofiltration of water
polluted with arsenic and heavy metals. Int J Environ Pollut., 33(2-3): 292-312.
Anjum N.A, Sofo A, Scopa A, Roychoudhury A, Gill S.S, Iqbal M, Lukatkin A.S, Pereira E,
Duarte A.C & Ahmad I. (2015). Lipids and proteins - Major targets of oxidative modifications
in abiotic stressed plants. Env Sci Pollut Res., 22: 4099–4121.
Ano A.O, Ubochi C.I & Nwokocha C.C. (2012). Effect of heavy metals (Cd, Ni and Pb) on soil
productivity: Organic carbon mineralization. Int J Phys Sci., 7(4): 573-577.
Arias M.S.B, Peña-Cabriales J.J, Alarcón A & Maldonado Vega M. (2015). Enhanced Pb
absorption by Hordeum vulgare L. and Helianthus annuus L. plants inoculated with an
arbuscular mycorrhizal fungi consortium. Int J Phytoremediat., 17(5): 405-413.
Arshad M, Merlina G, Uzu G, Sobanska S, Sarret G, Dumat C, Silvestre J, Pinelli E & Kallerhoff
J. (2016). Phytoavailability of lead altered by two Pelargonium cultivars grown on contrasting
lead-spiked soils, Soil Sediment Contam., 16(2): 581-591.
Arshad M, Silvestre J, Pinelli E, Kallerhoff J, Kaemmerer M, Tarigo A, Shahid, M, Guiresse M,
Pradère P & Dumat C. (2008). A field study of lead phytoextraction by various scented
Pelargonium cultivars. Chemosphere. 71(11): 2187-2192.
Ashraf U, Kanu A.S, Deng Q, Mo Z, Pan S, Tian H & Tang X. (2017). Lead (Pb) toxicity; physio-
biochemical mechanisms, grain yield, quality, and Pb distribution proportions in scented rice.
Front Plant Sci., 8: 259.
Aslam F, Yasmin A & Thomas T. (2016). Genome Sequence of Klebsiella quasipneumoniae
subsp. similipneumoniae MB373, an effective bioremediator. Genome Announce., 4: 1068-16.
ATSDR. (2007). Priority List of Hazardous Substances. Agency for Toxic Substances and
Diseases Registry. Available at:http://www.atsdr.cdc.gov/(accessed 10 Jan 2018).
ATSDR. (2018). Lead Toxicity. What Are U.S. Standards for Lead Levels? Available at:
https://www.atsdr.cdc.gov/csem/csem.asp?csem=34&po=8/(accessed 16 Jan 2018
Aziz N, Pandey R, Barman I & Prasad R. (2016). Leveraging the attributes of Mucor hiemalis-
derived silver nanoparticles for a synergistic broad-spectrum antimicrobial platform. Front
Microbiol., 7: 1984.
![Page 182: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/182.jpg)
163
Aziz O.A, Helal G.A, Galal Y.G.M & Rofaida A.K.S. (2016). Fungal siderophores production in
vitro as affected by some abiotic factors. Int. J. Curr. Microbiol. App. Sci., 5(6): 210-222.
Bai S.R & Abraham E. (2003). Studies on chromium (VI) adsorption-desorption using
immobilized fungal biomass. Bioresource Technol., 87: 17-26.
Baker A.J. (1981). Accumulators and excluders‐strategies in the response of plants to heavy
metals. J Plant Nutr., 3(1-4): 643-654.
Baker A.J.M & Brooks R. (1989). Terrestrial higher plants which hyperaccumulate metallic
elements. A review of their distribution, ecology and phytochemistry. Biorecovery., 1(2): 81-
126.
Bal H.B, Das S, Dangar T.K & Adhya T.K. (2013). ACC deaminase and IAA producing growth
promoting bacteria from the rhizosphere soil of tropical rice plants. J Basic Microb., 53(12):
972-984.
Baldrian P & Gabriel J (2002). Intraspecific variability in growth response to cadmium of the
wood-rotting fungus Piptoporus betulinus. Mycologia., 94: 428-436.
Bandara T, Herath I, Kumarathilaka P, Seneviratne M, Seneviratne G, Rajakaruna N... & Ok Y. S.
(2017). Role of woody biochar and fungal-bacterial co-inoculation on enzyme activity and
metal immobilization in serpentine soil. J Soil Sediment., 17(3): 665-673.
Bashmakov D.I, Kluchagina A.N, Malec P, Strzałka K & Lukatkin A.S. (2017). Lead
accumulation and distribution in maize seedlings: relevance to biomass production and metal
phytoextraction. Int. J. Phytoremediation., 19(11): 1059-1064.
Bech J, Roca N, Tume P, Ramos-Miras J, Gil C & Boluda R. (2016). Screening for new
accumulator plants in potential hazards elements polluted soil surrounding Peruvian mine
tailings. Catena., 136: 66-73.
Belimov A.A, Hontzeas N, Safronova V.I, Demchinskaya S.V, Piluzza G, Bullitta S & Glick B.R.
(2005). Cadmium-tolerant plant growth-promoting bacteria associated with the roots of Indian
mustard (Brassica juncea L. Czern.). Soil Biol Biochem., 37(2): 241-250.
Botero R.K & Joshi S.R. (2009). Promotion of seed germination of green gram and chick pea by
Penicillium verruculosum RS7PF, a root endophytic fungus of Potentilla fulgens L. J Adv
Biotechnol., 8(7): 16–18.
Bhargava A, Carmona F.F, Bhargava M & Srivastava S. (2012). Approaches for enhanced
phytoextraction of heavy metals. J Environ. Manage., 105: 103–120.
![Page 183: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/183.jpg)
164
Bilkay I.S, Karakoç S & Aksöz N. (2010). Indole-3-acetic acid and gibberellic acid production in
Aspergillus niger. Turk J Biol., 34: 313-318.
Blaylock M.J, Salt D.E, Dushenkov S, Zakharova O, Gussman C, Kapulnik Y... & Raskin I.
(1997). Enhanced accumulation of Pb in Indian mustard by soil-applied chelating agents. Env
Sci Technol., 31(3): 860-865.
Botero W.G, Oliveira L.C.D, Rocha J.C, Rosa A.H & dos Santos A. (2010). Peat humic substances
enriched with nutrients for agricultural applications: Competition between nutrients and non-
essential metals present in tropical soils. J Hazard Mater., 177: 307–311.
Braud A, Jézéquel K, Bazot S & Lebeau T. (2009). Enhanced phytoextraction of an agricultural
Cr-and Pb-contaminated soil by bioaugmentation with siderophore-producing bacteria.
Chemosphere., 74(2): 280-286.
Carson K.C, Holliday S, Glenn A.R & Dilworth M.J. (1992). Siderophore and organic acid
production in root nodule bacteria. Arch Microbiol., 157(3): 264-271.
Chandran C.S, Shijith K.V, Vipin K.V & Augusthy A.R. (2014). Study on heavy metals toxicity
biomarkers in Aspergillus niger. IJAPBC., 3(2):458-464.
Chen J, He F, Zhang X, Sun X, Zheng J & Zheng J. (2014). Heavy metal pollution decreases
microbial abundance, diversity and activity within particle-size fractions of a paddy soil. FEMS
Microbiol Ecol., 87(1): 164-181.
Chen J, Liu X, Zheng J, Zhang B, Lu H, Chi Z, Pan G, Li L, Zheng J, Zhang X, Wang J, Yu X.
(2013). Biochar soil amendment increased bacterial but decreased fungal gene abundance with
shifts in community structure in a slightly acid rice paddy from Southwest China. Appl Soil
Ecol.,71: 33–44
Clesscerl L.S, Greenberg A.E & Eaton A.D. (1998). Standard Methods for the Examination of
Water and Wastewater, 20th Ed, APHA-AWWA-WEF, Washington, DC.
Cui H, Zhou J, Zhao Q, Si Y, Mao J, Fang G & Liang J. (2013). Fractions of Cu, Cd, and enzyme
activities in a contaminated soil as affected by applications of micro- and nanohydroxyapatite.
J Soils Sediments., 13: 742–752
Cui S, Zhang T, Zhao S, Li P, Zhou Q, Zhang Q & Han Q. (2013). Evaluation of three ornamental
plants for phytoremediation of Pb-contamined soil. Int J Phytoremediat., 15(4): 299-306.
Dan T.V. (2001). Phytoremediation of metal contaminated soils: metal tolerance and metal
accumulation in Pelargonium sp. PhD Dissertation, University of Guelph, Canada.
![Page 184: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/184.jpg)
165
Dary M, Chamber-Pérez M.A, Palomares A.J & Pajuelo E. (2010). “In situ” phytostabilisation of
heavy metal polluted soils using Lupinus luteus inoculated with metal resistant plant-growth
promoting rhizobacteria. J Hazard Mater., 177(1-3): 323-330.
Das S, de Oliveira L.M, da Silva E & Ma L.Q. (2017). Arsenate and fluoride enhanced each other’s
uptake in As-sensitive plant Pteris ensiformis. Chemosphere., 180: 448-454.
Davison J. (2005). Risk mitigation of genetically modified bacteria and plants designed for
bioremediation. J Ind Microbiol Biotechnol., 32: 639–650.
Deng H, Ye Z.H & Wong M.H. (2004). Accumulation of lead, zinc, copper and cadmium by 12
wetland plant species thriving in metal-contaminated sites in China. Environ Pollut., 132(1):
29-40.
Deng Z, Cao L, Huang H, Jiang X, Wang W, Shi Y & Zhang R. (2011). Characterization of Cd-
and Pb-resistant fungal endophyte Mucor sp. CBRF59 isolated from rapes (Brassica chinensis)
in a metal-contaminated soil. J Hazard Mater., 185(3): 717-724.
Dick W.A, Chenga L & Wang P. (2000). Soil acid and alkaline phosphatase activity as pH
adjustment indicators. Soil Biol Biochem., 32: 1915-1919.
Du R.J, He E.K, Tang Y.T, Hu P.J, Ying R.R, Morel J.L & Qiu R.L. (2011). How phytohormone
IAA and chelator EDTA affect lead uptake by Zn/Cd hyperaccumulator Picris divaricata. Int
J Phytorem., 13(10): 1024-1036.
Ehsan M, Ahmed I, Hayat R, Iqbal M, Bibi N & Khalid N. (2016). Molecular Identification and
Characterization of Phosphate Solubilizing Pseudomonas sp. Isolated from Rhizosphere of
Mash Bean (Vigna Mungo L.) for Growth Promotion in Wheat. J Agric Sci Technol., 18(3):
775-788.
Epelde L, Hernández-Allica J, Becerril J.M, Blanco F & Garbisu C. (2008). Effects of chelates on
plants and soil microbial community: comparison of EDTA and EDDS for lead
phytoextraction. Sci Total Environ., 401(1-3): 21-28.
Epelde L, Lanzen A, Blanco F, Urich T & Garbisu C. (2015). Adaptation of soil microbial
community structure and function to chronic metal contamination at an abandoned Pb-Zn
mine. FEMS Microbiol Ecol., 91(1): 1-11.
Etcheverry M.G, Scandolara A, Nesci A, Ribeiro M.S.V.B, Pereira P & Battilani P. (2009).
Biological interactions to select biocontrol agents against toxigenic strains of Aspergillus
flavus and Fusarium verticillioides from maize. Mycopathologia., 167(5): 287-295.
![Page 185: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/185.jpg)
166
Evangelou M.W.H, Ebel M & Schaeffer A. (2007). Chelate assisted phytoextraction of heavy
metals from soil. Effect, mechanism, toxicity, and fate of chelating agents. Chemosphere.,
68(6): 989-1003.
Farina R, Beneduzi A, Ambrosini A, de Campos S.B, Lisboa B.B, Wendisch V, Vargas L.K &
Passaglia L.M. (2012). Diversity of plant growth-promoting rhizobacteria communities
associated with the stages of canola growth. Appl Soil Ecol., 55: 44-52.
Fasani E, Manara A, Martini F, Furini A & DalCorso G. (2017). The potential of genetic
engineering of plants for the remediation of soils contaminated with heavy metals. Plant Cell
Environ., http://dx.doi.org/10.1111/pce.12963.
Fu JW, Liu X, Han YH, Mei H, Cao Y, De Oliveira LM, Liu Y, Rathinasabapathi B, Chen Y &
Ma LQ. (2017). Arsenic-hyperaccumulator Pteris vittata efficiently solubilized phosphate rock
to sustain plant growth and As uptake. J Hazard Mater., 15; 330:68-75.
Gao G, Zeng X, Li Z, Chen A & Yang Z. (2017). Variations in several morphological
characteristics and Cd/Pb accumulation capacities among different ecotypes of torpedograss
responding to Cd-Pb stresses. Int J Phytorem.,19(9): 844–861.
Ghosh P, Rathinasabapathi B & Ma L.Q. (2015a). Phosphorus solubilization and plant growth
enhancement by arsenic-resistant bacteria. Chemosphere., 134: 1-6.
Ghosh P, Rathinasabapathi B, Teplitski M & Ma L.Q. (2015b). Bacterial ability in AsIII oxidation
and AsV reduction: relation to arsenic tolerance, P uptake, and siderophore production.
Chemosphere., 138: 995-1000.
Ghosh S, Penterman J.N, Little R.D, Chavez R & Glick B.R. (2003). Three newly isolated plant
growth-promoting bacilli facilitate the seedling growth of canola, Brassica campestris. Plant
Physiol Bioch., 41(3): 277-281.
Glick B.R, Patten C.L, Holguin G & Penrose D.M. (1999). Biochemical and genetic mechanisms
used by plant growth-promoting bacteria. J Theor Biol., 190: 63–68.
Greipsson S, Tay C, Whatley A & Deocampo D.M. (2013). Sharp decline in lead contamination
in topsoil away from a smelter and lead migration in ultisol. World Environment, 3(3): 102-
107.
Guerinot M.L & Meidl EJ Plessner O. (1990). Citrate as a siderophores in Bradyrhizobium
japonicum. J Bacteriol., 172: 3298-3303.
![Page 186: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/186.jpg)
167
Gul I, Manzoor M, Silvestre J, Rizwan M, Hina K, Kallerhoff J & Arshad M. (2019).
EDTA−assisted phytoextraction of lead and cadmium by Pelargonium cultivars grown on
spiked soil. Int J Phytorem., DOI: 10.1080/15226514.2018.1474441.
Hadi F, Bano A & Fuller M.P. (2010). The improved phytoextraction of lead (Pb) and the growth
of maize (Zea mays L.): the role of plant growth regulators (GA3 and IAA) and EDTA alone
and in combinations. Chemosphere., 80(4): 457-462.
Han Y.H, Fu J.W, Chen Y, Rathinasabapathi B & Ma L.Q. (2016). Arsenic uptake, arsenite efflux
and plant growth in hyperaccumulator Pteris vittata: Role of arsenic-resistant bacteria.
Chemosphere., 144: 1937-1942.
Hartley N.R, Tsang D.C, Olds W.E & Weber P.A. (2014). Soil washing enhanced by humic
substances and biodegradable chelating agents. Soil Sediment Contam., 23(6): 599-613.
Hayat R, Sheirdil R.A, Iftikhar-ul-Hassan M & Ahmed I. (2013). Characterization and
identification of compost bacteria based on 16S rRNA gene sequencing. Ann Microbiol., 63(3):
905-912.
He L.Y, Chen Z.J, Ren G.D, Zhang Y.F, Qian M & Sheng X.F. (2009) Increased cadmium and
lead uptake of a cadmium hyperaccumulator tomato by cadmium-resistant bacteria. Ecotox
Environ Safe., 72(5): 1343-1348.
Holbrook A.A, Edge W.J & Baily F. (1961). Advances in Chemical Series. 28: 159-167.
Holt J.G, Kreig N.R, Sneath P.H.A & Staley J.T. (1994). Bergey’s Manual of Determinative
Bacteriology, 9th edn., Williams and Wilkins, Baltimore, USA.
Hontzeas N, Zoidakis J, Glick B.R & Abu-Omar M.M. (2004). Expression and characterization of
1-aminocyclopropane-1-carboxylate deaminase from the rhizobacterium Pseudomonas putida
UW4: a key enzyme in bacterial plant growth promotion. BBA – Proteins and Proteomics.,
1703(1): 11-19.
Hossain M.A, Piyatida P, da Silva J.A.T & Fujita M. (2012). Molecular mechanism of heavy metal
toxicity and tolerance in plants: central role of glutathione in detoxification of reactive oxygen
species and methyl glyoxal and in heavy metal chelation. J Bot., 2012: 21-37.
Hossain M.M, Sultana F, Kubota M, Koyama H & Hyakumachi M. (2007). The plant growth-
promoting fungus Penicillium simplicissimum GP17-2 induces resistance in Arabidopsis
thaliana by activation of multiple defense signals. Plant Cell Physiol., 48(12): 1724-736.
![Page 187: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/187.jpg)
168
Hu X.F, Jiang Y, Shu Y, Hu X, Liu L & Luo F. (2014). Effects of mining wastewater discharges
on heavy metal pollution and soil enzyme activity of the paddy fields. J Geochem Explor., 147:
139–150
Hussain A, Abbas N, Arshad F, Akram M, Khan Z.I, Ahmad K, Mansha M & Mirzaei F. (2013).
Effects of diverse doses of Lead (Pb) on different growth attributes of Zea-Mays L. Agri Sci.,
4(5): 262.
Hynninen A, Touzé T, Pitkänen L, Mengin‐Lecreulx D & Virta M. (2009). An efflux transporter
PbrA and a phosphatase PbrB cooperate in a lead‐resistance mechanism in bacteria. Mol
Microbiol., 74(2): 384-394.
IARC. (2006). IARC Monographs on the Evaluation of Carcinogenic Risks to Human, Inorganic
and Organic Lead Compounds, International Agency for Research on Cancer (IARC), 87: 1-
519.
Iqbal M, Ahmad A, Ansari M.K.A, Qureshi M.I, Aref I.M, Khan P.R, Hegazy S.S, El-Atta H,
Husen A & Hakeem K.R. (2015). Improving the phytoextraction capacity of plants to scavenge
metal(loid)-contaminated sites. Environ Rev., 23: 44-65.
Iram S, Parveen K, Usman J, Nasir K, Akhtar N, Arouj S & Ahmad I. (2012). Heavy metal
tolerance of filamentous fungal strains isolated from soil irrigated with industrial wastewater.
Biologija., 58(3). https://doi.org/10.6001/biologija.v58i3.2527
Iram S, Zaman A, Iqbal Z & Shabbir R. (2013). Heavy metal tolerance of fungus isolated from
soil contaminated with sewage and industrial wastewater. Pol J Env Stud., 22(3): 691-697.
Iskandar N.L, Zainudin N.A & Tan S.G. (2011). Tolerance and biosorption of copper (Cu) and
lead (Pb) by filamentous fungi isolated from a freshwater ecosystem. J Environ Sci., 23(5):
824-30.
Islam M.S, Kashem M.A & Osman K.T. (2016). Phytoextraction efficiency of lead by arum
(Colocasia esculenta L.) grown in hydroponics. Open J Soil Sci., 6(07), 113.
Jackson V.A, Pulse A.N, Odendaal J.P, Khan S & Khan W. (2012). Identification of metal-tolerant
organisms isolated from the Plankenburg River, Western Cape, South Africa. Water SA, 38(1):
29-38.
Jaiswal D & Pandey J. (2018). Impact of heavy metal on activity of some microbial enzymes in
the riverbed sediments: Ecotoxicological implications in the Ganga River (India). Ecotoxicol
Env Safe., 150: 104-115.
![Page 188: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/188.jpg)
169
Jarosławiecka A & Piotrowska-Seget Z. (2014). Lead resistance in micro-organisms.
Microbiology, 160(1): 12-25.
Jeffrey M & Achurch H. (2017). Save our Soil to Save the Planet. In: Global Soil Security
Springer, Cham. pp 389-395.
Jena V, Gupta S, Dhundhel R.S, Matić N, Frančišković-Bilinski S & Dević N. (2013).
Determination of total heavy metal by sequential extraction from soil. Int J Environ Sci
Technol., 3(1): 35.
Jin-Yan Y.A.N.G, Zhen-Li, H.E, Yang X.E & Ting-Qiang L.I. 2014. Effect of lead on soil enzyme
activities in two red soils. Pedosphere., 24: 817-826.
Joynt J, Bischoff M, Turco R, Konopka A & Nakatsu C.H. (2006). Microbial community analysis
of soils contaminated with lead, chromium and petroleum hydrocarbons. Microbial
Ecol., 51(2): 209-219.
Kakar S.U.R, Tareen R.B & Wahid A. (2011). Impact of municipal wastewaters of Quetta city on
some oilseed crops of Pakistan: Effects on biomass, physiology and yield of sunflower
(Helianthus annuus L.). Pak J Bot., 43(3): 1477-1484.
Kandeler E, Tscherko D & Bruce K.D. (2000). Structure and function of the soil microbial
community in microhabitats of a heavy metal polluted soil. J Biol Fert Soils., 32: 390-400.
Katsalirou E, Deng S. Nofziger D.L. Gerakis A & Fuhlendorf S.D. (2010). Spatial structure of
microbial biomass and activity in prairie soil ecosystems. Eu J Soil Biol., 46:181-189.
Kaur G, Kaur J, Dadhich S & Cameotra S.S. (2011). Phosphate solubilizing bacteria
Microbacterium paraoxydans isolated from the rhizospheric system of wheat (Triticum
aestivum). Transylv Rev Syst Ecol Res., 1(12): 149.
Kaur G, Singh H.P, Batish D.R, Mahajan P, Kohli R.K & Rishi V. (2015). Exogenous nitric oxide
(NO) interferes with lead (Pb)-induced toxicity by detoxifying reactive oxygen species in
hydroponically grown wheat (Triticum aestivum) roots. PLoS One., 10(9): e0138713.
Kaurin A, Cernilogar Z & Lestan D. (2018). Revitalisation of metal-contaminated, EDTA-washed
soil by addition of unpolluted soil, compost and biochar: Effects on soil enzyme activity,
microbial community composition and abundance. Chemosphere., 193: 726-736.
Kavamura V.N & Esposito E. (2010). Biotechnological strategies applied to the decontamination
of soils polluted with heavy metals. Biotechnol Adv., 28(1): 61-69.
Kessler R. (2013). Sunset for leaded aviation gasoline? Environ. Health Perspect. 121(2): a54.
![Page 189: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/189.jpg)
170
Kim A.Y, Shahzad R, Kang S.M, Seo C.W, Park Y.G, Park H.J & Lee I.J. (2017). IAA-producing
Klebsiella variicola AY13 reprograms soybean growth during flooding stress. J Crop Sci
Biotechnol., 20(4): 235-242.
Knight B.P, McGrath S.P & Chaudri A.M. (1997). Biomass carbon measurements and substrate
utilization patterns of microbial populations from soils amended with cadmium, copper, or
zinc. Appl Environ Microb., 63(1): 39-43.
Kohler C, Merkle T & Neuhaus G. (1999). Characterisation of a novel gene family of putative
cyclic nucleotide- and calmodulin-regulated ion channels in Arabidopsis thaliana. Plant J.,
18(1): 97-104
Kotrba P, Najmanovaa J, Maceka T, Rumla T & Mackovaa M. (2009). Genetically modified plants
in phytoremediation of heavy metal and metalloid soil and sediment pollution. Biotechnol Adv.,
2: 799-810.
Kumar K.V, Srivastava S, Singh N & Behl H.M. (2009). Role of metal resistant plant growth
promoting bacteria in ameliorating fly ash to the growth of Brassica juncea. J Hazard Mater.,
170(1): 51-57.
Kushwaha A, Hans N, Kumar S & Rani R. (2018). A critical review on speciation, mobilization
and toxicity of lead in soil-microbe-plant system and bioremediation strategies. Ecotox
Environ Safe., 147: 1035-1045.
Lasat M.M. (2002). Phytoextraction of toxic metals. J Environ Qual., 31(1): 109-120.
Lee S.W, Glickmann E & Cooksey D.A. (2001). Chromosomal locus for cadmium resistance in
Pseudomonas putida consisting of a cadmium-transporting ATPase and a MerR family
response regulator. Appl Environ Microbiol., 67(4): 1437-1444.
Leedjärv A, Ivask A & Virta M. (2008). Interplay of different transporters in the mediation of
divalent heavy metal resistance in Pseudomonas putida KT2440. J Bacteriol., 190(8): 2680-
2689.
Leilei Z, Mingxin H & Suiyi Z. (2012). Enzymatic remediation of the polluted crude oil by
Rhodococcus. Afr J Microbiol Res., 6(6): 1213-1220.
Lin J.H, Lee D.J & Chang J.S. (2015). Lutein production from biomass: marigold flowers versus
microalgae. Bioresour Technol., 184: 421-428.
![Page 190: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/190.jpg)
171
Liu D, Li T, Yang X, Islam E, Jin X & Mahmood Q. (2007). Enhancement of lead uptake by
hyperaccumulator plant species Sedum alfredii Hance using EDTA and IAA. Bull Environ
Contam Toxicol., 78(3-4): 280-283.
Liu J.N, Zhou Q.X, Sun T, Ma L.Q & Wang S. (2008). Growth responses of three ornamental
plants to Cd and Cd–Pb stress and their metal accumulation characteristics. J Hazard Mater.,
151 (1): 261-267.
Lock H. (1948). Production of hydrocyanic acid by bacteria. Physiol Plant., 1: 142-146.
López M.L, Peralta-Videa J.R, Benitez T & Gardea-Torresdey J.L. (2005). Enhancement of lead
uptake by alfalfa (Medicago sativa) using EDTA and a plant growth promoter. Chemosphere.,
61(4): 595-598.
López-Ortega M.D.P, Criollo-Campos P.J, Gómez-Vargas R.M, Camelo-Rusinque M, Estrada-
Bonilla G, Garrido-Rubiano M.F & Bonilla-Buitrago R. (2013). Characterization of
diazotrophic phosphate solubilizing bacteria as growth promoters of maize plants. Rev Colomb
Biotecnol., 15(2): 115-123.
Loria C.C.R, Peralta-Perez M.D.R, Buendia-Gonzalez L & Volke-SepulvedaT.L. (2015). Effect
of a saprophytic fungus on the growth and the lead uptake, translocation and immobilization
in Dodonaea viscosa. Int J Phytoremediat., 14: 518-529.
Lu Y, Luo D, Lai A, Liu G, Liu L, Long J.. & Chen Y. (2017). Leaching characteristics of EDTA-
enhanced phytoextraction of Cd and Pb by Zea mays L. in different particle-size fractions of
soil aggregates exposed to artificial rain. Environ Sci Pollut R, 24(2): 1845-1853.
Ma L.Q, Komar K.M, Tu C, Zhang W, Cai Y & Kennelley E.D. (2001). A fern that
hyperaccumulates arsenic. Nature., 409(6820) : 579-579.
Maestri E, Marmiroli M, Visioli G & Marmiroli N. (2010). Metal tolerance and
hyperaccumulation: costs and trade-offs between traits and environment. Environ Exp Bot., 68
(1): 1-13.
Malar S, Vikram S.S, Favas P.J & Perumal V. (2016). Lead heavy metal toxicity induced changes
on growth and antioxidative enzymes level in water hyacinths [Eichhornia crassipes (Mart.)].
Bot Studies., 55(1): 54.
Malik D.M, Khan M.A & Choudhry T.A. (1984). Analysis Manual of Soil, water and Plant. In:
Directorate of Soil Fertility and Soil Testing, Lahore, Pakistan.
![Page 191: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/191.jpg)
172
Malik R.N, Husain S.Z & Nazir I. (2010). Heavy metal contamination and accumulation in soil
and wild plant species from industrial area of Islamabad, Pakistan. Pak J Bot., 42(1): 291-301.
Manshadi M, Ziarati P, Ahmadi M & Fekri K. (2013). Greenhouse study of cadmium and lead
phytoextraction by five Pelargonium spices. Intl J Farm & Alli Sci., 2(18): 665-669.
Manzoor M, Gul I, Silvestre J, Kallerhoff J & Arshad M. (2018). Screening of indigenous
ornamental species from different plant families for Pb accumulation potential exposed to
metal gradient in spiked soils. Soil Sediment Contam., 27(5): 439-453.
Marçal D, Rêgo A.T, Carrondo M.A & Enguita F.J. (2009). 1, 3-Propanediol dehydrogenase from
Klebsiella pneumoniae: decameric quaternary structure and possible subunit cooperativity, J
Bacteriol., 191:1143-1151.
Max B, Salgado J.M, Rodríguez N, Cortés S, Converti A & Dominguez J.M. (2010).
Biotechnological production of citric acid. Braz J Microbiol., 41: 862-875.
McGrath S.P & Cunliffe C.H. (1985). A simplified method for the extraction of the metals Fe, Zn,
Cu, Ni, Cd, Pb, Ni, Cr, Co, and Mn from soils and sewage sludge. J Sci Food and Agric., 36:
794-798.
McLaughlin M.J. (2001). Aging of metals in soils changes bioavailability. Environ Risk Assess.,
4, 1–6.
McLean E.O. (1982). Soil pH and lime requirement. In: Methods of soil analysis. Part 2 - Chemical
and microbiological properties. (2nd Ed.). A.L.R.H Miller & D.R Keeney (eds.) Agronomy, 9:
199-223.
Megharaj K.V.M, Sethunathan N & Naidu R. (2003). Bioavailability and toxicity of cadmium to
microorganisms and their activities in soil. Adv Environ Res., 8: 121-135.
Memon F, Narejo N.T, Abbasi A, Soomro A & Kunbhar K. (2014). Blood and offal tissue lead
levels of Goats, sheep and chickens farmed near battery recycling smelters of Hyderabad
Pakistan. Sindh University Research Journal-SURJ (Science Series), 46(4).
Meyers D.E, Auchterlonie G.J, Webb R.I & Wood B. (2008). Uptake and localisation of lead in
the root system of Brassica juncea. Environ Pollut., 153(2): 323-332.
Moeskops B, Buchan D, Sleutel S, Herawaty L, Husen E, Saraswati R, Setyorini D & De Neve S.
(2010). Soil microbial communities and activities under intensive organic and conventional
vegetable farming in West Java, Indonesia. Appl Soil Ecol., 45: 112-120.
![Page 192: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/192.jpg)
173
Mohammed A, Oyeleke S.B, Ndamitso M.M, Achife C.E & Badeggi U.M. (2013). The impact of
electronic waste disposal and possible microbial and plant control. Int J Eng Sci., 2(10): 35-
42.
Monchy S, Benotmane M.A, Janssen P, Vallaeys T, Taghavi S, van der Lelie D & Mergeay M.
(2007). Plasmids pMOL28 and pMOL30 of Cupriavidus metallidurans are specialized in the
maximal viable response to heavy metals. J Bacteriol., 189(20): 7417-7425.
Muhammad S, Shah M.T & Khan S. (2011). Heavy metal concentrations in soil and wild plants
growing around Pb–Zn sulfide terrain in the Kohistan region, northern Pakistan.
Microchemical Journal, 99(1): 67-75.
Mukhopadhyay M & Mondal T.K. (2015). Effect of zinc and boron on growth and water relations
of Camellia sinensis (L.) O. Kuntze cv. T-78. Natl Acad Sci Lett., 38: 283-286.
Munawar S & Iram S. (2014). Chelating impact assessment of biological and chemical chelates on
metal extraction from contaminated soils. J Chem Soc Pak., 36(3): 548-555.
Navarro-Noya Y.E, Hernández-Mendoza E, Morales-Jiménez J, Jan-Roblero J, Martínez-Romero
E & Hernández-Rodríguez C. (2012). Isolation and characterization of nitrogen fixing
heterotrophic bacteria from the rhizosphere of pioneer plants growing on mine tailings. Appl
Soil Ecol., 62: 52-60.
Nazir A, Malik R.N, Ajaib M, Khan N & Siddiqui M.F. (2011). Hyperaccumulators of heavy
metals of industrial areas of Islamabad and Rawalpindi. Pak J Bot., 43(4), 1925-1933.
Ni Q, Bao Z, Yang D & Zhang T. (2009). Distribution of heavy metal contents of urban soils in
sanya, China in bioinformatics and biomedical engineering. 3rd International Conference on
Bioinformatics and Biomedical Engineering (ICBBE). pp. 1-5.
Ousmanova D & Parker W. (2007). Fungal generation of organic acids for removal of lead from
contaminated soil. Water Air Soil Poll., 179: 65-380.
Pande A, Pandey P, Mehra S, Singh M & Kaushik S. (2017). Phenotypic and genotypic
characterization of phosphate solubilizing bacteria and their efficiency on the growth of maize.
Genet Eng Biotechnol J., 15(2): 379-391.
Pandey S.K & Bhattacharya T. (2018). Effect of two biodegradable chelates on metals uptake,
translocation and biochemical changes of Lantana camara growing in fly ash amended soil.
Int J Phytorem., 20(3): 214-224.
![Page 193: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/193.jpg)
174
Panneerselvam P, Choppala G, Kunhikrishnan A & Bolan N. (2013). Potential of novel bacterial
consortium for the remediation of chromium contamination. Water Air Soil Pollut., 224(12):
1716-1717.
Patel S & Kasture A. (2014). E (electronic) waste management using biological systems-overview.
Int J Curr Microbiol Appl Sci., 3(7): 495-504.
Permina E.A, Kazakov A.E, Kalinina O.V & Gelfand M.S. (2006). Comparative genomics of
regulation of heavy metal resistance in Eubacteria. BMC Microbiology., 6(1): 49.
Petruzzelli G, Pedron F, Rosellini I & Barbafieri M. (2015). The bioavailability processes as a key
to evaluate phytoremediation efficiency. In: Phytoremediation. Springer, Cham. 1: 31-43
Pikovskaya I. (1948). Mobilization of phosphorus in soil connection with the vital activity of some
microbial species. Microbiologia., 17: 362-370.
Pilon-Smits E. (2005). Phytoremediation. Annu Rev Plant Biol., 56: 15-39.
Pourrut B, Perchet G, Silvestre J, Cecchi M, Guiresse M & Pinelli E. (2008). Potential role of
NADPH-oxidase in early steps of lead-induced oxidative burst in Vicia faba roots. J Plant
physiol., 165(6): 571-579.
Pourrut B, Shahid M, Dumat C, Winterton P & Pinelli E. (2011). Lead uptake, toxicity, and
detoxification in plants. In: Reviews of Environmental Contamination and Toxicology.
Springer, New York, 213: pp 113-136.
Povedano-Priego C, Martín-Sánchez I, Jroundi F, Sánchez-Castro I & Merroun M.L. (2017).
Fungal biomineralization of lead phosphates on the surface of lead metal. Miner Eng., 106: 46-
54.
Prasad M.N.V & Freitas H.M.O (2006). Metal-tolerant plants: biodiversity prospecting for
phytoremediation technology. In: Trace elements in the environment: biogeochemistry,
biotechnology, and bioremediation. M.N.V Prasad, K.S Sajwan, R Naidu. 483-506 Boca Raton
(L, NY). CRC Press. pp 483-506.
Prasad M.N.V & Freitas H.M.O. (2003). Metal hyperaccumulation in plants: biodiversity
prospecting for phytoremediation technology. Electron J Biotechnol., 6(3): 285-321.
Punamiya P, Datta R, Sarkar D, Barber S, Patel M & Das P. (2010). Symbiotic role of Glomus
mosseae in phytoextraction of lead in vetiver grass [Chrysopogon zizanioides (L.)]. J Hazard
Mater., 177: 465-474.
![Page 194: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/194.jpg)
175
Qing H.U, Qi H.Y, Zeng J.H & Zhang H.X. (2007). Bacterial diversity in soils around a lead and
zinc mine. J Environ Sci., 19(1): 74-79.
Rajkumar M & Freitas H. (2008). Influence of metal resistant-plant growth-promoting bacteria on
the growth of Ricinus communis in soil contaminated with heavy metals. Chemosphere., 71(5):
834-842.
Rajkumar M, Sandhya S, Prasad M.N.V & Freitas H. (2012). Perspectives of plant-associated
microbes in heavy metal phytoremediation. Biotechnol Adv., 30: 1562–1574.
Raskin I & Ensley B.D. (2000). Phytoremediation of toxic metals using plants to clean up the
environment. I Raskin B.D Ensley). John Wiley and Sons, New York, pp 247-271.
Ravanbakhsh M, Ronaghi A.M, Taghavi S.M & Jousset A. (2016). Screening for the next
generation heavy metal hyperaccumulators for dryland decontamination. J Environ Chem
Eng., 4(2): 2350-2355.
Reena T, Dhanya H, Deepthi M.S & Pravitha D.L. (2013). Isolation of phosphate solubilizing
bacteria and fungi from rhizospheres soil from banana plants and its effect on the growth of
Amaranthus cruentus L. J Pharm Biol Sci., 5(3): 6-11.
Robinson B, Green S, Mills T, Clothier B, van der Velde M, Laplane R, Fung L, Deurer M, Hurst
S, Thayalakumaran T & van den Dijssel C. (2003). Phytoremediation: using plants as
biopumps to improve degraded environments. Soil Res., 41(3): 599-611.
Romero-Freire A, Martin Peinado F.J, van & Gestel C.A.M. (2015). Effect of soil properties on
the toxicity of Pb: Assessment of the appropriateness of guideline values. J Hazard Mater.,
289: 46-53.
Romero-Hernández J.A, Amaya-Chávez A, Balderas-Hernández P, Roa-Morales G, González-
Rivas N & Balderas-Plata M.Á. (2017). Tolerance and hyperaccumulation of a mixture of
heavy metals (Cu, Pb, Hg and Zn) by four aquatic macrophytes. Int J Phytorem., 19(3): 239-
245.
Roy M, McDonald L.M. (2015). Metal uptake in plants and health risk assessments in metal-
contaminated smelter soils. L Degrad Dev., 26: 785-792.
Sahodaran N.K & Ray J.G. (2018). Heavy metal contamination in “chemicalized’ green revolution
banana fields in southern India. Environ Sci Pollut Res., DOI: 10.1007/s11356-018-2729-0.
Salt D.E, Smith R.D & Raskin I. (1998). Phytoremediation. Annu Rev Plant Physiol Plant Mol
Biol., 49: 643-668.
![Page 195: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/195.jpg)
176
Sardar K, Qing C, Hesham A, Yue X & He J. (2007). Soil enzymatic activities and microbial
community structure with different application rates of Cd and Pb. J Environ Sci., 19(7), 834-
840.
Sarwar M, Arshad M, Martens D.A & Frankenberger W.T. (1992). Tryptophan-dependent
biosynthesis of auxins in soil, Plant and Soil., 147: 207-215.
Sauerbeck D. (1982). Which heavy metal contents in plants must not be exceeded in order to avoid
growth inhibitions? (Forsch. Special issue conference volume). pp: 108-129.
Schwyn B & Neilands J.B. (1987) Universal chemical assay for the detection and determination
of siderophores. Anal Biochem., 160: 47-56.
Sebiomo A, Banjo F.M, Ade-Ogunnowo F.E & Fagbemi F.T. (2017). Microbial population,
dehydrogenase and urease activities in soils polluted with spent engine and diesel oil. Afr J Sci
N., 4: 56-65.
Seneviratne M, Seneviratne G, Madawala H.M.S.P, Iqbal M.C.M, Rajakaruna N, Bandara T &
Vithanage M. (2015). A preliminary study of the role of bacterial–fungal co-inoculation on
heavy metal phytotoxicity in serpentine soil. Aus J Bot., 63(4): 261-268.
Seregin I.V, Shpigun L.K &Ivanov V.B. (2004). Distribution and toxic effects of cadmium and
lead on maize roots. Russ J Plant Physiol., 51(4): 525–533
Sessitsch A, Kuffner M, Kidd P, Vangronsveld J, Wenzel W.W, Fallmann K & Puschenreiter M.
2013. The role of plant-associated bacteria in the mobilization and phytoextraction of trace
elements in contaminated soils. Soil Biol Biochem., 60: 182-194.
Sezgin N, Ozcan H.K, Demir G, Nemlioglu S & Bayat C. (2004). Determination of heavy metal
concentrations in street dusts in Istanbul E-5 highway. Environ Int., 29(7): 979-985.
Shahid M, Arshad M, Kaemmerer M & Pinelli E. (2012a). Long-term field metal extraction by
Pelargonium: phytoextraction efficiency in relation to plant maturity. Int J Phytorem., 14: 493-
505.
Shahid M, Dumat C, Aslam M & Pinelli E. (2012b). Assessment of lead speciation by organic
ligands using speciation models. Chem Spec Bioavailab., 24(4): 248-252.
Shahid M, Dumat C, Pourrut B, Abbas G, Shahid N & Pinelli E. (2015). Role of metal speciation
in lead-induced oxidative stress to Vicia faba roots. Russ J Plant Physiol., 62(4): 448-454.
![Page 196: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/196.jpg)
177
Shahid M, Pinelli E, Pourrut B & Dumat C. (2014). Effect of organic ligands on lead-induced
oxidative damage and enhanced antioxidant defense in the leaves of Vicia faba plants. Journal
of Geochemical Exploration., 144: 282-289.
Shahid M, Pinelli E, Pourrut B, Silvestre J & Dumat C. (2011). Lead-induced genotoxicity to Vicia
faba L. roots in relation with metal cell uptake and initial speciation. Ecotoxicol Environ
safe., 74(1): 78-84.
Shahid M. (2010). Lead-induced toxicity to Vicia faba L. in relation with metal cell uptake and
speciation. PhD thesis, INP-ENSAT, University of Toulouse, Toulouse-FRANCE.
Sharma P & Dubey R.S. (2005). Lead toxicity in plants. Braz J Plant Physiol., 17(1): 35-52.
Shehata H.R, Lyons E.M, Jordan K.S & Raizada M.N. (2016). Relevance of in vitro agar based
screens to characterize the anti-fungal activities of bacterial endophyte communities. BMC
microbiology., 16(1): 8.
Shen Z.G & Liu Y.L. (1998). Progress in the study on the plants that hyperaccumulate heavy metal.
Plant Physiol Com., 34: 133-139.
Shen Z.G, Li X.D, Wang C.C, Chen H.M & Chua H. (2002). Lead phytoextraction from
contaminated soil with high-biomass plant species. J Environ Qual., 31(6): 1893-1900.
Sheng X.F, Jiang C.Y & He L.Y. (2008a). Characterization of plant growth-promoting Bacillus
edaphicus NBT and its effect on lead uptake by Indian mustard in a lead-amended soil. Can J
Microbiol., 54(5): 417-422.
Sheng X.F, Xia J.J, Jiang C.Y, He L.Y & Qian M. (2008b). Characterization of heavy metal-
resistant endophytic bacteria from rape (Brassica napus) roots and their potential in promoting
the growth and lead accumulation of rape. Environ Pollut., 156(3): 1164-1170.
Shi G, Chen Z, Xu S, Zhang J, Wang L, Bi C & Teng J. (2008). Potentially toxic metal
contamination of urban soils and roadside dust in Shanghai, China. Environ Pollut., 156(2):
251-260.
Siddique N, Majid A, Chaudhry M & Tufail M. (2011). Determination of heavy metals in air
conditioner dust using FAAS and INAA. J Rad Nuclear Chem., 292(1): 219-227.
Smith E, Kempson I.M, Juhasz A.L, Weber J, Rofe A & Gancarz D. (2011). In vivo–in vitro and
XANES spectroscopy assessments of lead bioavailability in contaminated periurban soils.
Environ Sci Technol., 45(14): 6145-6152.
![Page 197: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/197.jpg)
178
Sobolev D & Begonia M. (2008). Effects of heavy metal contamination upon soil microbes: lead-
induced changes in general and denitrifying microbial communities as evidenced by molecular
markers. Int J Environ Res Public H., 5(5): 450-456.
Sunil K.C.R, Swati K, Bhavya G, Nandhini M, Veedashree M, Prakash H.S, Kini K.R & Geetha
N. (2015) Streptomyces flavomacrosporus, A multi-metal tolerant potential bioremediation
candidate isolated from paddy field irrigated with industrial effluents. Int J Life Sci., 3(1): 9-
15.
Szczygłowska M, Piekarska A, Konieczka P & Namiesnik J. (2011). Use of brassica plants in the
phytoremediation and biofumigation processes. Int J Mol Sci., 12: 7760-7771.
Tabatabai M.A & Bremner J.M. (1969). Use of p-nitrophenyl phosphate for assay of soil
phosphatase activity. Soil Biol Biochem., 1: 301-307.
Tak H.I, Ahmad F & Babalola O.O. (2013). Advances in the application of plant growth-promoting
rhizobacteria in phytoremediation of heavy metals. In: Reviews of Environmental
Contamination and Toxicology. Springer, New York. 223: pp. 33-52.
Tan X, Liu Y, Yan K, Wang Z, Lu G, He Y & He W. (2017). Differences in the response of soil
dehydrogenase activity to Cd contamination are determined by the different substrates used for
its determination. Chemosphere., 169: 324-332.
Thamayanthi D, Sharavanan P.S & Jayaprasad B. (2013). Phytoremediation of lead contaminated
soil using ornamental plants (marigold and zinnia). J Environ Biol., 3(1): 32-34.
Thomas J.C, Malick F.K, Endreszl C, Davies E.C & Murray K.S. (1998). Distinct responses to
copper stress in the halophyte Mesembryanthemum crystallinum. Physiol Plant., 102(3): 360-
368.
Tong S, von Schirnding Y.E & Prapamontol T. (2000). Environmental lead exposure: a public
health problem of global dimensions. Bulletin WHO., 78(9): 1068-1077.
United States Environmental Protection Agency (USEPA). (1997). Cleaning up the nation’s waste
sites: markets and technology trends. EPA/542/R-96/005. Office of Solid Waste and
Emergency Response, Washington, DC.
Usha S & Padmavathi T. (2013). Effect of plant growth promoting microorganisms from
rhizosphere of Piper nigrum L. Int J Pharm Bio Sci., 4(1): 835-846.
Uzu G, Sobanska S, Sarret G, Munoz M & Dumat C. (2010). Foliar lead uptake by lettuce exposed
to atmospheric fallouts. Environ Sci Technol., 44(3): 1036-1042.
![Page 198: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/198.jpg)
179
Van der Ent A, Baker A.J, Reeves R.D, Pollard A.J & Schat H. (2013). Hyperaccumulators of
metal and metalloid trace elements: facts and fiction. Plant and Soil., 362(1-2): 319-334.
Velásquez L & Dussan J. (2009). Biosorption and bioaccumulation of heavy metals on dead and
living biomass of Bacillus sphaericus. J Hazard Mater., 167(3):713-716.
Wakelin S.A, Warren R.A, Harvey P.R & Ryder M.H. (2004). Phosphate solubilization by
Penicillium spp. closely associated with wheat roots. Biol Fert Soils., 40(1): 36-43.
Walkley A & Black I.A. (1934). An examination of Degtjareff method for determining soil organic
matter and a proposed modification of the chromic acid titration method. Soil Sci., 37: 29-37.
Wang H, Shan X, Wen B, Owens G, Fang J & Zhang S. (2007). Effect of indole-3-acetic acid on
lead accumulation in maize (Zea mays L.) seedlings and the relevant antioxidant response.
Environ Exper Bot., 61(3) : 246-253.
Waqas M, Khan A.L, Kamran M, Hamayun M, Kang S.M, Kim Y.H & Lee I.J. (2012). Endophytic
fungi produce gibberellins and indole acetic acid and promotes host-plant growth during Stress.
Molecules., 17: 10754-10773.
Wei C, Chen T, Huang Z & Zhang X. (2002). Cretan brake (Pteris cretica L.): an arsenic-
accumulating plant. Acta Ecologica Sinica., 22(5): 777-778.
Wei S, da Silva J.A.T & Zhou Q. (2008). Agro-improving method of phytoextracting heavy metal
contaminated soil. J Hazard Mater., 150 (3), 662-668.
WHO. (2001). WHO Regional Office for Europe, Air Quality Guidelines, Lead, Copenhagen,
Denmark, 2nd edition, http://www.euro.who.int/document/aiq/6 7lead.pdf.
WHO. (2017). Lead poisoning and health. Date searched on:
http://www.who.int/mediacentre/factsheets/fs379/en/
Wierzbicka M.H, Przedpełska E, Ruzik R, Ouerdane L, Połeć-Pawlak K, Jarosz M, Szpunar J &
Szakiel A. (2007). Comparison of the toxicity and distribution of cadmium and lead in plant
cells. Protoplasma., 231(1-2): 99.
Williams L.E, Pittman J.K & Hall J.L. (2000). Emerging mechanisms for heavy metal transport in
plants. Bioch Biophy Acta., 1463: 104-126.
Wu L.H, Luo Y.M, Christie P & Wong M.H. (2003). Effects of EDTA and low molecular weight
organic acids on soil solution properties of a heavy metal polluted soil. Chemosphere., 50: 819-
822.
![Page 199: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/199.jpg)
180
Xiao C, Chi R, He H, Qiu G, Wang D & Zhang W. (2009). Isolation of phosphate-solubilizing
fungi from phosphate mines and their effect on wheat seedling growth. Appl Biochem Biotech.,
159(2): 330-342.
Xiao C, Chi R, Li X, Xia M & Xia Z. (2011). Biosolubilization of rock phosphate by three stress-
tolerant fungal strains. Appl Biochem Biotech., 165(2): 719-727.
Xu Z.M, Tan X.Q, Mei X.Q, Li Q.S, Zhou C & Wang L.L. (2018). Low-Cd tomato cultivars
(Solanum lycopersicum L.) screened in non-saline soils also accumulated low Cd, Zn, and Cu
in heavy metal-polluted saline soils. Environ Sci Pollut Res., 25(27): 27439-27450.
Yadav B.K, Siebel M.A & van Bruggen J.J. (2011). Rhizofiltration of a heavy metal (lead)
containing wastewater using the wetland plant Carex pendula. Clean–Soil, Air, Water, 39(5):
467-474.
Yahaghi Z, Shirvani M, Nourbakhsh F, De La Pena T.C, Pueyo J.J & Talebi M. (2018). Isolation
and characterization of pb-solubilizing bacteria and their effects on pb uptake by Brassica
juncea: implications for microbe-assisted phytoremediation. J Microbiol Biotechnol., 28(7):
1156-1167.
Yang X, Liu J, McGrouther K, Huang H, Lu K, Guo X, He L, Lin X, Che L, Ye Z & Wang H.
(2016). Effect of biochar on the extractability of heavy metals (Cd, Cu, Pb, and Zn) and enzyme
activity in soil. Environ Sci Pollut Res., 23(2): 974-984.
Yang Y, Han X, Liang Y, Ghosh A, Chen J & Tang M. (2015). The combined effects of arbuscular
mycorrhizal fungi (AMF) and lead (Pb) stress on Pb accumulation, plant growth parameters,
photosynthesis, and antioxidant enzymes in Robinia pseudoacacia L. PLoS One., 10(12): 1-24
Yasser M.M, Mousa A.S.M, Massoud O.N & Nasr S.H. (2014). Solubilization of inorganic
phosphate by phosphate solubilizing fungi isolated from Egyptian soils. J Biol Earth Sci., 4(1):
83-90.
Yongpisanphop J, Babel S, Kruatrachue M & Pokethitiyook P. (2017). Phytoremediation potential
of plants growing on the Pb-contaminated soil at the Song Tho Pb mine, Thailand. Soil
Sediment Contam., 26(4): 426-437.
Yoon J, Cao X, Zhou Q & Ma L.Q. (2006). Accumulation of Pb, Cu, and Zn in native plants
growing on a contaminated Florida site. Sci Total Environ., 368(2): 456-464.
![Page 200: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/200.jpg)
181
Yu Q, Tian H, Yue K, Liu J, Zhang B, Li X & Ding Z. (2016). A P-loop NTPase regulates quiescent
center cell division and distal stem cell identity through the regulation of ROS homeostasis in
Arabidopsis root. PLoS genetics., 12(9): e1006175.
Yu S, Bai X, Liang J, Wei Y, Huang S, Li Y, Dong L, Liu X, Qu J & Yan L. (2019). Inoculation
of Pseudomonas sp. GHD-4 and mushroom residue carrier increased the soil enzyme activities
and microbial community diversity in Pb-contaminated soils. J Soil Sediment., 19(3): 1064-
1076.
Zaveri P, Patel R, Rana P, Shah B, Mahto N & Munshi N.S. (2016). Assessment of enzyme activity
and functional microbial diversity in coastal and desert soil ecosystems of Gujarat. J Enzymol
Metabol., 2: 1-9.
Zhang H, Guo Q, Yang J, Ma J, Chen G, Chen T & Shao C. (2016). Comparison of chelates for
enhancing Ricinus communis L. phytoremediation of Cd and Pb contaminated soil. Ecotoxicol
Environ Safe., 133: 57-62.
Zhang W, Chen L, Zhang R & Lin K. (2016). High throughput sequencing analysis of the joint
effects of BDE209-Pb on soil bacterial community structure. J Hazard Mater., 301: 1-7.
Zhang Y, He L, Chen Z, Zhang W, Wang Q, Qian M & Sheng X. (2010). Characterization of lead-
resistant and ACC deaminase-producing endophytic bacteria and their potential in promoting
lead accumulation of rape. J Hazard Mater., 186: 1720–1725.
Zhu S.C, Tang J.X, Zeng X.X, Wei B.J & Huang B. (2015). Isolation of Mucor circinelloides Z4
and Mucor racemosus Z8 from heavy metal-contaminated soil and their potential in promoting
phytoextraction with Guizhou oilseed rap. J Central South Uni., 22(1): 88-94.
![Page 201: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/201.jpg)
182
ANNEXURE
LIST OF PUBLICATIONS
Maria Manzoor
PhD Candidate, IESE-SCEE, NUST
Journal Papers
1. Maria Manzoor, Iram Gul, Jerome Silvestre, Jean Kallerhoff, Muhammad Arshad (2018)
Screening of indigenous ornamental species from different plant families for Pb
accumulation potential exposed to metal gradient in spiked soils. Soil and Sediment
Contamination an International Journal, 27(5): 439-453. DOI:
10.1080/15320383.2018.1488238
2. Maria Manzoor, Rafia Abid, Bala Rathinasabapathi, Letuzia M. De Oliveira, Evandro da
Silva, Fenglin Deng, Christopher Rensing, Muhammad Arshad, Iram Gul, Ping Xiang,
Lena Q Ma (2019) Metal tolerance of arsenic-resistant bacteria and their potential to
promote plant growth in Pb-contaminated soil. Science of the Total Environment, 660: 18-
24. DOI: 10.1016/j.scitotenv.2019.01.013
3. Maria Manzoor, Iram Gul, Iftikhar Ahmed, Muhammad Zeeshan, Imran Hashmi, ilal
Ahmad Zafar Amin, Jean Kallerhoff, Muhammad Arshad (2019) Metal tolerant bacteria
enhanced phytoextraction of lead by two accumulator ornamental species. Chemosphere.
227: 561-569. DOI: 10.1016/j.chemosphere.2019.04.093
4. Maria Manzoor, Iram Gul, Jean Kallerhoff, Muhammad Arshad (2019) Fungi assisted
phytoextraction of lead: tolerance, plant growth promoting activities and phytoavailability.
Environmental Science and Pollution Research. DOI: 10.1007/s11356-019-05656-3
Conefercne Papers
1. Maria Manzoor, Iram Gul, Jean Kallerhoff, Muhammad Arshad. Screening of Native
Ornamental Species as Phytoremediation Technology for Pb Contaminated Soil; Species
Variation in Lead Uptake and Translocation. International Conference on Bio-approaches
for Environment and Sustainability (ICBES-2017), held on February 22nd - 23rd 2017 at
NUST Islamabad.
![Page 202: MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT INTERFACE …](https://reader031.vdocuments.site/reader031/viewer/2022022217/6214b665861eac3d985ff118/html5/thumbnails/202.jpg)
183
2. Maria Manzoor, Iram Gul, Jean Kallerhoff, Muhammad Arshad. Evaluating potential of
ornamental plants to grow in lead contaminated soil. The International Conference on
Environmentally Sustainable Development (ESDev-VII), held on August 19th - 21st 2017,
COMSATS Abbottabad.
3. Maria Manzoor, Iram Gul, Jean Kallerhoff, Muhammad Arshad, Lena Q. Ma. Lead
Availability and phytoextraction in Rhizosphere–plant system. Environmental Science
Forum 2017, held on November 3rd 2017 at University of Florida USA.
4. Maria Manzoor, Iram Gul, Jean Kallerhoff, Muhammad Arshad. 2018. Effect of different
levels of lead on soil enzymatic activity and restoration by resistant bacteria. 11th
International conference on sustainable energy & environmental protection (SEEPS 2018),
held on 08th - 11th May, 2018 Paisley, UK. (Paper Published)
5. Maria Manzoor, Iram Gul, Imran Hashmi, Muhammad Zeeshan Ali Khan, Jean Kallerhoff,
Muhammad Arshad. Enhanced phytoextraction of Lead by plant growth promoting (PGP)
bacteria. 5th International Conference on Environmental Horizon (ICEH-2019), held on
11th - 13th January 2019 at University of Karachi, Pakistan.
6. Maria Manzoor, Iram Gul, Imran Hashmi, Muhammad Zeeshan Ali Khan, Jean Kallerhoff,
Muhammad Arshad. Lead Availability and Phytoextraction in Rhizosphere-Plant System.
International Conference on Environmental Toxicology and Health (ESCON, 2019), held
on 25th - 27th February, 2019 at COMSATS University, Vehari Pakistan.