![Page 1: DNA – How it Works Part 1 The importance of DNA clickThe importance of DNA](https://reader035.vdocuments.site/reader035/viewer/2022070404/56649f335503460f94c50044/html5/thumbnails/1.jpg)
DNA – How it WorksPart 1Part 1
•The importance of DNA click
![Page 2: DNA – How it Works Part 1 The importance of DNA clickThe importance of DNA](https://reader035.vdocuments.site/reader035/viewer/2022070404/56649f335503460f94c50044/html5/thumbnails/2.jpg)
Chromosomes are made of DNA…
![Page 3: DNA – How it Works Part 1 The importance of DNA clickThe importance of DNA](https://reader035.vdocuments.site/reader035/viewer/2022070404/56649f335503460f94c50044/html5/thumbnails/3.jpg)
DNA has two sides, each made of nucleotides…
![Page 4: DNA – How it Works Part 1 The importance of DNA clickThe importance of DNA](https://reader035.vdocuments.site/reader035/viewer/2022070404/56649f335503460f94c50044/html5/thumbnails/4.jpg)
Another look at the nucleotide…
![Page 5: DNA – How it Works Part 1 The importance of DNA clickThe importance of DNA](https://reader035.vdocuments.site/reader035/viewer/2022070404/56649f335503460f94c50044/html5/thumbnails/5.jpg)
Base Pairs ALWAYS Match Up!
Adenine with Adenine with ThymineThymine and vice versa and vice versa Cytosine with Cytosine with GuanineGuanine and vice versa and vice versa
A & G are A & G are PurinesPurines – – doubledouble rings rings C & T are C & T are PyrimidinesPyrimidines – – singlesingle rings rings
![Page 6: DNA – How it Works Part 1 The importance of DNA clickThe importance of DNA](https://reader035.vdocuments.site/reader035/viewer/2022070404/56649f335503460f94c50044/html5/thumbnails/6.jpg)
A look at the base pairs…
![Page 7: DNA – How it Works Part 1 The importance of DNA clickThe importance of DNA](https://reader035.vdocuments.site/reader035/viewer/2022070404/56649f335503460f94c50044/html5/thumbnails/7.jpg)
DNA Replication – Making a copy…
![Page 8: DNA – How it Works Part 1 The importance of DNA clickThe importance of DNA](https://reader035.vdocuments.site/reader035/viewer/2022070404/56649f335503460f94c50044/html5/thumbnails/8.jpg)
How it works… HelicaseHelicase (an enzyme) (an enzyme)
“unzips” the DNA“unzips” the DNA
![Page 9: DNA – How it Works Part 1 The importance of DNA clickThe importance of DNA](https://reader035.vdocuments.site/reader035/viewer/2022070404/56649f335503460f94c50044/html5/thumbnails/9.jpg)
How it Works, con’t… Each strand is used as aEach strand is used as a template template to build a to build a
complementarycomplementary strand strand When the complementary strand is When the complementary strand is
complete, it twists with the template strand complete, it twists with the template strand to form a new to form a new double helixdouble helix!!!!
![Page 10: DNA – How it Works Part 1 The importance of DNA clickThe importance of DNA](https://reader035.vdocuments.site/reader035/viewer/2022070404/56649f335503460f94c50044/html5/thumbnails/10.jpg)
Replication of DNA
Click this image to view movie
•Replication of DNA
![Page 11: DNA – How it Works Part 1 The importance of DNA clickThe importance of DNA](https://reader035.vdocuments.site/reader035/viewer/2022070404/56649f335503460f94c50044/html5/thumbnails/11.jpg)
Also, keep in mind… The Point where the double helix separates The Point where the double helix separates
is called the is called the replication forkreplication fork ( (looks like alooks like a Y) Y)
Enzymes called Enzymes called DNA polymeraseDNA polymerase move move along each strand adding the corresponding along each strand adding the corresponding nucleotides!nucleotides!
![Page 12: DNA – How it Works Part 1 The importance of DNA clickThe importance of DNA](https://reader035.vdocuments.site/reader035/viewer/2022070404/56649f335503460f94c50044/html5/thumbnails/12.jpg)
New DNA – Exactly like the old!
![Page 13: DNA – How it Works Part 1 The importance of DNA clickThe importance of DNA](https://reader035.vdocuments.site/reader035/viewer/2022070404/56649f335503460f94c50044/html5/thumbnails/13.jpg)
![Page 14: DNA – How it Works Part 1 The importance of DNA clickThe importance of DNA](https://reader035.vdocuments.site/reader035/viewer/2022070404/56649f335503460f94c50044/html5/thumbnails/14.jpg)
You tell me the complimentary strand… ATGGCGTCATGCTTAGATTACAATGGCGTCATGCTTAGATTACA
TACCGCAGTACGAATCTAATGTTACCGCAGTACGAATCTAATGT