Download - DNA and Beyond
DNA and BeyondDNA and Beyond
20112011
PHSPHS
Rashmi Pershad
ObjectivesObjectives
Learn about the role of DNA sequencing Learn about the role of DNA sequencing and fragment analysisand fragment analysis
Learn how to look up information on any Learn how to look up information on any gene of interestgene of interest
How to conduct a BLAST searchHow to conduct a BLAST search How to go from gene sequence to functionHow to go from gene sequence to function The $1,000 GenomeThe $1,000 Genome
DNA TechnologiesDNA Technologies MethodologyMethodology Fragment Analysis Fragment Analysis DNA SequencingDNA Sequencing Real time PCR Real time PCR
Applications:Applications: Medical DiagnosticsMedical Diagnostics Forensic AnalysisForensic Analysis Plant GeneticsPlant Genetics
Polymerase Chain ReactionPolymerase Chain Reaction
PCR Movie- Cold Spring HarborPCR Movie- Cold Spring Harbor http://www.dnalc.org/view/15475-The http://www.dnalc.org/view/15475-The
cycles-of-the-polymerase-chain-reaction-cycles-of-the-polymerase-chain-reaction-PCR-3D-animation-with-no-audio.htmlPCR-3D-animation-with-no-audio.html
PCR Movie Applied BiosystemsPCR Movie Applied Biosystems http://media.invitrogen.com.edgesuite.net/http://media.invitrogen.com.edgesuite.net/
ab/applications-technologies/pharma-ab/applications-technologies/pharma-biotherapeutics/pcr.swfbiotherapeutics/pcr.swf
MicrosatellitesMicrosatellites
What is a microsatellite?What is a microsatellite?
Are simple sequence repeats consisting of Are simple sequence repeats consisting of 1-6 base pair repeats1-6 base pair repeats
How can they be used?How can they be used?
They can be used as genetic markersThey can be used as genetic markers
377 gels96 well porous comb gelsData from 96 lanes in 2.5 hoursStill had to track create size standards and analyze data.
Study Microsatellite Instability
•Rox 350 size standard 0.02µl per sample
•Fiveplex Microsatellite Analysis
Fragment Analysis
Limitation of Instrumentation
In Cancer Center work with precious archival paraffin embedded patient DNA. Increased sensitivity provides more data from limited sample.
Too much sample results in pull upOptimal input of product for us is 0.4 ng/µl
DNA Sequencing Advances in DNA Sequencing Part I Overview Maxam Gilbert Sequencing-(1976) Sanger Sequencing Sequencing has been used to map the human genomes, mutation detection study genetic diseases such as CF, MS and to study cancer susceptibility genes. Fluoresent technology In 1986 ABI developed the technology to sequence using 4 dyes in one lane fluorescent technology. This allowed for increase in throughput and removed lane to lane variability. Platforms Initially all the work was performed using slab gels. In the early 1990s 24-36 lane capacity. In 1996 new instruments allowed for higher throughput 48,64 and 96 lane. Now capillary electrophoresis Celera Genomics versus NIH New technology is whole genome sequencing- Helicos
Dye Primer Labeling
And ddNTPS
dNTPs
AA
ACCG A
And ddNTPS
dNTPs
CC
ACCG A C
G
T
ACC
A
G
ACCGAC T
• 4 separate reactions
Taq polymerase
Taq polymerase
Dye Terminator labeling
Template
Primer A
AC
ACCG
ACCGT
Advantages •Reaction performed in single tube•Can used unlabeled primers •False stops are undetected
Taq polymerase, dNTPs+ ddTerminators
G
T
A
C
linker
Fluorescein donor Dye
dRhodamine Acceptor dye
Acceptor Dyes
dR6G AdRox CdR110 GdTamra T
Argon Laser
Emission spectra
500-600nm
CCD Camera
filter
Raw Data
•Donor Dye absorbs excitation energy from laser
•Transfers c.100% to acceptor molecule
•Big Dye gives 2-3 times brighter signal when incorporated into cycle sequencing product
Big Dye Terminators
DNA Sequencing MovieDNA Sequencing Movie
DNA Sequencing Movie- Applied DNA Sequencing Movie- Applied BiosystemsBiosystems
http://http://media.invitrogen.com.edgesuite.net/ab/media.invitrogen.com.edgesuite.net/ab/applications-technologies/pharma-applications-technologies/pharma-biotherapeutics/DNA_sequencing.swfbiotherapeutics/DNA_sequencing.swf
DATA FROM 3700 GENETIC ANALYZER RUN
Protocol
•Set up sequencing reaction in tube.•Keep reagents on ice•Mix well and spin briefly
Sequencing Reaction ProtocolReagent QuantityDNA 1.5µlPrimer 1.6µlBig Dye Terminator ready 2µlreaction mix5X reaction Buffer 3µldeionised water 11.9µlTotal Volume 20µl
Raw Sequence Data
Start of Sequence
Read out to 800 bases
Standard Template on Pop4 80cm Capillary.
Run under standard conditions
BDv3.1 ( 1µl)- 800-900 base reads
Data from a 3700 in 4hours run
Problematic Template on Pop4 80cm Capillary.
GC rich template with and without Enhancer A
Big dye Version 3.1
Normal Wilm’s Tumor Exon 9
Mutant C T
What do you do once you have a sequence?
•Compare it to normal sequence.
•Submit it to a sequence alignment program to assemble sequence
•Search database to identify sequence
DNA DatabasesDNA Databases When a scientist sequences a segment of DNA, be it a When a scientist sequences a segment of DNA, be it a
single gene, a gene operon or an entire chromosome or single gene, a gene operon or an entire chromosome or GENOMEGENOME, the sequence is deposited in an online , the sequence is deposited in an online database. database.
The most commonly used database in this country is The most commonly used database in this country is NCBI GenbankNCBI GenbankOther databases include:Other databases include:
EMBL-EBIEMBL-EBI (European Molecular Biology Laboratory- (European Molecular Biology Laboratory-European Bioinformatics Institute) European Bioinformatics Institute)
DDBJDDBJ (DNA Data Bank of Japan) (DNA Data Bank of Japan) These databases contains millions of DNA sequences These databases contains millions of DNA sequences
and exchange information dailyand exchange information daily
Bioinformatics Tools
BLAST( NCBI TOOL)
•Sequence Alignment
•Sequence Comparison
•Sequence Identification
BLAST SEARCHBLAST SEARCH NCBI allows users to search the databases and NCBI allows users to search the databases and
perform analyses in various ways.perform analyses in various ways. You can search by name for nucleotide You can search by name for nucleotide
sequences (genes) or amino acid sequences sequences (genes) or amino acid sequences (proteins). (proteins).
You can search by name for publications about You can search by name for publications about the sequence (recorded in the Science Life the sequence (recorded in the Science Life literature database called literature database called PUBMEDPUBMED). ).
You can search for similar sequences using the You can search for similar sequences using the feature called feature called BLASTBLAST (by inputting all or part of (by inputting all or part of a DNA or amino acid sequence) and compare a DNA or amino acid sequence) and compare two or more sequences. two or more sequences.
Pub MedPub Med
PUBMED is the NCBI database of PUBMED is the NCBI database of scientific literature that you can search scientific literature that you can search with terms of interest, to see what with terms of interest, to see what researchers have discovered about the researchers have discovered about the biology of proteins that are similar to your biology of proteins that are similar to your query sequence.query sequence.
Reference MaterialReference Material
http://www.pseudomonas-syringae.org/http://www.pseudomonas-syringae.org/Outreach/Module_4_Web.htmOutreach/Module_4_Web.htm
http://www.digitalworldbiology.com/http://www.digitalworldbiology.com/BLAST/slide1.htmlBLAST/slide1.html
Submit Search- WaitSubmit Search- Wait
New BLAST FormatNew BLAST Format
Genomic ViewGenomic View
BLAST OutputBLAST Output
NCBI Sequence RecordNCBI Sequence Record Each Each sequence recordsequence record in the NCBI sequence databases is in the NCBI sequence databases is
organized into three sections: organized into three sections: HeaderHeader – general information about the sequence including the – general information about the sequence including the
organism it came from and the paper in which it was first published. organism it came from and the paper in which it was first published. FeaturesFeatures - information about the role of the sequence in the biology - information about the role of the sequence in the biology
of the organism and any changes that have been made to the of the organism and any changes that have been made to the sequence. This section also includes information like the length of sequence. This section also includes information like the length of the sequence, the molecular weight of the protein, and any notes the sequence, the molecular weight of the protein, and any notes that the depositors wished to add. The start of this section is that the depositors wished to add. The start of this section is indicated with the label FEATURES on the left. Terms beginning indicated with the label FEATURES on the left. Terms beginning with a / are referred to as ‘qualifierswith a / are referred to as ‘qualifiers’’. Examples of qualifiers . Examples of qualifiers include /product, /gene, /locus_tag, and /note. include /product, /gene, /locus_tag, and /note.
SequenceSequence – nucleotides listed in order and numbered. The start of – nucleotides listed in order and numbered. The start of this section is indicated with the label ORIGIN on the left. this section is indicated with the label ORIGIN on the left.
Questions?Questions?
Question 1Question 1
1. How can you search Genebank for 1. How can you search Genebank for DNA sequences that are similar to your DNA sequences that are similar to your gene of interest?gene of interest?
a) Googlea) Google b) PubMedb) PubMed c) MySpacec) MySpace d) BLASTd) BLAST
AnswerAnswer
D D
BLASTBLAST
Question 2Question 2
If your E score is = 0If your E score is = 0 a) The sequence is 100% matcha) The sequence is 100% match b) The sequences are not alikeb) The sequences are not alike c) There is limited homology between c) There is limited homology between
sequencessequences d) Sequences are highly homologousd) Sequences are highly homologous
AnswerAnswer
AA
The e score shows the “expected” match The e score shows the “expected” match value. The lower the score the more value. The lower the score the more significant the alignment .significant the alignment .
Question 3Question 3
What does PCR stand for?What does PCR stand for?
AnswerAnswer
Polymerase Chain ReactionPolymerase Chain Reaction
Exercise 1Exercise 1
You will:You will: Copy the sequence provided in the box on the Copy the sequence provided in the box on the
Blast page of the NCBI :Blast page of the NCBI : websitehttp://www.ncbi.nlm.nih.gov/genome/websitehttp://www.ncbi.nlm.nih.gov/genome/
seq/BlastGen/BlastGen.cgi?taxid=9606seq/BlastGen/BlastGen.cgi?taxid=9606 Identify the name of the gene,Identify the name of the gene, Provide the title of the publication where the Provide the title of the publication where the
sequence was first published, the name of the sequence was first published, the name of the journal authors and the full title of the article.journal authors and the full title of the article.
What did you learn about this gene?What did you learn about this gene?
Exercise 1 continuedExercise 1 continued
You will be provided with a list of sequences that You will be provided with a list of sequences that you can use to perform BLAST searches.you can use to perform BLAST searches.
For each sequence provided you will answer For each sequence provided you will answer the questions from the previous slide.the questions from the previous slide.
If you need to review a BLAST tutorial you can If you need to review a BLAST tutorial you can find one at: find one at: http://www.digitalworldbiology.com/BLAST/slide1http://www.digitalworldbiology.com/BLAST/slide1.html.html
Sequence 1Sequence 1
TCGAAATAACGCGTGTTCTCAACGCGGTCGCGCAGATGCCTTTGCTCGAAATAACGCGTGTTCTCAACGCGGTCGCGCAGATGCCTTTGCTCATCTCATCAGATGCGACCGCAACCACGTCCGCCGCCTTGTTCGCCGTCCCAGATGCGACCGCAACCACGTCCGCCGCCTTGTTCGCCGTCCCCGTGCCTCCGTGCCTCAACCACCACCACGGTGTCGTCTTCCCCGAACGCGTCCCGGTCAACCACCACCACGGTGTCGTCTTCCCCGAACGCGTCCCGGTCAGCCAGCCAGCCAGCCTCCACGCGCCGCGCGCGCGGAGTGCCCATTCGGGCCGCAGCTCCACGCGCCGCGCGCGCGGAGTGCCCATTCGGGCCGCAGCTGCGACGGTTGCGACGGTGCCGCTCAGATTCTGTGTGGCAGGCGCGTGTTGGAGTCTAAA GCCGCTCAGATTCTGTGTGGCAGGCGCGTGTTGGAGTCTAAA
Sequence 2Sequence 2 GTTTATTAGTGATCATGGCTAAGTTTGCGTCCATCATCGCACTTGTTTATTAGTGATCATGGCTAAGTTTGCGTCCATCATCGCACTT
CTTTTTCTTTTTGCTGCTCTTGTTCTTTTTGCTGCTTTCGAAGCACCAACAATGGTGCTGCTCTTGTTCTTTTTGCTGCTTTCGAAGCACCAACAATGGTGGAAGCGGAAGCACAGAAGTTGTGCGAAAGGCCAAGTGGGACATGGTCAGGAGTACAGAAGTTGTGCGAAAGGCCAAGTGGGACATGGTCAGGAGTCTGTGGAACTGTGGAAACAATAACGCATGCAAGAATCAGTGCATTAACCTTGAGAAAGCAACAATAACGCATGCAAGAATCAGTGCATTAACCTTGAGAAAGCACGACATCGACATGGATCTTGCAACTATGTCTTCCCAGCTCACAAGTGTATCTGCTAGGATCTTGCAACTATGTCTTCCCAGCTCACAAGTGTATCTGCTACTTTCCCTTTCCTTGTTAATTTATCGCAAACTCTTTGGTGAATAGTTTTTATGTAATTTGTTAATTTATCGCAAACTCTTTGGTGAATAGTTTTTATGTAATTTACATTACACAAAATAAGTCAGTGTCACTATCCATGAGTGATTTTAAGACATGCAAAATAAGTCAGTGTCACTATCCATGAGTGATTTTAAGACATGTACCAGTACCAGATATGTTATGTTGGTTCGGTTATACAAATAAAGTTTTATTCACCAATATGTTATGTTGGTTCGGTTATACAAATAAAGTTTTATTCACCA
Sequence 3Sequence 3 CTCGAGACTAGTTCTCTCTCTCTCTCTCTCGTGCCGCATCTCACCTCGAGACTAGTTCTCTCTCTCTCTCTCTCGTGCCGCATCTCAC
ACCTGTACCTGTGGATGGACGGCAGCTGAACCGCGGGAAACTTTCGTTCTCACTGGATGGACGGCAGCTGAACCGCGGGAAACTTTCGTTCTCACTCTACCTAGCTACCTAGATGAACTTTAGTTTATATTAAACACGCGTCGACTCCCACACAAAATGAACTTTAGTTTATATTAAACACGCGTCGACTCCCACACAAACCGTGCCCGTGCTCGTTTTACATCTTTGTCTCCGCTTTTGAAAACGAGAAGTTGAATCGTTTTACATCTTTGTCTCCGCTTTTGAAAACGAGAAGTTGAATTCGCATTCGCAAGACGCAACTTTCCAGCCCCTCACTGAGCGGGCAGAGTCCGTAGACGCAACTTTCCAGCCCCTCACTGAGCGGGCAGAGTCCGTGAAGCGATGAAGCGATGGAGCCGTCCGTCATTCCCGGTGCTGACATACCCGACCTTTACGGAGCCGTCCGTCATTCCCGGTGCTGACATACCCGACCTTTACTCCATTATCCATTAACCCGTTTAATGTCACTTTTCCCGACGACGTTTTGAGTTTCGTTACCCGTTTAATGTCACTTTTCCCGACGACGTTTTGAGTTTCGTTCCTGATCCTGATGGGAGGAACTACACCGAACCTAACCCGGTAAAGAGCCGCG GGGAGGAACTACACCGAACCTAACCCGGTAAAGAGCCGCG GAATCATCAGAATCATCATCGCCATTTCCATCACCGCTCTCGCCATTTCCATCACCGCTC
Reference MaterialReference Material
http://www.pseudomonas-syringae.org/http://www.pseudomonas-syringae.org/Outreach/Module_4_Web.htmOutreach/Module_4_Web.htm
http://www.digitalworldbiology.com/http://www.digitalworldbiology.com/BLAST/slide1.htmlBLAST/slide1.html
Sequence DNA in Thermal Cycler
•Place tubes in thermal cycler•Repeat the following for 25 cycles
Rapid Thermal Ramp to 96˚C96˚C for 10 secsRapid Thermal ramp to50˚C50˚C for 5 secsRapid thermal ramp to 60˚C60˚C for 4minutes
•Cool to 4˚C. Hold until ready to purify.