1
Dining on DNA
A food biotechnology unitfor high school students and teachers
1996. Created by the Montana State University Extension Service.
Introduction ........................................... 3
Summary of Unit Contents ................................ 4
Design of the Unit ....................................... 5
Welcome to the World of Biotechnology: It’s Time to Eat .......... 7
Laboratory: Making Yogurt, an Ancient Chinese Secret? ........... 24
Laboratory: Who Put the DNA in My Salad? ................... 36
Building Life: How Do You Think It Works? .................... 49
Chocolate Flavored Cherries: An Exercise in Recombinant
DNA Technology ..................................... 61
Risky Business or Stupendous Solutions? A Risk/Benefit Analysis
of Food Biotechnology .................................. 73
Investigating Careers in Biotechnology ...................... 94
To Label or Not to Label? A Food Biotech Labeling Exercise ........ 99
An Exploration0f Food Biotechnology
2
3
Tomatoes that ripen on the vine longer…frost-resistant
strawberries…low-fat potato chips...higher protein grains
for third-world countries…
All of these are applications of biotechnology in the area of food
production, processing and agriculture. We hear bits and pieces
about this subject on the evening news and read an occasional
headline, but what does it all mean to us and to the safety and
abundance of our food supply? This unit seeks to answer these
questions through laboratories and activities designed for the high
school biology and social studies classrooms. It is a constant teaching
challenge to effectively incorporate current topics and exciting new
technologies into an existing curriculum. It is the goal of this unit
to help teachers meet this challenge.
Since the first gene was recombined, the field of biotechnology has
sprung from the starting gate, rounding the corners of the scientific
track at a blistering pace. Biotechnology has and will continue to have
a profound impact on society, touching such issues as agricultural
practices, environmental pollution, world hunger and health care.
On a more day-to-day level, biotechnology will greet us as daily food
choices in the supermarket, or, for many, a career path. Scientific
literacy concerning biotechnology will ultimately affect the
individual’s ability to make informed decisions and choices.
The high school students of today are tomorrow’s primary consumers.
Many are already responsible for their own food choices as well as food
choices for their families. Through this unit, these students will gain
skills which will help them to evaluate and process the existing and
rapidly emerging information concerning biotechnology in food
and agriculture.
Introduction
4
Summaryof Unit Contents
In total, this unit contains eight individual activities. Each activity is
designed to be completed in one or two class periods. Hence, a two-
week time slot would be necessary to incorporate the entire module
into one course. An interdisciplinary approach in which different
activities are being conducted concurrently would shorten this
timeline. All activities may also be used individually as well.
The unit begins with an introduction to biotechnology and food.
During this introduction, students walk through a food biotechnology
timeline and gain a historical perspective regarding the applications of
biotechnology in food production throughout time. Food sampling is
a component of this activity which is sure to spark the students’
enthusiasm for the unit!
Next, the students create a commonly eaten food (yogurt) through
an ancient application of biotechnology (fermentation). Following this
laboratory, the students are exposed to today’s most current
applications. This journey begins with an introduction to DNA via
a laboratory in which the students extract this genetic material from
an onion.
A DNA modeling activity is next. During the modeling, students
learn the structural details of this important genetic material. Most
importantly, they initiate their quest in learning how DNA dictates
the form and function of an organism. Background information on
protein synthesis follows the modeling activity. Next, the students
are introduced to recombinant DNA technology through a simulation
activity in which they are given the instructions to create a chocolate
flavored cherry. The conceptual link between changes in DNA and
changes in an organism’s form and function is introduced through
this activity.
The final three activities move from the laboratory science arena
into the social science spectrum. However, even if the unit is being
conducted solely in the science classroom, these cumulative activities
are valuable in that they allow the students to apply their scientific
knowledge to a problem solving/critical thinking scenario.
The risk/benefit activity presents the students with actual applications
of food biotechnology which are currently being investigated in the
scientific world. The students, by assessing the risks and benefits of
these applications, come to conclusions as to whether or not to send
this food to market. Next, the students investigate career opportunities
in the field of biotechnology. Each student seeks out detailed
information on one particular career of interest and presents his
findings to the class, so all will gain exposure to a variety of
biotechnology career options. Finally, students will investigate topics
related to the labeling of genetically modified foods including
regulatory agencies, present legislation, consumer group concerns
and industry concerns.
Student activiy sheets are
identified by the logo:
STU
DENT ACTIVITY
DINI N G O N D
NA
Answer sheets and informationsheets directed to teachers areidentified by the logo:
5
Designof the Unit
The Interdisciplinary FactorThe Interdisciplinary FactorThe Interdisciplinary FactorThe Interdisciplinary FactorThe Interdisciplinary FactorThe subject matter related to biotechnology and food lends itself well
to being presented in an interdisciplinary educational setting. The
social sciences and biological sciences are well represented in the topics
of food biotechnology. The subject matter also is relevant in the family
and consumer science arena. Thus, this unit has been designed to be
optimally utilized in the interdisciplinary setting. It is important, at
this time, to define the term interdisciplinary as it applies to this
specific unit. Here, interdisciplinary is defined as a curriculum
approach that consciously applies methodology and language from
more than one discipline to examine a central theme, issue, problem,
topic or experience. The central theme here is food biotechnology, of
course.
It is suggested that if the unit is to be utilized concurrently in two
physically separate classroom settings, that the teachers use a common
prep time for the duration of the unit so that the individual classroom
activities will complement one another.
The Learning Cycle Educational ModelThe Learning Cycle Educational ModelThe Learning Cycle Educational ModelThe Learning Cycle Educational ModelThe Learning Cycle Educational ModelThis unit was developed with the Learning Cycle Model for science
teaching. The Learning Cycle Model closely mimics the actions of
scientists in the real world through its three- stage investigative
approach. Within the first stage of the Learning Cycle (the exploration
phase), the students are introduced to a new concept through their
observation or participation in an activity or laboratory exercise.
With little or no background information, the students develop the
concept for themselves through their experience with the activity.
During the second phase of the Learning Cycle, the concept which was
introduced in the exploration phase is studied, identified and verbally
specified by using the tools acquired in the exploration phase. This is
the invention stage. During the third and final phase of the Learning
Cycle (called the discovery phase), the student is given the opportunity
to deal with the learned concept in a variety of problem-solving
situations.
This three-stage approach to learning provides the students with the
opportunity to move from the concrete to the abstract level by
building mental structures. The role of the teacher is that of discussion
leader rather than information dispenser, nurturing the student’s
developing skills in creative problem solving and critical thinking.
The Learning Cycleexploration
discovery invention
6
7
Welcome tothe World ofBiotechnology
It’s Time to Eat!
Summary:Summary:Summary:Summary:Summary:This activity serves as an introduction to the entire unit on biotech-
nology and food. Here, students will gain an appreciation for the age
and diverse scope of biotechnology by observing applications to food
items throughout a long history of humankind’s utilization of living
systems in food preparation and production. Stations will be set up
around the classroom. At each station will be a food of a specific time
period which has an associated biotechnology application. A brief
description of the food/technology association and related questions
for students will also be at each station.
Objectives:Objectives:Objectives:Objectives:Objectives:• Students will gain an appreciation of the ubiquitousness of
biotechnology applications in food production and processing.
• Students will gain some perspective as to when various techniques
of biotechnology were introduced.
• Students will brainstorm as to how living systems/organisms
function to alter a food product.
Materials:Materials:Materials:Materials:Materials:• food item for each time period. The following are the foods
suggested in this activity. However, there are many other
appropriate examples. Teachers may want to customize this part
of the activity according to appropriate foods that are readily
available and not too expensive:
• B.C. time period: leavened bread
• 1 A.D. –1900 A.D. : peas
• 900–1970: corn (hybrids are the focus here)
• 1970–1996: milk
• Future: tomatoes, peanuts, potato chips, popcorn
(any or all of these may be represented for this time period)
• paper plates, cups, bowls, and utensils as needed for each station.
• informational 3 x 5 card for each time period
• Challenge Questions 3 x 5 card for each time period.
• Student Answer Sheet
• Teacher Additional Background Information Sheet
8
Welcome tothe World ofBiotechnology
It’s Time to Eat!
Procedure:Procedure:Procedure:Procedure:Procedure:Teacher sets up stations around the classroom prior to the beginning
of class. Each station will depict a specific time period through a food
representing the biotechnology applications of that time period.
The five time periods to be represented are:
• B.C.
• 1 A.D.–1900 A.D.
• 1900 A.D.–1970 A.D.
• 1970 A.D.–1996 A.D.
• Future
The individual time period stations should be set up as follows:
• food sample of the time period, enough for each
student to sample the food. For example, B.C. time
period would have a plate of leavened bread slices.
• any appropriate cup, plate, or utensil needed to sample the food.
• informational 3 x 5 card: Each time period station has a 3 x 5
information card which discusses the link between food and
biotechnology for that time period.
• Student Questions on a 3 x 5 card: Each time period station has a
3 x 5 card which has several questions for students to answer.
When the students enter the classroom, they will be:
• given a brief introduction to the activity,
• divided into five groups (group size dependent on class size),
• provided with the student answer sheet to fill in as they travel
through the stations.
Each group will begin at a different station. The group will sample the
food, read about the associated food/biotechnology link and answer
the student questions. Students should have approximately five to ten
minutes at each station. Teacher should announce when it is time to
switch stations. Groups should move in a sequential direction so that
all groups get to all five stations within the class period.
Class Discussion:Class Discussion:Class Discussion:Class Discussion:Class Discussion:At the next class period, the teacher asks each group to present to the
class the answers to the questions from a specific time period.
Teachers:Teachers:Teachers:Teachers:Teachers: In setting up the stations
around the room, you may
choose to present a “contrasting”
food at some of the stations.
This food would be one that
was produced without any
biotechnology application.
For example, at station one,
you could present matzo along-
side the leavened bread as a
comparison of the changes
which can be attributed to
the biotechnology application.
9
It’s Time to Eat
Station InformationStation InformationStation InformationStation InformationStation Informationand Questionsand Questionsand Questionsand Questionsand Questions
Station #1: Time Period = B.C.Station #1: Time Period = B.C.Station #1: Time Period = B.C.Station #1: Time Period = B.C.Station #1: Time Period = B.C.
Suggested Food: Leavened Bread
Food/Biotechnology LinkStation #1: Time Period = B.C.
Can you imagine life without bread as we know it? Before 2000 B.C., the
bread that people ate was flat and hard. Then Egyptians discovered yeast,
a living organism that makes bread rise. These ancient people used yeast
to modify bread, yet never fully understood how the process worked. In
fact, no one would understand exactly how yeast makes bread rise until
nearly 38 centuries later.
Student Challenge QuestionsStation #1: Time Period = B.C.
1. Would you consider the ancient Egyptians to be biotechnologists?
Why? Why not?
2. How do you think yeast causes bread to rise?
3. a. What do you think the Latin root “bio” means?
b. Define the word “technology”.
10
It’s Time to Eat
Station InformationStation InformationStation InformationStation InformationStation Informationand Questionsand Questionsand Questionsand Questionsand Questions
Station #2: Time Period = Station #2: Time Period = Station #2: Time Period = Station #2: Time Period = Station #2: Time Period = 1 A.D.–1900 A.D.1 A.D.–1900 A.D.1 A.D.–1900 A.D.1 A.D.–1900 A.D.1 A.D.–1900 A.D.
Suggested Food: Peas
Food/Biotechnology LinkStation #2: Time Period = 1 A.D.–1900 A.D.
An Introduction to Mendelian Genetics
Do you play with your food? Most of us get in trouble for playing with
food, but Gregor Mendel didn’t. In fact, Mendel spent his life playing with
peas. He noticed that not all peas looked alike and that some characteristics
or traits showed up more often than others. In other words, some traits are
“dominant” over others. Mendel also recognized that many peas from the
same family had similar characteristics. He then began to mix or breed
families of peas with desirable traits such as richer color, better texture
and more flavor. This mixing to produce a better crop is called
classical breeding .
Student Challenge QuestionsStation #2: Time Period = 1 A.D.–1900 A.D.
1. Some traits are dominant over others. However, simply because a
trait is dominant does not necessarily mean it is desirable. If you
were a plant breeder and wanted your plants to express (have the
phenotype of) a recessive trait, how would you conduct your
breeding experiments?
2. For the following foods, list one characteristic, or desirable trait
that may have been “bred” for in that food:
• oranges
• grapes
• turkeys
11
It’s Time to Eat
Station InformationStation InformationStation InformationStation InformationStation Informationand Questionsand Questionsand Questionsand Questionsand Questions
Station #3: Time Period = Station #3: Time Period = Station #3: Time Period = Station #3: Time Period = Station #3: Time Period = 1900–19701900–19701900–19701900–19701900–1970
Suggested Food: Corn
Food/Biotechnology LinkStation #3: Time Period = 1900–1970
Application of Mendelian Genetics
What do you get when you cross Lassie with a pit bull? A dog that bites off
you leg and then runs to get help! Seriously, scientists have been attempting
to combine the desirable characteristics of different plants or animals for
centuries. Traditionally, this has been done by classical breeding . The
application of Mendelian genetics to classical breeding has led to the
formation of hybrids , or plants containing the best traits from their two
different parents. The corn we eat today is a hybrid of many varieties
of corn plants.
Student Challenge QuestionsStation #3: Time Period = 1900–1970
1. If you could mix any two plants to form a hybrid , what two plants
would you mix? Why these two? What name would you give
your hybrid?
2. What food(s) have you eaten that may be considered to be
a hybrid(s)?
12
It’s Time to Eat
Station InformationStation InformationStation InformationStation InformationStation Informationand Questionsand Questionsand Questionsand Questionsand Questions
Station #4: Time Period = 1970–1996Station #4: Time Period = 1970–1996Station #4: Time Period = 1970–1996Station #4: Time Period = 1970–1996Station #4: Time Period = 1970–1996
Suggested Food: Milk
Food/Biotechnology LinkStation #4: Time Period = 1970–1996
The pituitary gland at the base of the brain in all mammals produces
growth hormones. Cow growth hormone is called bovine somatotropin
(BST) . Scientists have known since the 1930s that injecting dairy cows with
this pituitary substance increases milk yield. The production of BST in large
quantities could allow dairy farmers to produce milk at lower cost.
Biotechnologists can produce large quantities of a biosynthetic version of
the naturally occurring BST in the laboratory. Bovine somatotropin
prepared in the laboratory is called recombinant BST (or rBST).
Student Challenge QuestionsStation #4: Time Period = 1970–1996
1. Do you have any worries or concerns about drinking milk that has
come from cows injectedwith recombinant BST?
What are your concerns?
2. Some dairy farmers refuse to use recombinant BST.
Can you think of a reason why?
13
It’s Time to Eat
Station InformationStation InformationStation InformationStation InformationStation Informationand Questionsand Questionsand Questionsand Questionsand Questions
Station #5: Time Period = FutureStation #5: Time Period = FutureStation #5: Time Period = FutureStation #5: Time Period = FutureStation #5: Time Period = Future
Suggested Food: Any fruit or vegetable, potato chips, popcorn, etc.
Food/Biotechnology LinkStation #5: Time Period = Future
Here are some examples of some foods scientists are working onfor the not-too-distant future:
• fruits and vegetables with higher levels of nutrients suchas Vitamin C
• lower fat french fries and potato chips• garlic cloves with more allicin, a substance which helps to
lower a person’s cholesterol• popcorn that is modified to taste better so that people won’t
be so tempted to add lots of salt and butter.
Student Challenge QuestionsStation #5: Time Period = Future
1. List one of your favorite foods.
2. What new trait would make this food even better?
3. List one of your least favorite foods.
4. What new trait would make this food better?
5. Do you feel that changing foods to exhibit more desirabletraits is OK? Explain why or why not.
14
It’s Time to Eat Station 1: Time Period = B.C.Station 1: Time Period = B.C.Station 1: Time Period = B.C.Station 1: Time Period = B.C.Station 1: Time Period = B.C.
1. _____________________________________________________
______________________________________________________
______________________________________________________
2. _____________________________________________________
______________________________________________________
______________________________________________________
3 a. ____________________________________________________
______________________________________________________
______________________________________________________
3b. ____________________________________________________
______________________________________________________
__________________________________________________________________________________________________________________________________________________________________________________________________________________
Station 2: Time Period = Station 2: Time Period = Station 2: Time Period = Station 2: Time Period = Station 2: Time Period = 1 A.D.–1900 A.D.1 A.D.–1900 A.D.1 A.D.–1900 A.D.1 A.D.–1900 A.D.1 A.D.–1900 A.D.
1. _____________________________________________________
______________________________________________________
______________________________________________________
2. oranges: ______________________________________________
grapes: _______________________________________________
turkeys: ______________________________________________
STU
DENT ACTIVITY
DINI N G O N D
NA
Answer Sheet for StudentAnswer Sheet for StudentAnswer Sheet for StudentAnswer Sheet for StudentAnswer Sheet for StudentChallenge QuestionsChallenge QuestionsChallenge QuestionsChallenge QuestionsChallenge Questions
15
It’s Time to Eat Station 3: Time Period = Station 3: Time Period = Station 3: Time Period = Station 3: Time Period = Station 3: Time Period = 1900–19701900–19701900–19701900–19701900–19701. What two plants and why these two? ______________________
___________________________________________________
Name: ______________________________________________
2. ___________________________________________________
Station 4: Time Period = Station 4: Time Period = Station 4: Time Period = Station 4: Time Period = Station 4: Time Period = 1970–19961970–19961970–19961970–19961970–19961. ___________________________________________________
___________________________________________________
___________________________________________________
2. ___________________________________________________
___________________________________________________
___________________________________________________
Station 5: Time Period = FUTUREStation 5: Time Period = FUTUREStation 5: Time Period = FUTUREStation 5: Time Period = FUTUREStation 5: Time Period = FUTURE1. ___________________________________________________
2. ___________________________________________________
___________________________________________________
3. ___________________________________________________
4. ___________________________________________________
___________________________________________________
5. ___________________________________________________
___________________________________________________
___________________________________________________
Final Question:Final Question:Final Question:Final Question:Final Question:All of the foods at the stations were produced using some type of
biotechnology. In your own words, define biotechnology.
______________________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
_____________________________________________________
STU
DENT ACTIVITY
DINI N G O N D
NA
16
It’s Time to Eat Station #1Station #1Station #1Station #1Station #1
1. Would you consider the ancient Egyptians to be biotechnologists?
Why? Why not?
This question is designed to provoke students to think about what
biotechnology is and what it entails. At this point in the unit, students
cannot comprehend the full scope of biotechnology, but they can
make judgements about what makes a person a biotechnologist.
In fact, the Egyptians were biotechnologists because they manipulated
a biological system to make a product. In general, biotechnology can
be defined as the use of living organisms to make a product or run
a process.
2. How do you think yeast causes bread to rise?
A wide variety of answers are possible here, but the actual process
should be explained at some point. Yeast, a fungus of the genus
Saccharomyces, has been used as a leavening agent for more than
six thousand years. Yeast metabolizes sugar in bread dough under
anaerobic conditions and converts the sugar to carbon dioxide.
As yeast releases carbon dioxide, the gas expands the gluten network
in the dough, displacing volume and making the dough rise.
3. What do you think the Latin root “bio” means? Define the word
“technology”.
“Bio” means life. “Technology” means the application of knowledge,
process, invention or method for practical ends.
17
It’s Time to Eat Station #2Station #2Station #2Station #2Station #2
1. Some traits are dominant over others. However, simply because a
trait is dominant does not necessarily mean it is desirable. If you
were a plant breeder and wanted your plants to express (have the
phenotype of) a recessive trait, how would you conduct your
breeding experiments?
Identify plants that express the recessive trait. They have two
alleles coding for the recessive trait. By breeding these two
plants, expression of the recessive trait is almost guaranteed.
2. For the following foods, list one characteristic that may have
been “bred” for in that food:
oranges
grapes
turkeys
oranges: seedlessness, size, sweetness
grapes: seedlessness, size, sweetness, color
turkeys: large breast section, overall more meat, size
Station #3Station #3Station #3Station #3Station #3
1. If you could mix any two plants to form a hybrid, what two
plants would you mix? Why these two?
What name would you give the hybrid?
Any thoughtful answer would be appropriate here. A good
“supermarket” example is the tangelo, a mix between tangerines
and grapefruit.
2. What food(s) have you eaten that may be considered to be a
hybrid(s)?
Again, the tangelo example is appropriate here. By definition, however,
many high-quality foods are hybrids because they have been bred to
contain the best traits from their two parents. Therefore, some students
may answer this question with foods like hybrid corns, peas, barley,
wheat, etc.
18
Station #4Station #4Station #4Station #4Station #4
1. Do you have any concerns about drinking milk that has come
from cows injected with recombinant BST? What are your
concerns?
Any thoughtful answers would be appropriate here. Answers will most
likely come in two categories:
• Negative impacts of BST on cows that are injected with the
hormone. (Example: infections in the udders (mastitis) due to
engorgement with milk.)
• Negative effects BST may have on humans who consume milk of
cows that are injected with the hormone. (No known negative
effects on those who consume milk from BST treated cows have
been identified.)
2. Some dairy farmers refuse to use recombinant BST. Can you think
of a reason why?
This question should encourage some ethical debate. If discussion is
progressing slowly on its own you may want to have them consider the
following issues:
• consumer acceptance of this new product
• concerns about the viability of the small family farm
• have all health issues been addressed?
Station #5Station #5Station #5Station #5Station #5
1. List one of your favorite foods?
Example: raspberries
2. What new trait would make this food even better?
Example: Why do raspberries have so many seeds? All those seeds get
stuck in my teeth! If I could get rid of the raspberry seeds, I would eat
raspberries more often.
3. List one of your least favorite foods?
Example: anchovies
4. What new trait would make this food better?
Example: Anchovies are too salty, and they smell too “fishy”. I would
grow salt- free, odorless anchovies.
It’s Time to Eat
19
It’s Time to Eat 5. Do you feel that changing foods to exhibit more desirable traits is
OK? Explain.
Most people are uneasy with change, so the students’ first instinct may
be that changing foods to exhibit more desirable characteristics might
somehow endanger human health. It should be explained that
knowing the facts prepares a person to make good decisions. This unit
will prepare students both to be informed consumers and to make
rational decisions about genetically altered foods.
Final Question:Final Question:Final Question:Final Question:Final Question:
All of the foods at the stations were produced using some type of
biotechnology. In your own words, define biotechnology.
Biotechnology is the use of living systems to make a product or run a
process. At this point, students may not be able to come up with a good
definition. That’s okay. You might want to ask this question several
times throughout the course of this unit, because students will develop
a better understanding of biotechnology as the unit progresses.
20
It’s Time to Eat Station 1: Time Period B.C.Station 1: Time Period B.C.Station 1: Time Period B.C.Station 1: Time Period B.C.Station 1: Time Period B.C.
Technology: Yeast for Leavened Bread
Yeast, a fungus of the genus Saccharomyces , has been used as a leavening
agent for more than six thousand years. Yeast metabolizes sugar in
bread dough and, under anaerobic conditions, converts the sugar into
carbon dioxide. As yeast releases carbon dioxide, the gas displaces
volume in the dough, and the dough begins to rise.
Possible concepts for expansion:
The use of yeast as a leavening agent is a classic example of
fermentation, the process by which microbes convert complex
compounds like sugar into simpler compounds like carbon dioxide,
alcohol, and lactic acid. In addition to (or in place of) the “Making
yogurt” lab, teachers may wish to further emphasize the concept of
fermentation through a hands-on activity like brewing rootbeer.
Brewing takes approximately two weeks, so teachers should begin
brewing at the start of the unit.
Another possible expansion avenue to explore during this activity
would be to have a dish with active yeast, warm water and sugar set up
at this station. Here students would see the gas production of the yeast
by viewing the bubbling of this mixture.
Station 2: Time Period Station 2: Time Period Station 2: Time Period Station 2: Time Period Station 2: Time Period 1 A.D.–1900 A.D.1 A.D.–1900 A.D.1 A.D.–1900 A.D.1 A.D.–1900 A.D.1 A.D.–1900 A.D.
Technology: Introduction to Mendelian Genetics
The “It’s Time to Eat” activity briefly introduces Mendel and the
concept of inheritance. By the end of the activity, students should
at least understand dominance . Teachers may wish to delve further
into Mendelian genetics by introducing the concepts of genes ,
alleles , homozygotes , heterozygotes , complete dominanc e,
incomplete dominance , recessive traits , codominance , phenotypes ,
and genotypes .
These concepts can be presented systematically via a description
of Mendel s garden pea (Pisum sativum) experiments and the
simultaneous development of either a Punnett square or a pedigree
diagram for the experiment. Most biology textbooks contain a
“genetics” section that goes through Mendel’s experiments and
introduces more advanced concepts than those presented in
this activity.
This sheet is designed toprovide the teacher withadditional informationabout the technologiespresented in the It’s Timeto Eat activity. This sheetmay be used by the teacheras an informational basisfor expanding the activityas he or she desires.
21
It’s Time to Eat Station 3: Time Period Station 3: Time Period Station 3: Time Period Station 3: Time Period Station 3: Time Period 1900–19701900–19701900–19701900–19701900–1970
Technology: Hybrids As An Application of MendelianGeneticsHybridization can be explained as an application of Mendelian
genetics. Hybrids are the offspring of two organisms of different
varieties, species, or genera. A monohybrid is the result of crossing
parents that differ in only one desirable trait. A dihybrid is the result
of crossing parents that differ in two desirable traits. A trihybrid is the
result of crossing parents that differ in three desirable traits. Classical
breeding is a biotechnology technique based on Mendelian genetics
in which hybrids are created by crossing two organisms expressing
desired traits. This technology has been utilized for centuries, even
prior to Mendel’s discoveries.
Possible concepts for expansion:A hands-on demonstration of Mendel’s hybridization method
may give students a better understanding of classical breeding as
biotechnology.
Explanation of Mendel’s Hybridization Method withPea Plants:In the case of pea plants, the pollen and eggs from a single flower
engage in self-fertilization. The stamen (containing pollen) and the
ovary (containing ovule s) are enclosed in a floral part called the keel
so pollen from one flower cannot reach the ovules of another flower.
Therefore, the keel must be removed and the stamens must be cut off
to pollenate one plant with another plant. If the ovaries are left
alone, pollen from one flower can be applied manually to another
flower. After fertilization, the ovary develops into the fruit or pod,
and its ovules develop into the seed or peas. Each pea may be
germinated to develop a hybrid plant of the next generation.
For more advanced classes, this may be a good time to present
transgenics by comparing and contrasting the use of hybridization
in classical breeding with the use of transgenics in modern breeding
techniques. Scientists today can insert foreign genes for insect
resistance into corn in order to reduce insect damage. A transgenic
organism is one that carries within its own genome DNA sequences
inserted by laboratory techniques. A trangene is one that was inserted
into a foreign genome by laboratory techniques. These concepts will
be examined in depth later in this unit.
22
It’s Time to Eat Station 4: Time Period Station 4: Time Period Station 4: Time Period Station 4: Time Period Station 4: Time Period 1970–19961970–19961970–19961970–19961970–1996
Technology: Bovine Somatotropin (BST)Somatotropin is a mammalian hormone produced in the anterior
pituitary gland beneath the brain. This hormone regulates growth
and affects the metabolism of all classes of nutrients. Insufficient
somatotropin production in humans leads to dwarfism, but medically
advanced countries do not have a problem with dwarfism because
babies diagnosed for insufficient somatotropin production may be
treated with human somatotropin injections. Somatotropin is not
orally active, so it is administered directly into the circulatory system.
Many farmers inject their dairy cows with somatotropin, called bovine
somatotropin. An abundance of the hormone in dairy cattle increases
milk yield by 10%-20%, increases productive efficiency (measured by
kilogram weight gain per kilogram feed) by 15%-35%, and reduces fatty
tissue by nearly 80%.
The Food and Drug Administration, the National Institutes of Health,
the United States Congress Office of Technology Assessment, and the
American Academy of Pediatrics have determined that bovine
somatotropin (BST) use is safe for three reasons:
• BST is a protein, and all plant and animal protein is degraded into
single amino acids in the stomach;
• nonprimate somatotropin does not affect humans; and
• the cooking process (pasteurization) denatures somatotropin and
renders the hormone biologically inactive.
Today, most of the BST administered to dairy cows is manufactured in
the laboratory via recombinant DNA technology. This allows for an
adequate supply of the hormone for all of the dairy farmers who wish
to utilize it. The students have not been introduced to recombinant
DNA technology at this time, however, you may choose to include the
fact that BST is a product of a more involved technology.
23
It’s Time to Eat Station 5: Time Period FUTUREStation 5: Time Period FUTUREStation 5: Time Period FUTUREStation 5: Time Period FUTUREStation 5: Time Period FUTURE
More and more researchers are looking into new ways of applying
techniques of modern molecular biology to practices in food
production, food processing and agriculture. It is projected that by the
year 2030, the world’s population will triple, but the number of
cultivated areas will not even double. This strain on agricultural
resources will undoubtedly result in greater world hunger (lack of food
security). Modifying plants to withstand environmental hardships
such as heat and drought has the potential for more plentiful, higher
quality crop yields. The development of pest-resistant crops may help
reduce overall chemical stress on the environment by reducing the
overall applications of chemical pesticides. Creating more nutrient
dense forms of staple foods in third world countries has the potential to
lessen disease states and enhance overall wellness of the world’s poor.
Yet, the questions remain, are we looking at the whole picture? Will the
practices of “genetic engineering” in agriculture negatively impact
ecosystems by limiting biodiversity? Could plants engineered to
contain virus particles in order to ward off pests pose a risk by having
the potential to create a new virus which could then go on to
negatively impact that or another crop? These questions are, as of yet,
unanswered, but thought provoking. The journey in which you will be
investigating food biotechnology promises to be one laden with
provocative questions and opportunities for creative problem-solving.
Keep in mind that food biotechnology is a subject area that can
be approached from many tacks such as history, economics,
environmental science, molecular biology, ethics, governmental/
legislative issues, food safety, and more. Many opportunities exist
for scintillating discussion regarding these issues. Enjoy!
Remember:
There’s lots of food biotechnology
information and ideas for classsroom
activities available online. See the
resource list at the end of the unit for
a few of these interesting cyberspace
references!
24
Laboratory:Making Yogurt,an AncientChineseSecret?
Humans began to realize the benefits of food biotechnology long ago.
In fact, as far back as 6000 B.C. the Sumerians and Babylonians utilized
yeast in beermaking. Today on the supermarket shelves we have the option
to buy yogurt with dinosaurs on the label or colored sprinkles neatly
packaged atop the lid. One would hardly guess that this seemingly modern
product has been around for thousands of years! Hold onto your hat! We
are traveling back in time to where we will harness some bacterial power
and make yogurt!
Summary:Summary:Summary:Summary:Summary:Students are exposed to traditional biotechnology techniques as
they observe and participate in the production of a fermented milk
product: yogurt.
Objectives:Objectives:Objectives:Objectives:Objectives:• Students will gain an appreciation for the long history of the
association between biotechnology and food production/
processing.
• Students will recognize biotechnology as the utilization of a
living organism to make a product or run a process.
• Students will discover fermentation as an application of
biotechnology.
• Students will examine the biochemical conversions that take
place during the fermentation of milk into yogurt and how
these changes contribute to food preservation.
• Students will learn about microorganisms considered to be
“beneficial”.
• Students will examine the physical characteristics of the
bacteria used in the yogurt production.
Suggested Time:Suggested Time:Suggested Time:Suggested Time:Suggested Time:Two class periods.
25
Laboratory:Making Yogurt,an AncientChineseSecret?
Materials Needed:Materials Needed:Materials Needed:Materials Needed:Materials Needed:• a container of commercial yogurt (this will be used as a
starter culture).
Teacher Note: Not all commercially available yogurt contains
live cultures. Some has been pasteurized. So be sure the yogurt
container you choose has the words “Contains Live Culture”
or “Contains Active Culture”.
• applicator sticks
• pH test paper
• slides
• Each lab group needs two 20 ml test tubes containing 10-15 ml of
whole milk fortified with 3–5% skim milk powder, freshly boiled
and cooled to 45ºC in a water bath.
Teacher Prep Hint: To fortify the whole milk with 3-5% skim
milk powder, add 3-5 g skim milk powder to 1 liter of whole milk.
Mix thoroughly until all the skim milk powder has been dissolved.
ppppp HHHHH
26
Laboratory:Making Yogurt,an AncientChineseSecret?
In utilizing the Learning Cycle model of science teaching, it is thought
best to allow the students to brainstorm some of the more complex “why”
questions on the post-laboratory question sheet. Therefore, it is suggested
that following this student activity, you then discuss the answers to these
questions with the whole class and allow the students to correct their own
answers prior to turning them in.
More Background Information for Teachers:More Background Information for Teachers:More Background Information for Teachers:More Background Information for Teachers:More Background Information for Teachers:The finished yogurt is the end product of a symbiotic culture of two
different bacteria, Streptococcus thermophilus and Lactobacillus
bulgaricus . This culture produces yogurt when incubated in milk
at a temperature range of 40–45°C. The optimal flavor and texture
of yogurt is achieved when these two cultures are present in equal
amounts. This 1:1 proportion of Streptococcus thermophilu s and
Lactobacillus bulgaricus is also considered to be optimal for use as
a starter culture.
At the beginning of the fermentation process, the Streptococcus
thermophilus grow faster, producing by-products which ultimately set
up a favorable environment for the Lactobacillus bulgaricus growth.
The major overall chemical change is the conversion of lactose to
lactic acid. The final pH of yogurt following fermentation is 4.2–4.3.
This acidic environment does not allow for the growth of many
pathogenic microbes and thus serves to preserve the food.
Note: Streptococcus thermophilus is a non-pathogenic strain of
streptococcus. It is not the strain responsible for “strep throat” and
other human illness.
Time (Hours)
The growth curves of S. thermophilus and L. bulgaricus during the
conversion of milk to yogurt.
27
Laboratory:Making Yogurt,an AncientChineseSecret?
Humans began to realize the benefits of food biotechnology long ago. In
fact, as far back as 6000 B.C. the Sumerians and Babylonians utilized yeast
in beermaking. Today on the supermarket shelves we have the option to
buy yogurt with dinosaurs on the label or colored sprinkles neatly packaged
atop the lid. One would hardly guess that this seemingly modern product
has been around for thousands of years! Hold onto your hat! We’re traveling
back in time where we will harness some bacterial power and make yogurt!
Background Information:Background Information:Background Information:Background Information:Background Information:Fermentation of food has been used as a method of preservation since
ancient times. This process allows for longer storage of food while
preserving valuable nutrients in the food. Fermentation is an anaerobic
process in which bacteria convert complex compounds, such as sugars,
into simpler compounds, such as alcohol, lactic acid or carbon dioxide.
The bacteria used in fermentation are often found in that food
naturally, yet not in high enough concentration to ensure that the
fermentation process will be successful for preservation. So, human-
kind has stepped in to use the natural power of these bacteria to
enhance food quality and availability.
Laboratory Procedure:Laboratory Procedure:Laboratory Procedure:Laboratory Procedure:Laboratory Procedure:Day One:1. Complete Pre-lab Questions.
2. Label the two test tubes A and B. Check the pH of both test tube
contents with the pH test paper and record your results on your
data sheet. Record the consistency, smell and taste (optional) of
the test tube contents on your data sheet.
3. Using an applicator stick, take some commercial yogurt (about
the volume of the tip of your finger, or approximately 1–2 ml.)
and put it into test tube A. This commercial yogurt is called the
starter culture . Cover it with a sterilized stopper or aluminum foil.
4. Mix the milk and the starter culture thoroughly by rolling the
tube between your hands and shaking gently.
5. Add no commercial yogurt to test tube B. Cover this test tube.
6. Put both test tubes into an incubator (oven) that is set at 45° C.
7. After four hours, the teacher will take the test tubes out of the
incubator and refrigerate.
STU
DENT ACTIVITY
DINI N G O N D
NA
28
Laboratory Procedure:Laboratory Procedure:Laboratory Procedure:Laboratory Procedure:Laboratory Procedure:Day Two:
1. Examine the test tubes observing the consistency and odor of
the contents. Record your observations on your data sheet.
2. Test the pH of the test tube contents for both test tubes A and B.
Record these values on your data sheet.
3. You may taste the contents of test tube A and record this
observation if you choose. Do not taste the contents of test tube B.
4. Put a tiny amount of the test tube A contents (< 1 ml) on a
microscope slide. Add a drop of mineral oil on top. Place a slip
cover over the slide contents. Examine the slide under the
microscope, recording your observations on the data sheet.
Repeat slide preparation and examination for test tube B contents.
(Note: Slide contents may be easier to view if they are stained with
crystal violet or safranin.)
5. Answer the post-laboratory questions.
6. Correct your own post-laboratory questions with teacher input.
Laboratory:Making Yogurt,an AncientChineseSecret?
STU
DENT ACTIVITY
DINI N G O N D
NA
29
Laboratory:Making Yogurt,an AncientChineseSecret?
Pre-lab QuestionsPre-lab QuestionsPre-lab QuestionsPre-lab QuestionsPre-lab Questions
The following questions are to be completed before beginning the
Making Yogurt laboratory activity:
1. In your own words, define biotechnology:
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
2. Describe how you think making yogurt is an application of
biotechnology?
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
3. In your own words, define fermentation.
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
4. Do you consider biotechnology a “new science”? Explain.
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
5. Read the laboratory procedure. Which treatment serves as the
control in this experiment? Why is it important to include
this control?
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
STU
DENT ACTIVITY
DINI N G O N D
NA
30
Laboratory:Making Yogurt,an AncientChineseSecret?
Laboratory Data SheetLaboratory Data SheetLaboratory Data SheetLaboratory Data SheetLaboratory Data Sheet
Pre-Yogurt Making Data:Pre-Yogurt Making Data:Pre-Yogurt Making Data:Pre-Yogurt Making Data:Pre-Yogurt Making Data:
Starter Culture Yogurt: Test Tube A Test Tube B
Consistency ________________ ________________
Smell ________________ ________________
Taste ________________ ________________
p H ________________ ________________
Milk: Test Tube A Test Tube B
Consistency ________________ ________________
Smell ________________ ________________
p H ________________ ________________
Post-Yogurt Making Data:Post-Yogurt Making Data:Post-Yogurt Making Data:Post-Yogurt Making Data:Post-Yogurt Making Data:Test Tube A Test Tube B
Consistency ________________ ________________
Smell ________________ ________________
Taste (Test Tube A only) ________________ ________________
p H ________________ ________________
Slide Observations:Slide Observations:Slide Observations:Slide Observations:Slide Observations:Test Tube A:
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________
Test Tube B:
______________________________________________________
______________________________________________________
______________________________________________________
STU
DENT ACTIVITY
DINI N G O N D
NA
31
Laboratory:Making Yogurt,an AncientChineseSecret?
Post-Lab QuestionsPost-Lab QuestionsPost-Lab QuestionsPost-Lab QuestionsPost-Lab Questions
The following questions are to be answered following completion
of the Making Yogurt laboratory activity:
1. How does the new yogurt compare to the commercial yogurt you
_ used as the “starter culture”? Do you notice any differences?
_ What might be some reasons for these?
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
2. Look at the yogurt under the microscope in an oil emersion slide.
What do you see? Can you identify any distinct shapes?
Describe them.
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
3. What chemical changes did the bacteria cause in the milk which
_ resulted in the formation of yogurt?
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
4. How does the chemical process that takes place during fermentation
_ help to preserve food?
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
5. Why should you not taste the contents of test tube B on Day Two?
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
STU
DENT ACTIVITY
DINI N G O N D
NA
32
Laboratory:Making Yogurt,an AncientChineseSecret?
6. Give an example of another food which is produced through the
process of fermentation.
___________________________________________________________________________
___________________________________________________________________________
___________________________________________________________________________
___________________________________________________________________________
7. Do you consider microbes in your food to be “bad”? Explain
your answer.
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
8. Going back to your definition of biotechnology in the pre-lab
questions, explain how making yogurt is an application of
biotechnology in food production.
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
STU
DENT ACTIVITY
DINI N G O N D
NA
33
Laboratory:Making Yogurt,an AncientChineseSecret?
Answers to Pre-Lab Questions:Answers to Pre-Lab Questions:Answers to Pre-Lab Questions:Answers to Pre-Lab Questions:Answers to Pre-Lab Questions:
1. In your own words, define biotechnology.
Of course a variety of answers is appropriate here. The intention
of the question is to initiate an association between the impending
laboratory exercise and biotechnology. Generally speaking,
biotechnology can be defined as the use of living organisms to
make a product or run a process.
2. Do you consider biotechnology to be a “new” science?
Explain your answer.
Once again a variety of responses is appropriate here. The primary
objective is to allow the student to gain an appreciation of food
biotechnology as a wide array of techniques used to change or create
a food product. Some of these techniques have been around for
thousands of years and some are state-of-the-art scientific applications.
3. Describe how you think making yogurt is an application of
biotechnology.
It is hoped that the student will recognize that some living organism
is being utilized in the yogurt making process. Any mention of a
microbe helping to change the milk to yogurt is an adequate answer.
4. In your own words, define fermentation.
Fermentation is the anaerobic process by which bacteria convert
complex compound, such as sugars, into simpler products, such as
alcohol, lactic acid and carbon dioxide.
5. Read the laboratory procedure. Which treatment serves as the
control in this experiment? Why is it important to include this
control?
Test tube B serves as the control. By including the control, the
outcome of the experimental test tube (test tube A) may be attributed
to influence of the starter culture instead of environmental variables.
In addition, controls help to identify any experimental error which
may occur.
34
Answers to Post-Lab Questions:Answers to Post-Lab Questions:Answers to Post-Lab Questions:Answers to Post-Lab Questions:Answers to Post-Lab Questions:
1. How does the new yogurt compare to the commercial yogurt you
used as the “starter culture”? Do you notice any differences?
What might be some reasons for these?
Student comparisons will be subjective. Some reasons for differences in
“starter culture” compared to “new yogurt” could be; the amount of
time new yogurt was allowed to ferment or the temperature at which
yogurt was allowed to ferment. The best flavored yogurt develops at a
point in incubation where the two bacteria in the culture are present in
approximately equal number. (See Teacher Background Information.)
Streptococcus thermophilus (the sphere-shaped bacteria) is the first to
grow in the culture. As it grows, it creates a more acidic environment.
Lactobacillu s bulgaricus (the rod-shaped bacteria) grows best in this
acidic environment (low pH) and therefore starts to grow best after the
Streptococcus thermophilus has lowered the pH. If the culture is allowed
to incubate for too long, a sour taste is created due to excessive acid
production. Refrigeration slows down the further growth of the two
bacteria and therefore prevents too much acid production.
2. Look at the yogurt under the microscope in an oil emersion slide.
What do you see? Can you identify any distinct shapes?
Describe them.
Students should be looking for the rod-shaped Lactobacillus and the
sphere-shaped Streptococcus . They should be encouraged to note the
amount of each of the bacteria. You could then take the question
further and have them assess what the amount of each of the cultures
means in terms of the outcome of the yogurt (flavor, texture). See
previous question.
3. What chemical changes did the bacteria in the starter culture
cause to take place in the milk and result in the formation of the
new yogurt?
The bacteria converted the lactose in the milk to lactic acid.
4. How does the chemical process that takes place during
fermentation help to preserve food?
The products of fermentation inhibit the growth of “food spoiling”
bacteria and fungi.
Laboratory:Making Yogurt,an AncientChineseSecret?
35
Laboratory:Making Yogurt,an AncientChineseSecret?
5. Why should you not taste the contents of test tube B on Day Two?
In test tube B, which has not been inoculated with the starter culture,
fermentation has not taken place. Therefore, the presence of
undesirable bacteria or bacteria responsible for causing food-borne
illness is likely. Fermentation helps to preserve food by lowering the
pH and therefore inhibiting the growth of these undesirable bacteria.
6. Can you give an example of another food which is produced
through the process of fermentation?
Sauerkraut, pickles, sourdough bread, kimchee, beer, wine.
7. Do you consider microbes in your food to be “bad”? Explain your
answer.
This is obviously a loaded question. It is hoped that at this point,
following the laboratory, the students will have gained an appreciation
for the positive things microbes can do in terms of food production
and preservation.
8. Going back to your definition of biotechnology in the pre-lab
questions, explain how making yogurt is an application of
biotechnology in food production.
Answer may be variable. Generally speaking, biotechnology is using
living organisms to make a product or run a process.
36
Laboratory:Who Put theDNA in MySalad?
Summary:Summary:Summary:Summary:Summary:Throughout the first activity, the students were exposed to many roles
that living organisms/systems have in the production of various foods.
The most recently discovered techniques in biotechnology are being
conducted at the molecular level. In order for the students to gain an
appreciation for this arena, they may benefit from actually seeing the
genetic material which is manipulated through today’s most state-of-
the-art techniques. In this activity, students will extract the DNA from
the cells of an onion and cause it to precipitate so that they may
actually “see” the DNA with the naked eye.
Objectives:Objectives:Objectives:Objectives:Objectives:• Students will confirm the presence of DNA in a food item
through extracting a visible mass of DNA from an onion.
• Students will gain an overview of the location of DNA in the
cell and the role of DNA in dictating the form and function of
an organism.
• Students will extrapolate how DNA can be manipulated to
change the characteristics of the food.
• Students will be introduced to modern techniques in
biotechnology and the importance of DNA in these techniques.
Suggested Time:Suggested Time:Suggested Time:Suggested Time:Suggested Time:Two class periods.
Day One: Lab preparation and introduction to DNA.
Day Two: Laboratory procedure and post lab discussion.
37
Laboratory:Who Put theDNA in MySalad?
Materials Needed:Materials Needed:Materials Needed:Materials Needed:Materials Needed:
Day One (for entire class):• two 500 ml beakers
• one 1000 ml beaker
• blender
• thermometer
• large funnel
• paring knife
• cheese cloth (or #6 coffee filter)
• hot tap water bath (60 °C)
• ice water bath
• two L distilled water
• one container meat tenderizer
• one large onion
• 100 ml liquid dishwashing detergent
• 20 g NaCl (or non-iodized table salt)
• 95% ethanol ( Note: 70% isopropyl alcohol can be used
but expect a lower DNA yield. Isopropyl is readily
available in most stores.)
Day Two (for each lab group):• one 20 ml test tube with 6 ml onion filtrate
• one 10 ml test tube with 9 ml ice cold ethanol
• one test tube with 3.5 ml meat tenderizer solution
• one glass rod (200 mm long)
• test tube holders
• one 10 ml test tube with 3 ml 4% NaCl solution
• eyedropper for adding phenol red solution
38
Laboratory:Who Put theDNA in MySalad?
Lab Material Hints:Lab Material Hints:Lab Material Hints:Lab Material Hints:Lab Material Hints:• Any kind of liquid dishwashing detergent will work, even if it
is colored.
• Any meat tenderizer will work as long as it contains papain,
so study the label before using it.
• For DNA to precipitate, a 95% ethanol solution is needed. This is a
more concentrated solution than is normally found on the drug
store shelf, so you may need to contact a chemical supply store or
talk to a pharmacist. However, 70% isopropanol can be found at
any grocery store and will work alright but will probably yield
less DNA.
Laboratory Procedure:Laboratory Procedure:Laboratory Procedure:Laboratory Procedure:Laboratory Procedure:It is recommended to involve students in some of the preparation for
the laboratory so that they make the association between the DNA
that they will eventually extract and the onion they viewed at the
beginning of the procedure. It is recommended that day 1 of this
activity should begin with an overview of DNA and its applicability
to biotechnology in agriculture and finish with the first seven steps of
the teacher lab prep. Students may complete their pre-lab questions
during the lag times during lab prep.
Each ingredient has a specific function in this experiment. Functions
are as follows:
liquid detergent: liquid soap is a lipid and protein emulsifier that
works by binding to the lipids and proteins and precipitating them
out of solution. The detergent/salt solution breads down the lipid cell
walls of the onion cells in order to release the cytosol.
NaCl: helps to precipitate the DNA out of the ethanol solution
because the Na+ ions surround the negative phosphorous ends of the
DNA and shields them from each other. This causes a decrease in
repulsive forces and allows the DNA to come closer together and
coalesce.
heat: denatures the DNAase enzymes which have the potential to
break genomic DNA into tiny pieces and prevent DNA from spooling.
cold: slows the rate of DNA breakdown.
blender: chops through cellular tissues like the cell wall, cell
membrane, and nuclear membrane, and thereby releases DNA.
39
Laboratory:Who Put theDNA in MySalad?
papain: contains protease, a protein enzyme that helps clear proteins
away from DNA. This enzyme is found in contact lense cleaners as
well.
ethanol/isopropanol: because DNA is not soluble in ice-cold ethanol,
it precipitates out of solution.
Pre-Lab Questions:Pre-Lab Questions:Pre-Lab Questions:Pre-Lab Questions:Pre-Lab Questions:These questions are designed to get students to think about the
experiment before the lab begins. Make sure students have read the
lab procedure before attempting to answer, but allow creative freedom
in the answers. It may be a good idea to have students answer the
pre-lab questions again once the experiment has been completed.
Be sure to go over the correct answers as well.
40
Who Put theDNA in MySalad?
Do you realize that all of you are now biotechnologists? In the previous
activity, you traveled back in time to use living organisms to make a
product. Along with the nomad people living long ago in Asia, you used
bacterial power to make yogurt. Bring those ancients back to the future and
delve into the modern world of biotechnology! Will you and the people of
ancient Asia survive as biotechnologists in today’s world? Not unless you
know about DNA! Take the magnifying glass out of your pocket and
investigate! Who put the DNA in your salad?
Procedure: Day OneProcedure: Day OneProcedure: Day OneProcedure: Day OneProcedure: Day OneThis part of the lab will be led by the teacher, and the whole class will
observe. Pre-lab questions may be answered during the lag times in this
lab procedure.
Labratory Preparation Procedure:1. Add 15.0 g of NaCl to 100 ml liquid dish washing detergent.
Add approximately 900 ml distilled water to make a final
volume of 1000 ml.
2. Cut the onion into pieces which are approximately one cm 2 in size.
Place the onion pieces into one of the large (500 ml) beakers.
3. Cover the onion slices with 100 ml of the detergent solution.
4. Stir the mixture and let it sit in a hot water bath for 15 minutes.
(The temperature of the hot water bath should be diligently
maintained at >60°C but well below 80°C, as this range is
optimal for the breakdown of enzymes which would break
apart the DNA.
5. Transfer beaker to an ice water bath and cool for 5 minutes,
stirring frequently. The breakdown of the DNA itself is slowed
down by this cooling step.
6. Pour the mixture into a blender and blend it at low speed
for one minute.
7. Filter the mixture through four thicknesses of cheesecloth or a
#6 coffee filter. The filtration process may be very slow, so you may
want to transfer the entire set-up to the refrigerator to complete the
filtration over night. Attempt to keep the foamy part of the mixture
from getting into the filtrate.
8. Leave the 95% ethanol in the freezer overnight, because it must be
icy-cold for the second part of this experiment.
STU
DENT ACTIVITY
DINI N G O N D
NA
41
Who Put theDNA in MySalad?
Pre-lab Questions:Pre-lab Questions:Pre-lab Questions:Pre-lab Questions:Pre-lab Questions:
1a. Is DNA found in all living organisms? ______________________
1b. Where is the DNA located within the cell?
________________________________________________________________________
_______________________________________________________________________
2. What do you think is the function of DNA?
________________________________________________________________________
________________________________________________________________________
_______________________________________________________________________
3. Read through the laboratory procedure and answer the following
questions:
a. What solution helps break down the outer cell wall of the onion?
______________________________________________________
______________________________________________________
b. What solution helps the DNA to come out of solution or to
“precipitate”?
________________________________________________________________________
________________________________________________________________________
4. What barriers do we need to get through to reach the DNA?
________________________________________________________________________
________________________________________________________________________
_______________________________________________________________________
STU
DENT ACTIVITY
DINI N G O N D
NA
42
Who Put theDNA in MySalad?
STU
DENT ACTIVITY
DINI N G O N D
NA
Laboratory Procedure:Laboratory Procedure:Laboratory Procedure:Laboratory Procedure:Laboratory Procedure:Day Two
Teacher Preparation:
1. Place 6 ml of the onion filtrate into enough test tubes so that
each lab group has one.
2. Mix 3 g of meat tenderizer into 50 ml water, creating a 6%
solution.
3. Give each lab group 3.5 ml of the 6% meat tenderizer solution.
4. Prepare a 4% NaCl solution by adding 4g NaCl to 100 ml
distilled H2O.
5. Prepare the phenol red indicator solution by adding a “toothpick
tip” amount of phenol red powder in 100 ml distilled water.
The solution should be a light amber color.
Materials Needed:Materials Needed:Materials Needed:Materials Needed:Materials Needed:Each Lab Group:
• one 20 ml test tube with 6 ml onion filtrate
• one 10 ml test tube with 9 ml ice cold ethanol
• one 10 ml test tube with 3.5 ml meat tenderizer solution
• one glass rod (200 mm long)
• test tube rack
• one test tube containing 3 ml 4% NaCl solution
• eyedropper for adding phenol red indicator
Students:
1. Add the entire volume of meat tenderizer solution (3.5 ml) to the
20 ml test tube with your onion filtrate and mix it by swirling.
2. Immediately add 9 ml of ice cold ethanol to the 20 ml test tube
with the onion filtrate mixture by slowly pouring it down the
side of the test tube so that two distinct layers of liquid appear.
3. Let this test tube sit for 2-3 minutes without disturbing it.
You may see bubbles forming during this time and the DNA
will begin to precipitate out of the filtrate solution.
4. Swirl the interface between the two layers gently using the glass rod
until the bubbles no longer appear.
5. Using a twirling motion of the glass rod, move the glass rod slowly
through the interface of the two layers of liquid. Continue to twirl
while gently lifting the mucus-like DNA up out of the solution.
6. Carefully place the mucus-like DNA into the 10 ml test tube
containing the 4% NaCl solution.
7. Add five drops of phenol red indicator to the DNA solution.
43
Who Put theDNA in MySalad?
STU
DENT ACTIVITY
DINI N G O N D
NA
Post-lab Questions:Post-lab Questions:Post-lab Questions:Post-lab Questions:Post-lab Questions:
1. Describe, in your own words, what the extracted onion DNA
looks like.
__________________________________________________________________
__________________________________________________________________
_________________________________________________________________
2. When phenol red indicator is added to an acid solution, it produces
a pink/red color.
a. What color change took place when you added the phenol red to
your extracted DNA?
_________________________________________________________________
_________________________________________________________________
b. What does this color change tell you about the DNA molecule?
_________________________________________________________________
_________________________________________________________________
3. Recombinant DNA technology is a modern day biotechnology
application that allows scientists to combine specific DNA
sequences from one organism with the DNA of another organism.
a. Why might a scientist want to add DNA to an organism?
__________________________________________________________________
__________________________________________________________________
_______________________________________________________
b. If you could use recombinant DNA technology to change the DNA
of an onion, what “new” characteristics would you want it to have?
W h y ?
__________________________________________________________________
__________________________________________________________________
__________________________________________________________________
_________________________________________________________________
c. To create this “new” onion, would you insert a gene (DNA sequence)
from another plant or animal? Explain.
__________________________________________________________________
__________________________________________________________________
__________________________________________________________________
44
Who Put theDNA in MySalad?
STU
DENT ACTIVITY
DINI N G O N D
NA
Post-lab Questions (continued):Post-lab Questions (continued):Post-lab Questions (continued):Post-lab Questions (continued):Post-lab Questions (continued):4. Other biotechnology applications (similar to recombinant DNA
technology) allow scientists to “turn-off” or remove a sequence
of DNA.
a. Why might a scientist want to remove DNA from an organism?
__________________________________________________________________
__________________________________________________________________
_______________________________________________________
b. If you could use an application of biotechnology to remove a
specific characteristic of an onion, what characteristics would you
want to get rid of? Why?
__________________________________________________________________
__________________________________________________________________
__________________________________________________________________
_________________________________________________________________
Bonus Question:Bonus Question:Bonus Question:Bonus Question:Bonus Question:DNA dictates the form and function of an organism. How does it do
this?
________________________________________________________________________
________________________________________________________________________
________________________________________________________________________
________________________________________________________________________
________________________________________________________________________
_______________________________________________________________________
Vocabulary:Vocabulary:Vocabulary:Vocabulary:Vocabulary:1. enzyme ____________________________________________
__________________________________________________
2. denaturation ________________________________________
__________________________________________________
3. solubility ___________________________________________
__________________________________________________
4. precipitate __________________________________________
__________________________________________________
5. D N A ______________________________________________
45
Who Put theDNA in MySalad?
Answers to Pre-lab Questions:Answers to Pre-lab Questions:Answers to Pre-lab Questions:Answers to Pre-lab Questions:Answers to Pre-lab Questions:
1. a. Is DNA found in all living organisms?
b. Where is the DNA located within the cell?
Yes, DNA is found in all organisms (both the living and, in most cases,
the once-living). DNA is located inside cells. In prokaryotes (those
one-celled organisms like bacteria that do not have a nucleus), DNA
is found floating around in the cytoplasm (“cyto” means cell and
“plasm” means fluid). In eukaryotes (organisms such as plants and
animals with a “eu-” or “true” nucleus), DNA is found within the
nucleus of the cell.
2. What do you think is the function of DNA?
Students might not yet understand the significance of DNA, so
students may respond with a variety of answers. The purpose of this
question is to get students to think about the significance of DNA
before the laboratory activity. DNA an informational molecule that
governs form and function for a single cell, and for the billions of
cells that make up an organism. DNA is the “blueprint” (or set of
instructions) that dictates the physical appearance as well as
biological function of the organism.
3. Read through the laboratory procedure and answer the following
questions:
a. How do you think the outer cell wall of the onion is broken down?
The blender chops up (breaks down) the cell wall, cell membrane, and
nuclear membrane. Teachers may wish to point out that as the cell
wall, cell membrane, and nuclear membrane are broken down, DNA is
released from the cell.
Teachers: You may choose to explain to students that the liquid
detergent also assists in cell wall breakdown. The liquid detergent
disrupts the polar interactions that hold the cell membrane together,
thereby suspending the lipids and proteins of the cell in its own soapy
liquids. Thus, the cell membrane begins to break down.
46
Who Put theDNA in MySalad?
b. What solution helps the DNA to come out of solution or to
“precipitate”?
In the Day Two Laboratory procedure, students add 9 ml of ice cold
ethanol to the test tube with the onion filtrate mixture. In the
following step, students watch for a precipitate to form. Therefore,
students should be able to deduce that the ethanol helps the DNA
to come out of solution or to “precipitate”.
An in-depth look at what really happens: The NaCl solution
precipitates the DNA out of the ethanol solution because the Na+
ions surround the negative phosphorous ends of the DNA and shield
those ends from each other. This causes a decreases in repulsive forces
and allows the DNA to come closer together and coalesce.
4. What barriers do we need to get through to reach the DNA?
The onion is an eukaryote, so its DNA is in the nucleus. Therefore, we
need to go through the cell membrane, cell wall, all the cytoplasmic
proteins, and the nuclear membrane in order to reach the DNA.
Answers to Post-Lab Questions:Answers to Post-Lab Questions:Answers to Post-Lab Questions:Answers to Post-Lab Questions:Answers to Post-Lab Questions:1. Describe in your own words what the extracted onion DNA
looks like.
This is a subjective answer. Creativity is encouraged. One view is that
after the DNA has been precipitated, it looks like a big, cloudy, swirling
mass of cotton floating around in water.
2. When phenol red indicator is added to an acid solution it produces
a pink/red color.
a. What color change took place when you added the phenol red to
your extracted DNA?
Change should have been to pink/red.
b. What does this color change tell you about the DNA molecule?
It is acidic in nature. Hence, the name deoxyribonucleic acid (DNA).
47
3. Recombinant DNA technology is a modern day biotechnology
application that allows scientists to combine specific DNA
sequences from one organism with the DNA of another organism.
a. Why might a scientist want to add DNA to an organism?
A scientist might utilize recombinant DNA technology to add DNA to
an organism in order to give that organism the ability to do something
it could not do before, or to give the organism more desirable
characteristics.
b. If you could use recombinant DNA technology to change the DNA
of an onion, what “new” characteristics would you want it to have?
W h y ?
• A thicker skin so that you could peel the onion like an apple (or an
orange)!
• Make the outer skin soft and moist so that you don’t have to worry
about peeling the skin before you cut the onion.
• A new taste!
c. To create this “new” onion, would you insert a gene (DNA sequence)
from another plant or animal? Explain.
Yes. To make an onion with a thicker skin so that it would peel like an
apple, a scientist might add the DNA from an apple that codes for skin
thickness. To make the outer skin soft and moist so that it would not be
necessary to peel off the skin before eating the onion, a scientist might
combine the “skin genes” from a grape with the genes of the onion.
Teachers: These gene transfer scenarios are purely fictitious.
4. Other biotechnology applications (similar to recombinant DNA
technology) allow scientists to “turn-off” or remove a sequence
of DNA.
a. Why might a scientist want to remove DNA from an organism?
A scientist might want to remove DNA from an organism to get rid of
“undesirable” characteristics.
b. If you could use an application of biotechnology to remove a
specific characteristic of an onion, what characteristics would you
want to get rid of? Why?
• The smell of the onion so your eyes would not water as you cut up
the onion.
• The flavor of the onion so the taste does not linger in your mouth
for several hours after eating an onion.
Who Put theDNA in MySalad?
48
Who Put theDNA in MySalad?
Answer to the Bonus Question:Answer to the Bonus Question:Answer to the Bonus Question:Answer to the Bonus Question:Answer to the Bonus Question:DNA dictates the form and function of an organism. How does it
do this?
DNA is often called the “building block of proteins”, and it dictates the
form and function of an organism by coding for specific structural or
functional proteins.
Structural proteins eventually make up the physical “hardware” of an
organism while the functional proteins make up the “software” of an
organism. In mammals, the hair, skin, organs, and muscle are made up
of structural proteins, and functional proteins, such as hormones and
enzymes, run all biological systems.
Another analogy: Structural proteins are like the houses, buildings, cars
etc. that make up a town, while functional proteins are the people who
do things within the town.
Vocabulary:Vocabulary:Vocabulary:Vocabulary:Vocabulary:enzyme: a protein that works to speed up or initiate chemical
reactions; a protein that does something.
denaturation: breaking bonds within the structure of a protein
(via heat or increasing the alkalinity) so that the original properties
are greatly changed or eliminated.
solubility: the capability to be dissolved.
precipitate: a substance that is settled out of a solution.
DNA: deoxyribonucleic acid; an informational molecule that contains
the genetic code and transmits the hereditary pattern; an essential
component of all living cells.
49
Building Life:How Do YouThink It Works?
Now that we have observed the actual presence of DNA in a food (onion) we
will move on to examine this DNA in more detail. We have heard over and
over that DNA is an organism’s “blueprint”, that it determines what the
organism looks like as well as how it functions. Sounds interesting, but just
how does DNA achieve all of this? Look no further.
Summary:Summary:Summary:Summary:Summary:Through the building of a DNA model, the students will be exposed
to the structural details of this important genetic material which will
initiate their quest in learning how DNA dictates the form and
function of an organism. This knowledge will help the students make
the transition into how and why modern day technology is focused
on manipulating this genetic material in order to create desired
changes in an organism.
Objectives:Objectives:Objectives:Objectives:Objectives:• Students will investigate the detailed structure of the DNA molecule
by building a model of the structure.
• Students will attempt to link the structure of DNA with its primary
function of determining the form and function of an organism.
• Students will explore the association between the DNA structure
and protein synthesis.
• Students will better understand why present day biotechnology
efforts are focused on the manipulation of this genetic material for
the purpose of creating or eliminating specific traits of an organism.
Suggested Time:Suggested Time:Suggested Time:Suggested Time:Suggested Time:One class period
Materials:Materials:Materials:Materials:Materials:fishing line/string or heavy thread toothpicks needle
two different colored tape rolls scissors raisins
apple chunks grapes apricots
Procedure:Procedure:Procedure:Procedure:Procedure:The entire procedure is detailed on the Student Activity Sheet .
It is suggested that students work in pairs for this activity, so the teacher’s
pre-lab preparation simply involves gathering materials and dividing
those materials for the appropriate number of lab pairs. Following the
modeling the students should do the protein synthesis review sheet.
Some of the post-activity questions involve comparing the DNA model
to the actual structure of DNA (specifically, nucleotide names and
pairing of nucleotides). You may want to set aside time to go over this
information with the students or provide the resources and opportunity
for the students to seek these answers on their own.
50
Building Life:How Do YouThink It Works?
STU
DENT ACTIVITY
DINI N G O N D
NA
As you learned in the “Who Put DNA in My Salad?” activity, DNA is
found in every cell of every organism. Once it is isolated, DNA looks the
same no matter what organism it comes from. You’ve seen the DNA from
an onion cloud up and spool like a fluffy strip of cotton candy, but do you
know exactly what DNA looks like up close?
In the 1950s, James Watson and Francis Crick (with the help of
experimental data from a woman named Rosalind Franklin) uncovered
the structure of DNA. Since then, scientists have used Watson and Crick’s
model as the basis of DNA research. As a result of Watson and Crick’s
discovery, it is possible to make a simple representation of DNA. Go to it!
Note: For more historical information on these DNA pioneers, go to
the “Access Excellence” homepage. The World Wide Web address for
this site can be found in the resource list at the end of the unit.
Materials:Materials:Materials:Materials:Materials:fishing line/string or heavy thread toothpicks needle
two different colored tape rolls scissors raisins
apple chunks grapes apricots
Modeling Activity Procedure:Modeling Activity Procedure:Modeling Activity Procedure:Modeling Activity Procedure:Modeling Activity Procedure:Part One
1. Cut one piece of fishing line three feet long. Tie five knots as close
together as possible in one end. Wrap a piece of the colored tape
around this end and write “5” on the tape. This will make your
5-knot end easier to identify.
2. With the open end, thread the needle. Pull the needle and fishing
line through a raisin until the raisin is close to the fifth knot or
colored tape.
3. Tie a knot around the raisin in order to “lock” the raisin into
position (approximately one inch from the uppermost knot).
4. Pull the needle and fishing line through a grape until it sits
approximately one inch above the raisin.
5. Tie a knot around the grape in order to “lock” the grape into
position (approximately one inch above the raisin).
6. Continue stringing fruits (in any order) until your fishing line has
twenty fruit pieces on it. Make sure all your fruits are approximately
the same distance from each other (one inch is a good distance).
51
Building Life:How Do YouThink It Works?
STU
DENT ACTIVITY
DINI N G O N D
NA
8. Before making your second strand, lay STRAND I in front of you
with the 5-knot end of the left and the 3-knot end on the right.
9. You are going to “read” STRAND I from the 5-knot to the 3-knot
end (or left to right), and add the matching fruit to the second
strand accordingly.
10. Cut another three feet long piece of fishing line and tie three knots
in one end. Start adding fruit to this second strand as you read
STRAND I from left to right. Be sure you are pairing the fruit
appropriately as indicated in the box above.
11. Continue adding fruit until all twenty fruit pieces on STRAND I
have a “matching” fruit on the second strand.
12. Tie off the second strand with five knots.
Your fruit strand (let’s call it STRAND I) represents a sequence
of chemicals called nucleotides that are bonded together to
form one-half of the DNA molecule. To form the other half of
the DNA molecule, you need to make a second fruit strand.
Each fruit on the second strand must “pair with” or “match “
a corresponding fruit on STRAND I.
Because there are four different fruits and each fruit needs to
match up with another fruit, you can make two fruit pairs.
So that the entire class is consistent, the fruit should be paired
as follows: grapes with raisins
apples with apricots
7. After stringing the last fruit, tie off the open end of the fruit strand
with three knots. Wrap a piece of the colored tape not used yet
around this end. Write “3” on the tape. This will make your 3-knot
end easier to identify.
52
Building Life:How Do YouThink It Works?
STU
DENT ACTIVITY
DINI N G O N D
NA
Congratulations!Congratulations!Congratulations!Congratulations!Congratulations!You have successfully created two separate strands of what will eventually
become your DNA model. Each fruit strand represents the sequence of
chemicals that bind together to form the one-half of the DNA molecule.
The chemicals (fruits) are called nucleotides. The nucleotides are linked by
chemical bonds. Next, you will link these two separate strands together to
complete the structure of the DNA molecule. At this point in time, answer
the questions below:
Post-Activity Questions:Post-Activity Questions:Post-Activity Questions:Post-Activity Questions:Post-Activity Questions:Part One:
Note: You may want to use your biology text book to assist you in
answering these questions.
1. Each of the fruit types on your “DNA” strand represents a nucleotide.
a. What are the names of the 4 different nucleotides which are on an
actual (real, not fruit) strand of DNA?
_________________________ ________________________
_________________________ ________________________
b. Of these 4 nucleotides, indicate which ones pair together on a DNA
molecule?
________________________ with _________________________
________________________ with _________________________
2. Each nucleotide can be broken down into three parts. What are
these three parts?
______________________________________________________
______________________________________________________
3. If the fruit pieces represent chemicals (or nucleotides) that must
bind together to form DNA, what materials represent the bonds
between these nucleotides on a single strand of DNA?
________________________________________________________________________
4. Somehow, the two strands must also bind together. What materials
will you use to bind the two strands to each other? Will these bonds
be different from the bonds that form the string? How?
________________________________________________________________________
________________________________________________________________________
5. You built your two DNA strands so that the first strand pairs
(matches) directly with the second strand. Do you know what this
phenomenon is called? If not, what would you call it?
________________________________________________________________________
________________________________________________________________________
53
Building Life:How Do YouThink It Works?
STU
DENT ACTIVITY
DINI N G O N D
NA
Modeling Activity Procedure:Modeling Activity Procedure:Modeling Activity Procedure:Modeling Activity Procedure:Modeling Activity Procedure:Part Two:
1. You are going to use the toothpicks to link the two strands together.
As you may have guessed by now, the toothpicks will represent the
bonds between nucleotides (fruits) on the two strands of DNA.
2. Before you bond the nucleotides (fruits) on STRAND I to the
nucleotides on STRAND II, you should lay the two strands in front
of you. STRAND I should be oriented with the 5-knot end on your
left and the 3-knot end on your right. STRAND II should be oriented
with its 3-knot end on your left and its 5-knot end on your right.
3. Use the toothpick to connect the fruit on the 5-knot end of
STRAND I with the fruit on the 3-knot end of the STRAND II.
Just stick one end of the toothpick into one fruit and the other
end of the toothpick into the other fruit.
4. Make a toothpick bond (connection) between each fruit on
STRAND I and its corresponding fruit on the STRAND II.
5. You aren’t done yet! Tie the 5-knot end of STRAND I to the 3-knot
end of the STRAND II. Next, tie the 3-knot end of the STRAND I to
the 5-knot end of the STRAND II.
6. Using the tape, cover up these two final knots.
7. Next, grab the taped ends (one in each hand) and begin to twist the
model. Twist your left wrist in the opposite direction from
your right wrist.
Congratulations! You have completed the creation of your DNA model!
Post-Activity Questions:Post-Activity Questions:Post-Activity Questions:Post-Activity Questions:Post-Activity Questions:Part Two:
1. If one chain of a DNA molecule has the following sequence, in
the blank space below write the sequence of the opposite chain
of that DNA molecule
5' A T T C G G C A A T C G T A 3'
3' _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 5 '
54
Building Life:How Do YouThink It Works?
STU
DENT ACTIVITY
DINI N G O N D
NA
Post-Activity Questions:Post-Activity Questions:Post-Activity Questions:Post-Activity Questions:Post-Activity Questions:Part Two:
2. Observing your DNA model, note the following bonds:
• The string represents bonds between the nucleotides on the
same strand of DNA.
• The toothpicks represent the bonds connecting the two
complementary strands of DNA.
a. Which of these two bonds do you think is weaker?
__________________________________________________________________
b. What is a possible reason for this particular bond being weaker?
__________________________________________________________________
__________________________________________________________________
__________________________________________________________________
3. Below, write down the sequence of one of your fruit DNA strands,
reading it from the 5' to the 3' end.
5' ____ _____ _______ _____ _____ _____
____ _____ _______ _____ _____ _____
____ _____ _______ _____ _____ _____
____ _____ 3 '
4. You are a world renowned food scientist attempting to eliminate an
allergy causing substance from the peanut. You have information
that the gene coding for this allergen contains the fruit sequence
grape, apple, apple, raisin, apricot, raisin.
a. Does your DNA strand (from question 3) contain the gene coding
for the allergen? (Remember: DNA is read from the 5’ end to the 3’
end.)
______________________________________________________
b. List three approaches you might take to eliminate the production of
this allergen from the genetic code of the peanut.
__________________________________________________________________
__________________________________________________________________
__________________________________________________________________
55
Building Life:How Do YouThink It Works?
Answers Answers Answers Answers Answers Post-Activity Questions:Post-Activity Questions:Post-Activity Questions:Post-Activity Questions:Post-Activity Questions:Part Two:
1. Each of the fruit types on your “DNA” strand represent a nucleotide.
a. What are the names of the four different nucleotides which are on
an actual (real, not fruit) strand of DNA?
Adenine nucleotide, thymine nucleotide, guanine nucleotide,
cytosine nucleotide.
b. Of these four nucleotides, indicate which ones pair together on a
DNA molecule?
Adenine pairs with thymine. Guanine pairs with cytosine.
2. Each nucleotide can be broken down into three parts. What are
these three parts?
One of these parts is sugar. In DNA this sugar is called deoxyribose.
Another part of the nucleotide is a compound of phosphorus-
phosphoric acid (H3PO
4). The third part of the nucleotide is a ring-like
structure of carbon, hydrogen, and nitrogen called a nitrogenous base.
These bases are adenine, thymine, guanine and cytosine, and hence,
give the individual nucleotide their identity.
3. If the fruit pieces represent chemicals (or nucleotides) that must
bind together to form DNA, what materials represent the bonds
between these nucleotides on a single strand of DNA?
The fishing line.
4. Somehow, the two strands must also bind together. What
materials will you use to bind the two strands to each other?
Will these bonds be different from the bonds that form the
string? How?
The toothpicks. Yes, the toothpick bonds are different from the string
bonds. The toothpick bonds are weaker, easier to break.
5. You built your two DNA strands so that the first strand pairs
(matches) directly with the second strand. Do you know what this
phenomenon is called? If not, what would you call it?
Complementation is the preferred answer here. However, any answer
which reflects pairing or matching of strands may be acceptable.
56
Building Life:How Do YouThink It Works?
Post-Activity Questions:Post-Activity Questions:Post-Activity Questions:Post-Activity Questions:Post-Activity Questions:Part 2:
1. If one chain of a DNA molecule has the following sequence, in
the blank space below write the sequence of the opposite chain
of that DNA molecule
5' A T T C G G C A A T C G T A 3'
3' T A A G C C G T T A G C A T 5'
2. Observing your DNA model, note the following bonds:
The string represents bonds between the nucleotides on the same
strand of DNA. The toothpicks represent the bonds connecting the
two complementary strands of DNA.
a. Which of these two bonds do you think is weaker?
The toothpicks. These toothpicks represent hydrogen bonds, which are
relatively easy to break.
b. What is a possible reason for this particular bond being weaker?
The two strands of DNA must readily “unzip” in order for DNA
replication or protein synthesis to occur.
3. Below, write down the sequence of one of your fruit DNA strands,
reading it from the 5' to the 3' end.
5' Answer dependent on the individual creation! 3'
4. You are a world renowned food scientist attempting to eliminate an
allergy causing substance from the peanut. You have information
that the gene coding for this allergen contains the fruit sequence
grape, apple, apple, raisin, apricot, raisin.
a. Does your DNA strand (from question 3) contain the gene coding
for the allergen?
Answer dependent on the individual creation!
b. List three approaches you might take to eliminate the production
of this allergen from the genetic code of the peanut.
1. Cut out the gene sequence coding for the allergen.
2. Insert an additional “fruit” to interrupt the sequence coding for
the allergen.
3. Reverse the sequence coding for the allergen.
57
DNA DeterminesForm & Function HOW?
Now that you have observed the structure of DNA through your food
model, it is time to explore just how this amazing material helps to
determine how organisms (including plants, animals, microbes and YOU)
look and function. The following background material will provide you
with some essential information for learning more about DNA and its
important role in life.
DNA is a molecule that contains hereditary information which passes
from parents to offspring. The molecule is found within the nucleus of
each cell in your body and within the cells of all living organisms.
Up close, DNA looks like a twisted ladder. Each rung of this ladder is
actually two chemicals (nucleotides) bonded to each other.
The DNA molecule is made up of a total of four nucleotides: adenine,
thymine, cytosine and guanine. We’ll just call them A, T, C and G.
The DNA ladder fits together in a very exact manner.
The rules for nucleotide bonding in the DNA double helix are:
A bonds only with T and C bonds only with G.
Background InformationBackground InformationBackground InformationBackground InformationBackground Information
58
DNA codes for the proteins that give cells structure and function.
Proteins are biologically important compounds that are found in all
plants, animals, and microbes. Structural proteins determine the
strength, shape, and elasticity of an organism’s cells. Functional
proteins dictate how cellular components act. One way of thinking
about this relationship is as follows:
• Structural proteins that make up a cell are like the houses,
buildings, streets and signs that make up a town.
• Functional proteins working within a cellular system are the
people who do things within the town.
DNA DeterminesForm & Function HOW?
Background InformationBackground InformationBackground InformationBackground InformationBackground Information
DNAdouble strandunzips revealing
exposednucleotides
A
A
T
T
G
T
T
T
G
G
C
G
T
T
C
G
C
C
A
A
A
C
A
A
DNAStrand 1
DNAStrand 2
DNADouble Strand
A
A
A
A
C
A
C
T
C
G
C
T
T
G
T
T
T
G
G
C
A
G
A T
When it is time to make a protein, the
DNA molecule unzips—just like the
zipper on a coat. Once DNA unzips, a
“secret code” on the single DNA strand
is exposed. This secret code is simply
the order that the nucleotides are
arranged on that DNA strand.
59
Next, the newly formed mRNA acts as a messenger by carrying its code
outside the nucleus.
A similar molecule called RNA begins to “read” the DNA secret code.
The code is always read in the direction from the 5’ end of the strand
to the 3’ end. Two types of RNA are involved in the decoding process:
mRNA (messenger RNA ) and tRNA ( transfer RNA ).
In the first decoding step ( transcription ), mRNA “reads” the A,T,C,G
code from single stranded DNA. As mRNA reads, it forms its own
complementary code. The chemicals in this RNA code bond with
DNA like the pieces of a puzzle. The RNA code is similar to the DNA
code in that it is made up of four nucleotides. The only difference is
that the nucleotide uracil (U) on the RNA replaces T (thymine) on
the DNA.
mRNA forms ascomplementary strand offof DNA single strand
A
A
U
U
G
U
U
U
G
G
C
G
T
T
C
G
A
newly formedmRNA strand
DNAStrand 2
Note:U replaces Ton RNA
pore
A
C
A
A
A
C
C
completedmRNA leavesnucleus
nuclearmembrane
DNA DeterminesForm & Function HOW?
Background InformationBackground InformationBackground InformationBackground InformationBackground Information
60
DNA DeterminesForm & Function HOW?
tRNA with attached amino acito complementary triplet on
UUGUUUGGCA GA
UU
AA
C
mRNA
tRNA a 3-nucleotide unit floats in cytoplasm. An amino acid, coded for by 3-nucleotide sequence,
attaches to appropriate tRNA
U CU G C C A A A
aminoacids
C A A
As tRNA’s "read" mRNA codesequentially, amino acidstrand grows formingprotein molecule
U
mRNA
UGUGCG
Growing chainof amino acid
eventually becoprotein molecu
A
A A G U U
AA
Here, another molecule called transfer RNA (tRNA) is present. tRNA
has three nucleotides on it. With the help of an organelle called a
ribosome , the three nucleotides of the tRNA bind to complementary
nucleotides on the mRNA. Attached to the end of the tRNA is a specific
amino acid (AA).
Note: The amino acid bound to the tRNA is determined by the
specific code or three nucleotides of that tRNA.
Tagging along with each tRNA is an amino acid. As several tRNAs are
bound along and then released the mRNA strand, these accompanying
amino acids also bind together and form an amino acid chain.
This amino acid chain is a protein. A
single protein may contain hundreds
of amino acids linked together.
61
ChocolateFlavoredCherries
An Exercise inAn Exercise inAn Exercise inAn Exercise inAn Exercise inRecombinant DNARecombinant DNARecombinant DNARecombinant DNARecombinant DNATechnologyTechnologyTechnologyTechnologyTechnology
Through the previous exercise, students were able to understand the
structure of DNA and how this structure related to the function of DNA
within an organism. In this activity, students will utilize this knowledge
of the DNA structure while exploring how today’s scientists are able
to manipulate this genetic material in efforts to produce desired
characteristics or products.
Summary:Summary:Summary:Summary:Summary:Students conduct a simulation of a recombinant DNA technique.
They attempt to create a chocolate flavored cherry by combining a
gene coding for chocolate with DNA from a cherry tree.
Objectives:Objectives:Objectives:Objectives:Objectives:• Students will gain an appreciation for the association between
modern biotechnology techniques and food production/processing.
• Students will understand one type of biotechnology as the
manipulation of a living organism’s genetic code to make a product
or run a process.
• Students will understand recombination as an application of
biotechnology.
• Students will gain an appreciation for the malleability of DNA and
how this characteristic has spawned the tremendous advancements
in genetic engineering.
Suggested Time:Suggested Time:Suggested Time:Suggested Time:Suggested Time:One class period.
Teachers:Teachers:Teachers:Teachers:Teachers:It is important that the students are reminded that the procedure
they will follow for this activity is simply for example. Any DNA
sequence used in this activity is not an actual gene sequence for
cacoa, chocolate flavoring, or a cherry tree.
Materials List:Materials List:Materials List:Materials List:Materials List:• cacao DNA (linear paper DNA)
• restriction Enzyme (scissors)
• plasmid DNA (circular paper DNA)
• ligase (tape)
• background information sheet: Recombinant DNA Technology
62
ChocolateFlavoredCherries
An ExerciseAn ExerciseAn ExerciseAn ExerciseAn Exercisein Recombinantin Recombinantin Recombinantin Recombinantin RecombinantDNA TechnologyDNA TechnologyDNA TechnologyDNA TechnologyDNA Technology
STU
DENT ACTIVITY
DINI N G O N D
NA
We know that a recipe is a set of directions which dictates what a final end
product will be like. Similarly, an organism’s DNA is a set of directions
which dictates the physical appearance and functions of an organism.
So if you want to make the organism better by changing the set of
directions, how do you go about this? This is precisely where modern
biotechnology techniques have arrived.
By combining DNA that contains the instructions for a desired trait with
the organism’s DNA, scientists are enabling that organism to express the
desired trait. Conversely, by removing a section of DNA from the organism
which codes for an undesirable or reversing the genetic sequence (antisense)
the end result may also be a more productive, functional organism.
Situation:Situation:Situation:Situation:Situation:A large candy company has hired your laboratory to conduct a very
important project. The company is attempting to develop a new
product, chocolate flavored cherries. Consumer surveys indicate that
people love the combination of chocolate and cherries and the ACME
Candy Company wants to be the first to put these delicious morsels on
the market. You are the laboratory technician given the task of altering
the DNA of a cherry tree so that it bears a fruit that has a chocolate
flavor to it. The “big shot” scientist in your laboratory has isolated a
gene in the cacao bean which codes for the delicious chocolate flavor.
It is up to you as laboratory technician to remove this gene from the
cacao bean and insert it into the cherry seedling so that the new
chocolate flavored cherry results. If you follow the directions below
closely, you are bound to get a promotion and probably a big raise too!
Fun Fact:Fun Fact:Fun Fact:Fun Fact:Fun Fact:Chocolate really does grow on trees! Well, at
least one of its most important ingredients does.
The cacao bean grows inside large pods that
sprout from the trunk of a large cacao tree or
Theobroma Cacao . Each pod contains between
20 to 60 cacao beans. The trees grow in regions
close to the equator where it is warm all
year round.
63
An Exercise inRecombinantDNA Technology
STU
DENT ACTIVITY
DINI N G O N D
NA
Plasmid DNA: VectorPlasmid DNA: VectorPlasmid DNA: VectorPlasmid DNA: VectorPlasmid DNA: Vector
direction
inwhichDNAsequenceshouldberead
→
cut out thismiddle section
GACT
CT
TT
AA
AG
AC
AA
AA
AA A T A A
CT
C
CA
TC
GA
TA
AA
CC
TCG
CTGAG
AAAT
TT
CT
GTT
TTT T T A T T G
AG
GTA
GC
TAT
TT
GG
AGC
ATGCTCGGCAAGCTTATTGAGGTAGCTGGCTACCGCT
TACGAGCCGTTCGAATAACTCCATCGACCGATGGCGA
Start
5’
5’
Star
Stop
3’
3’
Stop
Linear DNA fromLinear DNA fromLinear DNA fromLinear DNA fromLinear DNA fromthe Cacao Bean:the Cacao Bean:the Cacao Bean:the Cacao Bean:the Cacao Bean:
63
64
ChocolateFlavoredCherries
An ExerciseAn ExerciseAn ExerciseAn ExerciseAn Exercisein Recombinantin Recombinantin Recombinantin Recombinantin RecombinantDNA TechnologyDNA TechnologyDNA TechnologyDNA TechnologyDNA Technology
STU
DENT ACTIVITY
DINI N G O N D
NA
Procedure:Procedure:Procedure:Procedure:Procedure:
1. Before beginning your Nobel Prize winning procedure, please read
the background information sheet on Recombinant DNA. There is
lots of information here which will help you with your pre-activity
questions, the actual procedure and the post-activity questions.
2. Complete your Pre-Activity Questions .
3. Removing the desired gene from the linear cacao DNA:
a. Pick up your restriction enzyme (scissors).
b. Beginning on the top of your cacao DNA ladder at the end that
indicates “start” (the 5’ end) read the bases of the strand until you
have read an A G C T sequence all in a row in that order.
c. Use your restriction enzyme (scissors) to make a cut after the
A in the four base sequence.
d. Continue to make cuts after the A in every four-base A GC T
sequence.
e. Now begin reading the DNA on the bottom strand of your cacao
DNA ladder. Start reading from the end that indicates “start” and
look for an A GC T sequence all in a row in that order.
f. As before, make a cut after the A in every four-base A GC T
sequence.
g. One cut on the top cacao DNA strand should be two bases (rungs)
away from one cut on the bottom cacao DNA strand. Cut through
the hydrogen bonds right down the middle of the DNA ladder in
order to connect the two closest cuts.
h. Repeat this step on the opposite end of the DNA ladder. You should
make a total of two cuts down the middle of the ladder, right
through the hydrogen bonds.
i. Remove the strip of DNA that comes out of the DNA ladder. This
piece of DNA should have two exposed rungs and a central portion
of the ladder intact. It contains the chocolate-flavor gene and
should be shaped like this:
j. Put this DNA aside for the moment and move on to the plasmid.
GC
CG
65
ChocolateFlavoredCherries
An ExerciseAn ExerciseAn ExerciseAn ExerciseAn Exercisein Recombinantin Recombinantin Recombinantin Recombinantin RecombinantDNA TechnologyDNA TechnologyDNA TechnologyDNA TechnologyDNA Technology
STU
DENT ACTIVITY
DINI N G O N D
NA
4. Getting the plasmid ready for insertion of the gene
a. Cut your circular plasmid out so that it looks like a large doughnut
ring (make sure the middle of the doughnut ring is cut out).
b. Each of the two strands of the circular plasmid is to be read in a
certain direction as indicated by the arrows on the plasmid.
c. Beginning on the outside at the arrow, start reading along the
plasmid in the direction of the arrow until you come across an
A G C T sequence all in a row.
d. With your restriction enzyme (scissors), make a shallow cut (only to
the middle of the ring) after the A in every A GC T sequence.
e. Now going in the opposite direction read along the inside loop of
the plasmid, reading until you come across the A GC T sequence on
the inside DNA strand.
f. With your restriction enzyme, make a shallow cut after the A in
every A GC T sequence.
g. Once again, each cut on the inside loop should be two rungs
(bases G, C) away from a cut on the outside loop.
h. Cut through the hydrogen bonds right down the middle of the
plasmid loop in order to connect each of the two closest cuts.
i. With the final cut, open the loop and look closely at the two
exposed rungs.
5. Insertion of the New Gene into the Plasmid (Recombination)
a. Look at the strip of DNA that you removed from the cacao DNA.
b. Compare this strip with the cut-open plasmid DNA.
c. Can you see how they match together? The two pieces of
DNA fit together like a puzzle.
d. Match the shapes as well as the bases ( A goes with T and C
goes with G).
e. Take out your ligase (tape) and insert the cacao DNA into the
plasmid loop.
f. You just inserted the cacao gene for chocolate flavor into the
plasmid, and now the plasmid can be used to carry the cacao
chocolate-flavor gene into the cherry plant!
GCCG
Plasmid vector
with exposed nucleotides
66
ChocolateFlavoredCherries
An ExerciseAn ExerciseAn ExerciseAn ExerciseAn Exercisein Recombinantin Recombinantin Recombinantin Recombinantin RecombinantDNA TechnologyDNA TechnologyDNA TechnologyDNA TechnologyDNA Technology
STU
DENT ACTIVITY
DINI N G O N D
NA
Pre-Activity Questions:Pre-Activity Questions:Pre-Activity Questions:Pre-Activity Questions:Pre-Activity Questions:
1. Using a dictionary, textbook and your background information
sheet, define the following terms:
vector _________________________________________________
______________________________________________________
______________________________________________________
ligase __________________________________________________
______________________________________________________
______________________________________________________
restriction enzyme ________________________________________
______________________________________________________
______________________________________________________
plasmid ________________________________________________
______________________________________________________
______________________________________________________
2. Read through your laboratory procedure and answer the
following:
a. What on your materials list represents a vector? Why?
________________________________________________________________________
________________________________________________________________________
________________________________________________________________________
b. What on your materials list represents a restriction enzyme?
W h y ?
________________________________________________________________________
________________________________________________________________________
________________________________________________________________________
c. What on your materials list represents ligase? Why?
________________________________________________________________________
________________________________________________________________________
________________________________________________________________________
3. In your own words, state why scientists may want to use
recombinant DNA technology.
______________________________________________________________________________
________________________________________________________________________
______________________________________________________________________________
67
Post-Activity Questions:Post-Activity Questions:Post-Activity Questions:Post-Activity Questions:Post-Activity Questions:1. Attach your plasmid containing the recombined gene sequence on the
back of this paper or on a blank sheet of paper.
2. Now that you have seen that DNA from unrelated organisms
can be combined, let’s use this knowledge and have some fun!
a. Below, write down your least favorite food:
_____________________________________________________________________
b. What characteristic would you add to this food to make it tolerable?
(ie, chocolate flavor, crunchiness, etc.)
________________________________________________________________________
______________________________________________________________________
c. Where would you take the DNA from to insert it into this food?
________________________________________________________________________
_____________________________________________________________________
________________________________________________________________________
________________________________________________________________________
d. Write a brief laboratory procedure for this experiment, starting with
extracting the DNA from the organism (plant, animal, microbe) that
contains the desired trait and ending with recombing the “new” gene
sequence into your least favorite food.
________________________________________________________________________
_____________________________________________________________________
________________________________________________________________________
________________________________________________________________________
________________________________________________________________________
_____________________________________________________________________
________________________________________________________________________
________________________________________________________________________
________________________________________________________________________
_____________________________________________________________________
________________________________________________________________________
________________________________________________________________________
________________________________________________________________________
____________________________________________________________________
ChocolateFlavoredCherries
An ExerciseAn ExerciseAn ExerciseAn ExerciseAn Exercisein Recombinantin Recombinantin Recombinantin Recombinantin RecombinantDNA TechnologyDNA TechnologyDNA TechnologyDNA TechnologyDNA Technology
STU
DENT ACTIVITY
DINI N G O N D
NA
68
Answers to Pre-Activity Questions:Answers to Pre-Activity Questions:Answers to Pre-Activity Questions:Answers to Pre-Activity Questions:Answers to Pre-Activity Questions:
1. Using a dictionary, textbook and your background information
sheet, define the following terms:
a. vector
In terms of biotechnology, a vector is an agent used to transfer genetic
information from one organism to another.
b. ligase
A ligase is an enzyme which functions to bind loose ends of genetic
material together.
c. restriction enzyme
Restriction enzymes are specific molecules that cut the DNA in
specific places. Examples of commonly used restriction enzymes
in biotechnology laboratories are EcoR1, Bam2.
d. plasmid
A plasmid is a circular ring of DNA which is found in some bacterium.
2. Read through your laboratory procedure and answer the following:
a. What on your materials list represents a vector? Why?
The circular plasmid DNA represents the vector because it will be
transferring the new genetic material into the plant.
b. What on your materials list represents a restriction enzyme? Why?
The scissors represent the restriction enzymes because they will be
cutting the DNA in the specific location indicated.
c. What on your materials list represents ligase? Why?
The tape represents the ligase because it will be binding together the
loose, exposed ends of the DNA which have been cut by the restriction
enzymes.
3. In your own words, state why scientists may want to using
recombinant DNA technology.
Answers to this question may be quite variable. We are looking to have
the students reiterate the capacity of recombinant DNA technology to
enable an organism to express a desired trait it would not have
expressed without this technology.
ChocolateFlavoredCherries
69
Answers to Answers to Answers to Answers to Answers to Post-Activity Questions:Post-Activity Questions:Post-Activity Questions:Post-Activity Questions:Post-Activity Questions:
1. Attach your plasmid containing the recombined gene sequence
below.
Complementary DNA on the plasmid and “new” fragment should
match correctly.
2. Now that you have seen that DNA from unrelated organisms
can be combined, let’s use this knowledge and have some fun!
a. Below, write down your least favorite food:
Variable answer.
b. What characteristic would you add to this food to make it
tolerable? (ie, chocolate flavor, crunchiness, etc.)
Variable answer.
c. Where would you take the DNA from to insert it into this
food?
Variable answer.
d. On the back of this paper, write a brief laboratory procedure for
this experiment, starting with extracting the DNA from the
organism (plant, animal, microbe) that contains the desired trait
and ending with recombining the “new” gene sequence into your
least favorite food.
Student answers should overview DNA extraction procedure (from
onion laboratory). Then, they should indicate how they will cut the
desired gene sequence out of the extracted DNA (restriction enzymes
specific to the particular region of interest). They should then discuss
the vector for inserting the new DNA fragment into the food they are
interested in changing. This may be a plasmid or a virus. They then
should discuss how they will combine the new DNA fragment with
the vector and ultimately how it will be inserted in the chromosomal
DNA of the food they are changing.
ChocolateFlavoredCherries
70
ChocolateFlavoredCherries
Bonus Question:Bonus Question:Bonus Question:Bonus Question:Bonus Question:Here is a bonus question you may wish to pose to the students.
The content is difficult, however the concepts are important in terms
of laboratory practice of recombinant DNA techniques.
Can you think of a way to tell from the beginning if a particular
cherry cell has been transformed?
If students have a hard time with this question, ask them the following
question: A dog named Cocoa is running around a fenced-in yard with
1,000 other dogs. You must pick Cocoa up at night, but you don’t know
what Cocoa looks like. What could Cocoa’s owner do to help you find
Cocoa? Possible answer: Put a fluorescent dog-collar on Cocoa.
DNA can be labeled in the same way. To see if the piece of chocolate-
flavor DNA gets incorporated into the cherry cells, a scientist might
put a fluorescent label on it. The fluorescent label will go wherever
that piece of DNA goes, so if the cherry plant cell has been transformed,
it will fluoresce!
71
STU
DENT ACTIVITY
DINI N G O N D
NA
An Example ofRecombinantDNA Technology
Use of Use of Use of Use of Use of Agrobacterium
tumefaciens to ferry “new” to ferry “new” to ferry “new” to ferry “new” to ferry “new”genes into plant cells.genes into plant cells.genes into plant cells.genes into plant cells.genes into plant cells.
Background Information:Background Information:Background Information:Background Information:Background Information:You learned in the last activity that DNA is the material within the cell
that determines what an organism looks like and how it functions.
DNA does all of this via the proteins for which it codes.
Today, scientists are able to insert pieces of “foreign” DNA into an
organism’s DNA so that the organism will express a desired
characteristic, produce a certain substance, or even not express an
undesirable characteristic. This moving of DNA pieces between
unrelated organisms is called recombinant DNA technology.
There are many ways to insert a piece of DNA from one organism
into the cells of another organism. In recombinant DNA technology,
one of the most widely used mechanisms for DNA insertion is the
plasmid from Agrobacterium tumefaciens.
plasmidvector
gene
gene
restriction enzyme activit
gene
DNA moleculethat containsdesired gene
fragmentedDNA
molecule
gene putinto plasmid
gene
bacteria’schromosomal
DNA
plasmid
plasmid put intobacteria
A plasmid is a circular ring
of DNA which is found in
some bacteria. The Agro-
bacterium’s plasmid is
unique because it has a
DNA transforming region.
When the bacterium
bumps up against another
cell, the DNA within the
transfer region (T-DNA)
“jumps out” of the plasmid
and is inserted into the
other cell’s chromosome.
As a biotechnologist, you could use your knowledge about this special
capability of the T-DNA region of this plasmid in order to transfer
desirable genes into plant cells of your choice.
72
So how do you “recombine”
DNA using this technology?
Once you have found the
DNA that contains the
characteristics you want, you
must isolate or remove this
specific DNA section.
Restriction enzymes are special
molecules that cut the DNA in
specific places so that the
section you are looking for
may be removed.
Once the DNA fragment is cut,
it needs to be inserted into
the vector DNA ( the
Agrobacterium’s plasmid).
You must first isolate the
plasmid from the Agrobacterium,
and then expose the plasmid to
the restriction enzymes so that
a gap in this circular DNA opens
to combine with the new piece
of DNA.
The restriction enzymes must
be selected carefully so that:
1) it cuts the DNA fragment (the
new piece of DNA) that contains
the specific characteristics you
want, and 2) it splices the T-DNA
out of the plasmid, but leaves
the genes responsible for
transfer intact!
STU
DENT ACTIVITY
DINI N G O N D
NA
An Example ofRecombinantDNA Technology
Use of Use of Use of Use of Use of Agrobacterium
tumefaciens to ferry “new” to ferry “new” to ferry “new” to ferry “new” to ferry “new”genes into plant cells.genes into plant cells.genes into plant cells.genes into plant cells.genes into plant cells.aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaleaf diskaaaaaaaaaaaaaaaaaaaaAgrobacterium tumefac
new leaf cellswith new gene
Now you must “recombine” the plasmid with the DNA fragment coding
for the specific characteristic you want. Once the plasmid and new DNA
piece are mixed together, they must be joined. Ligase is a molecule which
helps to join the exposed ends of the plasmid with the new DNA piece.
Ligase functions like a piece of tape, binding the pieces together.
The “new” plasmid is then put back into the Agrobacterium and when the
bacterium replicates, this new DNA will replicate too. Very often, this
Agrobacterium plasmid is inserted into the plant in which the desired
changes are sought. When this Agrobacterium bumps up against a plant
cell, the new piece of DNA in the transfer region of the plasmid jumps
into the plant cell’s chromosomal DNA (linear DNA). Thus, the “desired”
piece of DNA and the trait it codes for are transferred into the plant cell.
73
Risky BusinessOr StupendousSolutions?
A Risk/Benefit AnalysisA Risk/Benefit AnalysisA Risk/Benefit AnalysisA Risk/Benefit AnalysisA Risk/Benefit Analysisof Food Biotechnologyof Food Biotechnologyof Food Biotechnologyof Food Biotechnologyof Food Biotechnology
Summary:Summary:Summary:Summary:Summary:The class divides into groups of 2-4 students. Each group is then given
the background information on a specific scenario pertaining to a food
biotechnology application. The group discusses the scenario, answers
questions pertaining to the scenario and then lists some potential risks
and benefits associated with this application. As a group, they come to
a consensus on whether or not to send this new food to market.
Objectives:Objectives:Objectives:Objectives:Objectives:• Students will be exposed to current applications of biotechnology
in food and agriculture.
• Students will utilize critical thinking skills in assessing the positive
and negative aspects of these biotechnology applications.
• Students will draw on the scientific concepts they have been
exposed to in previous exercises in this unit to develop conclusions
related to the utilization of a specific biotechnology application.
• Students will be exposed to group discussion and consensus reaching.
Suggested Time:Suggested Time:Suggested Time:Suggested Time:Suggested Time:Two class periods (with homework time for question answering).
Materials Needed:Materials Needed:Materials Needed:Materials Needed:Materials Needed:• Background information scenario sheet
• Student Activity Sheets
Teacher Preparation:Teacher Preparation:Teacher Preparation:Teacher Preparation:Teacher Preparation:Familiarize yourself with the various food biotechnology applications
that the students will be investigating. Prepare copies of the Student
Activity Sheets.
Procedure:Procedure:Procedure:Procedure:Procedure:1. Class is divided into groups of 2-4 students.
2. Each group is then given a background information sheet
pertaining to a specific application of biotechnology in food
and agriculture.
The topics are:
• Lower Fat Potato Chips and French Fries
• The Flavr Savr™ Tomato
• Recombinant Bovine Somatotropin (BST)
• Frost-resistant Strawberries
• Virus-resistant Squash and Sweet Potatoes
• Herbicide-resistant Soybeans
• Peanut Protein
• Potato Plant-Pesticides
74
3. Group Discussion:
The group reads about the specific biotechnology application,
discusses it at length, focusing on the potential risks and benefits
this application may pose.
4. Answer Questions:
Each group answers all of the questions on the Student Activity
Sheet. Included are questions that relate to the details of the specific
food biotechnology application as well as inquiries regarding the
risks and benefits of this food biotechnology application. Questions
are to be completed for the homework assignment.
5. Group Discussion:
The next day in class, the group returns to discussion. They should
reach a consensus in terms of whether their specific biotechnology
application should be marketed to the general public.
6. Presentation:
Each group selects a spokesperson. The spokesperson gives a brief
overview of the food biotechnology application which was
reviewed by the group and then details the group’s assessment
of the risks/benefits and their ultimate conclusion in terms
of marketing.
Risky BusinessOr StupendousSolutions?
A Risk/Benefit AnalysisA Risk/Benefit AnalysisA Risk/Benefit AnalysisA Risk/Benefit AnalysisA Risk/Benefit Analysisof Food Biotechnologyof Food Biotechnologyof Food Biotechnologyof Food Biotechnologyof Food Biotechnology
75
Risky BusinessOr StupendousSolutions?
A Risk/Benefit AnalysisA Risk/Benefit AnalysisA Risk/Benefit AnalysisA Risk/Benefit AnalysisA Risk/Benefit Analysisof Food Biotechnologyof Food Biotechnologyof Food Biotechnologyof Food Biotechnologyof Food Biotechnology
STU
DENT ACTIVITY
DINI N G O N D
NA
Does DNA intrigue you? scare you? excite you? confuse you? Now that
you know what DNA is, what DNA does, and how DNA is altered, you
should be able to answer these questions rationally. Scientists today are
using biotechnology to change food either as it grows or as it is processed.
In the near future, your knowledge of the risks and the benefits involved
with biotechnology as it applies to food will help you make decisions as a
consumer. The following are eight food products (or potential food products)
developed via some application of biotechnology. Your group will either
select or be assigned one of these foods. Your task will be to discuss that
product, answer questions about it and ultimately decide if it should be
sent to the marketplace to be sold to consumers.
Heart disease is the number one
killer in the United States. Studies
have shown that a diet lower in fat
and cholesterol can reduce the
risks of heart disease. In 1992,
Monsanto Company genetically
altered a potato so that the starch
content of this potato would be
higher. A higher starch content
results in less oil absorption during
frying The cost of producing
french fries and chips from these
altered potatoes is potentially
lower due to decreased oil use, and
the end product also is considered
healthier due to its lower oil
content. This potato was produced
by the insertion of a gene from a
bacterium into a Russet Burbank
potato.
Lower FatLower FatLower FatLower FatLower FatPotato ChipsPotato ChipsPotato ChipsPotato ChipsPotato Chips
andandandandandFrench FriesFrench FriesFrench FriesFrench FriesFrench Fries
76
In the United States, tomato-
lovers spend $4 billion dollars on
tomatoes each year (this includes
tomatoes for salads, pastes, sauces,
ketchups, and soups). American
consumers expect to be able to
purchase fresh tomatoes all year
long, so during cold months
tomato growers have a hard time
keeping up with the demand.
Over the winter, tomatoes
grown in southern states are
picked while green and shipped
to northern states. The tomatoes
are then reddened and ripened in
containers filled with ethylene
gas. Northern consumers
complain because ethylene-
ripened tomatoes do not have the
“backyard summertime” flavor of
those in grocery stores during
warmer months. Another
problem is that because the
tomatoes were picked early, they
did not take up enough nutrients
from the soil and sun order to
gain vine-ripened flavor and
texture. What’s more, ethylene-
ripened tomatoes start rotting in
4-7 days, so many tomatoes spoil
before they can be sold.
Pectin, a naturally occurring
fiber substance, is what gives
tomatoes their firmness and keeps
tomatoes from getting mushy.
Tomatoes have a gene (section of
DNA) that codes for an enzyme
called polygalacturonase. Lets call
it “polyG” here for simplicity.
PolyG actually chews up the
pectin in the tomato and the end
result is a softer, mushier tomato.
A company called Calgene, Inc.
genetically engineered a tomato
by changing this gene that codes
for polyG. Basically, they “turned
off’’ the gene that codes for the
polyG enzyme so that the tomato
does not soften as quickly and can
stay on the vine longer to gain
some delicious flavor there. These
new, genetically altered
tomatoes were named Flavr
Savr™ tomatoes.
How did the scientists “turn
off “the polyG gene? They
introduced an “antisense” version
of the polyG gene into the
tomato plant cell. An antisense
gene is basically an inverted or
mirror image copy of the original
gene. When the antisense gene is
introduced into the cell it
attaches, like a puzzle piece to
the original polyG gene and
therefore does not allow the
polyG gene to code for the
polyG enzyme, The end result is
a tomato that stays firm even as
it continues to ripen.
Risky BusinessOr StupendousSolutions?
A Risk/Benefit AnalysisA Risk/Benefit AnalysisA Risk/Benefit AnalysisA Risk/Benefit AnalysisA Risk/Benefit Analysisof Food Biotechnologyof Food Biotechnologyof Food Biotechnologyof Food Biotechnologyof Food Biotechnology
STU
DENT ACTIVITY
DINI N G O N D
NA
TheTheTheTheTheFlavr SavrFlavr SavrFlavr SavrFlavr SavrFlavr Savr™
TomatoTomatoTomatoTomatoTomato
77
Risky BusinessOr StupendousSolutions?
A Risk/Benefit AnalysisA Risk/Benefit AnalysisA Risk/Benefit AnalysisA Risk/Benefit AnalysisA Risk/Benefit Analysisof Food Biotechnologyof Food Biotechnologyof Food Biotechnologyof Food Biotechnologyof Food Biotechnology
STU
DENT ACTIVITY
DINI N G O N D
NA
Ice Minus VersionBelieve it or not, bacteria are
found on all plants. Bacteria
thrive on plants because they
feed on plant material (leaves,
stems and fruit).
A particular bacteria, Pseudo-
monas syringae (soo-du-mone-us
sir-in-gay) is commonly found on
plants. Pseudomonas has a protein
in its cell membrane that
promotes ice crystal formation.
So when the Pseudomonas is
sitting on the leaves or fruit of a
strawberry plant and the
temperature dips, this protein
will result in ice crystals forming
on the strawberry plant. Once the
ice forms, the plant is damaged
and the Pseudomonas can have a
feast on the weakened plant. Not
such a dumb microbe, huh?
Well, scientists have isolated
the gene in Pseudomonas that
codes for the ice crystal forming
protein. They can remove the
gene, grow a new version of
Pseudomonas without the gene
called “ice-minus” Pseudomonas,
Frost-resistantFrost-resistantFrost-resistantFrost-resistantFrost-resistantStrawberriesStrawberriesStrawberriesStrawberriesStrawberries
and spray the strawberry plants
with the ice-minus Pseudomonas.
These plants can tolerate
temperatures down to 27 ° F with-
out freezing. The end result is
reduced loss to the farmer and
more undamaged strawberries for
you!
Artic Flounder Antifreeze
Version
Another way that scientists are
working to keep strawberries
from freezing is by using the help
of a fish called the Arctic
flounder. The Arctic flounder
makes an “antifreeze” protein to
protect itself against the chilly
waters in which it lives. Scientists
have isolated the gene that codes
for this antifreeze protein and are
now attempting to insert this
gene into the DNA of the
strawberry plant. If this insertion
is successful, the strawberry plant
should be able to make this
antifreeze protein and therefore
protect itself when the mercury
drops!
78
Risky BusinessOr StupendousSolutions?
A Risk/Benefit AnalysisA Risk/Benefit AnalysisA Risk/Benefit AnalysisA Risk/Benefit AnalysisA Risk/Benefit Analysisof Food Biotechnologyof Food Biotechnologyof Food Biotechnologyof Food Biotechnologyof Food Biotechnology
STU
DENT ACTIVITY
DINI N G O N D
NA
Potato PlantPotato PlantPotato PlantPotato PlantPotato PlantPesticidePesticidePesticidePesticidePesticide
Many different types of bacteria
find their homes on the leaves,
stems and fruit of plants. These
microbes must often compete for
their nutrients (food) with other
plant pests such as insects or
fungi. How do they compete?
They produce a substance called a
toxin which is harmful to their
opponents, the insects and fungi.
As scientists observed this
competitive relationship between
the plant pests, some came up
with the idea to allow the plant to
defend itself by producing this
toxin all on its own.
How did they do it? Let’s
explore the background in a little
more detail. There is a specific
bacteria known as Bacillus
thuringiensis or Bt for short. Bt
produces a substance which is
toxic to many insects. Scientists
identified the Bt genes responsible
for the production for this toxin
and transferred these genes into
certain crop plants such as
potatoes, corn and cotton. Now
these plants which have been
genetically engineered are able to
produce the toxin on their own
and protect themselves against
the damaging insects. The toxin
produced directly by the plant is
called a “plant pesticide”. Many
people who support this research
feel that by enabling plants to
protect themselves through
producing plant pesticides, the
use of conventional or chemical
pesticides will be reduced. The
U.S. Environmental Protection
Agency has approved some
limited use of the Bt plant
pesticide. Also, they have
determined that the use of the Bt
plant pesticide will not pose an
unreasonable risk to the health of
people or other organisms which
are not targeted by the plant
pesticide.
79
Risky BusinessOr StupendousSolutions?
A Risk/Benefit AnalysisA Risk/Benefit AnalysisA Risk/Benefit AnalysisA Risk/Benefit AnalysisA Risk/Benefit Analysisof Food Biotechnologyof Food Biotechnologyof Food Biotechnologyof Food Biotechnologyof Food Biotechnology
STU
DENT ACTIVITY
DINI N G O N D
NA
RecombinantRecombinantRecombinantRecombinantRecombinantBovineBovineBovineBovineBovine
SomatrotropinSomatrotropinSomatrotropinSomatrotropinSomatrotropin
Bovine somatotropin is a protein
hormone which is naturally
produced in dairy cows. It is also
known as BST. BST plays a role in
some vital functions of the cow
such as growth and milk
production. In the early 1980’s
scientists at a biotechnology
company called Genetech
isolated the genes that code for
the production of BST in cows. By
inserting these genes into
bacteria, scientists were able to
produce large quantities of BST in
the laboratory. This form of BST
which is produced through
genetic engineering is called
recombinant BST or rBST.
The next step was to see how
the rBST affected the cows. It was
found that when rBST is given
(via injections) to lactating cows,
milk production is increased by
about 10%. Since this discovery,
two companies (Monsanto and Eli
Lilly) have developed a
commercially available form of
rBST to be used by dairy farmers,
The U.S. Food and Drug
Administration (FDA) has
approved the use of rBST in dairy
cows. The FDA reported that rBST
does not change the composition
of milk and poses no health
threats to individuals who
consume the milk. According to
research conducted on rBST and
cows supplemented with rBST:
• The concentration of BST in
the milk of cows treated with
usual doses of rBST is not
higher than the concentration
in untreated cows
• When people ingest BST orally
or receive an injection of BST,
BST has no biological activity
in these people.
• BST is a protein and is digested
like other proteins in the
human digestive tract.
80
Risky BusinessOr StupendousSolutions?
A Risk/Benefit AnalysisA Risk/Benefit AnalysisA Risk/Benefit AnalysisA Risk/Benefit AnalysisA Risk/Benefit Analysisof Food Biotechnologyof Food Biotechnologyof Food Biotechnologyof Food Biotechnologyof Food Biotechnology
STU
DENT ACTIVITY
DINI N G O N D
NA
Viruses are ultramicroscopic
infectious agents. Scientists call
viruses “infectious agents” for two
reasons. First, viruses have both
living and nonliving features, so it
is difficult to call a virus an
organism. Second, viruses must
live inside the cells of a living host
in order to survive. Viruses infect
their living hosts (mainly
bacteria, plants, or animals) and
make the hosts sick. Hence,
viruses are infectious agents.
In plants, many viruses are
transmitted by aphids (little
insects that feed on plants).
Viruses can be detrimental to the
development of a plant and to the
success of a farmer’s crop. To
engineer a virus resistant plant,
scientists take a gene out of a virus
and then insert that gene into the
plant of choice. Once the virus
gene is inside the plant the gene
becomes part of the plant’s DNA
and acts as a vaccine. Virus
resistant squash and virus
resistant sweet potatoes are two
examples of plants which have
been genetically modified to
combat deadly plant viruses
In 1992, the Asgrow Seed
Company of Michigan developed
a yellow crookneck squash that
was resistant to two different
viruses. These two viruses can
wipe out up to 80 percent of an
annual squash crop. Disease
symptoms include fruit
discoloration and a distorted
shape. Because of the effects of the
virus, squash producers cannot
sell infected fruit. Thus virus-
resistant squash plants could
greatly impact how much of the
squash the farmer sells. (Note:
Scientists use the Agrobacterium
tumefacien s method of gene
transfer to produce the new
squash. See Chocolate Flavored
Cherry activity.)
In Africa, sweet potatoes are
one of the staple crops.
Unfortunately, a virus called
feathery mottle virus (FMV) kills
two-thirds of the typical sweet
potato crop every year. Many
African farmers cannot afford
chemical pesticides so the
development of a virus-resistant
sweet potato could have
tremendous value by reducing
hunger and enhancing
nutritional status.
Virus-resistantVirus-resistantVirus-resistantVirus-resistantVirus-resistantSquashSquashSquashSquashSquash
andandandandandSweet PotatosSweet PotatosSweet PotatosSweet PotatosSweet Potatos
81
Risky BusinessOr StupendousSolutions?
A Risk/Benefit AnalysisA Risk/Benefit AnalysisA Risk/Benefit AnalysisA Risk/Benefit AnalysisA Risk/Benefit Analysisof Food Biotechnologyof Food Biotechnologyof Food Biotechnologyof Food Biotechnologyof Food Biotechnology
STU
DENT ACTIVITY
DINI N G O N D
NA
How do modern farmers deal
with weed problems? One
solution is to use chemical
herbicides. Herbicides are
chemical substances used to
destroy plants or limit their
growth. One such herbicide is
called Roundup ®. Roundup ® has a
compound called glyphosate in it.
Glyphosate is called a broad
spectrum herbicide because it
negatively impacts many
different types of plants (for
example, broad leaf plants and
grasses). Therefore, Roundup® will
not only harm the pesky weeds, it
may also harm the desired crop
plant. So, scientists from a
company called Monsanto
identified a gene which enables a
plant to tolerate Roundup ®. They
transferred this gene into a
soybean plant and then, through
traditional plant breeding
methods, created many of these
Roundup ®-resistant soybean
plants. The name given to the
plants are Roundup ® Ready™
soybeans. Now, farmers are able to
apply Roundup ® to their fields to
get rid of the weeds yet do not
have to worry about harming
their soybean crop.
Those who advocate the use of
this application of biotechnology
note that Roundup ® is an
herbicide that is easily degraded
in the environment and that by
making the crop plants resistant
to Roundup ®, the end result will
be less overall volume of
herbicides used. Individuals
opposed to this technology
fear that the genes for
herbicide-resistance will be
somehow passed to the weeds.
Herbicide-resistantHerbicide-resistantHerbicide-resistantHerbicide-resistantHerbicide-resistantSoybeansSoybeansSoybeansSoybeansSoybeans
82
Risky BusinessOr StupendousSolutions?
A Risk/Benefit AnalysisA Risk/Benefit AnalysisA Risk/Benefit AnalysisA Risk/Benefit AnalysisA Risk/Benefit Analysisof Food Biotechnologyof Food Biotechnologyof Food Biotechnologyof Food Biotechnologyof Food Biotechnology
STU
DENT ACTIVITY
DINI N G O N D
NA
Peanuts are high in protein, but
are also high in fat. In order to
utilize the protein in a peanut and
avoid the fat, scientists and
nutritionists have suggested
putting the genes that code for
peanut protein into corn. Corn
that contains the peanut protein
will have a higher protein content
than normal corn. A high protein
corn has tremendous potential in
our country and in third world
countries as well.
In our country, corn is used in
processed food like cereals,
breads, and chips Increasing the
protein content in corn would
therefore increase the nutritional
value of these processed foods.
In third world countries,
malnutrition is a big problem.
Because corn is a staple crop in
most of these countries, a high-
protein corn could help combat
Peanut ProteinPeanut ProteinPeanut ProteinPeanut ProteinPeanut Proteinin Cornin Cornin Cornin Cornin Corn
protein calorie malnutrition
world-wide The condition of
protein calorie malnutrition in
people is called kwashiorkor
(kwash-ee-or-kor).
Now for the controversy! Yes,
it’s true that peanuts are high in
protein, yet this peanut protein
causes an allergic reaction in some
people. So if the gene coding for
the peanut protein is transferred
into another food, such a corn,
how is that person to know that
he/she should avoid eating the
corn? Other biotechnologists
argue that genetic engineering
techniques can actually be used
to reduce the presence of allergy
causing proteins in food since
scientists can isolate the gene
coding for the allergen and
reverse it or cut it out so that
protein will no longer be made.
83
Risky Businessor StupendousSolutions?
A Risk/BenefitA Risk/BenefitA Risk/BenefitA Risk/BenefitA Risk/BenefitAnalysis of FoodAnalysis of FoodAnalysis of FoodAnalysis of FoodAnalysis of FoodBiotechnologyBiotechnologyBiotechnologyBiotechnologyBiotechnology
STU
DENT ACTIVITY
DINI N G O N D
NA
Please answer all of the following questions as they apply to your
specific food biotechnology application:
Food Safety Concerns:
1. An allergen is any substance that can cause an allergic reaction in a
person. Does this application of biotechnology pose any problems
in terms of introducing an allergen to the food? Explain.
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
Nutrition Quality:
2. Does this application of biotechnology enhance or take away from
the nutritional quality of the original food? Explain.
________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
World Hunger:
3. Does this application of biotechnology have the potential to
impact world hunger? How?
________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
Environmental Issues:
4. Will this application of food biotechnology:
a. Increase the use of chemical pesticides? ________________
b. Decrease the use of chemical pesticides? ________________
c. Not impact chemical pesticide use? ___________________
Explain your answers.
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
_________________________________________________________________
_________________________________________________________________
_________________________________________________________________
84
Risky Businessor StupendousSolutions?
A Risk/BenefitA Risk/BenefitA Risk/BenefitA Risk/BenefitA Risk/BenefitAAAAAnalysis of Foodnalysis of Foodnalysis of Foodnalysis of Foodnalysis of FoodBiotechnologyBiotechnologyBiotechnologyBiotechnologyBiotechnology
5. Biodiversity is a term which is used often when discussing whole
ecosystems. Biodiversity refers to the variability of animals, plants
and microorganisms within a specific ecosystem. Does introduction
of the genetically altered product you read about pose any
environmental risks in terms of biodiversity?
________________________________________________________________________
_________________________________________________________________
_________________________________________________________________
Economics:
6. Is this application of biotechnology needed from an economic
point of view? Explain.
________________________________________________________________________
_______________________________________________________________________
_______________________________________________________________________________________________________________________________________
7. Does this application of biotechnology have the potential to have
positive of negative economic impact on:
a. the farmer? Explain.
__________________________________________________________________
_________________________________________________________________
b. the food processor? Explain.
__________________________________________________________________
_________________________________________________________________
c. the consumer? Explain.
__________________________________________________________________
_________________________________________________________________
Aesthetics:
8. Will this application of biotechnology change the appearance of
the food to make it more marketable (desirable to the consumer)?
How?
________________________________________________________________________
________________________________________________________________________
_______________________________________________________________________________________________________________________________________
_______________________________________________________________________________________________________________________________________
STU
DENT ACTIVITY
DINI N G O N D
NA
85
Risky Businessor StupendousSolutions?
A Risk/BenefitA Risk/BenefitA Risk/BenefitA Risk/BenefitA Risk/BenefitAnalysis of FoodAnalysis of FoodAnalysis of FoodAnalysis of FoodAnalysis of FoodBiotechnologyBiotechnologyBiotechnologyBiotechnologyBiotechnology
Social Issues:
9. Might this application of biotechnology present problems to
consumers due to religious or moral beliefs? Explain.
________________________________________________________________________
________________________________________________________________________
________________________________________________________________________
_______________________________________________________________________
10. Now list five potential risks and five potential benefits of this
application.
Potential Risks:
a. _____________________________________________________
______________________________________________________
b. _____________________________________________________
______________________________________________________
c. _____________________________________________________
______________________________________________________
d. _____________________________________________________
______________________________________________________
e. _____________________________________________________
______________________________________________________
Potential Benefits:
a. _____________________________________________________
______________________________________________________
b. _____________________________________________________
______________________________________________________
c. _____________________________________________________
______________________________________________________
d. _____________________________________________________
______________________________________________________
e. _____________________________________________________
______________________________________________________
STU
DENT ACTIVITY
DINI N G O N D
NA
86
Risky Businessor StupendousSolutions?
A Risk/BenefitA Risk/BenefitA Risk/BenefitA Risk/BenefitA Risk/BenefitAnalysis of FoodAnalysis of FoodAnalysis of FoodAnalysis of FoodAnalysis of FoodBiotechnologyBiotechnologyBiotechnologyBiotechnologyBiotechnology
STU
DENT ACTIVITY
DINI N G O N D
NA
11. How might we minimize the risks and maximize the benefits of
this technology?
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
_____________________________________________________________________________
____________________________________________________________________________
____________________________________________________________________________
12. Prioritize your list of Potential Risks (rate the risks on a scale from
1 to 5, with 1 being most risky and 5 being least risky).
1. _____________________________________________________
2. _____________________________________________________
3. _____________________________________________________
4. _____________________________________________________
5. _____________________________________________________
13. Prioritize your list of Potential Benefits (rate on a scale of 1 to 5,
with 1 being the most beneficial and 5 being the least beneficial).
1. _____________________________________________________
2. _____________________________________________________
3. _____________________________________________________
4. _____________________________________________________
5. _____________________________________________________
14. Assess the priorities and state why you approve (or disapprove) of
this application of biotechnology.
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
____________________________________________________________________________
____________________________________________________________________________
15. Take a group vote to decide whether the group approves or
disapproves the application.
Number who approve? _________________________________
Number who disapprove? ______________________________
87
16. Discuss your reasons for supporting or opposing the application.
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
_____________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
_____________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
_____________________________________________________________________________
______________________________________________________________________________
_____________________________________________________________________________
______________________________________________________________________________
_____________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
Risky Businessor StupendousSolutions?
A Risk/BenefitA Risk/BenefitA Risk/BenefitA Risk/BenefitA Risk/BenefitAnalysis of FoodAnalysis of FoodAnalysis of FoodAnalysis of FoodAnalysis of FoodBiotechnologyBiotechnologyBiotechnologyBiotechnologyBiotechnology
STU
DENT ACTIVITY
DINI N G O N D
NA
88
Risky Businessor StupendousSolutions?
A Risk/BenefitA Risk/BenefitA Risk/BenefitA Risk/BenefitA Risk/BenefitAnalysis of FoodAnalysis of FoodAnalysis of FoodAnalysis of FoodAnalysis of FoodBiotechnologyBiotechnologyBiotechnologyBiotechnologyBiotechnology
Students will answer questions in the following categories according to
the application of biotechnology they have chosen. Some general
answers in all categories are provided below.
Food Safety Concerns:1. Does this application of biotechnology pose any problems in terms
of introducing an allergen to the food? Explain.
The alteration of the genetic makeup of some plants may produce
unforeseen health risks through the introduction of an allergen into a
plant which previously contained no allergen. Hence, people who are
allergic need to be made aware that the “new” food does contain a
potential allergen. For example, many people are allergic to peanuts. A
protein for a peanut allergen that has been transferred into the corn
plant is not immediately apparent to the person who picks up that ear
of corn. This poses a potential danger for people who are allergic to this
peanut protein.
Nutrition Quality:2. Does this application of biotechnology enhance or take away from
the nutritional quality of the original food? Explain.
Genetically altering foods can make a big impact on certain foods.
Foods can be made more nutritious, already nutritious foods can be
made tastier, and perishable foods can be given a longer shelf-life. On
the other hand, concern has been voiced that genetically altering foods
may decrease the beneficial nutrient composition of that food.
However, at this point in time, there has been no approval sought for a
food which has significant compositional differences from the “parent”
(non-genetically altered) counterpart.
World Hunger:3. Does this application have the potential to impact world hunger?
How?
At present, there are 5.5 billion people inhabiting Earth. According to
statistics on population growth, approximately 11 billion people will
inhabit the world by the year 2030. Many people question whether or
not we will have the capability to feed an extra 5.5 billion mouths (plus
the 700 million people who presently do not have enough food to eat)
in the next forty years. Food biotechnology may be a part of the
solution to the many facets of world hunger. Increasing crop yields,
allowing crops to grow in regions presently not suited for adequate
growth, and enhancing the nutrient composition of a food are all
potential ways that biotechnology can help the world hunger problem.
89
Risky Businessor StupendousSolutions?
A Risk/BenefitA Risk/BenefitA Risk/BenefitA Risk/BenefitA Risk/BenefitAnalysis of FoodAnalysis of FoodAnalysis of FoodAnalysis of FoodAnalysis of FoodBiotechnologyBiotechnologyBiotechnologyBiotechnologyBiotechnology
Environmental Issues:4. Will this application of biotechnology:
a. Increase the use of chemical pesticides?
b. Decrease the use of chemical pesticides?
c. Not impact chemical pesticide use?
Explain your answer.
Many genetically altered foods are targeted at cutting the amount of
pesticide use in crop production. Some applications of biotechnology
are designed to protect the environment by producing crops that can
withstand environmental stresses. Examples:
a. In some cases, the goal is to reduce the need for pesticides by
enabling plants to kill any pests that endanger them. The plants,
themselves, are given the gene to produce whatever toxic substance
adversely affects the pest. Therefore, application of chemical
pesticides is lessened.
b. Biological control is another biotechnology application which has
environmential implications. Bacteria and viruses are directly applied
to the plant, as chemical pesticides presently are. The “live” pesticides
produce toxins to decrease pest damage on that particular plant. Once
again, the need for chemical pesticide application is lessened.
c. Pesticide, herbicide, fungicide tolerant crops are being created so
that the chemical can be applied on an entire field and the desired
crop plant will not be adversely affected. This application of
biotechnology has the potential to increase the use of a particular
pesticide on a field due to a more blanket approach to application.
However, it may also have the potential to decrease overall pesticide
use on that field because that one particular pesticide will be all that is
necessary and a less toxic chemical may be used.
5. Does introduction of this transgenic product pose any
environmental risks in terms of biodiversity?
Any mutation (natural or otherwise) in an organism affects variability
within the environment by altering the genetic makeup of a species.
When an organism’s genetic makeup is affected, that organism may
either be able to do something it couldn’t do before, or not do
something it could do before genetic manipulation. Because the
organism’s abilities may change, it impacts the environment
differently. Whether the impacts of genetic engineering benefit
or hinder environmental diversity is highly debatable.
90
Many people feel that genetic changes enhance the diversity within
the environment, because we are adding new characteristics to existing
organisms. Other people feel that genetic engineering threatens the
diversity within the environment by stifling natural selection and
letting engineered organisms out-compete natural organisms. The
argument has been made that genetic engineering lets man dictate
which organisms will live, so many “undesirable” natural species will
be allowed to become extinct. It has also been said that diversity
within the environment gives the ecosystem resilience, and any
decrease in nature’s biodiversity could be deadly.
Economics:6. Is this application of biotechnology needed from an economic
point of view?
The answer to this question will vary depending on the biotechnology
application in review. For example, a biotechnology application which
promises to decrease hunger in a third world country most definitely
would be viewed as “needed” from an economic stand point.
Additionally, any application which could boost crop yields could be
viewed as “needed” for that local economy. The only situation which
would not seem “needed” from an economic point of view would be
that which would increase the presence of a product which is already
in surplus in a market (for example, milk and BST in the U.S.). Yet, the
argument could be made that this application of biotechnology looks
to the future when the population to be fed will be greater and the
need for a greater food supply exists.
7. Does this application of biotehcnology have the potential to have
positive or negative economic impact on
a. the farmer?
b. the food processor?
c. the consumer?
Some applications of biotechnology will have an enormous impact
on a specific industry, a local economy or a broader economy.
Positive impacts may include: 1) the creation of a whole new industry
for an area, and 2) the creation of a more affordable food supply.
Negative impacts may include: 1) the downfall of an existing industry,
and 2) the creation of an exclusive product that would drive up prices.
Risky Businessor StupendousSolutions?
A Risk/BenefitA Risk/BenefitA Risk/BenefitA Risk/BenefitA Risk/BenefitAnalysis of FoodAnalysis of FoodAnalysis of FoodAnalysis of FoodAnalysis of FoodBiotechnologyBiotechnologyBiotechnologyBiotechnologyBiotechnology
91
Aesthetics:8. Will this application of biotechnology change the appearance of
the food to make it more marketable (desirable to the customer)?
How?
Some efforts in food biotechnology are in the creation of fruits and
vegetable which have a longer shelf-life. By delaying the softening
(ripening) of the food, the appearance is more “fresh” or desirable for
the consumer.
Social Issues:9. Might this application of biotechnology present problems to
consumers due to religious or moral beliefs? Explain.
Some people have religious or moral beliefs which inhibit them from
eating certain animal foods. For example, kosher food practices do not
allow for the consumption of pork or pork products. The religious and
moral debate focuses on issues like the following: If a pig gene were
introduced into a plant or animal to make a transgenically altered
food, would a person following kosher practices be allowed to eat that
food? Additionally, many people are opposed to any application of
biotechnology due to beliefs that genetically altering an organism is
“playing God” and that it is not man’s place to do this.
10. Now list five potential risks and five potential benefits of this
application.
The previous questions were designed to initiate thought and to enable
students to answer this question well. Again, answers here can be based
on thoughts generated above in the students’ work.
Potential Benefits:
a. Foods could be made more nutritious.
b. Already nutritious food could be made tastier.
c. Perishable foods can be given a longer shelf-life.
d. Decrease the number of food poisoning incidents by increasing the
detection of food borne pathogens.
e. Waste management: Enzyme bioreactors are being developed that
will pretreat certain components of disposable serviceware or waste
and allow their removal through the sewage system rather than
through solid waste disposal or convert them to biofuel for operating
generators.
Risky Businessor StupendousSolutions?
A Risk/BenefitA Risk/BenefitA Risk/BenefitA Risk/BenefitA Risk/BenefitAnalysis of FoodAnalysis of FoodAnalysis of FoodAnalysis of FoodAnalysis of FoodBiotechnologyBiotechnologyBiotechnologyBiotechnologyBiotechnology
92
Risky Businessor StupendousSolutions?
A Risk/BenefitA Risk/BenefitA Risk/BenefitA Risk/BenefitA Risk/BenefitAnalysis of FoodAnalysis of FoodAnalysis of FoodAnalysis of FoodAnalysis of FoodBiotechnologyBiotechnologyBiotechnologyBiotechnologyBiotechnology
f. Reduce the need for pesticides by transferring the genes that confer
resistance.
g. Make plants grow faster, therefore shortening the time to market
and reducing dependence on fertilizers and feed.
h. Make crops more drought tolerant, therefore increasing food
supplies in the world’s hungriest nations.
i. Non-food materials could be made from foods. For example,
research is being done so that plastics may be made from potatoes
by using a gene that creates a precursor of plastic in the tubers.
Potential Risks:
a. Allergic Reactions: Genes code for the creation of proteins and
proteins can set off allergic reactions. One concern is the possibility
that a new food would be created with a gene from another food
(like peanuts or shellfish) that contains allergy-provoking proteins.
b. Some people have religious or moral beliefs which inhibit them
from eating certain animal foods. Would the recombining of a gene
from these certain animals into a food that is okay to eat keep people
from eating the “new and improved” recombined food?
c. Marker genes are often inserted into the new host along with the
gene that confers the desired characteristics. The marker gene allows
scientists to determine if the gene transfer has, in fact, been successful.
Very often this marker is antibiotic resistant and it is through this
resistance that scientists are able to note the successful gene transfer.
However, some people worry that these antibiotic marker genes might
make consumers antibiotic resistant, either by getting into their genes
or into the microorganisms which inhabit their gut. These fears are
most likely unfounded since the protein dictated by this antibiotic
resistance gene would be quickly digested when eaten.
d. Environmental concerns: What about the possibility of
genetically altered “test” plants or animals getting out into the wild
and taking over, changing the nature of environments?
e. Some scientists fear that the introduced genes could adversely
affect other genes in the organism.
f. Ethical Concerns: Many concerns have been expressed that
genetically altering organisms is “playing God” and that it is not
man’s place to do this.
93
Risky Businessor StupendousSolutions?
A Risk/BenefitA Risk/BenefitA Risk/BenefitA Risk/BenefitA Risk/BenefitAnalysis of FoodAnalysis of FoodAnalysis of FoodAnalysis of FoodAnalysis of FoodBiotechnologyBiotechnologyBiotechnologyBiotechnologyBiotechnology
9. How might we minimize the risks and maximize the benefits of
this technology?
One possible way to minimize the risks might be to enforce strict
labeling requirements for genetically altered foods, and another
might be to follow a stringent approval process.
To maximize the benefits of genetically altered foods, scientists and
regulatory agencies must keep careful watch on preliminary testing.
Genetically altered foods may eventually help eliminate starvation
in third world countries and help us meet the food demands of the
twenty-first century.
Note: The remaining questionswill express the results ofthe group discussion andconsensus building.
94
Summary:Summary:Summary:Summary:Summary:Students will select a career that interests them from a list of possible
careers related to the field of biotechnology. They will create ten
provocative questions from which they will learn more about this
career. With these ten questions they have the option to conduct an
interview (in person or by phone) with a person working in this role
or close to it. Or, they may find the answers to their inquiries through
researching that particular career. All students will present the results
of their interviews/research projects to the class in a brief five minute
presentation so that the entire class will benefit from the individual
inquiries.
Objectives:Objectives:Objectives:Objectives:Objectives:1. Students will be exposed to many careers in biotechnology.
2. Students will examine a specific career in biotechnology and
assemble a list of provocative inquiries about the career.
3. Students will make a connection with a professional individual
who is actually employed in a biotechnology related field.
4. Students will assess their own individual skills, likes and dislikes
in terms of future professional desires and options.
5. Students will practice their writing and presentation skills.
Suggested Time:Suggested Time:Suggested Time:Suggested Time:Suggested Time:Homework and one class period for student presentation.
Note : This activity could serve as an extra credit activity if class time
does not allow it to be conducted in class.
Procedure:Procedure:Procedure:Procedure:Procedure:1. Students will read the list of biotech careers.
2. From the list, students will select one career to investigate in depth.
Students may choose a career not on the list with teacher approval.
3. Students will make up a list of ten questions which inquire about
various aspects of the career they wish to investigate.
InvestigatingCareers inBiotechnology
95
InvestigatingCareers inBiotechnology
4. With the list of ten questions students have two options:
a. Contact an individual who is working in a position similar to
the one selected by the student and conduct an interview,
utilizing the ten questions developed. A written representation
of the interview must be turned in for a grade.
b. Research, at the library or from on-line sources through any
publications you can find, about the position you have selected.
Keep in mind, guidance counselors often have career
information software that may be useful for this activity.
Try to answer all ten of your questions through this research.
Additional Activities:Additional Activities:Additional Activities:Additional Activities:Additional Activities:Teacher could invite a representative of a biotech company
or university to speak to the class regarding his/her career in
biotechnology.
96
Have the questions started yet? “What do you want to be when you grow
up?”, “Where are you going to college?”, “What will be your major in
college?” If they haven’t, don’t worry, they will. But how do you ever know
the answers to these questions? There are so many exciting career
possiblities available. Biotechnology, a rapidly changing and growing area,
offers a wide variety of opportunites. Yet, how are you to know if this is the
field for you until you investigate what’s out there? Through this activity
you will look, in detail, at one of many possible career options related to
biotechnology. At the end of your investigation, you will present your
findings to the class and learn about all of the interesting careers your
fellow classmates chose to investigate. Have fun!
Before getting started on your career investigation, let’s look at some
general information about careers related to biotechnology:
InvestigatingCareers inBiotechnology
STU
DENT ACTIVITY
DINI N G O N D
NA
What types of places hire people forWhat types of places hire people forWhat types of places hire people forWhat types of places hire people forWhat types of places hire people forbiotechnology related jobs?biotechnology related jobs?biotechnology related jobs?biotechnology related jobs?biotechnology related jobs?
As the field of biotechnology expands so do the employment
opportunities. Below is a list of possible employers.
Undoubtedly there are many more!
• colleges and universities
• research and development units of large corporations
• production units of large corporations
• hospitals
• pharmaceutical companies
• agricultural research or production companies
• food processing companies
Where are most of the biotechnology jobsWhere are most of the biotechnology jobsWhere are most of the biotechnology jobsWhere are most of the biotechnology jobsWhere are most of the biotechnology jobslocated in the United States?located in the United States?located in the United States?located in the United States?located in the United States?
The majority of biotechnology companies, at this time, are
located either in the Northeast or along the West Coast.
However, more and more small firms are cropping up all over
the country. Additionally, most major universities have quite
a few biotechnology related projects going on at all times
in various departments.
97
Investigate A Career:Investigate A Career:Investigate A Career:Investigate A Career:Investigate A Career:From the list that follows, select a career that you think interests you
and investigate it further:
• Make a list of ten questions which will provide you with
information about the career you are investigating.
• Find the answers to these questions via one of two avenues:
1. Identify a person who is employed in that specific job and
conduct an interview (either in person or by telephone) with
that person.
2. Research the specific career in your library using books,
magazines or internet resources to answer all of your interesting
questions.
• Once you have gathered all of the information on a particular
career, present your findings to your classmates in a 5–10 minute
presentation.
Note: It might be fun to dress the part when you give your
presentation.
List of Biotechnology Related Jobs:List of Biotechnology Related Jobs:List of Biotechnology Related Jobs:List of Biotechnology Related Jobs:List of Biotechnology Related Jobs:Here is a list of job titles within the field of biotechnology. Each of the
job titles is followed by a very brief overall description of the job.
lab assistant : performs day-to-day experiments in a laboratory under
the supervision of a research scientist.
bio-process engineer: designs and operates systems that will enable a
biotech company to produce a product on a large scale.
research scientist: directs experiments at a university, research facility
or biotech company. Experiments are usually designed to answer an
unknown question about biochemistry or to develop a new technique
or application of biotechnology.
marketing or public relations specialist: presents a positive image of
the biotechnology research or applications to the public.
CEO (Chief Executive Officer): runs the company; decides which
research is done, what products are developed and future directions
of the company.
InvestigatingCareers inBiotechnology
STU
DENT ACTIVITY
DINI N G O N D
NA
98
plant breeder: designs, develops and conducts plant breeding research
projects.
regulatory affairs specialist: prepares documents which are to be
submitted to regulatory agencies (for example, when the company is
seeking approval of a new, genetically altered product).
market research analyst: investigates and analyzes how well a product
will sell and what the competition is like; makes presentations to
company executives on any changes in the market or technological
changes.
quality control engineer: develops standards through which high
quality materials are processed into the final product.
environmental health and safety specialist: develops, monitors and
conducts industrial safety programs to ensure a safe working
environment for all employees.
biostatistician: analyzes data statistically so that research may be
published in professional journals or presented at professional
meetings.
technical writer: writes and edits laboratory procedures, company
standard operating procedures, informational or instructional
documents.
product development engineer: designs, develops, modifies and
enhances products or processes within the company.
instrument/calibration technician: performs maintainance,
calibration and repair on the analytical instruments and equipment
used in the research and development laboratory.
systems analyst: maintains computer operating system; provides
technical computer support.
sales representative: responsible for the direct sale of a company’s
product.
human resources representative: responsibilities may include hiring
personnel, working with benefits, employee relations or training
programs.
patent administrator: prepares all documentation for patent filings
and applications.
InvestigatingCareers inBiotechnology
STU
DENT ACTIVITY
DINI N G O N D
NA
99
To Label orNot to Label
Summary:Summary:Summary:Summary:Summary:Students will investigate several topics related to food labeling,
specifically as it applies to genetically modified foods. Following their
investigation of the topics as well as their examination of existing food
labels, student teams will decide whether or not they believe
genetically modified foods should be labeled and to what degree.
Objectives:Objectives:Objectives:Objectives:Objectives:• Students will examine the many issues which are continuously
being debated in regard to the labeling of genetically modified
foods.
• Students will identify the regulatory agencies and laws which
govern food labeling in the United States.
• Students will incorporate skills in risk/benefit analysis as they weigh
the various issues pertaining to the labeling of genetically modified
foods in forming an opinion on the issue.
Suggested Time:Suggested Time:Suggested Time:Suggested Time:Suggested Time:One class period
Procedure:Procedure:Procedure:Procedure:Procedure:1. Teacher sets up display of a variety of food labels found on products
in the local supermarket. This display should be varied. Some of the
food labels should represent foods which are produced through
biotechnology techniques (old or new).
Some possible examples are a label from a yogurt indicating the use
of live cultures in the product; a label from a meat product
indicating safe preparation techniques; a label from cheese
produced with chymosin; a label from a loaf of sourdough bread;
and if available, a label from a tomato grown from genetically
altered seeds.
2. Students examine label display, taking note of the various pieces of
information on the food labels and filling in the information
requested on the To Label or Not to Label student activity sheet.
3. Teacher goes over the Food Labeling background information
handout.
4. Students divide into pairs. Within each pair, one student is
designated as the consumer advocate and the other is designated as
a representative of a food processing company which is seeking to
send a genetically modified food product to market.
100
To Label orNot to Label
5. Student pairs complete the Labeling Issues to Address student activity
sheet.
6. With each student in the pair assuming his/her designated role,
the pair debates their final decision as to whether or not the food
label of genetically modified food products should indicate this
genetic modification, and if so, to what degree. For this stage of
the assignment, the student pair should complete the Labeling
Selections student activity aheet.
7. To conclude the activity, the teacher should review the actual
present policy set forth by the FDA concerning the labeling of
genetically modified foods.
Materials:Materials:Materials:Materials:Materials:Food Label display, prepared ahead of time by the teacher
• To Label or Not to Label student activity sheet
• Food Labeling background bnformation handout
• Labeling Issues to Address student activity sheet
• Labeling Selections student activity sheet
Note to Teachers:Note to Teachers:Note to Teachers:Note to Teachers:Note to Teachers:
The FDA policy on genetically modified foods, as of the
publication of this module (1996) follows. You may want to
update this information periodically, as the legislation is
rapidly changing in this period of technological advancement.
FDA requires labeling of any new plant varieties,
regardless of how they were derived if they contain
transferred allergenic proteins.
FDA reopened the labeling issue when flooded with
letters saying that consumers have a right to know how
their food is produced. However, as of the printing of this
material, no major changes in labeling requirements
have resulted from this public comment.
101
To Label orNot to Label
Now that you are experts in the area of Food Biotechnology, you are going to
be asked to complete an important task. In this activity you will be required
to decide on the proper food label that should appear on genetically
modified foods to be sold in the marketplace. Before making your final
decision, you will review some information on food labeling and some
important issues surrounding the labeling of genetically modified foods.
Procedure:Procedure:Procedure:Procedure:Procedure:1. Study the display on food labels which has been put together by
your teacher. Please take note of the following points:
What information appears on all of the food labels?
________________________________________________________________________
________________________________________________________________________
________________________________________________________________________
________________________________________________________________________
Does any of the label information indicate the use of any
biotechnology technique in the production or processing of the
food (old techniques or modern techniques)?
________________________________________________________________________
________________________________________________________________________
________________________________________________________________________
What information appears to be there simply for the purpose of selling
the food product?
________________________________________________________________________
________________________________________________________________________
________________________________________________________________________
2. Review the Food Labeling background information handout with
your teacher’s help.
3. The teacher will divide the class into pairs. With your partner,
decide who will play the role of the consumer advocate and who
will play the role of the representative of a food processing
company which is seeking approval to market a genetically
modified food product.
4. With your partner, complete the Labeling Issues to Address
student activity sheet.
5. Debate with your partner, each in the appropriate role, the final
decision on how the food going to market should be labeled. For
this stage of the assignment, you and your partner should complete
the Labeling Selections student activity sheet.
STU
DENT ACTIVITY
DINI N G O N D
NA
102S
TU
DENT ACTIVITY
DINI N G O N D
NA
To Labelor Not to Label
1. Introduction of Allergens
Biotechnology Example: Transfer of peanut protein into corn
Some improvement in the growing characteristics of corn may result
from copying a protein from the peanut plant into corn. However,
many people have allergic reactions to peanuts. If these individuals
were to eat the genetically modified corn unknowingly, they may
have an allergic reaction to the transferred peanut protein in the corn.
Since your present role requires that you make important decisions
regarding food labels, how would you address the potential problems
of transferring the peanut allergen into corn?
________________________________________________________________________
________________________________________________________________________
________________________________________________________________________
________________________________________________________________________
________________________________________________________________________
________________________________________________________________________
2. The Expense of Labeling: Will It Block the Benefits of the
New Food?
Biotechnology Example: Virus resistant squash
Scientists are developing a squash which is resistant to a virus which
normally wipes out 80% of the squash crop. When this “new” squash is
grown, less acreage will be required to plant a more productive crop.
Therefore, less water, fertilizer and chemical pesticides will be required
to achieve the same yield. These are all environmental advantages.
However, if labeling is mandatory, the growers will incur greater
production costs due to the need to keep the genetically modified
squash separate from the other squash. Separate facilities and bins
require money that these growers cannot afford. Therefore it is likely
that most squash growers will not opt to grow the genetically modified
variety despite its advantages.
From your point of view as a labeling policy maker, would you require
the squash growers to label their produce? Explain your reasoning.
________________________________________________________________________
________________________________________________________________________
________________________________________________________________________
________________________________________________________________________
________________________________________________________________________
103
3. Consumer Perception of Labels as Warnings
When you see a food label, do you view the information on this label
as a warning or simply as a source of information for your general
knowledge? There is concern that consumers have negative feelings
toward mandatory labels and that they do, in fact, interpret such labels
as warnings. Comment on how labeling could negatively impact future
advancement in food biotechnology if it is true that labels are
perceived as warnings.
________________________________________________________________________
________________________________________________________________________
________________________________________________________________________
________________________________________________________________________
________________________________________________________________________
________________________________________________________________________
________________________________________________________________________
________________________________________________________________________
4. Changes in Nutrient Content
What if the genetic alteration to the specific food changes the
nutrient content of this food? We know tomatoes are a major source
of vitamin C. Hypothetically, what if a tomato is created that no
longer has vitamin C? Should the label be required to indicate this
change in nutrient composition? Explain your answer?
________________________________________________________________________
________________________________________________________________________
________________________________________________________________________
________________________________________________________________________
________________________________________________________________________
To Labelor Not to Label
STU
DENT ACTIVITY
DINI N G O N D
NA
104
STU
DENT ACTIVITY
DINI N G O N D
NA
5. Consumers Have a Right to Know How Their Food is Produced
We take it for granted that when we purchase a box of corn flakes that
what is inside the box is, in fact, corn flakes; not puffed rice, not bran
cereal, but corn flakes. We trust the label we read on the food package.
Where does this need for information on the label end? Do we need to
know more than what is basically required by the FDA on all food
labels (name of product, amount, ingredient list, etc.)?
On one side of the argument, people say they have a right to know how
foods were produced so they can make food choices based on a variety
of factors. These factors may be social, economic or environmental
concerns or concerns directly related to the wholesomeness and safety
of the food.
Others say that when you open the door to mandatory labeling of
factors which are “non-scientific” there will be no end to the number
of items proposed for inclusion on a food label. Such social statement
such as “Made by Union Labor” or “Made by Vegetarians” could
eventually be required by law to appear on labels if certain consumer
groups voice such desires loudly enough.
What are your thoughts on this issue? How much information
should be required by law to be on the food label? Should any and
all information on how the food was produced be available to the
consumer on the label? Explain your reasons for your answers.
To Labelor Not to Label
________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________
105
STU
DENT ACTIVITY
DINI N G O N D
NA
To Labelor Not to Label
Food LabelingFood LabelingFood LabelingFood LabelingFood LabelingBackground InformationBackground InformationBackground InformationBackground InformationBackground Information
What governmental agency is in charge of food labeling?
The Food and Drug Administration (FDA) and the Food Safety
Inspection Service (FSIS) of the U.S. Department of Agriculture are the
governmental agencies responsible for assuring that foods sold in the
United States are properly labeled. The FDA regulates the labeling of
most food products, except for meat and poultry products which are
regulated by the FSIS. The responsibilities of these agencies apply to
foods produced in the United States (domestic) and foods imported
from foreign countries.
What laws govern food labeling in the United States?
Three main pieces of legislation are used by the Food and Drug
Administration in the monitoring and enforcement of proper food
labeling. These are:
• Food, Drug and Cosmetic Act (1938): This major piece of legislation
was passed as a result of concern over the safety of food being sold in
the United States. This Act identifies the FDA as the federal agency
responsible for enforcing food labeling legislation. Through this act,
a minimum quality standard was designated for foods.
• Fair Packaging and Labeling Act (1966): This Act is an amendment to
the original Food, Drug and Cosmetic Act. Generally, it says that all
food labels must contain the same basic information (see next
question, “What are some features of the food label which are required
by the FDA?”).
• Nutrition Labeling and Education Act (1990): This Act is also an
amendment to the Food, Drug and Cosmetic Act. Through this
legislation, foods are required to have nutrition labels that contain
information on nutrient content.
What are some features of the food label which are required by the
FDA?
• name of food
• net quantity of contents
• ingredients list (in order by weight)
• nutrition labeling information (sodium content, fat content)
• any danger the packaging may present (for example, “contents
under pressure”)
• name and address of manufacturer, distributor or packager
• statement if any artificial color or flavor
What is prohibited from being on food labels?
Statements which are misleading. For example, if a statement implies
that this particular food is safer than the competitors, yet there is no
scientific proof to back this up, then the statement is prohibited.
106
Food LabelingSelections
Now that you have reviewed the background information on food labeling
as well as explored many of the complicated issues associated with the
labeling of genetically modified foods, it is time for you and your partner to
come to an agreement on the proper food label to appear on foods which
have been genetically modified. Below is a selection of possible labels from
which you may choose. If none of these fit your needs, please feel free to
design your own label. At the bottom of the sheet is space for you to explain
your rationale.
Choice #1: Require a label only if the modified food might present a
health or safety issue to consumers. (For example: allergic reaction).
Choice #2: Require a mandatory label on all foods which have been
genetically modified in some way.
Choice #3: Require a label on all products containing any ingredients
which were modified through biotechnology.
Choice #4: Require no labeling at all for genetically modified foods.
Choice #5: Require a label only if the nutrient composition varies
greatly from the original food.
Choice #6: Your own custom label:
__________________________________________________________________
__________________________________________________________________
_________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
Give a summary of the discussion which took place between you and
your partner in coming to a consensus on which way to label the food.
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
STU
DENT ACTIVITY
DINI N G O N D
NA
107
References Additional Sources of InformationAdditional Sources of InformationAdditional Sources of InformationAdditional Sources of InformationAdditional Sources of Informationfor Your Reading Enjoyment:for Your Reading Enjoyment:for Your Reading Enjoyment:for Your Reading Enjoyment:for Your Reading Enjoyment:Alcamo, I. Edward. DNA Technology: The Awesome Skill,
Times Mirror Higher Education Group, Inc., IA, 1996.
Brown, Sheldon S. Opportunities in Biotechnology Careers ,N T C Publishing Group, IL, 1994.
Campbell, G.R. Biotechnology: An Introduction, American Councilon Science and Health, NJ, 1988
Food Biotechnology , International Food Information Council,Washington DC, 1993.
Kelfler, George H. Biotechnology, Genetic Engineering and Society(Monograph Series: III), National Association of BiologyTeachers, VA. 1987.
Rissler, Jane and Margaret Mellon. Perils Amidst the Promise ,Union of Concerned Scientists, MA. 1993.
Voichick, Jane and Tom Zinnen. Biotechnology and Food,University of Wisconsin Biotech Center, WI 1993.
Online Resources for Biotechnology Information:*Online Resources for Biotechnology Information:*Online Resources for Biotechnology Information:*Online Resources for Biotechnology Information:*Online Resources for Biotechnology Information:**The following addresses were current as of the publication date.
Access Excellencehttp://www.gene.com/ae
A multifaceted resource. A great communications networkfor teachers plus a wealth of online information and ideasfor classroom activities.
Internet Directory of Biotechnology Resourceshttp://biotech.chem.indiana.edu
Biotechnology Information Center (BIC)http://www.nal.usda.gov/bic
An organization within the U.S. Dept. of Agriculture,National Agriculture Library.
The Biology Placehttp://www.biology.com
Designed for biology educators by biology educators.Has an active genetics area.
The Biotech BiblioNethttp://schmidel.com/biotech.htm
A free monthly online bibliography of recently publishedbiotechnology articles, review and commentaries.
Global Agriculture Biotech Associationhttp://www.lights.com/gaba/index.html
Australian Biotechnology Associationhttp://www.aba.asn.au
108
Notes